Methods of reducing or eliminating blood flow restriction and methods of treating, ameliorating and / or preventing diseases or disorders associated with restriction of blood flow

Abstract

Described herein are compositions and methods for promoting an outward remodeling of a blood vessel, and compositions and methods for treating, ameliorating, and / or preventing a disease or disorder caused by or involving a plaque in the blood vessel in a subject. The methods herein include administering to the subject an effective amount of a compound that downregulates Smad1 / 5 and / or BMP9 / 10.

Description

[0001] TITLE

[0002] METHODS OF REDUCING OR ELIMINATING BLOOD FLOW RESTRICTION AND

[0003] METHODS OF TREATING, AMELIORATING AND / OR PREVENTING DISEASES OR DISORDERS ASSOCIATED WITH RESTRICTION OF BLOOD FLOW

[0004] CROSS-REFERENCE TO RELATED APPLICATIONS

[0005] The present application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 551,347, filed February 08, 2024, which is incorporated herein by reference in its entirety.

[0006] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0007] This invention was made with government support under HL107205 and HL169510-01 awarded by National Institutes of Health. The government has certain rights in the invention.

[0008] SEQUENCE LISTING

[0009] The XML file named " 047162-7495W01(02520)_Seq Listing.xml " created on February702, 2025, comprising 2,051 bytes, is hereby incorporated by reference in its entirety.

[0010] BACKGROUND

[0011] Atherosclerotic plaque can enlarge and decrease artery lumen size to restrict blood flow through those vessel segments. Restricted blood flow due to atherosclerotic plaque is a major cause of pain and tissue dysfunction and can result in angina, heart failure or limb amputation. Medical treatments for plaques are limited to cholesterol reducing drugs, which act by slowing plaque growth. Stent implantation can be used to open arteries but such intervention is not suitable for addressing widespread atherosclerotic disease.

[0012] Atherosclerotic plaques are present in the vast majority of healthy adults without causing issues. One of the reasons is that the unaffected regions of the artery undergo outward remodeling to preserve lumen diameter as the plaques grow.

[0013] Multiple risk factors (e.g., age, smoking, diabetes, and so forth) impede the outward remodeling process, resulting in symptomatic disease caused by or associated with plaques. Patients with diabetes, for example, have high incidence of critical limb ischemia, which can result in non-healing ulcers and eventually limb amputation. There is a need for compositions and methods for reducing or eliminating impaired artery’ outward remodeling in the cases of atherosclerotic plaque, as well as treatments for diseases or disorders associated with ischemia caused by the impaired artery outward remodeling. The present invention addresses this need.

[0014] SUMMARY

[0015] In some aspects, the present invention is directed to the following non-limiting embodiments:

[0016] Method of promoting outward remodeling of blood vessel

[0017] In some aspects, the present invention is directed to a method of promoting outward remodeling of a blood vessel in a subject.

[0018] In some embodiments, the method comprising administering to the subject an effective amount of a compound that down regulates Smadl / 5 and / or BMP9 / 10.

[0019] In some embodiments, the outward remodeling of the blood vessel eliminates, reduces, and / or compensates for blood flow restriction or disruption in the blood vessel caused by a plaque.

[0020] In some embodiments, the compound downregulates a Smadl / 5 and / or BMP9 / 10 activity7and / or expression level.

[0021] In some embodiments, the compound downregulates Smadl / 5 and / or BMP9 / 10 in a vascular endothelial cell of the subject.

[0022] In some embodiments, the compound treats, ameliorates, and / or prevents a disease or disorder caused by or involving a plaque or a restricted or disrupted blood flow in the blood vessel.

[0023] In some embodiments, the disease or disorder comprises atherosclerosis, ischemia caused by narrowing of blood vessels, peripheral artery disease, angina, cerebral large artery disease, or critical limb ischemia.

[0024] In some embodiments, the compound comprises a small molecule inhibitor of Smadl / 5 and / or BMP9 / 10.

[0025] In some embodiments, the compound comprises a protein inhibitor of Smadl / 5 and / or BMP9 / 10.

[0026] In some embodiments, the compound comprises a nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity7and / or expression level by RNA interference. In some embodiments, the compound comprises a ribozyme that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level, and / or an expression vector expressing the ribozyme.

[0027] In some embodiments, the compound comprises an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by CRISPR knockout or CRISPR knockdown.

[0028] In some embodiments, the compound comprises a trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10, and / or an expression vector that expresses the trans- dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10.

[0029] In some embodiments, the compound comprises an antibody against BMP9 and / or BMP10.

[0030] In some embodiments, the antibody against BMP9 and / or BMP 10 blocks the activation of Smadl / 5 by BMP9 / 10.

[0031] In some embodiments, the subject is a diabetic subject.

[0032] In some embodiments, the subject is a mammal, optionally a human.

[0033] Method of treating, ameliorating, and / or preventing a disease or disorder

[0034] In some aspects, the present invention is directed to a method of treating, ameliorating, and / or preventing a disease or disorder.

[0035] In some embodiments, the disease or disorder is caused by or involving a plaque in the blood vessel.

[0036] In some embodiments, the method comprising administering to the subject an effective amount of a compound that downregulates Smadl / 5 and / or BMP9 / 10.

[0037] In some embodiments, the plaque restricts and / or disrupts blood flow in the blood vessel, thereby causing the disease or disorder.

[0038] In some embodiments, the disease or disorder comprises atherosclerosis, ischemia caused by narrowing of blood vessels, peripheral artery disease, angina, cerebral large artery disease, or a critical limb ischemia.

[0039] In some embodiments, the compound causes outwardly remodeling in the blood vessel which fully or partially restores a restriction or disruption of blood flow in the blood vessel caused by the plaque.

[0040] In some embodiments, the compound downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level. In some embodiments, the method downregulates Smadl / 5 and / or BMP9 / 10 in a vascular endothelial cell of the subject.

[0041] In some embodiments, the compound comprises a small molecule inhibitor of Smadl / 5 and / or BMP9 / 10.

[0042] In some embodiments, the compound comprises a protein inhibitor of Smadl / 5 and / or BMP9 / 10.

[0043] In some embodiments, the compound comprises a nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference.

[0044] In some embodiments, the compound comprises a ribozyme that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level, and / or an expression vector expressing the ribozyme.

[0045] In some embodiments, the compound comprises an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by CRISPR knockout or CRISPR knockdown.

[0046] In some embodiments, the compound comprises a trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10, and / or an expression vector that expresses the trans- dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10.

[0047] In some embodiments, the compound comprises an antibody against BMP9 and / or BMP10.

[0048] In some embodiments, the antibody against BMP9 and / or BMP 10 blocks the activation of Smadl / 5 by the BMP9 / 10.

[0049] In some embodiments, the subject is a diabetic subject.

[0050] In some embodiments, the subject is a mammal, optionally a human.

[0051] BRIEF DESCRIPTION OF THE DRAWINGS

[0052] The following detailed description of exemplary embodiments will be better understood w hen read in conjunction with the appended drawings. For the purpose of illustrating, non-limiting embodiments are shown in the drawings. It should be understood, however, that the instant specification is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0053] Figs. 1A-1F demonstrate that KLF2 mediates high FSS-induced Smadl / 5 suppression, in accordance with some embodiments. HUVECs transfected with Ctrl or KLF2 siRNA were subjected to FSS at the indicated magnitudes. Fig. 1A: At 12 h, Cells were fixed and stained for total Smadl. Scale bar, 25 pm. Fig. IB: The nucleus / cytoplasm intensity ratio of Smadl was quantified, n = 100 cells per group from three independent experiments. Fig. 1C: Immunostaining of p-Smadl / 5. Scale bar, 25 pm. Fig. ID: The nuclear intensity of Smadl / 5 was quantified (normalized to siCtrl 3 dynes cm2group), n = 100 cells for each group from three experiments. The dots represent values from individual cell, center line indicates median (50% percentile), whiskers indicate minimum to maximum, box bounds indicate interquartile range in Figs. IB and D. Fig. IE: HUVECs transfected with Ctrl and KLF2 siRNA were subjected to FSS at indicated magnitudes for 12 h. Western blotting for p- Smadl / 5 and total Smadl, n = 5 experiments. Western blots quantified in Fig. IF. Data are presented as mean ± s.e.m. Statistics calculated by two-way ANOVA with Sidak’s multiple comparison tests.

[0054] Figs. 2A-2H demonstrate that BMPER suppresses Smadl / 5 activation under high FSS, in accordance with some embodiments. Fig. 2A: HUVECs transfected with Ctrl or BMPER siRNA were subjected to FSS at indicated magnitudes for 12 h. Cells were fixed and stained for Smadl. Scale bar, 25 pm. Fig. 2B: The nucleus / cytoplasm intensity ratio of Smadl was quantified, n = 100 cells for each group from three experiments and the adjusted P value was calculated by two-way ANOVA with Sidak’s multiple comparison tests. Fig. 2C: Immunostaining of p-Smadl / 5. Scale bar, 25 pm. the nuclear intensity of Smadl / 5 was quantified (normalized to siCtrl 3 dynes cm2group), n = 100 cells for each group from three independent experiments. Figs. 2B & 2D: The dots represent values from individual cells, center line indicates median (50% percentile), whiskers indicate minimum to maximum and box bounds indicate interquartile range in Figs. 2B & 2D. Fig. 2E: HUVECs transfected with Ctrl or BMPER siRNA were subjected to FSS at indicated magnitudes for 12 h and analyzed by western blotting. Figs. 2F-2H: Quantification of p-Smadl / 5, total Smadl and BMPER, n = 5 experiments, data are presented as mean ± s.e.m. Statistics calculated by two-way ANOVA with Sidak’s multiple comparison tests.

