Promoters and uses thereof

Abstract

Provided herein are polynucleotides and uses thereof for expressing a product of interest in a cell. Further provided herein are promoters which are capable of targeting expression of a product of interest in a mammal to cardiac tissue and / or muscle tissue with a surprisingly high degree of specificity. Also provided herein are expression cassettes and vectors comprising the polynucleotides, as well as methods of producing a product of interest in a cell and methods of targeting expression of a product of interest.

Description

[0001] PROMOTERS AND USES THEREOF

[0002] RELATED APPLICATIONS

[0003] This application claims the benefit under 35 U.S.C. § 119 of U.S. provisional application serial number 63 / 550,758, filed February 7, 2024, the entire contents of which are incorporated by reference herein.

[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0005] The contents of the electronic sequence listing (A121070013WO00-SEQ-CRP.xml; Size: 40,873 bytes; and Date of Creation: February 5, 2025) are herein incorporated by reference in their entirety.

[0006] FIELD

[0007] Provided herein are polynucleotides and uses thereof for expressing a product of interest in a cell.

[0008] BACKGROUND

[0009] A tissue- specific promoter is a promoter that has activity in only certain cell types. Use of a tissue- specific promoter in an expression cassette can restrict unwanted gene expression, as well as facilitate persistent gene expression. In the context of gene therapies, choosing the correct promoter, especially a tissue-specific promoter, is a major step towards achieving a successful therapeutic. For gene therapies targeting muscle and cardiac diseases, promoters based on the MCK gene (e.g., the MHCK7 promoter) are widely used for cellspecific expression (see e.g., Skopenkova et al., Acta Naturae. 2021 Jan-Mar; 13(1): 47-58).

[0010] SUMMARY

[0011] Provided herein are promoters which are capable of targeting expression of a product of interest in a mammal to cardiac tissue and / or muscle tissue with a surprisingly high degree of specificity. Also provided herein are expression cassettes and vectors comprising the polynucleotides, as well as methods of producing a product of interest in a cell and methods of targeting expression of a product of interest.

[0012] In some aspects, the disclosure relates to a polynucleotide comprising a first segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 6 and a second segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 1, wherein the first segment and the second segment are separated by fewer than 1000 nucleotides, fewer than 900 nucleotides, fewer than 800 nucleotides, fewer than 700 nucleotides, fewer than 600 nucleotides, fewer than 500 nucleotides, fewer than 400 nucleotides, fewer than 300 nucleotides, fewer than 200 nucleotides, fewer than 100 nucleotides, fewer than 50 nucleotides, fewer than 40 nucleotides, fewer than 30 nucleotides, fewer than 20 nucleotides, or fewer than 10 nucleotides.

[0013] In some embodiments, the first segment is 5’ to the second segment.

[0014] In some embodiments, the first segment comprises: the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 14; the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 16; or a combination thereof. In some embodiments, the first segment comprises: the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 15; the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 17; or a combination thereof.

[0015] In some embodiments, the second segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 18; the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 22; the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 24; the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 37; or any combination thereof. In some embodiments, the second segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 23; the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 26; the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 28; or any combination thereof. In some embodiments, the second segment comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than

[0016] 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 20. In some embodiments, the second segment comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 21.

[0017] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 2.

[0018] In some aspects, the disclosure relates to a polynucleotide comprising a first segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO:

[0019] 6, a second segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 7, and a third segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 1.

[0020] In some embodiments, the first segment is 5’ to the second segment and the second segment is 5’ to the third segment.

[0021] In some embodiments, the first segment comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the first segment comprises: the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 14; the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 16; or a combination thereof. In some embodiments, the first segment comprises: the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 15; the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 17; or a combination thereof.

[0022] In some embodiments, the second segment comprises: the nucleotide sequence of CCTTCCCTGGCCGGCTGCCATGGCC (SEQ ID NO: 29) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 29; the nucleotide sequence of GAAAAACCTGTTC (SEQ ID NO: 30) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 30; or a combination thereof.

[0023] In some embodiments, the third segment comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 9.

[0024] In some embodiments, the third segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) differences with SEQ ID NO: 18; the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 22; the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 24; the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 37; or any combination thereof. In some embodiments, the third segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 23; the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 26; the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 28; or any combination thereof. In some embodiments, the third segment comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 20. In some embodiments, the third segment comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 21.

[0025] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 3.

[0026] In some aspects, the disclosure relates to a polynucleotide comprising a first segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 10 and a second segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 11, wherein the first nucleotide sequence and the second nucleotide sequence are separated by fewer than 1000 nucleotides, fewer than 900 nucleotides, fewer than 800 nucleotides, fewer than 700 nucleotides, fewer than 600 nucleotides, fewer than 500 nucleotides, fewer than 400 nucleotides, fewer than 300 nucleotides, fewer than 200 nucleotides, fewer than 100 nucleotides, fewer than 50 nucleotides, fewer than 40 nucleotides, fewer than 30 nucleotides, fewer than 20 nucleotides, or fewer than 10 nucleotides.

[0027] In some embodiments, the first segment is 5’ to the second segment.

[0028] In some embodiments, the first segment comprises: the nucleotide sequence of TTTATATAGCT (SEQ ID NO: 31) or a nucleotide sequence having no more than 2 or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 31; the nucleotide sequence of GCGGGACCAGGTTCG (SEQ ID NO: 32) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 32; or a combination thereof.

[0029] In some embodiments, the first segment comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 12.

[0030] In some embodiments, the second segment comprises: the nucleotide sequence of GTCATGGGGTTATTTTTAAAC (SEQ ID NO: 33) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 33; the nucleotide sequence of CTGGGCGGAGTGTGGAATT (SEQ ID NO: 34) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 34; or a combination thereof.

[0031] In some embodiments, the second segment comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 13.

[0032] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 4.

[0033] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 5.

[0034] In some aspects, the disclosure relates to a polynucleotide comprising: (i) a promoter comprising a nucleotide sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 1; and (ii) a nucleotide sequence encoding a product of interest; wherein the nucleotide sequence encoding the product of interest is operably linked to the promoter.

[0035] In some embodiments, the promoter comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 18; the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 22; the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 24; the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 37; or any combination thereof. In some embodiments, the promoter comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 23; the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 26; the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 28; or any combination thereof. In some embodiments, the promoter comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 20. In some embodiments, the promoter comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 21.

[0036] In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 1.

