Pharmaceutical composition for preventing and / or treating osteoarthritis and / or rheumatoid arthritis
GalNAc-T12 is used in a pharmaceutical composition to address the ineffectiveness of current treatments for osteoarthritis and rheumatoid arthritis by promoting chondrocyte health and reducing inflammation, effectively preventing and treating these conditions.
Patent Information
- Application Number
- PCT/JP2025/003340
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-05
- Filing Date
- 2025-02-03
- Publication Date
- 2025-08-14
AI Technical Summary
Current treatments for osteoarthritis and rheumatoid arthritis are ineffective, with no effective drugs available for osteoarthritis and existing rheumatoid arthritis drugs not applicable to osteoarthritis, highlighting the need for a targeted therapeutic approach.
A pharmaceutical composition comprising GalNAc-T12, a glycosyltransferase that initiates O-linked glycosylation, is administered to prevent and treat osteoarthritis and rheumatoid arthritis by maintaining chondrocyte homeostasis, inhibiting hypertrophy, and suppressing inflammatory responses.
GalNAc-T12 effectively prevents and treats osteoarthritis and rheumatoid arthritis by promoting chondrocyte proliferation, reducing apoptosis, increasing expression of cartilage matrix components, and suppressing inflammation and hypertrophy, thereby preserving cartilage integrity.
Smart Images

Figure JP2025003340_14082025_PF_FP_ABST
Abstract
Description
Pharmaceutical composition for preventing and / or treating osteoarthritis and / or rheumatoid arthritis
[0001] The present invention relates to a pharmaceutical composition for preventing and / or treating osteoarthritis and / or rheumatoid arthritis.
[0002] Cartilage tissue consists of chondrocytes, the only cells present, and the cartilage matrix synthesized by chondrocytes, with chondrocytes interspersed throughout the matrix. Proteoglycans, the main component of the cartilage matrix, are composed of glycosaminoglycans (GAGs), such as chondroitin sulfate, bound to a core protein, with a large amount of water bound to them. Proteoglycans form flexible, higher-order structures with collagen fibers, including type II collagen, to maintain water retention and elasticity, which play an important role in the joint lubrication mechanism that maintains smooth musculoskeletal movement.
[0003] Glycosylation of proteoglycans, such as GAGs, not only provides structural functionality but also contributes to various biological processes, such as cell morphology, proliferation, migration, differentiation, signal transduction, and metabolic activity, through interactions with cells and bioactive substances. Glycosylation of proteins can be broadly divided into two types: N-linked and O-linked. N-linked glycans are formed by the addition of N-acetylglucosamine (GlcNAc) to asparagine residues in proteins and have been reported to be involved in signal transduction by cytokines such as IL-6, TNFα, and IL-1β (Non-Patent Document 1). O-linked glycans are formed by the addition of sugars such as GlcNAc or N-acetylgalactosamine (GalNAc) to serine or threonine residues in proteins. O-linked GlcNAc (O-GlcNAc) has been reported to activate signal transduction pathways mediated by JNK, ERK, and p38 (Non-Patent Document 2). O-linked GalNAc (O-GalNAc) is formed by GalNAc transferase (GalNAc-T), of which 20 isozymes have been reported in humans (Non-Patent Documents 3 and 4). It has been reported that in GalNAc-T overexpressing mice, increased O-GalNAc suppresses chondrocyte hypertrophy, reduces GAG, and causes stunted growth (Non-Patent Document 5). However, there have been few analytical reports on O-GalNAc and GalNAc-T, and their detailed functions remain to be elucidated.
[0004] Glycosylation has been shown to be important in cartilage tissue and chondrocytes. Recently, alterations in these glycosylation processes have been reported in osteoarthritis (OA) and rheumatoid arthritis (RA), diseases associated with cartilage destruction. Regarding N-linked glycans, it has been reported that high-mannose N-linked glycans are increased in chondrocytes of human OA and OA model mice (Non-Patent Document 6), and that N-linked glycans are involved in the development of RA in RA model mice (Non-Patent Document 1). Regarding O-linked glycans, it has been reported that O-GlcNAc is increased in OA chondrocytes (Non-Patent Document 7) and promotes chondrocyte hypertrophy (Non-Patent Document 2). Regarding O-GalNAc, it has been reported that GalNAc-T expression is increased in OA chondrocytes (Non-Patent Document 8). GalNAc-T has also been implicated in RA. Previous genome-wide association studies have shown that single nucleotide polymorphisms (SNPs) in GalNAc transferase 12 (GalNAc-T12) are significantly associated with the rapid progression of joint destruction in RA (Non-Patent Document 9). However, the direct involvement of O-GalNAc and GalNAc-T in the pathogenesis of OA and RA has not been investigated.