[0055] Figs. 3A-3G illustrate the AVF model of high FSS-mediated outward remodeling, in accordance with some embodiments. Fig. 3A: A schematic of AVF model: the RCA was connected to the jugular vein through a branch. The blue double-headed arrows indicate the regions that were excised and sectioned. Figs. 3B-3C: H&E staining (Fig. 3B) and quantification of cross-sectional circumference from the RCA and LCA (Fig. 3C). Scale bar. 100 pm. Figs. 3D-3E: Immunostaining of BMPER (Fig. 3E) and quantification in the RCA and LCA, n = 6 mice (Fig. 3E). Scale bar, 25 gm. Figs. 3F-3G: P-Smadl / 5 staining (Fig. 3F) and quantification in the RCA and LCA, n = 6 mice (Fig. 3G). The arrowheads are the nuclei and p-Smadl / 5-positive area in artery ECs. Scale bar, 25 gm. Data are presented as mean ± s.d. Statistics calculated by two-tailed paired / -tests.

[0056] Figs. 4A-4F demonstrate that BMPER regulates Akt activation under high FSS, in accordance with some embodiments. Figs. 4A-4B: Immunostaining for Akt S473 phosphorylation (Fig. 4A) and quantification in the RCA and LCA sections from the AVF model, n = 6 mice, data are presented as mean ± s.e.m. (Fig. 4B). Scale bar, 25 pm. Figs. 4C- 4F: HUVECs transfected with Ctrl or BMPER siRNA were subjected to high FSS for 24 h. Akt S473 phosphorylation was assayed by immunostaining (Fig. 4C quantified in Fig. 4D) and western blotting (Fig. 4E quantified in Fig. 4F). Scale bar, 25 pm. In Fig. 4D, n = 60 cells for each group from three experiments; dots represent values from individual cell, center line indicates median (50% percentile), whiskers indicate minimum to maximum and box bounds indicate interquartile range. In Fig. 4F, n = 4 experiments, data are presented as mean± s.e.m. Statistics calculated by two-tailed unpaired / -tests (Fig. 4B) or two-way ANOVA with Tukey’s multiple comparison tests (Figs. 4D and 4F).

[0057] Figs. 5A-5F demonstrate that BMPER iECKO impairs blood flow recovery in the HLI model, in accordance with some embodiments. Fig. 5A: BMPERflox / flox;Cdh5-CreERT2 and Ctrl mice at 6 weeks were injected with tamoxifen. Fig. 5B: BMPER deletion was confirmed by qPCR analysis of isolated lung ECs, n = 3 mice per group, data are presented as mean ± s.e.m. Fig. 5C: BMPER immunostaining in carotid arteries (three mice per group were examined). Scale bar, 25 pm. Figs. 5D-5E: Representative images (Fig. 5D) and quantification (Fig. 5E) of blood flow recovery7from Ctrl and BMPER iECKO mice at indicated days, n = 8 mice per group, data are presented as mean ± s.e.m. Fig. 5F: Representative images and quantification of SMA staining of sections from ligated and Ctrl thighs, n = 8 mice per group, data are presented as mean ± s.e.m. Scale bar, 100 pm. Statistics calculated by two-tailed unpaired / -tests (Fig. 5B) or two-way ANOVA with Sidak’s multiple comparison tests (Figs. 5E and 5F).

[0058] Figs. 6A-6F demonstrate that BMPER iECKO blocks outward remodeling in the AVF model, in accordance with some embodiments. Figs. 6A-6B: H&E staining (Fig. 6A) and quantification of vessel circumference in the RCA and LCA (Fig. 6B). Scale bar, 100 pm. Figs. 6C-6D: Representative images (Fig. 6C) and quantification of BMPER staining in Ctrl and BMPER iECKO mice (Fig. 6D). Figs. 6E-6F: Representative images (Fig. 6E) and quantification of p-Smadl / 5 in Ctrl and BMPER iECKO mice (Fig. 6F). Scale bar, 25 pm (Figs. 6C and 6E). n = 6 mice per group (Figs. 6B, 6D and 6F). Arrowheads are the nuclei and BMPER or p-Smadl / 5 positive area in artery ECs. Data are presented as mean ± s.e.m. Statistics calculated by two-way ANOVA with Tukey’s multiple comparison tests.

[0059] Figs. 7A-7E demonstrate that BMP9 / 10 blocking Abs restore blood flow recovery in the BMPER iECKO HLI model, in accordance with some embodiments. Fig. 7A: Experiment timeline: 8-week-old mice were injected with tamoxifen on five consecutive days. At 10 weeks of age. the left femoral artery was ligated. BMP9 / 10 bAbs or IgG (2.5 mg kg ') were injected i.p. every week. Figs. 7B-7C: Representative images and quantification of blood flow recovery from Ctrl and BMPER iECKO mice treated with IgG or BMP9 / 10 bAbs at indicated days. Statistical comparisons: *BMPER iECKO + BMP9 / 10 bAbs versus BMPER iECKO + IgG, P < 0.05;#BMPER iECKO + IgG versus Ctrl + BMP9 / 10 bAbs, P < 0.05. Figs. 7D-7E: Representative images (Fig. 7D) and quantification of SMA staining of sections from ligated and control thighs (Fig. 7E). Scale bar, 100 pm. Data are presented as mean ± s.e.m. Statistics calculated by two-way ANOVA with Tukey’s (Fig. 7C) or Sidak’s (Fig. 7E) multiple comparison tests.

[0060] Figs. 8A-8J demonstrate thatBMP9 / 10 blocking Abs improve blood flow recovery and vascular remodeling in diabetic mice, in accordance with. Fig. 8A: Timeline for T1D experiment: 12- week -old mice were injected with STZ for five consecutive days. At 16 weeks, the left femoral artery was ligated. BMP9 / 10 bAbs or IgG (2.5 mg kg1) were injected i.p. every week. Figs. 8B-8C: Representative images (Fig. 8B) and quantification of blood flow recovery from IgG- or BMP9 / 10 bAbs-treated male (n = 4 per group) and female (n = 5 per group) mice at indicated days, data are presented as mean ± s.d. (Fig. 8C). Figs. 8D-8E: Representative images (Fig. 8D) and quantification of SMA staining of sections from ligated and control thighs, data are presented as mean ± s.e.m. (Fig. 8E). Fig. 8F: Timeline for T2D experiment: 12-w'eek-old mice were fed a 60 kcal% HFD for 8 weeks. The left femoral artery was ligated and BMP9 / 10 bAbs or IgG (2.5 mg kg1) was injected i.p. every week. Figs. 8G-8H: Representative images (Fig. 8G) and quantification of blood flow' recovery in IgG- or BMP9 / 10 bAbs-treated T2D male (n = 5 per group) and female (n = 5 per group) mice at indicated days, data are presented as mean ± s.d. (Fig. 8H). The gray dotted line with open circle symbol (Fig. 8H) blood flow recovery in control mice treated with isotype IgG (n = 5 mice per gender). Statistical comparisons: *T2D + BMP9 / 10 bAbs versus T2D + IgG; #T2D + BMP9 / 10 bAbs versus Ctrl + IgG. Figs. 8I-8J: Representative images (Fig. 81) and quantification of SMA staining of sections from ligated and control thighs, data are presented as mean ± s.e.m. (Fig. 8J). Scale bar, 100 pm. Statistics calculated by two-way ANOVA with Sidak’s multiple comparison tests.

[0061] Figs. 9A-9E demonstrate that KLF2 suppresses Smadl / 5 activation under high FSS in HAECs, in accordance with some embodiments. Figs. 9A-9C: Human aortic endothelial cells (HAECs) transfected with control or KLF2 siRNA were subjected to FSS at indicated magnitudes for 12 hours. KLF2 KD efficiency was confirmed by Q-PCR (Fig. 9A), n = 3 experiments, data are presented as means ± s.e.m. Cells were fixed and stained for Smadl. Nucleus / Cytoplasm intensity ratio of Smadl was quantified, n = 60 cells for each group from 3 experiments. Figs. 9D-9E: Immunostaining of phospho-Smadl / 5. Nuclear intensity of Smadl / 5 was quantified (normalized to siCtrl 3 dyn / cm2group), n = 60 cells for each group from 3 experiments. Scale bar: 25 pm. Dots represent values from individual cell; center line indicates median (50% percentile); whiskers indicate minimum to maximum; box bounds indicate interquartile range (Figs. 9C and 9E). Statistics were calculated by two-tailed unpaired t tests (Fig. 9A) or two-way ANOVA with Tukey’s multiple comparison tests (Fig. 9C and 9E). ns, not significant.