[0037] In some aspects, the disclosure relates to a polynucleotide comprising: (i) a promoter comprising a first segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 6 and a second segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 1, wherein the first segment and the second segment are separated by fewer than 1000 nucleotides, fewer than 900 nucleotides, fewer than 800 nucleotides, fewer than 700 nucleotides, fewer than 600 nucleotides, fewer than 500 nucleotides, fewer than 400 nucleotides, fewer than 300 nucleotides, fewer than 200 nucleotides, fewer than 100 nucleotides, fewer than 50 nucleotides, fewer than 40 nucleotides, fewer than 30 nucleotides, fewer than 20 nucleotides, or fewer than 10 nucleotides; and (ii) a nucleotide sequence encoding a product of interest; wherein the nucleotide sequence encoding the product of interest is operably linked to the promoter.

[0038] In some embodiments, the first segment is 5’ to the second segment.

[0039] In some embodiments, the first segment comprises: the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 14; the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 16; or a combination thereof. In some embodiments, the first segment comprises: the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 15; the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 17; or a combination thereof.

[0040] In some embodiments, the second segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 18; the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 22; the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 24; the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 37; or any combination thereof. In some embodiments, the second segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 23; the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 26; the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 28; or any combination thereof. In some embodiments, the second segment comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 20. In some embodiments, the second segment comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 21.

[0041] In some embodiments, the promoter comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 2. In some aspects, the disclosure relates to a polynucleotide comprising: (i) a promoter comprising a first segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 6, a second segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 7, and a third segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 1; and (ii) a nucleotide sequence encoding a product of interest; wherein the nucleotide sequence encoding the product of interest is operably linked to the promoter.

[0042] In some embodiments, the first segment is 5’ to the second segment and the second segment is 5’ to the third segment.

[0043] In some embodiments, the first segment comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 8.

[0044] In some embodiments, the first segment comprises: the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 14; the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 16; or a combination thereof.

[0045] In some embodiments, the first segment comprises: the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 15; the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 17; or a combination thereof.

[0046] In some embodiments, the second segment comprises: the nucleotide sequence of CCTTCCCTGGCCGGCTGCCATGGCC (SEQ ID NO: 29) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 29; the nucleotide sequence of GAAAAACCTGTTC (SEQ ID NO: 30) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 30; or a combination thereof.

[0047] In some embodiments, the third segment comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 9.

[0048] In some embodiments, the third segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 18; the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 22; the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 24; the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 37; or any combination thereof. In some embodiments, the third segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 23; the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 26; the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 28; or any combination thereof. In some embodiments, the third segment comprises the nucleotide sequence of

[0049] CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 20. In some embodiments, the third segment comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 21.

[0050] In some embodiments, the promoter comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 3.

[0051] In some aspects, the disclosure relates to a polynucleotide comprising: (i) a promoter comprising a first segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 10 and a second segment comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 11, wherein the first nucleotide sequence and the second nucleotide sequence are separated by fewer than 1000 nucleotides, fewer than 900 nucleotides, fewer than 800 nucleotides, fewer than 700 nucleotides, fewer than 600 nucleotides, fewer than 500 nucleotides, fewer than 400 nucleotides, fewer than 300 nucleotides, fewer than 200 nucleotides, fewer than 100 nucleotides, fewer than 50 nucleotides, fewer than 40 nucleotides, fewer than 30 nucleotides, fewer than 20 nucleotides, or fewer than 10 nucleotides; and (ii) a nucleotide sequence encoding a product of interest; wherein the nucleotide sequence encoding the product of interest is operably linked to the promoter.

[0052] In some embodiments, the first segment is 5’ to the second segment.

[0053] In some embodiments, the first segment comprises: the nucleotide sequence of TTTATATAGCT (SEQ ID NO: 31) or a nucleotide sequence having no more than 2 or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 31; the nucleotide sequence of GCGGGACCAGGTTCG (SEQ ID NO: 32) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 32; or a combination thereof.

[0054] In some embodiments, the first segment comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 12.

[0055] In some embodiments, the second segment comprises: the nucleotide sequence of GTCATGGGGTTATTTTTAAAC (SEQ ID NO: 33) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 33; the nucleotide sequence of CTGGGCGGAGTGTGGAATT (SEQ ID NO: 34) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 34; or a combination thereof.

[0056] In some embodiments, the second segment comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the promoter comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 4.

[0057] In some embodiments, the promoter comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 5.

[0058] In some embodiments, the product of interest is a polypeptide. In some embodiments, the product of interest is an RNA.

[0059] In some embodiments, the polynucleotide further comprises a nucleic acid encoding a polyadenylation signal, a transcriptional terminator, or a combination thereof.

[0060] In some aspects, the disclosure relates to a vector comprising a polynucleotide described herein. In some embodiments, the vector is a viral vector or a plasmid vector. In some embodiments, the vector is a viral vector, and wherein the viral vector is an adeno- associated viral (AAV) vector, a lentiviral vector, an HSV vector, or a retroviral vector.

[0061] In some aspects, the disclosure relates to a method of producing a product of interest in a cell comprising introducing into the cell a polynucleotide described herein.

[0062] In some embodiments, the cell is a cardiomyocyte, an epicardial cell, an endocardial cell, or an interstitial cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is within a multicellular organism.

[0063] In some embodiments, the step of introducing comprises administering a composition comprising the polynucleotide to the multicellular organism. In some embodiments, the composition is administered orally, intranasally, intraperitoneally, or intramuscularly.

[0064] In some embodiments, the product of interest is a polypeptide. In some embodiments, the product of interest is an RNA.

[0065] In some aspects, the disclosure relates to a method of targeting expression of a product of interest in a mammal to cardiac muscle tissue, said method comprising administering to the mammal a composition comprising a polynucleotide described herein.

[0066] In some embodiments, the mammal is a human.

[0067] In some embodiments, the composition is administered orally, intravenously, intranasally, intraperitoneally, or intramuscularly. In some embodiments, the product of interest is a polypeptide. In some embodiments, the product of interest is an RNA.

[0068] BRIEF DESCRIPTION OF DRAWINGS

[0069] FIG. 1 shows an alignment of nucleotide sequences of exemplary promoters described herein. TSP_Full 1505: SEQ ID NO: 3; TSP_Truncl 604: SEQ ID NO: 2; TSP_Trunc2 464: SEQ ID NO: 1.

[0070] FIG. 2 depicts the sequence components (or segments) of exemplary promoters described herein.

[0071] FIGs. 3A-3B show tissue specific expression of exemplary promoters described herein. FIG. 3A shows expression of luciferase RNA (normalized to GAPDH RNA) in various mouse tissues. Promoters driving expression of luciferase are provided on the X- axis. Tissues are presented as follows, from left to right: tibialis; gastrocnemius, quadricep, diaphragm, heart, liver, brain, kidney, spleen, lung, duodenum, ileum jejunum, and traverse colon. FIG. 3B shows a bioluminescent image of three replica mice expressing luciferase under the control of the TSP_Full 1505 promoter.