[0005] Uehara I et al. 2-Deoxy-D-glucose induces deglycosylation of proinflammatory cytokine receptors and strongly reduces immunological responses in mouse models of inflammation. Pharmacol Res Perspect 10:e00940, 2022.Andres-Bergos J et al. The increase in O-linked N-acetylglucosamine protein modification stimulates chondrogenic differentiation both in vitro and in vivo. J Biol Chem 287:33615, 2012.Bennett EP et al. Control of mucin-type O-glycosylation: A classification of the polypeptide GalNAc-transferase gene family. Glycobiology 22:736, 2012.Wandall HH et al. Global functions of O-glycosylation: promises and challenges in O-glycobiology. FEBS J 288:7183, 2021.Yoshida CA et al. Overexpression of Galnt3 in chondrocytes resulted in dwarfism due to the increase of mucin-type O-glycans and reduction of glycosaminoglycans. J Biol Chem 289:26584, 2014.Urita A et al. Alterations of high-mannose type N-glycosylation in human and mouse osteoarthritis cartilage. Arthritis Rhum 63:3428, 2011.Tardio L et al. O-linked N-acetylglucosamine (O-GlcNAc) protein modification is increased in the cartilage of patients with knee osteoarthritis. Osteoarthritis Cartilage 22:259, 2014. Yoshimoto M et al. Bioinformatic analysis reveals potential relationship between chondrocyte senescence and protein glycosylation in osteoarthritis pathogenesis. Front Endocrinol 14:1153689, 2023. Hayashi S et al. A genome-wide predictive association study identifying the SNPs of rapid joint destruction in patients with rheumatoid arthritis. Biomed Rep 14:31, 2021.
[0006] Thus, while the functions of N-linked glycans and O-GlcNAc in chondrocytes and their association with OA and RA are being demonstrated, the functions and involvement of O-GalNAc and GalNAc-T in disease remain unclear.
[0007] Compared to other sugar chain modifications, O-GalNAc has many unknowns. This study focuses on GalNAc-T, which is involved in its formation, and aims to investigate the functions of GalNAc-T12 in maintaining chondrocyte homeostasis, hypertrophy, and inflammatory stimuli in chondrocytes. It also aims to analyze the direct involvement of GalNAc-T12 in the pathogenesis of OA and RA using model mice, with the aim of utilizing the results for drug discovery.
[0008] In cartilage tissue, glycosaminoglycans (GAGs) are responsible for maintaining water retention and elasticity, thereby creating a lubrication mechanism in joints. Thus, the importance of glycans such as GAGs in cartilage tissue and chondrocytes has been suggested. Previously, the inventors reported, through genome-wide association studies, that single nucleotide polymorphisms (SNPs) in GalNAc transferase 12 (GalNAc-T12), a glycosyltransferase that forms O-linked N-acetylgalactosamine (O-GalNAc), a type of glycosylation, are significantly associated with the rapid progression of joint destruction in rheumatoid arthritis (RA) (Non-Patent Document 9). Therefore, we analyzed the function of GalNAc-T12 in chondrocytes. GalNAc-T12 was involved in maintaining chondrocyte homeostasis and suppressed hypertrophy and cytokine-induced inflammation. Furthermore, in mouse models, GalNAc-T12 suppressed cartilage destruction in osteoarthritis (OA) and RA. These results indicate that GalNAc-T12 inhibits cartilage destruction in OA and RA by contributing to the properties of chondrocytes. The present invention was completed based on these findings.
[0009] The gist of the present invention is as follows: (1) A pharmaceutical composition for preventing and / or treating osteoarthritis and / or rheumatoid arthritis, comprising GalNAc-T12. (2) A method for preventing and / or treating osteoarthritis and / or rheumatoid arthritis, comprising administering a pharmaceutically effective amount of GalNAc-T12 to a subject. (3) Use of GalNAc-T12 for preventing and / or treating osteoarthritis and / or rheumatoid arthritis. (4) Use of GalNAc-T12 in the manufacture of a medicament for preventing and / or treating osteoarthritis and / or rheumatoid arthritis.
[0010] Although many drugs for treating rheumatoid arthritis have been developed, these drugs are not effective or applicable to the treatment of osteoarthritis. For osteoarthritis, the only treatments available are intra-articular injection of hyaluronic acid, and oral supplements consisting of glucosamine, collagen, and a mixture thereof, but no effective treatment has been found. Therefore, the provision of an effective treatment for osteoarthritis by the present invention will be a great benefit to humanity.
[0011] The present invention enables the prevention and treatment of osteoarthritis and rheumatoid arthritis. This specification incorporates the contents as disclosed in the specification and / or drawings of Japanese Patent Application No. 2024-015445, which is a priority document of the present application.