[0062] Figs. 10A-10E demonstrate that KLF2 regulates BMPER expression, in accordance with some embodiments. HUVECs were transfected with Ctrl (siCtrl) or KLF2 (siKLF2) siRNA for 4 days, total RNA was extracted and subjected to RNAseq, n = 4 samples for each group. Fig. 10A: Heatmap showing all differentially expressed genes between siCtrl and siKLF2. Fig. 10B: Volcano plot of log2 fold change against -loglO p-value (siKLF2 versus siCtrl). red showing differentially up-regulated genes (log2 fold change >1; p-value < 0.05), blue showing differentially down-regulated genes (log2 fold change <-l ; p-value < 0.05). Genes related to BMP-Smadl / 5 pathway are highlighted. Fig. 10C: Heatmap show7expression of genes relevant to the BMP-Smadl / 5 pathway. Fig. 10D: Q-PCR analysis of BMPER and KLF2 expression, with and without KLF2 KD under indicated FSS levels for 24 h, n = 7 experiments, data are presented as means ± s.e.m. Statistics calculated by two-way ANOVA with Sidak’s multiple comparison tests, ns, not significant. Fig. 10E: Analysis of KLF4 ChlP-seq dataset from endothelial cells in which constitutively active MEK5 (caMEK5) drove induction of KLF4. caMEK5 triggered increased binding of KLF4 to an intronic region within the BMPER gene, correlating with a near-consensus Klf2 / Klf4 motif. The KLF4 binding site correlated with other markers associated with active endothelial enhancer regions, including H3K27Ac and ERG binding. The rightmost sequence shown in Fig. 10E is AACATCCTACCAGGGTGGTCT (SEQ ID NO:1)

[0063] Figs. 11A-1 IE illustrate certain aspects of Smad7 knockdown in HUVECs. in accordance with some embodiments. Figs. 11A-11C: HUVECs transfected with control or Smad7 siRNA were subjected to FSS at indicated magnitudes for 12 hours. Smad7 knockdown efficiency was confirmed by Q-PCR (Fig. 11 A), n = 3 experiments, data are presented as means ± s.e.m. Cells were fixed and stained for Smadl. Nuclear / Cytoplasm intensity ratio of Smadl was quantified, n = 60 cells for each group from 3 experiments. Figs. 11D-11E: Immunostaining of phospho-Smadl / 5. Nucleus intensity of Smadl / 5 was quantified (normalized to siCtrl 3 dyn / cm2group), n = 60 cells for each group from 3 experiments. Scale bar: 25 pm. Dots represent values from individual cell; center line indicates median (50% percentile); whiskers indicate minimum to maximum; box bounds indicate interquartile range (Figs. 11C and HE). Statistics calculated by two-tailed unpaired t tests (Fig. 11 A) or two-way ANOVA with Tukey ’s multiple comparison tests (Figs. 11C and HE), ns, not significant.

[0064] Figs. 12A-12E illustrate certain aspects of Smad6 knockdown in HUVECs, in accordance with some embodiments. Figs. 12A-12C: HUVECs transfected with control or Smad6 siRNA were subjected to FSS at indicated magnitudes for 12 h. Smad6 knockdown efficiency was confirmed by Q-PCR (Fig. 12A), n = 3 experiments, data are presented as means ± s.e.m. Cells were fixed and stained for Smadl. Nucleus / Cytoplasm intensity ratio of Smadl was quantified, n = 60 cells for each group from 3 experiments. Figs. 12D-12E: Immunostaining of phospo-Smadl / 5. Nucleus intensity7of Smadl / 5 was quantified (normalized to siCtrl 3 dyn / cm2group), n = 60 cells for each group from 3 experiments, data showing all points from min to max. Scale bar: 25 pm. Dots represent values from individual cell; center line indicates median (50% percentile); whiskers indicate minimum to maximum; box bounds indicate interquartile range (Figs. 12C and 12E). Statistics calculated by tw o- tailed unpaired t tests (Fig. 12A) or two-way ANOVA with Tukey’s multiple comparison tests (Figs. 12C and 12E). ns, not significant.

[0065] Figs. 13A-13E demonstrate that BMPER mediates high FSS-induced Smadl / 5 suppression in HAECs, in accordance with some embodiments. Figs. 13A-13C: Human aortic endothelial cells (HAECs) transfected with control or BMPER siRNA were subjected to FSS at indicated magnitudes for 12 h. BMPER knockdown efficiency was confirmed by western blotting (Fig. 13A). Cells were fixed and stained for Smadl. Nucleus / Cytoplasm intensity ratio of Smadl was quantified, n = 60 cells for each group from 3 experiments. Figs. 13D- 13E: Immunostaining of phospo-Smadl / 5. Nucleus intensity of Smadl / 5 was quantified (normalized to siCtrl 3 dyn / cm2group), n = 60 cells for each group from 3 experiments. Scale bar: 25 pm. Dots represent values from individual cell; center line indicates median (50% percentile); whiskers indicate minimum to maximum; box bounds indicate interquartile range (Figs. 13C and 13E). Statistics calculated by two-way ANOVA with Tukey’s multiple comparison tests (Figs. 13C and 13E). ns, not significant.

[0066] Figs. 14A-14G show clip control and entire cross sections immunostaining for AVF model, in accordance with some embodiments. Figs. 14A-14B: H&E staining and quantification of vessel circumference in cross sections from LCA and RCA without anastomosis, n = 6 mice. Scale bar: 100 pm. Fig. 14C: Immunostaining of KLF4 and CD31 in the entire cross sections of RCA and LCA at day 3. Representative sections were from one out of six mice. Scale bar: 75 pm. Figs. 14D-14E: Higher magnification of KLF4 immunostaining and quantification in the RCA and LCA, n = 6 mice, data are presented as means ± s.e.m. Arrowheads indicate nuclei and KLF4 positive area in artery ECs. Scale bar: 25 pm. ns: not significant, statistics calculated by two-tailed paired t test. Fig. 14F: Representative immunostaining of BMPER and CD31 in the entire cross sections of RCA and LCA from BMPER iECKO and Control mice. Three mice per group were examined in this experiment. Fig. 14G: Representative immunostaining of p-Smadl / 5 and CD31 in the entire cross sections of RCA and LCA from BMPER iECKO and Control mice. Three mice per group were examined for this purpose. Scale bar: 75 pm.

[0067] Figs. 15A-15B illustrate certain aspects of the expression of angiogenic factors in BMPER iECKO mice with BMP9 / 10 Abs treatment, in accordance with some embodiments. BMPER iECKO and control mice at 12 weeks were subjected to HLI surgery and injected with BMP9 / 10 bAbs or IgG (2.5 mg / kg). At day 2 after Abs injection, gastrocnemius muscle in the calf from ligated side was collected and RNA was extracted for Q-PCR. Expression of Vegfa, Vegfc, Pdgfa, Pdgfb, Angptl and Angpt2 in BMPER iECKO mice with BMP9 / 10 bAbs or IgG treatment after HLI surgery, normalized to control mice with IgG. n = 5 mice per group. Data are presented as means ± s.e.m. Statistics calculated by one-way ANOVA with Tukey’s multiple comparison tests, ns, not significant.

[0068] Figs. 16A-16C illustrate certain aspects of blood glucose and CD31 immunostaining in T1D, in accordance with some embodiments. Fig. 16A: After fasting for 10 h, blood glucose was measured for vehicle and STZ-treated male (n = 8 per group) and female (n = 10 per group) mice. Data are presented as means ± s.d. Statistics calculated by two-tailed unpaired t test. Fig. 16B: Representative images and quantification of CD31 staining of calf muscle sections from IgG or BMP9 / 10 bAb treated T1D mice. Right, unligated; Left, ligated. n = 4 (male) or 5 (female), data are presented as means ± s.e.m. Scale bar: 75 pm. Fig. 16C: Higher magnification images of CD31 staining of calf muscle sections from IgG or BMP9 / 10 bAbs treated T1D mice. Four male and five female mice per group were examined for this purpose. Right, unligated; Left, ligated. Scale bar: 25 pm. Statistics calculated by two-way ANOVA with Tukey's multiple comparison tests, ns, not significant.

[0069] Figs. 17A-17B illustrate certain aspects of the Body weight and blood glucose in T2D, in accordance with some embodiments. Fig. 17A: Body weight was measured before and 8 weeks after HFD for male (n = 10 per group) and female (n = 10 per group) mice, data are presented as means ± s.e.m. Fig. 17B: After fasting for lOh, blood glucose was measured before and 8 weeks after HFD for male (n = 10 per group) and female (n = 10 per group) mice, data are presented as means ± s.d. Statistics calculated by two-tailed paired t test.

[0070] Figs. 18A-18G show immunostaining in T2D mice after BMP9 / 10 blocking Abs treatment and pathway diagram, in accordance with some embodiments. Figs. 18A-18B: Representative images and quantification of CD31 staining of calf muscle sections from IgG or BMP9 / 10 bAbs treated T2D mice. Scale bar: 75 pm. Figs. 18C-18D: Representative images and quantification of p-Akt S473 staining of thigh muscle sections from IgG or BMP9 / 10 bAbs treated T2D mice. Figs. 18E-18F: Representative images and quantification of BMPER staining of thigh muscle sections from IgG or BMP9 / 10 bAbs treated T2D mice Scale bar: 75 pm. Right, unligated; Left, ligated, n = 5 mice for both male and female, data are presented as means ± s.e.m. Statistics calculated by two-way ANOVA with Sidak’s multiple comparison tests, ns, not significant. Fig. 18G: Pathway diagram: high FSS suppresses Smadl / 5 activation through KLF2-dependent induction of BMPER, which derepresses Akt to enable vessel remodeling.