[0072] FIG. 4 shows an alignment of nucleotide sequences of exemplary promoters described herein. TSP_Full 1499: SEQ ID NO: 5; TSP_truncl 454; SEQ ID NO: 4.

[0073] FIG. 5 depicts the sequence components (or segments) of exemplary promoters described herein.

[0074] FIG. 6 shows tissue specific expression of exemplary promoters described herein. Expression of luciferase RNA (normalized to GAPDH RNA) is shown in various mouse tissues. Promoters driving expression of luciferase are provided on the X-axis. Tissues are presented as follows, from left to right: tibialis; gastrocnemius, quadricep, diaphragm, heart, liver, brain, kidney, spleen, lung, duodenum, ileum jejunum, and traverse colon.

[0075] DETAILED DESCRIPTION OF INVENTION

[0076] Provided herein are promoters which are capable of targeting expression of a product of interest in a mammal to cardiac tissue and / or muscle tissue with a surprisingly high degree of specificity. Also provided herein are expression cassettes and vectors comprising the polynucleotides, as well as methods of producing a product of interest in a cell and methods of targeting expression of a product of interest. I. Polynucleotides

[0077] A. Promoters

[0078] In some aspects, the disclosure relates to promoters that - when operably linked to a gene encoding a product of interest - are capable of initiating transcription of the gene in a cell. In some embodiments, a promoter is a synthetic promoter (z.e., a promoter that is not found naturally within a cell).

[0079] In some embodiments, a promoter described herein is capable of driving expression of a product of interest specifically or preferentially in cardiac tissue and / or muscle tissue (e.g., cardiac tissue and / or muscle tissue in a mammal).

[0080] In some embodiments, a promoter described herein is capable driving expression of product of interest in cardiac tissue at a level that is at least 10 times higher (e.g., at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 16 times, at least 17 times, at least 18 times, at least 19 times, at least 20 times, at least 21 times, at least 22 times, at least 23 times, at least 24 times, at least 25 times, at least 26 times, at least 27 times, at least 28 times, at least 30 times, at least 50 times, at least 75 times, at least 100 times, at least 150 times, or at least 200 times higher) than the level of expression of the product of interest in liver tissue.

[0081] In some embodiments, a promoter described herein lacks the ability to drive expression of a product of interest to a level detectable by immunohistochemistry in liver tissue, brain tissue, kidney tissue, spleen tissue, lung tissue, duodenum tissue, jejunum tissue, and / or colon tissue in a mammal.

[0082] In some embodiments, a promoter comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to a nucleotide sequence of TABLE 1. In some embodiments, the promoter comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to a nucleotide sequence of TABLE 1. In some embodiments, a promoter comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the promoter comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1.

[0083] In some embodiments, a promoter comprises a first segment comprising a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 6 and a second segment comprising a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1.

[0084] In some embodiments, the first segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 6.

[0085] In some embodiments, the second segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the first segment and the second segment are separated by fewer than 2000 nucleotides, fewer than 1900 nucleotides, 1800 nucleotides, 1700 nucleotides, 1600 nucleotides, 1500 nucleotides, 1400 nucleotides, 1300 nucleotides, 1200 nucleotides, 1100 nucleotides, 1000 nucleotides, 900 nucleotides, 800 nucleotides, 700 nucleotides, 800 nucleotides, 700 nucleotides, 600 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, 100 nucleotides, 90 nucleotides, 80 nucleotides, 70 nucleotides, 60 nucleotides, 50 nucleotides, 40 nucleotides, 30 nucleotides, 20 nucleotides, 10 nucleotides, 9 nucleotides, 8 nucleotides, 7 nucleotides, 6 nucleotides, 5 nucleotides, 4 nucleotides, 3 nucleotides, 2 nucleotides, or 1 nucleotide.

[0086] In some embodiments, the first segment is 5’ to the second segment. In some embodiments, the second segment is 5’ to the first segment.

[0087] In some embodiments, a promoter comprises, from 5’ to 3, a first segment comprising a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 6, a second segment comprising a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 7, and a third segment comprising a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1.

[0088] In some embodiments, the first segment is 5’ to the second segment. In some embodiments, the first segment is 5’ to the third segment. In some embodiments, the first segment is 5’ to the second segment and the third segment. In some embodiments, the second segment is 5’ to the third segment.

[0089] In some embodiments, the first segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the first segment comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the first segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 8.

[0090] In some embodiments, the second segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 7.

[0091] In some embodiments, the third segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1.

[0092] In some embodiments, the third segment comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the third segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 9.

[0093] In some embodiments, the first segment and the second segment are separated by fewer than 2000 nucleotides, fewer than 1900 nucleotides, 1800 nucleotides, 1700 nucleotides, 1600 nucleotides, 1500 nucleotides, 1400 nucleotides, 1300 nucleotides, 1200 nucleotides, 1100 nucleotides, 1000 nucleotides, 900 nucleotides, 800 nucleotides, 700 nucleotides, 800 nucleotides, 700 nucleotides, 600 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, 100 nucleotides, 90 nucleotides, 80 nucleotides, 70 nucleotides, 60 nucleotides, 50 nucleotides, 40 nucleotides, 30 nucleotides, 20 nucleotides, 10 nucleotides, 9 nucleotides, 8 nucleotides, 7 nucleotides, 6 nucleotides, 5 nucleotides, 4 nucleotides, 3 nucleotides, 2 nucleotides, or 1 nucleotide.

[0094] In some embodiments, the second segment and the third segment are separated by fewer than 2000 nucleotides, fewer than 1900 nucleotides, 1800 nucleotides, 1700 nucleotides, 1600 nucleotides, 1500 nucleotides, 1400 nucleotides, 1300 nucleotides, 1200 nucleotides, 1100 nucleotides, 1000 nucleotides, 900 nucleotides, 800 nucleotides, 700 nucleotides, 800 nucleotides, 700 nucleotides, 600 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, 100 nucleotides, 90 nucleotides, 80 nucleotides, 70 nucleotides, 60 nucleotides, 50 nucleotides, 40 nucleotides, 30 nucleotides, 20 nucleotides, 10 nucleotides, 9 nucleotides, 8 nucleotides, 7 nucleotides, 6 nucleotides, 5 nucleotides, 4 nucleotides, 3 nucleotides, 2 nucleotides, or 1 nucleotide.

[0095] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1 - comprises: a) the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 18; b) the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 22; c) the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 24; d) the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 25; e) the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference (i.e., insertion, substitution, and / or deletion) with SEQ ID NO: 27; f) the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 35; g) the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 36; h) the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 37; or i) any combination thereof.