[0012] Graph showing the results of a WST assay, where the number of viable cells at the start of culture is set to 1. Graph showing the results of a WST assay, where the number of viable cells when neither GalNAc-T12 nor actinomycin D was added is set to 1. Results of detecting caspase 3, PARP, and cleaved PARP by Western blot. Graph showing the gene expression of each molecule, where the expression level when GalNAc-T12, GalNAc, and GlcNAc were not added (medium only) was set to 1. Graph showing the gene expression of each molecule, where the expression level when no hypertrophy was induced was set to 1. Graph showing the gene expression of each molecule after stimulation with IL-6 + sIL-6R, where the expression level when GalNAc-T12, IL-6, and sIL-6R were not added (medium only) was set to 1. Graph showing the gene expression of each molecule after stimulation with TNFα, where the expression level when neither GalNAc-T12 nor TNFα was added (medium only) was set to 1. Graph showing gene expression of each molecule upon stimulation with IL-1β, with the expression level set to 1 when neither GalNAc-T12 nor IL-1β was added (medium only). Graph showing gene expression of each molecule, with the expression level set to 1 when GalNAc-T12 was not added. Safranin O-stained histological images of the right hind knee joints of mice that underwent DMM surgery and administration of PBS or GalNAc-T12. Graph of OARSI scores for the histological images in Figure 10. Graph showing the results of limb swelling scoring for CAIA model mice that were administered PBS or GalNAc-T12. Safranin O-stained histological images of the right hind knee joints of CAIA model mice that were administered PBS or GalNAc-T12. Graph of OARSI scores for the histological images in Figure 13. Graph showing p21 expression, with the expression level set to 1 when hypertrophy was not induced. Results of Western blotting detection of O-GalNAc.
[0013] The present invention will be described in detail below.
[0014] The present invention provides a pharmaceutical composition for preventing and / or treating osteoarthritis and / or rheumatoid arthritis, comprising GalNAc-T12.
[0015] The present invention also provides a method for preventing and / or treating osteoarthritis and / or rheumatoid arthritis, which comprises administering a pharmaceutically effective amount of GalNAc-T12 to a subject.
[0016] Furthermore, the present invention provides the use of GalNAc-T12 for the prevention and / or treatment of osteoarthritis and / or rheumatoid arthritis.
[0017] Furthermore, there is provided use of GalNAc-T12 in the manufacture of a medicament for the prevention and / or treatment of osteoarthritis and / or rheumatoid arthritis.
[0018] GalNAc-transferase 12 (GalNAc-T12) is a glycosyltransferase that initiates O-linked glycosylation, adding GalNAc to serine or threonine residues of proteins. GalNAc-T12 is widely expressed in the body, with particularly high expression in the large intestine, small intestine, stomach, and pancreas, moderate expression in the thyroid, spleen, and testis, and low expression in the brain, bone marrow, thymus, heart, lung, liver, kidney, esophagus, etc. NCBI Gene ID: 79695 (information on the GalNAc-T12 gene) NCBI Reference Sequence No.: NG_028218.1 (nucleotide sequence of the full-length GalNAc-T12 gene) GenBank Accession No.: AB078146.1 (nucleotide sequence of GalNAc-T12 cDNA) The amino acid sequence and nucleotide sequence of the recombinant human GalNAc-T12 used in the Examples described below are shown in SEQ ID NOs: 1 and 2, respectively, in the Sequence Listing. In the present invention, GalNAc-T12 preferably consists of the amino acid sequence of SEQ ID NO: 1, but it may also be a protein consisting of an amino acid sequence that shares 90% or more but less than 100% identity with the amino acid sequence of SEQ ID NO: 1. The identity of two amino acid sequences can be determined using BLAST. Furthermore, in the present invention, GalNAc-T12 may have 1, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, or 10 or less amino acid residues deleted, substituted, or added to the amino acid sequence of SEQ ID NO: 1. These mutant polypeptides can be effective in preventing and / or treating osteoarthritis and / or rheumatoid arthritis.
[0019] GalNAc-T12 can be obtained, for example, by producing it in host cells using genetic recombination techniques, followed by separation and purification, or it can also be produced by chemical synthesis.
[0020] To produce GalNAc-T12 in host cells using genetic recombination techniques, DNA encoding GalNAc-T12 is inserted into a vector and introduced into host cells to produce recombinant GalNAc-T12 in the host cells. Plasmids are often used as vectors, and host cells include Escherichia coli, yeast, animal cells, and human cells. Methods for preparing GalNAc-T12 are described in, for example, Guo JM et al. "Molecular cloning and characterization of a novel member of the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase family, pp-GalNAc-T12," FEBS Lett 524:211, 2002. GalNAc-T12 produced by host cells can be recovered from the culture medium using known protein purification methods.
[0021] Furthermore, GalNAc-T12 is commercially available, and commercially available products may also be used.