[0071] DETAILED DESCRIPTION

[0072] The following disclosure provides many different embodiments, or examples, for implementing different features of the provided subject matter. Specific examples of components and arrangements are described below to simplify the present disclosure. These are, of course, merely examples and are not intended to be limiting. For example, the formation of a first feature over or on a second feature in the description that follow s may include embodiments in which the first and second features are formed in direct contact, and may also include embodiments in which additional features may be formed between the first and second features, such that the first and second features may not be in direct contact. In addition, the present disclosure may repeat reference numerals and / or letters in the various examples. This repetition is for the purpose of simplicity and clarify and does not in itself dictate a relationship between the various embodiments and / or configurations discussed.

[0073] In the study described herein (‘'the present study”), it was discovered that the activation of Smadl / 5 in endothelial cells suppresses certain pathways that mediate outward artery’ remodeling. Smadl / 5 is activated in these cells by binding of circulating BMP9 and / or 10 to their receptors.

[0074] It was further discovered that down-regulating BMP 9 and / or 10 in subjects (such as by injecting mice with antibodies against BMP9 and / or 10) improved vessel remodeling under high flow. In type 1 and type 2 diabetic mice, the downregulation of BMP9 / 10 led to drastic improvements in the recovery from hindlimb ischemia, a model for peripheral artery disease.

[0075] Accordingly, in some aspects, the present invention is directed to a method of promoting outward remodeling in the blood vessel of a subject, such as outward remodeling to reduce or eliminate the effects of plaques.

[0076] In some aspects, the present invention is directed to a method of treating, ameliorating, and or preventing a disease or disorder caused by or involving insufficient outward remodeling in the blood vessel, such as insufficient outward remodeling in the blood vessel in response to plaques. Such diseases or disorders include atherosclerosis, ischemia caused by narrowing of blood vessels, peripheral artery disease, cerebral large artery disease, angina, and the like.

[0077] Definitions

[0078] As used herein, each of the following terms has the meaning associated with it in this section. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary’ skill in the art to which this disclosure belongs. Generally, the nomenclature used herein and the laboratory' procedures in animal pharmacology, pharmaceutical science, peptide chemistry’, and organic chemistry are those w ell-known and commonly employed in the art. It should be understood that the order of steps or order for performing certain actions is immaterial, so long as the present teachings remain operable. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety7, as though individually incorporated by reference.

[0079] In the application, where an element or component is said to be included in and / or selected from a list of recited elements or components, it should be understood that the element or component can be any one of the recited elements or components and can be selected from a group consisting of two or more of the recited elements or components.

[0080] In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.

[0081] In this document, the terms “a,” “an,” or “the” are used to include one or more than one unless the context clearly dictates otherwise. The term “or” is used to refer to a nonexclusive “or” unless otherwise indicated. The statement “at least one of A and B” or “at least one of A or B” has the same meaning as “A, B, or A and B.”

[0082] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, in certain embodiments ±5%, in certain embodiments ±1%, in certain embodiments ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0083] Abbreviations: Ab: antibody; AVF: arteriovenous fistula; bAb: blocking antibody; EC: endothelial cells; FSS: fluid shear stress; HLI: hindlimb ischemia; LCA: left carotid artery: LDI: Laser Doppler flow-imaging; PAD: peripheral artery' disease; RCA: right carotid artery; SMA: smooth muscle actin; STZ: streptozotocin; T1D: type 1 diabetes.

[0084] Method of Promoting Outward Remodeling in Blood Vessel

[0085] In some aspects, the present invention is directed to a method of promoting outward remodeling in a blood vessel in a subject.

[0086] In some embodiments, the blood vessel is an artery.

[0087] In some embodiments, the outward remodeling takes place near a plaque, such as an atherosclerotic plaque. In some embodiments, the outward remodeling eliminates, reduces, or compensates for a restriction of blood flow caused by the plaque.

[0088] In some embodiments, the outward remodeling treats, ameliorates and / or prevents a disease or disorder caused by or involving a plaque in the blood vessel, or a disease or disorder caused by or involving reduced and / or disrupted blood flow due to the plaque in the blood vessel. Non-limiting examples of such disease or disorder include atherosclerosis, ischemia caused by narrowing of blood vessels, peripheral artery disease, cerebral large artery’ disease, angina, critical limb ischemia, and the like.

[0089] In some embodiments, the method includes down-regulating a level (such as an expression level, a protein level, an mRNA level, a genomic DNA level / copy number, etc.) or an activity of Smad 1 and / or Smad5 in the subject, and / or a level or activity of BMP9 and / or BMP 10 in the subject.

[0090] In some embodiments, the level or activity of Smadl / 5 is down-regulated in a vascular endothelial cell , and / or BMP9 / 10 are dow nregulated in the circulation of the subject.

[0091] In some embodiments, the subject is a mammal, such as a human.

[0092] In some embodiments, the compound that downregulates the activity and / or expression level acts at the genomic level. For example, the expression level of Smadl / 5 and / or BMP9 / 10 can be down-regulated by gene knockout, such as CRISPR knockout and other knockout techniques.

[0093] In some embodiments, the compound that downregulates the activity and / or expression level acts at the transcriptional level or the translational level. For example, the expression level of Smadl / 5 and / or BMP9 / 10 can be down-regulated by gene knockdown, such as by RNA interference technique, ribozyme knockdown, or CRISPR knockdown.

[0094] In some embodiments, the compound that downregulates the activity and / or expression level acts at the post-translational level. For example, the expression level of Smadl / 5 and / or BMP9 / 10 can be down-regulated by targeted protein degradation, such as proteolysis-targeting chimera (PROTAC) and other protein degradation strategies. The activity of Smadl / 5 and / or BMP9 / 10 can be down-regulated by small molecules inhibitors of Smadl / 5 and / or BMP9 / 10, antibodies that neutralizes Smadl / 5 and / or BMP9 / 10, transdominant negative mutant of Smadl / 5 and / or BMP9 / 10, and the like.

[0095] In some embodiments, the compound that downregulates the activity and / or expression level includes a protein inhibitor of Smadl / 5 and / or BMP9 / 10, or a compound that downregulates the expression level and / or activity of Smadl / 5 and / or BMP9 / 10 by RNA interference, by ribozyme, by CRISPR knockout / knockdown. or by producing a transdominant negative mutant, and so forth.

[0096] In some embodiments, the compound contemplated herein can be delivered by a vector, such as a plasmid or a viral vector. One of ordinary skill in the art would understand that such vectors can be used to deliver compounds in the form of nucleic acids, such as RNA or DNA. Such vectors are described herein below;

[0097] Downregulating Smadl / 5 and / or BMP9 / 10 by Small Molecule Inhibitors

[0098] In some embodiments, the compound that downregulates the activity and / or expression level includes a small molecule that inhibits the activity of Smadl / 5 and / or BMP9 / 10. As used herein, the term "‘small molecule” refers to a molecule having a size of less than 2000, 1800, 1600, 1400, 1200, 1000, 800, or 600 daltons.

[0099] In some embodiments, the small molecule inhibitor comprises a PROTAC or a Proteolysis Targeting Chimeric Molecule. PROTACs are heterobifunctional nanomolecules that can target any protein for ubiquitination and degradation. In certain embodiments, the proteins contemplated in the present invention comprises a group that is recognized by the E3 ubiquitin ligase and a group that is recognized by Smadl / 5 and / or BMP9 / 10. The PROTAC is able to simultaneously bind to the protein herein and the E3 ligase. Formation of such trimeric complex formation leads to the transfer of ubiquitins to the proteins herein, marking it for degradation. PROTAC molecules possess good tissue distribution and the ability to target intracellular proteins, thus can be directly applied to cells or injected into animals without the use of vectors. PROTACS useful within the invention can be prepared using any known compound that binds to and / or recognizes and / or inhibits Smadl / 5, which is linked through a linker to an E3 ubiquitin ligase, such as but not limited to those described in WO 2013 / 106643, WO 2013 / 106646, and WO 2019 / 148055.

[0100] Downregulating Smadl / 5 and / or BMP9 / 10 by Protein Inhibitors of Smadl / 5 and / or BMP9 / 10

[0101] In some embodiments, the compound that downregulates the activity and / or expression level includes a protein that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level.

[0102] It is w orth noting that, since BMP9 / 10 are extracellular proteins in circulation, the administration of antibodies against BMP9 / 10 to downregulate BMP9 / 10 is especially convenient.

[0103] The term “antibody” or “Ab” or “immunoglobulin” are terms of art and can be used interchangeably and refer to a protein, or polypeptide sequence which is or is derived from an immunoglobulin molecule having at least one antigen binding site which specifically binds to a specific epitope on an antigen (See, e.g.. Harlow et al., 1998, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al.. 1988, Science 242:423-426). Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. The antibodies useful in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, synthetic antibodies, tetrameric antibodies comprising two heavy chain and two light chain molecules, an antibody light chain monomer, an antibody heavy chain monomer, an antibody light chain dimer, an antibody heavy chain dimer, an antibody light chain-antibody heavy chain pair, intrabodies, heteroconjugate antibodies, single domain antibodies, monovalent antibodies, single chain antibodies or single chain Fv (scFv), nanobodies, intracellular antibodies, intrabodies, camelized antibodies, camelid antibodies, IgNAR antibodies, affybodies, Fab fragments, F(ab’) fragments, F(ab)2, disulfide-linked Fvs (sdFv), anti-idiotypic (anti-Id) antibodies (including, e.g., anti-anti-Id antibodies), and antigen-binding fragments of any of the above. Antibodies can be of any type (e.g., IgG, IgE, IgM, IgD, IgA or IgY), any class, (e.g., IgGl, IgG2, IgG3, IgG4, IgAl or IgA2), or any subclass (e.g., IgG2a or IgG2b) of immunoglobulin molecule. In certain embodiments, antibodies described herein are IgG antibodies, or a class (e.g.. human IgGl or IgG4) or subclass thereof. Full-length antibodies are sometimes tetramers comprising two heavy chain and two light chain immunoglobulin molecules.