[0096] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1 - comprises two or more of, three or more of, four or more of, five or more of, six or more of, seven or more of, or all of a), b), c), d), e), f), g), and h). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1 - comprises the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18), the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22), the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24), the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25), the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27), the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35); the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36), and the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37).

[0097] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1 - comprises: j) the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 19); k) the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 23; l) the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 26; m) the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 28; or n) any combination thereof.

[0098] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1 - comprises two or more of, three or more of, or all four of g), h), i), and j). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 comprises the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19), the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23), the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26), and the nucleotide sequence of TCGGCAGCTGCTGTTCTGA.

[0099] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1 - comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 20. In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20).

[0100] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1 - comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 21. In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 1 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 1 - comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21).

[0101] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 6 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 6 - comprises: a) the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 14; b) the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 16; c) or a combination thereof.

[0102] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 6 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 6 - comprises both a) and b). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 6 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 6 - comprises the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) and the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16).

[0103] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 6 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 6 - comprises: d) the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 15; e) the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 17; f) or a combination thereof.

[0104] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 6 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 6 - comprises both d) and e). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 6 comprises the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) and the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17).

[0105] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 7 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 7 - comprises: a) the nucleotide sequence of CCTTCCCTGGCCGGCTGCCATGGCC (SEQ ID NO: 29) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 29; b) the nucleotide sequence of GAAAAACCTGTTC (SEQ ID NO: 30) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 30; c) or a combination thereof.

[0106] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 7 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 7 - comprises both a) and b). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 7 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 7 - comprises the nucleotide sequence of CCTTCCCTGGCCGGCTGCCATGGCC (SEQ ID NO: 29) and the nucleotide sequence of GAAAAACCTGTTC (SEQ ID NO: 30). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 8 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 8 - comprises: a) the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 14; b) the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 16; c) or a combination thereof.

[0107] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 8 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 8 - comprises both a) and b). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 8 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 8 - comprises the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) and the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16).

[0108] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 8 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 8 - comprises: d) the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 15; e) the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 17; f) or a combination thereof.

[0109] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 8 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) ( / .<?., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 8 - comprises both d) and e). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 8 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 8 - comprises the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) and the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17).

[0110] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) ( / .<?., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 9 - comprises: a) the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 18; b) the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 22; c) the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 24; d) the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 25; e) the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference (i.e., insertion, substitution, and / or deletion) with SEQ ID NO: 27; f) the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 35; g) the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 36; h) the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertions, substitutions, and deletions) with SEQ ID NO: 37; or i) any combination thereof.

[0111] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 9 - comprises two or more of, three or more of, four or more of, five or more of, six or more of, seven or more of, or all of a), b), c), d), e), f), g), and h). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 comprises the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18), the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22), the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24), the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25), the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) , the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35); the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36), and the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37).

[0112] In some embodiments, a nucleotide sequence having at least 80% identity e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 9 - comprises: j) the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 19); k) the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 23; l) the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 26; m) the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 28; or n) any combination thereof.

[0113] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 9 - comprises two or more of, three or more of, or all four of g), h), i), and j). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 comprises the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19), the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23), the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26), and the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28).

[0114] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 9 - comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 20. In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 9 - comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20).

[0115] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 9 - comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 21. In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 9 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 9 - comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21).

[0116] In some embodiments, a promoter comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, a promoter comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 2.

[0117] In some embodiments, a promoter comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 3. In some embodiments, a promoter comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 3.

[0118] In some embodiments, a promoter comprises a first segment comprising a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 10 and a second segment comprising a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to SEQ ID NO: 11, wherein the first nucleotide sequence and the second nucleotide sequence are separated by fewer than 2000 nucleotides.

[0119] In some embodiments, the first segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 10.

[0120] In some embodiments, the first segment comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the first segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 12.

[0121] In some embodiments, the second segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 11.

[0122] In some embodiments, the second segment comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the second segment comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 13.

[0123] In some embodiments, the first segment and the second segment are separated by fewer than 2000 nucleotides, fewer than 1900 nucleotides, 1800 nucleotides, 1700 nucleotides, 1600 nucleotides, 1500 nucleotides, 1400 nucleotides, 1300 nucleotides, 1200 nucleotides, 1100 nucleotides, 1000 nucleotides, 900 nucleotides, 800 nucleotides, 700 nucleotides, 800 nucleotides, 700 nucleotides, 600 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, 100 nucleotides, 90 nucleotides, 80 nucleotides, 70 nucleotides, 60 nucleotides, 50 nucleotides, 40 nucleotides, 30 nucleotides, 20 nucleotides, 10 nucleotides, 9 nucleotides, 8 nucleotides, 7 nucleotides, 6 nucleotides, 5 nucleotides, 4 nucleotides, 3 nucleotides, 2 nucleotides, or 1 nucleotide.

[0124] In some embodiments, the first segment is 5’ to the second segment. In some embodiments, the second segment is 5’ to the first segment.

[0125] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 10 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 10 - comprises: a) the nucleotide sequence of TTTATATAGCT (SEQ ID NO: 31) or a nucleotide sequence having no more than 2 or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 31; b) the nucleotide sequence of GCGGGACCAGGTTCG (SEQ ID NO: 32) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 32; c) or a combination thereof.

[0126] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 10 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 10 - comprises both a) and b). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 10 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 10 - comprises the nucleotide sequence of TTTATATAGCT (SEQ ID NO: 31) and the nucleotide sequence of GCGGGACCAGGTTCG (SEQ ID NO: 32).

[0127] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 11 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 11 - comprises: a) the nucleotide sequence of GTCATGGGGTTATTTTTAAAC (SEQ ID NO: 33) or a nucleotide sequence having no more than 4, no more than 3, no more than 2 or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 33; b) the nucleotide sequence of CTGGGCGGAGTGTGGAATT (SEQ ID NO: 34) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 34; c) or a combination thereof.

[0128] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 11 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 11 - comprises both a) and b). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 11 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 11 - comprises the nucleotide sequence of GTCATGGGGTTATTTTTAAAC (SEQ ID NO: 33) and the nucleotide sequence of CTGGGCGGAGTGTGGAATT (SEQ ID NO: 34). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 12 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 12 - comprises: a) the nucleotide sequence of TTTATATAGCT (SEQ ID NO: 31) or a nucleotide sequence having no more than 2 or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 31; b) the nucleotide sequence of GCGGGACCAGGTTCG (SEQ ID NO: 32) or a nucleotide sequence having no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 32; c) or a combination thereof.