[0022] To introduce a mutation into GalNAc-T12, which consists of the amino acid sequence of SEQ ID NO: 1, site-specific mutagenesis can be performed using the CRISPR / Cas9 system or specific primers (containing the desired mutation). GalNAc-T12 mutants have been reported in, for example, Guda K et al., "Inactivating germ-line and somatic mutations in polypeptide N-acetylgalactosaminyltransferase 12 in human colon cancers," Proc Natl Acad Sci USA 106:12921, 2009. These mutants may also be used in the present invention.
[0023] GalNAc-T12 can be used to prevent and / or treat osteoarthritis and / or rheumatoid arthritis.
[0024] In the present invention, "treatment" means recovery from, remission of, alleviation of and / or delay in the worsening of clinical symptoms of a disease in a patient who has developed the disease.
[0025] In the present invention, "prevention" means reducing the incidence of a disease. Prevention includes reducing the risk of disease progression or reducing the severity of the disease, and also includes preventing recurrence.
[0026] GalNAc-T12 (hereinafter referred to as the "active ingredient") can be administered orally or parenterally to mammals (e.g., humans, rabbits, dogs, cats, rats, and mice) either alone or together with pharmacologically acceptable carriers, diluents, or excipients to form pharmaceutical compositions in an appropriate dosage form. The dosage varies depending on the subject, target disease, symptoms, and route of administration. For example, when used to prevent or treat osteoarthritis, a single dose of the active ingredient is typically about 0.01 to 10 mg / kg body weight, preferably about 1 to 2 mg / kg body weight, administered orally, intramuscularly, subcutaneously, or intravenously (preferably continuously or every other day) about once a month to three times a day, preferably about once a week to once a day. When used for the prevention and treatment of rheumatoid arthritis, a single dose of the active ingredient is usually about 0.01 to 10 mg / kg body weight, preferably about 1 to 2 mg / kg body weight, administered orally, intramuscularly, subcutaneously, intravenously, or intra-articularly (preferably administered continuously or every other day) at a frequency of about once a month to three times a day, preferably about once a week to once a day.
[0027] Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups, emulsions, suspensions, etc. Such compositions can be prepared by conventional methods and may contain carriers, diluents, or excipients commonly used in the pharmaceutical field. For example, carriers and excipients for tablets include lactose, starch, sucrose, magnesium stearate, etc.
[0028] Compositions for parenteral administration include, for example, injections and suppositories, and injections may be in the form of intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip infusions, intra-articular injections, etc. Such injections are prepared by conventional methods, i.e., by dissolving, suspending, or emulsifying the active ingredient in a sterile aqueous or oily liquid typically used for injections. Aqueous liquids for injection include physiological saline, isotonic liquids containing glucose and other adjuvants, and may be used in combination with an appropriate solubilizing agent, such as alcohol (e.g., ethanol), polyalcohols (e.g., propylene glycol, polyethylene glycol), or nonionic surfactants (e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)). Oily liquids include sesame oil and soybean oil, and may be used in combination with a solubilizing agent such as benzyl benzoate or benzyl alcohol. The prepared injection solution is usually filled into a suitable ampule. Suppositories for rectal administration can be prepared by mixing the active ingredient with a conventional suppository base.
[0029] The oral or parenteral pharmaceutical composition may be prepared in a dosage unit form suitable for the dosage of the active ingredient, such as tablets, pills, capsules, injections (ampoules), suppositories, etc., each of which preferably contains 0.5 to 500 mg of the active ingredient.
[0030] The present invention will be described in more detail below with reference to examples.
[0031] Example 1: Effect of GalNAc-T12 on Chondrocyte Proliferation and Survival (Method) Normal human knee articular chondrocytes (NHAC-Kn; Lonza) were cultured with 0-800 ng / ml GalNAc-T12 (R&D Systems). After 72 hours, a WST assay was performed using a Cell Counting Kit-8 (Dojindo Laboratories) to assess viable cell numbers. Cultures were also performed in two media: Dulbecco's modified Eagle's medium (DMEM; Nissui Pharmaceutical) containing 10% fetal bovine serum (Biowest) and serum-free DMEM. (Results) Figure 1 shows the WST assay results, where the number of viable cells at the start of culture is set to 1 (n = 3). When cultured in a medium containing 10% serum, chondrocyte numbers increased approximately 1.5-fold compared to the start of culture. Addition of GalNAc-T12 further increased the number of chondrocytes. In particular, GalNAc-T12 at concentrations of 200 ng / ml or higher significantly increased the number of chondrocytes. On the other hand, when cultured in serum-free medium, the number of chondrocytes decreased to approximately 60% compared to the initial number at the start of culture, but the addition of 200 ng / ml GalNAc-T12 significantly prevented this decrease. These results indicate that GalNAc-T12 is involved in the proliferation and survival of chondrocytes.