[0104] Certain antibodies against SmadI / 5 and BMP9 / 10 are available commercially. For example, non-limiting examples of antibodies against Smadl include 38-5400 and 12H1L14 available from Invitrogen (Waltham, MA, USA). H00004086-M03 and H00004086-M02 available from Novus Biologicals (Centennial, CO, USA), ABIN393407 and ABIN393492 available from antibodies-online Inc. (Pottstown, PA, USA), as well as any humanized derivatives thereof.

[0105] Non-limiting examples of antibodies against Smad5 include 39-5700 available from Invitrogen (Waltham, MA, USA), ABIN969404 and ABIN 1846564 available from antibodies-online Inc. (Pottstown, PA, USA), GTX60384 and GTX49219 available from Genetex (Irvine, CA, USA), as well as any humanized derivatives thereof.

[0106] Non-limiting examples of antibodies against BMP9 include MAB3209-100 and BAF3209 available from R&D Systems (Minneapolis, MN. USA). ABIN2839135 and ABIN2159559 available from antibodies-online Inc. (Pottstown, PA, USA), LS-C97992 and ES-C402642 available from Eifespan Biosciences (Lynnwood, WA, USA), as well as any humanized derivatives thereof.

[0107] Non-limiting examples of antibodies against BMP 10 include MAB2926-100. MAB2926, MAB6038, AF3956 and BAF3956 available from R&D Systems (Minneapolis, MN, USA), GTX108409 and GTX52564 available from GeneTex (Irvine, CA, USA), as well as any humanized derivatives thereof.

[0108] In some embodiments, the protein that downregulates the expression level and / or activity of Smadl / 5 and / or BMP9 / 10 is administered in form of a protein. In some embodiments, the protein that downregulates the expression level and / or activity of Smadl / 5 and / or BMP9 / 10 is administered in form of a nucleic acid that expresses the protein, such as an expression vector. The expression vector is described in the ‘"Vector’ section elsewhere in the present disclosure.

[0109] Downregulating Smadl / 5 and / or BMP9 / 10 by RNA Interference

[0110] In some embodiments, the compound that downregulates the activity and / or expression level of Smadl / 5 and / or BMP9 / 10 includes a nucleic acid that downregulates the activity’ and / or expression level of Smadl / 5 and / or BMP9 / 10 by the means of RNA interreference.

[0111] In some embodiments, the nucleic acid that downregulates the expression level of Smadl / 5 and / or BMP9 / 10 by the means of RNA interreference includes an isolated nucleic acid. In other embodiments, the modulator is an RNAi molecule (such as but not limited to siRNA and / or shRNA and / or miRNAs) or antisense molecule, which inhibits Smadl / 5 and / or BMP9 / 10 expression and / or activity. In yet other embodiments, the nucleic acid comprises a promoter / regulatory sequence, such that the nucleic acid is preferably capable of directing expression of the nucleic acid. Thus, the present disclosure provides expression vectors and methods for the introduction of exogenous DNA into cells with concomitant expression of the exogenous DNA in the cells such as those described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (1997, Current Protocols in Molecular Biology', John Wiley & Sons, New York) and as described elsewhere herein.

[0112] In certain embodiments, siRNA is used to decrease the level of Smadl / 5 and / or BMP9 / 10. RNA interference (RNAi) is a phenomenon in which the introduction of doublestranded RNA (dsRNA) into a diverse range of organisms and cell types causes degradation of the complementary mRNA. In the cell, long dsRNAs are cleaved into short 21-25 nucleotide small interfering RNAs, or siRNAs, by a ribonuclease known as Dicer. The siRNAs subsequently assemble with protein components into an RNA-induced silencing complex (RISC), unwinding in the process. Activated RISC then binds to complementary transcript by base pairing interactions between the siRNA antisense strand and the mRNA. The bound mRNA is cleaved and sequence specific degradation of mRNA results in gene silencing. See, for example, U.S. Patent No. 6,506,559; Fire et al., 1998, Nature 391(19):306- 311; Timmons et al., 1998, Nature 395:854; Montgomery et al., 1998, TIG 14 (7):255-258; Engelke, Ed., RNA Interference (RNAi) Nuts & Bolts of RNAi Technology, DNA Press, Eagleville, PA (2003); and Hannon, Ed., RNAi A Guide to Gene Silencing, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2003). Soutschek et al. (2004, Nature 432: 173-178) describes a chemical modification to siRNAs that aids in intravenous systemic delivery. Optimizing siRNAs involves consideration of overall G / C content, C / T content at the termini, Tm and the nucleotide content of the 3’ overhang. See, for instance, Schwartz et al., 2003, Cell, 115: 199-208 and Khvorova etal., 2003, Cell 115:209-216. Therefore, the present disclosure also includes methods of decreasing levels of Smadl / 5 and / or BMP9 / 10 using RNAi technology.

[0113] In certain embodiments, the present disclosure provides a vector comprising an siRNA or antisense polynucleotide. In other embodiments, the siRNA or antisense polynucleotide inhibits the expression Smadl / 5 and / or BMP9 / 10. The incorporation of a desired polynucleotide into a vector and the choice of vectors is well-known in the art.

[0114] In certain embodiments, the expression vectors described herein encode a short hairpin RNA (shRNA) inhibitor. shRNA inhibitors are well known in the art and are directed against the mRNA of a target, thereby decreasing the expression of the target. In certain embodiments, the encoded shRNA is expressed by a cell, and is then processed into siRNA. For example, in certain instances, the cell possesses native enzymes (e g., dicer) that cleaves the shRNA to form siRNA.

[0115] The siRNA, shRNA, or antisense polynucleotide can be cloned into a number of types of vectors as described elsewhere herein. For expression of the siRNA or antisense polynucleotide, at least one module in each promoter functions to position the start site for RNA synthesis.

[0116] In order to assess the expression of the siRNA, shRNA, or antisense polynucleotide, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected using a viral vector. In certain embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers are known in the art and include, for example, antibiotic-resistance genes. such as neomycin resistance and the like.

[0117] Following the generation of the siRNA polynucleotide, a skilled artisan will understand that the siRNA polynucleotide has certain characteristics that can be modified to improve the siRNA as a therapeutic compound. Therefore, in some embodiments, the siRNA polynucleotide is further designed to resist degradation by modifying it to include phosphorothioate, or other linkages, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate. phosphate esters, and the like (see, e.g., Agrwal et al., 1987, Tetrahedron Lett. 28:3539-3542; Stec et al., 1985 Tetrahedron Lett. 26:2191-2194; Moody et al., 1989 Nucleic Acids Res. 12:4769-4782; Eckstein, 1989 Trends Biol. Sci. 14:97-100; Stein, In: Oligodeoxynucleotides. Antisense Inhibitors of Gene Expression, Cohen, ed.. Macmillan Press, London, pp. 97-117 (1989)).

[0118] Any polynucleotide may be further modified to increase its stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5 ’ and / or 3’ ends; the use of phosphorothioate or 2’ O-methyl rather than phosphodiester linkages in the backbone; and / or the inclusion of nontraditional bases such as inosine, queosine, and wybutosine and the like, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine, and uridine.

[0119] In certain embodiments, an antisense nucleic acid sequence expressed by a plasmid vector is used to inhibit SmadI / 5 and / or BMP9 / 10 protein expression. The antisense expressing vector is used to transfect a mammalian cell or the mammal itself, thereby causing reduced endogenous expression of Smadl / 5 and / or BMP9 / 10.

[0120] Antisense molecules and their use for inhibiting gene expression are well known in the art (see, e.g., Cohen, 1989, In: Oligodeoxyribonucleotides, Antisense Inhibitors of Gene Expression, CRC Press). Antisense nucleic acids are DNA or RNA molecules that are complementary, as that term is defined elsewhere herein, to at least a portion of a specific rnRNA molecule (Weintraub, 1990, Scientific American 262:40). In the cell, antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule thereby inhibiting the translation of genes.

[0121] The use of antisense methods to inhibit the translation of genes is known in the art. and is described, for example, in Marcus-Sakura (1988, Anal. Biochem. 172:289). Such antisense molecules may be provided to the cell via genetic expression using DNA encoding the antisense molecule as taught by Inoue. 1993, U.S. Patent No. 5,190,931.

[0122] Alternatively, antisense molecules of the present disclosure may be made synthetically and then provided to the cell. Antisense oligomers of between about 10 to about 30, and more preferably about 15 nucleotides, are preferred, since they are easily synthesized and introduced into a target cell. Synthetic antisense molecules contemplated by the present disclosure include oligonucleotide derivatives known in the art which have improved biological activity compared to unmodified oligonucleotides (see U.S. Patent No. 5,023,243).