[0129] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 12 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 12 - comprises both a) and b). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 12 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 12 - comprises the nucleotide sequence of TTTATATAGCT (SEQ ID NO: 31) and the nucleotide sequence of GCGGGACCAGGTTCG (SEQ ID NO: 32).

[0130] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 13 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 13 - comprises: a) the nucleotide sequence of GTCATGGGGTTATTTTTAAAC (SEQ ID NO: 33) or a nucleotide sequence having no more than 4, no more than 3, no more than 2 or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 33; b) the nucleotide sequence of CTGGGCGGAGTGTGGAATT (SEQ ID NO: 34) or a nucleotide sequence having no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide difference(s) (i.e., cumulative insertion(s), substitution(s), and / or deletion(s)) with SEQ ID NO: 34; c) or a combination thereof.

[0131] In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 13 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (i.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 13 - comprises both a) and b). In some embodiments, a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 13 - or having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 13 - comprises the nucleotide sequence of GTCATGGGGTTATTTTTAAAC (SEQ ID NO: 33) and the nucleotide sequence of CTGGGCGGAGTGTGGAATT (SEQ ID NO: 34).

[0132] In some embodiments, a promoter comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 4. In some embodiments, a promoter comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 4.

[0133] In some embodiments, a promoter comprises a nucleotide sequence having at least 80% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity) to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, a promoter comprises a nucleotide sequence having 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer or 1 nucleotide difference(s) (z.e., substitution(s), deletion(s), or addition(s)) relative to the nucleotide sequence of SEQ ID NO: 5.

[0134] B. Expression Cassettes

[0135] In some aspect, the disclosure relates to an expression cassette comprising: (i) a promoter (as described herein); and (ii) a nucleic acid sequence encoding a product of interest; wherein the nucleic acid sequence encoding the product of interest is operably linked to the promoter. In some embodiments, the product of interest is a polypeptide. In some embodiments, the product of interest is an RNA.

[0136] In some embodiments, the expression cassette comprises a nucleic acid sequence encoding a polyadenylation signal. As used herein, the term “polyadenylation signal” refers to a region of a mRNA that directs polyadenylation of the mRNA. Examples of polyadenylation signals are known in the art (e.g., an SV40 or rbGlob polyadenylation sequence). See e.g., Patent No.: Yang et al., Biotechnol. Bioeng. 2009 Mar 1; 102(4): 1152- 60; Laniox and Acheson, EMBO J. 1998 Aug; 7(8): 2515-22; the entireties of which are incorporated here by reference.

[0137] In some embodiments, the expression cassette comprises a nucleic acid sequence of a transcriptional terminator. As used herein, the term “transcriptional terminator” refers to an untranslated region at the 3’ end of a gene that induces polymerase to end transcription. Examples of transcriptional terminator are known in the art. In some embodiments, a polynucleotide comprises a wild-type woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). See e.g., Patent No.: US 6,136,597 A - the entirety of which is incorporated here by reference.

[0138] C. Vectors

[0139] In some aspect, the disclosure relates to vectors comprising a polynucleotide, a synthetic promoter, or an expression cassette as described herein.

[0140] In some embodiments, the vector is a DNA plasmid vector.

[0141] In some embodiments, the vector is a viral vector, such as an adenoviral (AV) vector, an adeno-associated viral (AAV) vector, a lentiviral vector, a herpes viral (HSV) vector, or a retroviral vector.

[0142] In some embodiments, the vector is an adenoviral (AV) vector.

[0143] In some embodiments, the vector is an adeno-associated viral (AAV) vector.

[0144] In some embodiments, the vector is a lentiviral vector. In some embodiments, the vector is a herpes viral (HSV) vector.

[0145] In some embodiments, the vector is a retroviral vector.

[0146] D. Percent Identity

[0147] As used herein, the term “percent identity” refers to a relationship between the sequences of two polynucleotides, as determined by sequence comparison (alignment). In some embodiments, identity is determined across the entire length of a sequence. In some embodiments, identity is determined over a region of a sequence.

[0148] Identity of related nucleic acid sequences can be readily calculated by those having ordinary skill in the art.

[0149] In some embodiments, the percent identity of two sequences is determined using the algorithm of Karlin and Altschul 1990 Proc. Natl. Acad. Sci. U.S.A. 87:2264-68, modified as in Karlin and Altschul 1993 Proc. Natl. Acad. Sci. U.S.A. 90:5873-77. This algorithm is incorporated into the NBLAST® and XBLAST® programs (version 2.0) of Altschul et al. 1990 J. Mol. Biol. 215:403-10. BLAST® protein searches can be performed, for example, with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the invention. Where gaps exist between two sequences, Gapped BLAST® can be utilized, for example, as described in Altschul et al. 1997 Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST® and Gapped BLAST® programs, the default parameters of the respective programs (e.g., XBLAST® and NBLAST®) can be used, or the parameters can be adjusted appropriately as would be understood by one of ordinary skill in the art.

[0150] In some embodiments, the percent identity of two sequences is determined using the algorithm of Smith-Waterman (Smith, T.F. & Waterman, M.S. 1981 J. Mol. Biol. 147:195- 197).

[0151] In some embodiments, the percent identity of two sequences is determined using the algorithm of Needleman-Wunsch (Needleman, S.B. & Wunsch, C.D. 1970 J. Mol. Biol. 48:443-453).

[0152] In some embodiments, the percent identity of two sequences is determined using the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA).

[0153] In some embodiments, the percent identity of two sequences is determined using Clustal Omega (Sievers et al. 2011 Mol Syst Biol. 7:539), using default parameters.

[0154] In some embodiments, the identity of two nucleic acid sequences is determined by aligning the two sequences, calculating the number of identical nucleotides, and dividing by the length of one of the nucleic acid sequences. In some embodiments, the identity of two nucleic acid sequences is determined by aligning the two sequences, calculating the number of identical nucleotides, and dividing by the length of the longer nucleic acid sequence. In some embodiments, the identity of two nucleic acid sequences is determined by aligning the two sequences, calculating the number of identical nucleotides, and dividing by the length of the shorter nucleic acid sequence.

[0155] II. Compositions

[0156] In some aspects, the disclosure relates to compositions comprising a polynucleotide described herein.

[0157] In some embodiments, a viral particle (e.g., an adenoviral (AV) particle, an adeno- associated viral (AAV) particle, a lentiviral particle, a herpes viral (HSV) particle, or a retroviral particle) comprises a polynucleotide described herein.

[0158] In some embodiments, an adenoviral (AV) particle comprises a polynucleotide described herein. In some embodiments, the AV particle is an hAd2 particle or an hAd5 particle.