[0032] Example 2: Effect of GalNAc-T12 on Chondrocyte Apoptosis (Method) NHAC-Kn was cultured with 200 ng / ml GalNAc-T12. 5 μg / ml actinomycin D (Sigma-Aldrich) was added simultaneously to induce apoptosis. After 72 hours, a WST assay was performed using the Cell Counting Kit-8 to assess viable cell numbers. Western blotting was also performed to assess the expression of caspase 3, PARP, and cleaved PARP. (Results) Figure 2 shows the WST assay results, with the viable cell number in the absence of either GalNAc-T12 or actinomycin D set at 1 (n = 3). Addition of GalNAc-T12 significantly increased chondrocyte numbers. On the other hand, addition of actinomycin D led to apoptosis and a decrease in chondrocyte numbers. However, addition of GalNAc-T12 significantly inhibited the actinomycin D-induced decrease in chondrocyte numbers. Figure 3 shows the results of Western blot analysis of caspase 3, PARP, and cleaved PARP. Induction of apoptosis by actinomycin D resulted in a decrease in the expression of caspase 3 and PARP, and an increase in the expression of cleaved PARP. However, these changes were suppressed by the addition of GalNAc-T12. These results indicate that GalNAc-T12 suppresses apoptosis in chondrocytes.
[0033] Example 3: Effect of GalNAc-T12 on Gene Expression in Chondrocytes (Method) NHAC-Kn cells were cultured with 200 ng / ml GalNAc-T12, 200 μM N-acetylgalactosamine (GalNAc; Sigma-Aldrich), or 200 μM N-acetylglucosamine (GlcNAc; Sigma-Aldrich). After 72 hours, cells were harvested, and RNA was extracted using an RNeasy Mini Kit (Qiagen). cDNA was synthesized by reverse transcription using 1 μg of RNA with a GeneAmp RNA PCR kit (Applied Biosystems). Real-time PCR was performed using TB Green Premix Ex Taq II (Takara Bio) to examine changes in gene expression. Expression levels of each molecule were normalized by the Ct value of GAPDH and compared using the ΔΔCt method with the control group (medium alone) lacking GalNAc-T12, GalNAc, and GlcNAc. (Results) Figure 4 shows a graph of gene expression for each molecule, with the expression level in the absence of GalNAc-T12, GalNAc, or GlcNAc (medium only) set to 1 (n = 3). The addition of GalNAc-T12 significantly increased the expression of aggrecan and type II collagen. In contrast, the addition of GalNAc or GlcNAc did not result in any changes in any of the molecules. These results demonstrate that GalNAc-T12 increases the expression of cartilage matrix components.
[0034] Example 4: Effect of GalNAc-T12 on Chondrocyte Hypertrophy (Method) NHAC-Kn cells were cultured with 1x ITS supplement (R&D Systems) and 50 μg / ml ascorbic acid (Wako Pure Chemical Industries, Ltd.) to induce chondrocyte hypertrophy. During the culture, 200 ng / ml GalNAc-T12, 200 μM GalNAc, or 200 μM GlcNAc was simultaneously added. The medium was changed every 72 hours, and on day 15, cells were harvested and RNA was extracted using the RNeasy Mini Kit. cDNA was synthesized by reverse transcription using 1 μg of RNA using the GeneAmp RNA PCR kit. Real-time PCR was performed using TB Green Premix Ex Taq II to examine changes in gene expression of hypertrophy-related molecules. Expression levels of each molecule were normalized by the Ct value of GAPDH and compared using the ΔΔCt method with the control without hypertrophy induction. (Results) Figure 5 shows the gene expression of each molecule, with the expression level without hypertrophy induction set to 1 (n = 3). Expression of type X collagen, MMP13, ADAMTS5, EPAS1 (HIF-2α), and RUNX2 increased with hypertrophy induction. However, the addition of GalNAc-T12 significantly inhibited these increases. Expression of aggrecan, type II collagen, and SOX9 also decreased with hypertrophy induction, but the addition of GalNAc-T12 significantly inhibited these decreases. In contrast, the addition of GalNAc and GlcNAc did not alter any of the molecules. These results demonstrate that GalNAc-T12 inhibits chondrocyte hypertrophy.