[0123] Downregulating Smadl / 5 and / or BMP9 / 10 by Ribozyme

[0124] In some embodiments, the compound that downregulates the activity or expression level of Smadl / 5 and / or BMP9 / 10 includes a ribosome that inhibits Smadl / 5 and / or BMP9 / 10 protein expression.

[0125] A ribozyme is used to inhibit Smadl / 5 and / or BMP9 / 10 protein expression. Ribozymes useful for inhibiting the expression of a target molecule may be designed by incorporating target sequences into the basic ribozyme structure which are complementary, for example, to the mRNA sequence encoding Smadl / 5 and / or BMP9 / 10. Ribozymes are antisense RNAs which have a catalytic site capable of specifically cleaving complementary RNAs. Therefore, ribozymes having sequence complementary to Smadl / 5 and / or BMP9 / 10 mRNA sequences are capable of downregulating the expression of Smadl / 5 and / or BMP9 / 10 by reduces the level of Smadl / 5 and / or BMP9 / 10 mRNA. Ribozy mes targeting Smadl / 5 and / or BMP9 / 10, may be synthesized using commercially available reagents (Applied Biosystems, Inc., Foster City, CA) or they may be genetically expressed from DNA encoding them. In some embodiments, the DNA encoding the ribozymes are incorporated in a vector, which is described in the “Vector” section elsewhere in the present disclosure.

[0126] Downregulating Smadl / 5 and / or BMP9 / 10 by CRISPR Knockout / Knockdown and Other Knockouts / Knockdown Techniques

[0127] In some embodiments, the compound that downregulates the activity or expression level of Smadl / 5 and / or BMP9 / 10 comprises a nucleic acid that downregulates the expression level of Smadl / 5 and / or BMP9 / 10 by the means of CRISPR knockout.

[0128] In some embodiments, the compound downregulates the activity or expression level of Smadl / 5 and / or BMP9 / 10 comprises a CRISPR / Cas9 system for knocking out Smadl / 5 and / or BMP9 / 10.

[0129] The CRISPR / Cas9 system is a facile and efficient system for inducing targeted genetic alterations. Target recognition by the Cas9 protein requires a “seed” sequence within the guide RNA (gRNA) and a conserved di -nucleotide containing protospacer adjacent motif (PAM) sequence upstream of the gRNA-binding region. The CRISPR / Cas9 system can thereby be engineered to cleave virtually any DNA sequence by redesigning the gRNA in cell lines (such as 293T cells), primary cells, and CAR T cells. The CRISPR / Cas9 system can simultaneously target multiple genomic loci by co-expressing a single Cas9 protein with two or more gRNAs, making this system uniquely suited for multiple gene editing or synergistic activation of target genes.

[0130] The Cas9 protein and guide RNA form a complex that identifies and cleaves target sequences. Cas9 is comprised of six domains: REC I, REC IE Bridge Helix, PAM interacting, HNH, and RuvC. The Reel domain binds the guide RNA, while the Bridge helix binds to target DNA. The HNH and RuvC domains are nuclease domains. Guide RNA is engineered to have a 5’ end that is complementary' to the target DNA sequence. Upon binding of the guide RNA to the Cas9 protein, a conformational change occurs activating the protein. Once activated, Cas9 searches for target DNA by binding to sequences that match its protospacer adjacent motif (PAM) sequence. A PAM is a two or three nucleotide base sequence within one nucleotide dow nstream of the region complementary to the guide RNA. In one nonlimiting example, the PAM sequence is 5’-NGG-3’. When the Cas9 protein finds its target sequence with the appropriate PAM. it melts the bases upstream of the PAM and pairs them with the complementary region on the guide RNA. Then the RuvC and HNH nuclease domains cut the target DNA after the third nucleotide base upstream of the PAM.

[0131] One non-limiting example of a CRISPR / Cas system used to inhibit gene expression, CRISPRi, is described in U.S. Patent Appl. Publ. No. US2014 / 0068797. CRISPRi induces permanent gene disruption that utilizes the RNA-guided Cas9 endonuclease to introduce DNA double stranded breaks which trigger error-prone repair pathways to result in frame shift mutations. A catalytically dead Cas9 lacks endonuclease activity'. When coexpressed with a guide RNA. a DNA recognition complex is generated that specifically interferes with transcriptional elongation, RNA polymerase binding, or transcription factor binding. This CRISPRi system efficiently represses expression of targeted genes.

[0132] CRISPR / Cas gene disruption occurs when a guide nucleic acid sequence specific for a target gene and a Cas endonuclease are introduced into a cell and form a complex that enables the Cas endonuclease to introduce a double strand break at the target gene. In certain embodiments, the CRISPR / Cas system comprises an expression vector, such as, but not limited to, an pAd5F35-CRISPR vector. In other embodiments, the Cas expression vector induces expression of Cas9 endonuclease. Other endonucleases may also be used, including but not limited to, T7, Cas3, Cas8a, Cas8b, CaslOd. Csel, Csyl, Csn2, Cas4. CaslO. Csm2, Cmr5, Fokl, other nucleases known in the art, and any combinations thereof. In certain embodiments, inducing the Cas expression vector comprises exposing the cell to an agent that activates an inducible promoter in the Cas expression vector. In such embodiments, the Cas expression vector includes an inducible promoter, such as one that is inducible by exposure to an antibiotic (e.g., by tetracycline or a derivative of tetracycline, for example doxycycline). However, it should be appreciated that other inducible promoters can be used. The inducing agent can be a selective condition (e.g., exposure to an agent, for example an antibiotic) that results in induction of the inducible promoter. This results in expression of the Cas expression vector.

[0133] The guide RNA is specific for a genomic region of interest and targets that region for Cas endonuclease-induced double strand breaks. The target sequence of the guide RNA sequence may be within a loci of a gene or within a non-coding region of the genome. In certain embodiments, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length.

[0134] Guide RNA (gRNA), also referred to as “short guide RNA" or “sgRNA”. provides both targeting specificity and scaffolding / binding ability for the Cas9 nuclease. The gRNA can be a synthetic RNA composed of a targeting sequence and scaffold sequence derived from endogenous bacterial crRNA and tracrRNA. gRNA is used to target Cas9 to a specific genomic locus in genome engineering experiments. Guide RNAs can be designed using standard tools well known in the art.

[0135] In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have some complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity’ is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In certain embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In other embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or nucleus. Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e g., within about 1, 2, 3, 4, 5, 6. 7, 8, 9, 10, 20, 50 or more base pairs) the target sequence. As with the target sequence, it is believed that complete complementarity is not needed, provided this is sufficient to be functional. In certain embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell, such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5’ with respect to (“upstream’" of) or 3’ with respect to (“downstream” of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In certain embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzy me and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g.. each in a different intron, two or more in at least one intron, or all in a single intron).

[0136] In certain embodiments, the CRISPR enzy me is part of a fusion protein comprising one or more heterologous protein domains (e.g. about or more than about 1, 2, 3, 4, 5, 6, 7. 8, 9, 10, or more domains in addition to the CRISPR enzyme). A CRISPR enzyme fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity' and nucleic acid binding activity'. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in U.S. Patent Appl. Publ. No. US20110059502, incorporated herein by reference. In certain embodiments, a tagged CRISPR enzyme is used to identify the location of a target sequence.

[0137] Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian and non-mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after deliver}7to the cell (Anderson, 1992, Science 256:808-813; and Yu, et al., 1994, Gene Therapy 1 : 13-26).

[0138] In certain embodiments, the CRISPR / Cas is derived from a type II CRISPR / Cas system. In other embodiments, the CRISPR / Cas system is derived from a Cas9 protein. The Cas9 protein can be from Streptococcus pyogenes. Streptococcus thermophilus, or other species.

[0139] In general, Cas proteins comprise at least one RNA recognition and / or RNA binding domain. RNA recognition and / or RNA binding domains interact with the guiding RNA. Cas proteins can also comprise nuclease domains (i.e., DNase or RNase domains), DNA binding domains, helicase domains, RNAse domains, protein-protein interaction domains, dimerization domains, as well as other domains. The Cas proteins can be modified to increase nucleic acid binding affinity and / or specificity, alter an enzymatic activity, and / or change another property of the protein. In certain embodiments, the Cas-like protein of the fusion protein can be derived from a wild type Cas9 protein or fragment thereof. In other embodiments, the Cas can be derived from modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein can be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, and so forth) of the protein. Alternatively, domains of the Cas9 protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified Cas9 protein is smaller than the wild type Cas9 protein. In general, a Cas9 protein comprises at least two nuclease (i.e., DNase) domains. For example, a Cas9 protein can comprise a RuvC-like nuclease domain and a HNH-like nuclease domain. The RuvC and HNH domains work together to cut single strands to make a double-stranded break in DNA. (Jinek, et al., 2012, Science, 337:816-821). In certain embodiments, the Cas9-derived protein can be modified to contain only one functional nuclease domain (either a RuvC-like or a HNH-like nuclease domain). For example, the Cas9-derived protein can be modified such that one of the nuclease domains is deleted or mutated such that it is no longer functional (i.e., the nuclease activity is absent). In some embodiments in which one of the nuclease domains is inactive, the Cas9-derived protein is able to introduce a nick into a doublestranded nucleic acid (such protein is termed a "nickase"), but not cleave the double-stranded DNA. In any of the above-described embodiments, any or all of the nuclease domains can be inactivated by one or more deletion mutations, insertion mutations, and / or substitution mutations using well-known methods, such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis, as well as other methods known in the art.