[0159] In some embodiments, an adeno-associated viral (AAV) particle comprises a polynucleotide described herein. In some embodiments, the AAV particle is an AAV 1 particle, an AAV2 particle, AAV3 particle, an AAV4 particle, an AAV5 particle, an AAV6 particle, an AAV7 particle, an AAV8 particle, an AAV9 particle, an AAV10 particle, or an AAV 11 particle.

[0160] In some embodiments, a lentiviral particle comprises a polynucleotide described herein.

[0161] In some embodiments, a herpes viral (HSV) particle comprises a polynucleotide described herein. In some embodiments, the HSV particle is an HSV1 particle or an HSV2 particle.

[0162] In some embodiments, a retroviral particle comprises a polynucleotide described herein.

[0163] III. Methods of Producing a Product of Interest in a Cell

[0164] In some aspects, the disclosure relates to methods of producing a product of interest in a cell. In some embodiments, a method of producing a product of interest (e.g., a protein or an RNA) in a cell comprises introducing into the cell a polynucleotide comprising an expression cassette as described herein, or a composition comprising the same.

[0165] In some embodiments, the cell is a cardiac tissue cell or a skeletal muscle tissue cell. In some embodiments, the cell is a cardiomyocyte or a myocyte.

[0166] In some embodiments, the cell is a mammalian cell.

[0167] In some embodiments, the cell is a human cell.

[0168] Methods of introducing polynucleotides into a cell are known to those of ordinary skill in the art and include, but are not limited to, electroporation, transfection (e.g., heat- shock-mediated transfection, laser transfection, lipofectamine-mediated transfection, liposomal transfection), transformation, microinjection, nuclear injection, biolistics, gene guns, gene therapy, and gene transfer. In some embodiments, a polynucleotide is introduced into a cell by contacting the cell with a viral particle that comprises the polynucleotide (as described herein).

[0169] In some embodiments, the cell is within a multicellular organism, such as a mammal (e.g., a human). In some embodiments, the step of introducing comprises administering the polynucleotide (or composition comprising the polynucleotide) to the multicellular organism. In some embodiments, the administration is intranasal (IN), intraperitoneal (IP), intramuscular (IM), intravenous (IV), intraocular (IO), intratumoral (IT), or any combination thereof.

[0170] IV. Methods of Targeting Expression of a Product of Interest in a Mammal

[0171] In some aspects, the disclosure relates to methods of targeting expression of a product of interest in a mammal to skeletal muscle tissue and / or cardiac muscle tissue.

[0172] In some embodiments, a method of targeting expression of a product of interest (e.g., a protein or an RNA) in a mammal comprises administering to the mammal a polynucleotide comprising an expression cassette as described herein, or a composition (e.g., viral particle) comprising the same.

[0173] In some embodiments, the mammal is a human.

[0174] In some embodiments, the administration comprises intranasal (IN) administration, intraperitoneal (IP) administration, intramuscular (IM) administration, intravenous (IV) administration, intraocular (IO) administration, intratumoral (IT) administration, or any combination thereof. In some embodiments, the administration is via inhalation. EXAMPLES

[0175] Example 1: Design and Testing of Promoters

[0176] A transformer model trained on Genotype-Tissue Expression (GTEx) data was used to perform a retrieval of core promoter sequences of genes expressed in cardiac muscle and skeletal muscle. Using this model, various synthetic promoters were generated (see TABLE l; FIGs. 1, 2, 4, and 5).

[0177] The synthetic promoters were then tested to assess their ability to drive tissue-specific expression. Engineered AAV9 capsids were generated, comprising an expression cassette having the expression of luciferase driven by: a synthetic promoter of TABLE 1; a MHCK7 promoter, which was previously identified as a skeletal- and cardiac-specific promoter (a tissue-specific positive control); or a constitutive promoter (CMV, positive control).

[0178] CD-I (f) mice were administered a dose of 6E13 vg / kg AAV9 engineered capsids. In vivo imaging was performed at 2, 3, and 4 weeks post administration (see FIG. 3B). Tissues were harvested 4 weeks post administration and assayed for luciferase expression (FIGs. 3A and 6).

[0179] TABLE 1: Exemplary Promoter Sequences

[0180] Example 2: Analyses of Promoter Sequences

[0181] Computational analyses were performed to identify subsequences of the promoters provided in TABLE 1 that are important to driving expression specifically in cardiac muscle and skeletal muscle. The subsequences that were identified are provided in TABLE 2.

[0182] TABLE 2: Exemplary Promoter Subsequences

Claims

CLAIMSWhat is claimed is:

1. A polynucleotide comprising a first segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 6 and a second segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 1, wherein the first segment and the second segment are separated by fewer than 1000 nucleotides.

2. The polynucleotide of claim 1, wherein the first segment is 5’ to the second segment.

3. The polynucleotide of claim 1 or claim 2, wherein the first segment comprises: the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 14; the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 16; or a combination thereof.

4. The polynucleotide of claim 3, wherein the first segment comprises: the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 15; the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 17; or a combination thereof.

5. The polynucleotide of any one of claims 1-4, wherein the second segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 18;the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 22; the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 24; the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 37; or any combination thereof.

6. The polynucleotide of any one of claims 1-5, wherein the second segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 23; the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than eight nucleotide differences with SEQ ID NO: 26; the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 28; or any combination thereof.

7. The polynucleotide of any one of claims 1-6, wherein the second segment comprises the nucleotide sequence ofCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGGCG (SEQ ID NO: 20) or a nucleotide sequence having no more than twelve nucleotide differences with SEQ ID NO: 20.

8. The polynucleotide of any one of claims 1-7, wherein the second segment comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than fifteen nucleotide differences with SEQ ID NO: 21.

9. The polynucleotide of any one of claims 1-8, comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 2.

10. The polynucleotide of any one of claims 1-9, consisting of the nucleotide sequence of SEQ ID NO: 2.

11. A polynucleotide comprising a first segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 6, a second segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 7, and a third segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 1.

12. The polynucleotide of claim 11, wherein the first segment is 5’ to the second segment and the second segment is 5’ to the third segment.

13. The polynucleotide of claim 11 or claim 12, wherein the first segment comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 8.

14. The polynucleotide of any one of claims 11-13, wherein the first segment comprises: the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO:14) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 14;the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 16; or a combination thereof.

15. The polynucleotide of any one of claims 11-14, wherein the first segment comprises: the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQ ID NO: 15) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 15; the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 17; or a combination thereof.

16. The polynucleotide of any one of claims 11-15, wherein the second segment comprises: the nucleotide sequence of CCTTCCCTGGCCGGCTGCCATGGCC (SEQ ID NO: 29) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 29; the nucleotide sequence of GAAAAACCTGTTC (SEQ ID NO: 30) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 30; or a combination thereof.