[0035] Example 5: Effect of GalNAc-T12 on Inflammatory Stimulation of Chondrocytes (Method) NHAC-Kn cells were cultured with 200 ng / ml GalNAc-T12 for 72 hours and then stimulated with 100 ng / ml IL-6 (Peprotech) + 100 ng / ml soluble IL-6 receptor (sIL-6R; Peprotech), 10 ng / ml TNFα, or 10 ng / ml IL-1β. After 24 hours, cells were harvested, and RNA was extracted using the RNeasy Mini Kit. cDNA was synthesized by reverse transcription using 1 μg of RNA using the GeneAmp RNA PCR kit. Real-time PCR was performed using TB Green Premix Ex Taq II to examine changes in gene expression. Expression levels of each molecule were normalized by the Ct value of GAPDH and compared using the ΔΔCt method relative to the control group (medium alone) without GalNAc-T12 or cytokines. (Results) Figure 6 shows the gene expression of each molecule stimulated with IL-6 + sIL-6R, with the expression level in the absence of GalNAc-T12, IL-6, or sIL-6R (medium alone) set to 1 (n = 3). Expression of MMP3, RUNX2, and NOS2 (iNOS) was significantly increased by IL-6 stimulation. However, this increase was significantly suppressed by incubation with GalNAc-T12 before IL-6 stimulation. Expression of aggrecan, type II collagen, and SOX9 was significantly reduced by IL-6 stimulation, but this decrease was significantly suppressed by incubation with GalNAc-T12 before IL-6 stimulation. Gene expression of each molecule stimulated with TNFα is shown in Figure 7 (n = 3), with the expression level in the absence of GalNAc-T12 or TNFα (medium alone) set to 1 (n = 3). Expression of type X collagen, MMP3, MMP13, RUNX2, NOS2 (iNOS), PTGS2 (COX-2), and NFKB1 was significantly increased by TNFα stimulation, but this increase was significantly suppressed by incubation with GalNAc-T12 prior to TNFα stimulation.Furthermore, the expression of aggrecan, type II collagen, and SOX9 was significantly decreased by TNFα stimulation, but this decrease was significantly suppressed by incubation with GalNAc-T12 before TNFα stimulation. Figure 8 shows the gene expression of each molecule upon stimulation with IL-1β, with the expression level in the absence of GalNAc-T12 or IL-1β (medium alone) set to 1 (n = 3). The expression of MMP3, MMP13, ADAMTS5, SPP1 (OPN), type X collagen, and RUNX2 was significantly increased by IL-1β stimulation. However, this increase was significantly suppressed by incubation with GalNAc-T12 before IL-1β stimulation. The expression of aggrecan, type II collagen, and SOX9 was significantly decreased by IL-1β stimulation, but this decrease was significantly suppressed by incubation with GalNAc-T12 before IL-1β stimulation.
[0036] Example 6: Effect of GalNAc-T12 on Chondrocytes from Osteoarthritis (OA) Patients (Method) Chondrocytes from OA patients were cultured with 200 ng / ml GalNAc-T12. After 72 hours, cells were harvested, and RNA was extracted using the RNeasy Mini Kit. 1 μg of RNA was reverse-transcribed using the GeneAmp RNA PCR kit to synthesize cDNA. Real-time PCR was performed using TB Green Premix Ex Taq II to examine changes in gene expression. The expression levels of each molecule were normalized by the Ct value of GAPDH and compared using the ΔΔCt method with the expression level without GalNAc-T12 as the reference. (Results) Figure 9 shows a graph of gene expression for each molecule, where the expression level without GalNAc-T12 is set to 1 (n = 3). The expression of MMP3, MMP13, SPP1 (OPN), NOS2 (iNOS), TNF (TNFα), IL1B, VEGFA, PTGS2 (COX-2), and NFKB1 was decreased by GalNAc-T12. On the other hand, the expression of aggrecan, type II collagen, and SOX9 was increased by GalNAc-T12. However, no statistically significant differences were observed for all molecules. However, GalNAc-T12 decreased the expression of molecules whose expression is increased under inflammatory conditions (MMP3, MMP13, SPP1 (OPN), NOS2 (iNOS), TNF (TNFα), IL1B, VEGFA, PTGS2 (COX-2), and NFKB1), while GalNAc-T12 increased the expression of molecules whose expression is decreased under inflammatory conditions (aggrecan, type II collagen, and SOX9). The results of Examples 5 and 6 demonstrated that GalNAc-T12 suppresses inflammation.
[0037] Example 7: Effect of GalNAc-T12 on Chondrocytes in OA Model Mice (Method) A medial meniscus destabilization (DMM) model was used as an OA model. Ten-week-old male C57BL / 6 mice underwent DMM surgery on the right hind knee joint, and 5 μg of GalNAc-T12 or PBS (Nissui Pharmaceutical) was administered to the same joint. Eight weeks later, safranin O staining was performed, and cartilage tissue pathology was evaluated using the OARSI score. (Results) Figure 10 shows histological images of the right hind knee joints of mice that underwent DMM surgery and PBS or GalNAc-T12 administration, stained with safranin O (n = 2). Figure 11 also shows a graph of the OARSI score (PBS group, n = 5; GalNAc-T12 group, n = 4). The OARSI score was significantly lower in the GalNAc-T12 group compared to the PBS control group. This indicates that GalNAc-T12 suppresses the destruction of cartilage tissue in OA.