[0140] In one non-limiting embodiment, a vector drives the expression of the CRISPR system. The art is replete with suitable vectors that are useful in the present disclosure. The vectors to be used are suitable for replication and, optionally, integration in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence. The vectors of the present disclosure may also be used for nucleic acid standard gene delivery protocols. Methods for gene deliver}' are known in the art (U.S. Patent Nos. 5,399,346, 5,580,859 & 5,589,466, incorporated by reference herein in their entireties).

[0141] Further, the vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (4th Edition, Molecular Cloning: A Laboratory' Manual, Cold Spring Harbor Laboratory, New York, 2012), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, Sindbis virus, gammaretrovirus and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326.193).

[0142] In some embodiments, the compound that downregulates the activity or expression level of Smadl / 5 and / or BMP9 / 10 comprises a nucleic acid that downregulates the expression level of Smadl / 5 and / or BMP9 / 10 by the means of CRISPR knockdown. CRISPR knockdown includes, but not limited to, CRISPRCasl3 knockdown. (See e.g., Mendez- Mancilla et al.. Cell Chemical Biology 29, 1-7, 2021 Jul 27, and Kushawah et al., Dev Cell. 2020 Sep 28;54(6): 805-817. The entireties of which are incorporated herein by reference).

[0143] In some embodiments, the present invention includes any other methods for effecting gene knockdown and / editing, which allow' for deletion and / or inactivation of PDL3, such as but not limited to those described in WO 2018 / 236840 (which is incorporated herein in its entirety by reference).

[0144] Downregulating Smadl / 5 and / or BMP9 / 10 by Inactivating and / or Sequestering

[0145] In some embodiments, the compound that downregulates the activity or expression level of Smadl / 5 and / or BMP9 / 10 includes a protein that downregulates the activity of Smadl / 5 and / or BMP9 / 10 by inactivating and / or sequestering Smadl / 5 and / or BMP9 / 10. In some embodiment, the compound includes a nucleic acid that express the protein that downregulates the activity of Smadl / 5 and / or BMP9 / 10 by inactivating and / or sequestering Smadl / 5 and / or BMP9 / 10. In some embodiments, the compound includes an expression vector that express the protein that downregulates the activity of Smadl / 5 and / or BMP9 / 10 by inactivating and / or sequestering Smadl / 5 and / or BMP9 / 10 (see “Vector” section for descriptions on vectors).

[0146] In some embodiments, the compound that downregulates the expression level of Smadl / 5 and / or BMP9 / 10 is atrans-dominant negative mutant of Smadl / 5 and / or BMP9 / 10, and / or a nucleic acid or a vector expressing the trans-dominant negative mutant of Smadl / 5 and / or BMP9 / 10.

[0147] Method of Treating, Ameliorating, and / or Preventing Diseases / Disorders

[0148] In some aspects, the present invention is directed to a method of treating, ameliorating, and / or preventing a disease or a disorder in a subject in need thereof. In some embodiments, the disease or a disorder is caused by or involving the inability or reduced ability to outwardly remodel blood vessel in response to a plaque in the blood vessel. In some embodiments, the subject is a mammal, such as a human.

[0149] In some embodiments, the disease or disorder include atherosclerosis, ischemia caused by narrowing of blood vessels, critical limb ischemia, angina, cerebral large artery disease, and / or peripheral artery disease (such as in diabetics).

[0150] In some embodiments, the method includes administering to the subject an effective amount of a compound that down-regulates Smadl / 5 and / or BMP9 / 10, such as a level or an activity thereof. In some embodiments, the compound that down-regulates Smadl / 5 and / or BMP9 / 10 is the same as or similar to those described elsewhere herein, such as in the “Method of Promoting Outward Remodeling in Blood Vessel” section.

[0151] Vectors

[0152] Vectors can increase the stability of the nucleic acids, make the delivery’ easier, or allow the expression of the nucleic acids or protein products thereof in the cells.

[0153] Therefore, in some embodiments, the protein inhibitors or the nucleic acids that that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level is incorporated into a vector.

[0154] In some embodiments, the present disclosure relates to a vector, including the nucleic acid sequence of the present disclosure or the construct of the present disclosure. The choice of the vector will depend on the host cell in which it is to be subsequently introduced. In certain embodiments, the vector of the present disclosure is an expression vector. Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. In certain embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector and a mammalian cell vector. Prokary ote- and / or eukary ote-vector based systems can be employed for use with the present disclosure to produce polynucleotide, or their cognate polypeptides. Many such systems are commercially and widely available.

[0155] In some embodiments, the vector is a viral vector. Viral vector technology is well known in the art and is described, for example, in virology7and molecular biology7manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. (See, e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193.

[0156] In some embodiments, the viral vector is a suitable adeno-associated virus (AAV), such as the AAV1-AAV8 family of adeno-associated viruses. In some embodiments, the viral vector is a viral vector that can infect a human. The desired nucleic acid sequence, such as the nucleic acids that downreg ulates Smadl / 5 and / or BMP9 / 10 described above, can be inserted between the inverted terminal repeats (ITRs) in the AAV. In various embodiments, the viral vector is an AAV2 or an AAV8. The promoter can be a thyroxine binding globulin (TBG) promoter. In various embodiments, the promoter is a human promoter sequence that enables the desired nucleic acid expression in the vascular endothelial cells. In some embodiments, the promoter is a vascular endothelium-selective promoter. The AAV can be a recombinant AAV, in which the capsid comes from one AAV serotype and the ITRs come from another AAV serotype. In various embodiments, the AAV capsid is selected from the group consisting of a AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, and a AAV8 capsid. In various embodiments, the ITR in the AAV is at least one ITR selected from the group consisting of a AAV1, AAV2, AAV3. AAV4. AAV5, AAV6, AAV7, and an AAV8 ITR. In various embodiments, the present disclosure contemplates an AAV 8 viral vector (recombinant or non-recombinant) containing a desired nucleic acid expression sequence and at least one promoter sequence that, when administered to a subject, causes elevated systemic expression of the desired nucleic acid. In some embodiments, the viral vector is a recombinant or non-recombinant AAV2 or AAV5 containing any of the desired nucleic acid expression sequences described herein. In some embodiments, the vector in which the nucleic acid sequence is introduced is a plasmid that is or is not integrated in the genome of a host cell when it is introduced in the cell. Illustrative, non-limiting examples of vectors in which the nucleotide sequence of the present disclosure or the gene construct of the present disclosure can be inserted include a tet- on inducible vector for expression in eukaryote cells.

[0157] The vector may be obtained by conventional methods known by persons skilled in the art. In certain embodiments, the vector is a vector useful for transforming animal cells.

[0158] In certain embodiments, the recombinant expression vectors may also contain nucleic acid molecules which encode a peptide or peptidomimetic inhibitor of the present disclosure, described elsewhere herein.

[0159] A promoter may be one naturally associated with a gene or polynucleotide sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and / or exon. Such a promoter can be referred to as “endogenous.” Similarly, an enhancer may be one naturally associated with a polynucleotide sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding polynucleotide segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a polynucleotide sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a polynucleotide sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not “naturally occurring,” i.e., containing different elements of different transcriptional regulatory regions, and / or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and / or nucleic acid amplification technology7, including PCR™, in connection with the compositions disclosed herein (U.S. Patent No. 4,683,202. U.S. Patent No. 5,928,906). Furthermore, it is contemplated the control sequences that direct transcription and / or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.

[0160] It will be important to employ a promoter and / or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. Those of skill in the art of molecular biology generally know how to use promoters, enhancers, and cell type combinations for protein expression. The promoters employed may be constitutive, tissue-specific, inducible, and / or useful under the appropriate conditions to direct high-level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and / or peptides. The promoter may be heterologous or endogenous.

[0161] The recombinant expression vectors may also contain a selectable marker gene which facilitates the selection of transformed or transfected host cells. Suitable selectable marker genes are genes encoding proteins such as G418 and hygromycin which confer resistance to certain drugs, 0-galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin preferably IgG. The selectable markers may be introduced on a separate vector from the nucleic acid of interest.

[0162] Combination Therapies

[0163] In some embodiments, the method of treating, ameliorating, and / or preventing the inability or reduced ability to outwardly remodel blood vessel in response to a plaque or the associated diseases or disorders includes administering to the subject the effective amount of at least one compound and / or composition contemplated within the disclosure.

[0164] In some embodiments, the composition for treating vascular the condition herein and associated diseases / disorders includes at least one compound and / or composition contemplated within the disclosure.

[0165] In some embodiments, the subject is further administered at least one additional agent that treats, ameliorates, and / or prevents a disease and / or disorder contemplated herein. In other embodiments, the compound and the at least one additional agent are co-administered to the subject. In yet other embodiments, the compound and the at least one additional agent are co-formulated.

[0166] For example, atherosclerosis is treatable by statin and other cholesterol medications, anticoagulant, stenting, and coronary bypass surgery’. Such existing treatments can be combined with the compounds herein

[0167] The compounds contemplated within the disclosure are intended to be useful in combination with one or more additional compounds. These additional compounds may comprise compounds of the present disclosure and / or at least one additional agent for treating one or more diseases or disorders contemplated herein.