17. The polynucleotide of any one of claims 11-16, wherein the third segment comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO:9.

18. The polynucleotide of any one of claims 11-17, wherein the third segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 18; the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 22; the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 24;the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 37; or any combination thereof.

19. The polynucleotide of any one of claims 11-18, wherein the third segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 23; the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than eight nucleotide differences with SEQ ID NO: 26; the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 28; or any combination thereof.

20. The polynucleotide of any one of claims 11-19, wherein the third segment comprises the nucleotide sequence ofCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than twelve nucleotide differences with SEQ ID NO: 20.

21. The polynucleotide of any one of claims 11-20, wherein the third segment comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than fifteen nucleotide differences with SEQ ID NO: 21.

22. The polynucleotide of any one of claims 11-21, comprising a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 3.

23. The polynucleotide of any one of claims 11-18, consisting of the nucleotide sequence of SEQ ID NO: 3.

24. A polynucleotide comprising a first segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 10 and a second segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 11, wherein the first nucleotide sequence and the second nucleotide sequence are separated by fewer than 1000 nucleotides.

25. The polynucleotide of claim 24, wherein the first segment is 5’ to the second segment.

26. The polynucleotide of claim 24 or claim 25, wherein the first segment comprises: the nucleotide sequence of TTTATATAGCT (SEQ ID NO: 31) or a nucleotide sequence having no more than two nucleotide differences with SEQ ID NO: 31; the nucleotide sequence of GCGGGACCAGGTTCG (SEQ ID NO: 32) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 32; or a combination thereof.

27. The polynucleotide of any one of claims 24-26, wherein the second segment comprises: the nucleotide sequence of GTCATGGGGTTATTTTTAAAC (SEQ ID NO: 33) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 33; the nucleotide sequence of CTGGGCGGAGTGTGGAATT (SEQ ID NO: 34) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 34;or a combination thereof.

28. The polynucleotide of any one of claims 24-27, wherein the first segment comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 12.

29. The polynucleotide of any one of claims 24-28, wherein the second segment comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 13.

30. The polynucleotide of any one of claims 24-27, comprising a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 4.

31. The polynucleotide of any one of claims 24-27, consisting of the nucleotide sequence of SEQ ID NO: 4.

32. The polynucleotide of any one of claims 24-29, comprising a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 5.

33. The polynucleotide of any one of claims 24-29, consisting of the nucleotide sequence of SEQ ID NO: 5.

34. A polynucleotide comprising: (i) a promoter comprising a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 1; and (ii) a nucleotide sequence encoding a product of interest; wherein the nucleotide sequence encoding the product of interest is operably linked to the promoter.

35. The polynucleotide of claim 34, wherein the promoter comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 18; the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 22;the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 24; the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 37; or any combination thereof.

36. The polynucleotide of claim 34 or claim 35, wherein the promoter comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 23; the nucleotide sequence ofTCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than eight nucleotide differences with SEQ ID NO: 26; the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 28; or any combination thereof.

37. The polynucleotide of any one of claims 34-36, wherein the promoter comprises the nucleotide sequence ofCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than twelve nucleotide differences with SEQ ID NO: 20.

38. The polynucleotide of any one of claims 34-37, wherein the promoter comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than fifteen nucleotide differences with SEQ ID NO: 21.

39. The polynucleotide of any one of claims 34-37, wherein the promoter consists of the nucleotide sequence of SEQ ID NO: 1.

40. A polynucleotide comprising: (i) a promoter comprising a first segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 6 and a second segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 1, wherein the first segment and the second segment are separated by fewer than 1000 nucleotides; and (ii) a nucleotide sequence encoding a product of interest; wherein the nucleotide sequence encoding the product of interest is operably linked to the promoter.

41. The polynucleotide of claim 40, wherein the first segment is 5’ to the second segment.

42. The polynucleotide of claim 40 or claim 41, wherein the first segment comprises: the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO: 14) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 14; the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 16; or a combination thereof.

43. The polynucleotide of any one of claims 40-42, wherein the first segment comprises: the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQID NO: 15) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 15;the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 17; or a combination thereof.

44. The polynucleotide of any one of claims 40-43, wherein the second segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 18; the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 22; the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 24; the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 37; or any combination thereof.

45. The polynucleotide of any one of claims 40-44, wherein the second segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO: 23) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 23;the nucleotide sequence of TCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than eight nucleotide differences with SEQ ID NO: 26; the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 28; or any combination thereof.

46. The polynucleotide of any one of claims 40-45, wherein the second segment comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than twelve nucleotide differences with SEQ ID NO: 20.

47. The polynucleotide of any one of claims 40-46, wherein the second segment comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than fifteen nucleotide differences with SEQ ID NO: 21.

48. The polynucleotide of any one of claims 40-47, wherein the promoter comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 2.

49. The polynucleotide of any one of claims 40-48, wherein the promoter consists of the nucleotide sequence of SEQ ID NO: 2.

50. A polynucleotide comprising: (i) a promoter comprising a first segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 6, a second segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 7, and a third segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 1; and (ii) a nucleotide sequence encoding a product of interest; wherein the nucleotide sequence encoding the product of interest is operably linked to the promoter.

51. The polynucleotide of claim 50, wherein the first segment is 5’ to the second segment and the second segment is 5’ to the third segment.

52. The polynucleotide of claim 50 or claim 51, wherein the first segment comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 8.

53. The polynucleotide of any one of claims 50-52, wherein the first segment comprises: the nucleotide sequence of TGTAAGGAATTTCAGAGCACATTCC (SEQ ID NO:14) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 14; the nucleotide sequence of AAGCTACCTGCCCTCCCAAATTCCT (SEQ ID NO: 16) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 16; or a combination thereof.

54. The polynucleotide of any one of claims 50-53, wherein the first segment comprises: the nucleotide sequence of GGTGTGTAAGGAATTTCAGAGCACATTCCT (SEQID NO: 15) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 15; the nucleotide sequence of GGAAGCTACCTGCCCTCCCAAATTCCTTT (SEQ ID NO: 17) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 17; or a combination thereof.

55. The polynucleotide of any one of claims 50-54, wherein the second segment comprises: the nucleotide sequence of CCTTCCCTGGCCGGCTGCCATGGCC (SEQ ID NO:29) or a nucleotide sequence having no more than six nucleotide differences with SEQ ID NO: 29; the nucleotide sequence of GAAAAACCTGTTC (SEQ ID NO: 30) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 30; or a combination thereof.

56. The polynucleotide of any one of claims 50-55, wherein the third segment comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO:9.