[0038] Example 8: Effect of GalNAc-T12 on Chondrocytes in a Rheumatoid Arthritis (RA) Mouse Model (Method) A study was conducted using an anti-type II collagen antibody-induced arthritis (CAIA) model as an RA model. Seven-week-old male DBA1 / J mice were intraperitoneally administered 1.5 mg of an anti-type II collagen antibody cocktail (Chondrex). Three days later, 50 μg of LPS was intraperitoneally administered to enhance the induction of arthritis, and simultaneously 5 μg of GalNAc-T12 or PBS (Nissui Pharmaceutical) was administered to the right hind knee joint. Limb swelling was scored daily, and 14 days later, safranin O staining was performed, and cartilage tissue pathology was evaluated using the OARSI score. (Results) A graph of limb swelling scoring results is shown in Figure 12 (0-4 points / limb, maximum 16 points / limb; PBS-treated group n = 6, GalNAc-T12-treated group n = 5). No difference in limb swelling was observed between the PBS-treated control group and the GalNAc-T12-treated group. Furthermore, when only the right hind limb, which had been treated with GalNAc-T12, was examined, no difference was observed between the two groups. Figure 13 shows histological images of the right hind knee joints of CAIA model mice treated with PBS or GalNAc-T12, stained with Safranin O (n = 2). Figure 14 shows the OARSI score graph (PBS-treated group, n = 6; GalNAc-T12-treated group, n = 5). The OARSI score for the cartilage pathology evaluation was lower in the GalNAc-T12-treated group compared with the PBS-treated control group. However, no statistically significant difference was observed. These results suggest that GalNAc-T12 tends to inhibit cartilage destruction in RA.
[0039] Example 9: Effect of GalNAc-T12 on p21 Expression During Chondrocyte Hypertrophy (Method) NHAC-Kn was cultured with 1x ITS supplement and 50 μg / ml ascorbic acid to induce chondrocyte hypertrophy. During the culture, 200 ng / ml GalNAc-T12 was simultaneously added. The medium was changed every 72 hours, and on day 15, cells were harvested and RNA was extracted using the RNeasy Mini Kit. One gram of RNA was reverse-transcribed using the GeneAmp RNA PCR kit to synthesize cDNA. Real-time PCR was performed using TB Green Premix Ex Taq II to examine p21 expression. The p21 expression level was normalized by the Ct value of GAPDH and compared using the ΔΔCt method with the control without hypertrophy induction. (Results) Figure 15 shows a graph of p21 expression, where the expression level without hypertrophy induction is set to 1 (n = 4). Expression of p21 increased with the induction of hypertrophy. However, this increase was significantly suppressed by the addition of GalNAc-T12. Previous reports have shown that suppression of p21 expression inhibits chondrocyte hypertrophy (Kikuchi K et al. P21 deficiency exhibits delayed endochondral ossification during fracture healing. Bone 165:116572, 2022.). Therefore, this report and the present results indicate that GalNAc-T12 inhibits chondrocyte hypertrophy by suppressing p21 expression.
[0040] Example 10: Effect of GalNAc-T12 on O-linked Glycans in Chondrocytes (Method) To analyze the effects of GalNAc-T12 on O-linked glycans, we focused on the IL-6 receptor gp130 and examined the changes in O-linked glycans on gp130 (Non-Patent Document 1). NHAC-Kn cells were cultured with 200 ng / ml GalNAc-T12 for 5, 10, 30, 60, and 360 minutes. Cells were harvested, proteins were extracted, and gp130 was immunoprecipitated. O-GalNAc was then detected by Western blotting. (Results) The results of Western blotting for O-GalNAc detection are shown in Figure 16. Addition of GalNAc-T12 increased O-GalNAc on gp130. These results indicate that GalNAc-T12 increases O-linked glycans in chondrocytes. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.
[0041] The present invention makes it possible to prevent and / or treat osteoarthritis and / or rheumatoid arthritis.
[0042] <SEQ ID NO: 1> Shows the amino acid sequence of recombinant human GalNAc-T12. UniProt accession No; Q8IXK2 1 MWGRTARRRC PRELRRGREA LLVLLALLAL AGLGSVLRAQ RGAGAGAAEP GPPRTPRPGR 61 REPVMPRPPV PANALGARGE AVRLQLQGEE LRLQEESVRL HQINIYLSDR ISLHRRLPER 121 WNPLCKEKKY DYDNLPRTSV IIAFYNEAWS TLLRTVYSVL ETSPDILLEE VILVDDYSDR 181 EHLKERLANE LSGLPKVRLI RANKREGLVR ARLLGASAAR GDVLTFLDCH CECHEGWLEP 241 LLQRIHEEES AVVCPVIDVI DWNTFEYLGN SGEPQIGGFD WRLVFTWHTV PEERERIRMQS 301 PVDVIRSPTM AGGLFAVSKK YFEYLGSYDT GMEVWGGENLEFSFRIWQCG GVLETHPCSH 361 VGHVFPKQAP YSRNKALANS VRAAEVWMDE FKELYYHRNP RARLEPFGDV TERKQLRDKL 421 QCKDFKWFLE TVYPELHVPE DRPGFFGMLQ NKGLTDYCFD YNPPDENQIV GHQVILYLCH 481 GMGQNQFFEY TSQKEIRYNT HQPEGCIAVE AGMDTLIMHL CEETAPENQK FILQEDGSLF 541 HEQSKKCVQA ARKESSDSFV PLLRDCTNSD HQKWFFKERM L <SEQ ID NO: 2> This shows the base sequence of recombinant human GalNAc-T12. GenBank accession No; AB078146.1 1 atgtgggggc gcacggcgcg gcggcgctgc ccgcgggaac tgcggcgcgg ccgggaggcg 61 ctgttggtgc tcctggcgct actggcgttg gccgggctgg gctcggtgct gcgggcgcag 121 cgtggggccggggccggggc tgccgagccg ggacccccgc gcaccccgcg ccccgggcgg 181 cgcgagccgg tcatgccgcg gccgccggtg ccggcgaacg cgctgggcgc gcggggcgag 241 gcggtgcggc tgcagctgca gggcgaggag ctgcggctgc aggaggagag cgtgcggctg 301 caccagatta acatctacct cagcgaccgc atctcactgc accgccgcct gcccgtgcgc 361 tggaacccgc tgtgcaaaga gaagaaatat gattatgata atttgcccag gacatctgtt 421 atcatagcat tttataatga agcctggtca actctccttc ggacagttta cagtgtcctt 481 gagacatccc cggatatcct gctagaagaa gtgatccttg tagatgacta cagtgataga 541 gagcacctga aggagcgctt ggccaatgag ctttcgggac tgcccaaggt gcgcctgatc 601 cgcgccaaca agagagaggg cctggtgcga gcccggctgc tgggggcgtc tgcggcgagg 661 ggcgatgttc tgaccttcct ggactgtcac tgtgagtgcc acgaagggtg gctggagccg 721 ctgctgcaga ggatccatga agaggagtcg gcagtggtgt gcccggtgat tgatgtgatc 781 gactggaaca ccttcgaata cctggggaac tccggggagc cccagatcgg cggtttcgac 841 tggaggctgg tgttcacgtg gcacacagtt cctgagaggg agaggatacg gatgcaatcc 901cccgtcgatg tcatcaggtc tccaacaatg gctggtgggc tgtttgctgt gagtaagaaa 961 tattttgaat atctggggtc ttatgataca ggaatggaag tttggggagg agaaaacctc 1021 gaatttcct ttaggatctg gcagtgtggt ggggttctgg aaacacaccc atgttcccat 1081 gttggccatg ttttccccaa gcaagctccc tactcccgca acaaggctct ggccaacagt 1141 gttcgtgcag ctgaagtatg gatggatgaa tttaaagagc tctactacca tcgcaacccc 1201 cgtgcccgct tggaaccttt tggggatgtg acagagagga agcagctccg ggacaagctc 1261 cagtgtaaag acttcaagtg gttcttggag actgtgtatc cagaactgca tgtgcctgag 1321 gacaggcctg gcttcttcgg gatgctccag aacaaaggac taacagacta ctgctttgac 1381 tataaccctc ccgatgaaaa ccagattgtg ggacaccagg tcattctgta cctctgtcat 1441 gggatgggcc agaatcagtt tttcgagtac acgtcccaga aagaaatacg ctataacacc 1501 caccagcctg agggctgcat tgctgtggaa gcaggaatgg atacccttat catgcatctc 1561 tgcgaagaaa ctgccccaga gaatcagaag ttcatcttgc aggaggatgg atctttattt 1621 cacgaacagt ccaagaaatg tgtccaggct gcgaggaagg agtcgagtga cagtttcgttccactcttac gagactgcac caactcggat catcagaaat ggttcttcaa agagcgcatg 1741 ttatga
Claims
1. A pharmaceutical composition for the prevention and / or treatment of osteoarthritis and / or rheumatoid arthritis, comprising GalNAc-T12.
2. A method for preventing and / or treating osteoarthritis and / or rheumatoid arthritis, comprising administering a pharmaceutically effective amount of GalNAc-T12 to a subject.
3. Use of GalNAc-T12 for the prevention and / or treatment of osteoarthritis and / or rheumatoid arthritis.
4. Use of GalNAc-T12 in the manufacture of a medicament for the prevention and / or treatment of osteoarthritis and / or rheumatoid arthritis.
Citation Information
Patent Citations
Game machine
JP2024015445A
Treatment of early osteoarthritis
JP2012512177A
Osteoarthritis preventive and therapeutic
JP2021084867A
Pharmaceutical agent and method for treatment or prevention of articular cartilage deformation
WO2008078588A1