57. The polynucleotide of any one of claims 50-56, wherein the third segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTA (SEQ ID NO: 18) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 18; the nucleotide sequence of CCCTGGCACCTGCCAA (SEQ ID NO: 22) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 22; the nucleotide sequence of TCGCACATTCCTCCC (SEQ ID NO: 24) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 24; the nucleotide sequence of GGCTGGCTCACCAGGCC (SEQ ID NO: 25) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 25; the nucleotide sequence of TGTTCTGA (SEQ ID NO: 27) or a nucleotide sequence having one nucleotide difference with SEQ ID NO: 27; the nucleotide sequence of TGTCGCACATTCCTCCC (SEQ ID NO: 35) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 35; the nucleotide sequence of GGCTGGCTCACCAGGCCCCA (SEQ ID NO: 36) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 36; the nucleotide sequence of TCTGTCGGCAGCTGCTGTTCTGA (SEQ ID NO: 37) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 37; or any combination thereof.

58. The polynucleotide of any one of claims 50-57, wherein the third segment comprises: the nucleotide sequence of TGGTTTTAAATAGCTTATCT (SEQ ID NO: 19) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 19); the nucleotide sequence of TTGTCCCTGGCACCTGCCAAAATAGC (SEQ ID NO:23) or a nucleotide sequence having no more than five nucleotide differences with SEQ ID NO: 23; the nucleotide sequence ofTCGCACATTCCTCCCTCCGCAGGGCTGGCTCACCAGGCC (SEQ ID NO: 26) or a nucleotide sequence having no more than eight nucleotide differences with SEQ ID NO: 26;the nucleotide sequence of TCGGCAGCTGCTGTTCTGA (SEQ ID NO: 28) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 28; or any combination thereof.

59. The polynucleotide of any one of claims 50-58, wherein the third segment comprises the nucleotide sequence of CTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCACATGGGCTTATATGG CG (SEQ ID NO: 20) or a nucleotide sequence having no more than twelve nucleotide differences with SEQ ID NO: 20.

60. The polynucleotide of any one of claims 57-59, wherein the third segment comprises the nucleotide sequence of TCCCTGCATATCTGCTCTGGTTTTAAATAGCTTATCTGAGCAGCTGGAGGACCAC ATGGGCTTATATGGCGTGGGG (SEQ ID NO: 21) or a nucleotide sequence having no more than fifteen nucleotide differences with SEQ ID NO: 21.

61. The polynucleotide of any one of claims 50-60, wherein the promoter comprises a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 3.

62. The polynucleotide of any one of claims 50-57, wherein the promoter consists of the nucleotide sequence of SEQ ID NO: 3.

63. A polynucleotide comprising: (i) a promoter comprising a first segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 10 and a second segment comprising a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 11, wherein the first nucleotide sequence and the second nucleotide sequence are separated by fewer than 1000 nucleotides; and (ii) a nucleotide sequence encoding a product of interest; wherein the nucleotide sequence encoding the product of interest is operably linked to the promoter.

64. The polynucleotide of claim 63, wherein the first segment is 5’ to the second segment.

65. The polynucleotide of claim 63 or claim 64, wherein the first segment comprises: the nucleotide sequence of TTTATATAGCT (SEQ ID NO: 31) or a nucleotide sequence having no more than two nucleotide differences with SEQ ID NO: 31; the nucleotide sequence of GCGGGACCAGGTTCG (SEQ ID NO: 32) or a nucleotide sequence having no more than three nucleotide differences with SEQ ID NO: 32; or a combination thereof.

66. The polynucleotide of any one of claims 63-65, wherein the second segment comprises: the nucleotide sequence of GTCATGGGGTTATTTTTAAAC (SEQ ID NO: 33) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 33; the nucleotide sequence of CTGGGCGGAGTGTGGAATT (SEQ ID NO: 34) or a nucleotide sequence having no more than four nucleotide differences with SEQ ID NO: 34; or a combination thereof.

67. The polynucleotide of any one of claims 63-66, wherein the first segment comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 12.

68. The polynucleotide of any one of claims 63-67, wherein the second segment comprises a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO: 13.

69. The polynucleotide of any one of claims 63-68, wherein the promoter comprises a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 4.

70. The polynucleotide of any one of claims 63-69, wherein the promoter consists of the nucleotide sequence of SEQ ID NO: 4.

71. The polynucleotide of any one of claims 63-70, wherein the promoter comprises a nucleotide sequence having at least 80% identity with the nucleotide sequence of SEQ ID NO: 5.

72. The polynucleotide of any one of claims 63-67, wherein the promoter consists of the nucleotide sequence of SEQ ID NO: 5.

73. The polynucleotide of any one of claims 34-72, wherein the product of interest is a polypeptide.

74. The polynucleotide of any one of claims 34-73, wherein the product of interest is an RNA.

75. The polynucleotide of any one of claims 34-74, further comprising a nucleic acid encoding a polyadenylation signal, a transcriptional terminator, or a combination thereof.

76. A vector comprising the polynucleotide of any one of claims 1-75.

77. The vector of claim 76, wherein the vector is a viral vector or a plasmid vector.

78. The vector of claim 77, wherein the vector is a viral vector, and wherein the viral vector is an adeno-associated viral (AAV) vector, a lentiviral vector, an HSV vector, or a retroviral vector.

79. A method of producing a product of interest in a cell comprising introducing into the cell a polynucleotide according to any one of claims 34-75.

80. The method of claim 79, wherein the cell is a cardiomyocyte.

81. The method of claim 79 or claim 80, wherein the cell is a mammalian cell.

82. The method of any one of claims 79-81, wherein the cell is a human cell.

83. The method of any one of claims 79-82, wherein the cell is within a multicellular organism.

84. The method of claim 83, wherein the step of introducing comprises administering a composition comprising the polynucleotide to the multicellular organism.

85. The method of claim 84, wherein the composition is administered orally, intranasally, intraperitoneally, or intramuscularly.

86. The method of any one of claims 79-85, wherein the product of interest is a polypeptide.

87. The method of any one of claims 79-85, wherein the product of interest is an RNA.

88. A method of targeting expression of a product of interest in a mammal to cardiac muscle tissue, said method comprising administering to the mammal a composition comprising a polynucleotide according to any one of claims 34-75.

89. The method of claim 88, wherein the mammal is a human.

90. The method of claim 88 or claim 89, wherein the composition is administered orally, intravenously, intranasally, intraperitoneally, or intramuscularly.

91. The method of any one of claims 88-90, wherein the product of interest is a polypeptide.

92. The method of any one of claims 88-90, wherein the product of interest is an RNA.

Images