[0168] A synergistic effect may be calculated, for example, using suitable methods such as, for example, the Sigmoid-Emax equation (Holford & Scheiner, 1981. Clin. Pharmacokinet. 6:429-453), the equation of Loewe additivity (Loewe & Muischnek, 1926, Arch. Exp. Pathol Pharmacol. 1 14:313-326) and the median-effect equation (Chou & Talalay, 1984, Adv. Enzyme Regul. 22:27-55). Each equation referred to above may be applied to experimental data to generate a corresponding graph to aid in assessing the effects of the drug combination. The corresponding graphs associated with the equations referred to above are the concentration-effect curve, isobologram curve and combination index curve, respectively.

[0169] Administration / Dosage / Formulations

[0170] The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations contemplated within the disclosure may be administered to the subject either prior to or after the onset of a disease and / or disorder contemplated herein. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations contemplated within the disclosure may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.

[0171] Administration of the compositions contemplated within the disclosure to a patient, preferably a mammal, more preferably a human, may be carried out using known procedures, at dosages and for periods of time effective to treat a disease and / or disorder contemplated herein in the patient. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound contemplated within the disclosure to treat a disease and / or disorder contemplated herein in the patient. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A nonlimiting example of an effective dose range for a therapeutic compound contemplated within the disclosure is from about 1 and 5.000 mg / kg of body weight / per day. One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation.

[0172] Actual dosage levels of the active ingredients in the pharmaceutical compositions contemplated within the disclosure may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient. composition, and mode of administration, without being toxic to the patient.

[0173] In particular, the selected dosage level depends upon a variety of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well, known in the medical arts.

[0174] A medical doctor, e g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds contemplated within the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

[0175] In particular embodiments, it is especially advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The dosage unit forms contemplated within the disclosure are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such a therapeutic compound for the treatment of a disease and / or disorder contemplated herein.

[0176] In certain embodiments, the compositions of the disclosure are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions of the disclosure comprise a therapeutically effective amount of a compound of the disclosure and a pharmaceutically acceptable carrier.

[0177] The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, sodium chloride, or poly alcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.

[0178] In certain embodiments, the compositions of the disclosure are administered to the patient in dosages that range from one to five times per day or more. In another embodiment, the compositions of the disclosure are administered to the patient in range of dosages that include, but are not limited to, once every day, every two, days, every three days to once a week, and once every two weeks. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions of the disclosure varies from individual to individual depending on many factors including, but not limited to, age. disease or disorder to be treated, gender, overall health, and other factors. Thus, the disclosure should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient is determined by the attending physical taking all other factors about the patient into account.

[0179] Compounds of the disclosure for administration may be in the range of from about 1 pg to about 10,000 mg, about 20 pg to about 9,500 mg, about 40 pg to about 9,000 mg, about 75 pg to about 8,500 mg, about 150 pg to about 7,500 mg, about 200 pg to about 7,000 mg, about 3050 pg to about 6,000 mg, about 500 pg to about 5,000 mg, about 750 pg to about 4,000 mg, about 1 mg to about 3,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1 ,500 mg, about 30 mg to about 1 ,000 mg, about 40 mg to about 900 mg, about 50 mg to about 800 mg, about 60 mg to about 750 mg, about 70 mg to about 600 mg, about 80 mg to about 500 mg, and any and all whole or partial increments therebetween.

[0180] In some embodiments, the dose of a compound of the disclosure is from about 1 mg and about 2,500 mg. In some embodiments, a dose of a compound of the disclosure used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5.000 mg, or less than about 3.000 mg, or less than about 2.000 mg, or less than about 1.000 mg. or less than about 500 mg. or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, a dose of a second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg. or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg. or less than about 10 mg, or less than about 5 mg, or less than about 2 mg. or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.

[0181] In certain embodiments, the present disclosure is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound of the disclosure, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of the condition herein and associated diseases / disorders in a patient.

[0182] Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for intracranially, intrathecal , oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, know n to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and / or aromatic substances and the like. They may also be combined where desired with other active agents, e.g.. other analgesic agents.

[0183] Routes of administration of any of the compositions of the disclosure include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical. The compounds for use in the disclosure may be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal. (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, inirapulmonaiy. intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.

[0184] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry’ powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions that would be useful in the present disclosure are not limited to the particular formulations and compositions that are described herein.

[0185] Oral Administration

[0186] For oral application, particularly suitable are tablets, dragees, liquids, drops. suppositories, or capsules, caplets and gelcaps. The compositions intended for oral use may be prepared according to any method known in the art and such compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets. Such excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets may be uncoated or they may be coated by known techniques for elegance or to delay the release of the active ingredients. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent.

[0187] For oral administration, the compounds of the disclosure may be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., polyvinylpyrrolidone, hydroxypropylcellulose or hydroxypropylmethylcellulose); fillers (e.g., cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrates (e.g., sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate). If desired, the tablets may be coated using suitable methods and coating materials such as OPADRY™ film coating systems available from Colorcon, West Point, Pa. (e g., OPADRY™ OY Type, OYC Type, Organic Enteric OY -P Type, Aqueous Enteric OY -A Type, OY -PM Type and OPADRY™ White, 32K18400). Liquid preparation for oral administration may be in the form of solutions, syrups or suspensions. The liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters or ethyl alcohol); and preservatives (e.g.. methyl or propyl p-hydroxy benzoates or sorbic acid).

[0188] The present disclosure also includes a multi-layer tablet comprising a layer providing for the delayed release of one or more compounds of the disclosure, and a further layer providing for the immediate release of another medication. Using a w ax / pH-sensiti ve polymer mix, a gastric insoluble composition may be obtained in which the active ingredient is entrapped, ensuring its delayed release.

[0189] Parenteral Administration

[0190] For parenteral administration, the compounds of the disclosure may be formulated for injection or infusion, for example, intravenous, intramuscular or subcutaneous injection or infusion, or for administration in a bolus dose and / or continuous infusion. Suspensions, solutions or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and / or dispersing agents may be used.

[0191] Additional Administration Forms

[0192] Additional dosage forms of this disclosure include dosage forms as described in U.S. Patents Nos. 6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms of this disclosure also include dosage forms as described in U.S. Patent Applications Nos. 20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Additional dosage forms of this disclosure also include dosage forms as described in PCT Applications Nos. WO 03 / 35041; WO 03 / 35040; WO 03 / 35029; WO 03 / 35177; WO 03 / 35039; WO 02 / 96404; WO 02 / 32416; WO 01 / 97783; WO 01 / 56544; WO 01 / 32217; WO 98 / 55107; WO 98 / 11879; WO 97 / 47285; WO 93 / 18755; and WO 90 / 11757.

[0193] Controlled Release Formulations and Drug Delivery Systems

[0194] In certain embodiments, the formulations of the present disclosure may be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations.

[0195] The term sustained release is used in its conventional sense to refer to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time may be as long as a month or more and should be a release which is longer that the same amount of agent administered in bolus form.

[0196] For sustained release, the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds. As such, the compounds for use the method of the disclosure may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation.

[0197] In certain embodiments of the disclosure, the compounds of the disclosure are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.

[0198] The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours.

[0199] The term pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profiles of the drug after drug administration. The term immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately after drug administration.

[0200] As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration.

[0201] As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration.

[0202] Dosing

[0203] The therapeutically effective amount or dose of a compound of the present disclosure depends on the age, sex and w eight of the patient, the current medical condition of the patient and the progression of the condition herein or diseases / disorders associated therewith in the patient being treated. The skilled artisan is able to determine appropriate dosages depending on these and other factors.

[0204] A suitable dose of a compound of the present disclosure may be in the range of from about 0.01 mg to about 5,000 mg per day, such as from about 0.1 mg to about 1,000 mg, for example, from about 1 mg to about 500 mg. such as about 5 mg to about 250 mg per day. The dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or different. For example, a dose of 1 mg per day may be administered as two 0.5 mg doses, with about a 12-hour interval between doses.

[0205] It is understood that the amount of compound dosed per day may be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every75 days. For example, with every' other day administration, a 5 mg per day dose maybe initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on.

[0206] In the case wherein the patient’s status does improve, upon the doctor’s discretion the administration of the modulator of the disclosure is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily- suspended for a certain length of time (i.e., a "drug holiday”). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days. 70 days, 100 days, 120 days. 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0207] Once improvement of the patient’s conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, is reduced, as a function of the patient’s condition, to a level at which the improved disease is retained. In certain embodiments, patients require intermittent treatment on a longterm basis upon any recurrence of symptoms and / or infection.

[0208] The compounds for use in the method of the disclosure may be formulated in unit dosage form. The term “unit dosage form” refers to physically discrete units suitable as uni tan ■ dosage for patients undergoing treatment, with each unit containing a predetermined quantity' of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g.. about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may' be the same or different for each dose.

[0209] Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. Capsid assembly modulators exhibiting high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human. The dosage of such capsid assembly^ modulators lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized.

[0210] Those skilled in the art recognizes, or is able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents were considered to be within the scope of this disclosure and covered by the claims appended hereto. For example, it should be understood, that modifications in assay and / or reaction conditions, with art-recognized alternatives and using no more than routine experimentation, are within the scope of the present disclosure.

[0211] It is to be understood that wherever values and ranges are provided herein, all values and ranges encompassed by these values and ranges, are meant to be encompassed within the scope of the present disclosure. Moreover, all values that fall within these ranges, as well as the upper or lower limits of a range of values, are also contemplated by the present disclosure.

[0212] EXAMPLES

[0213] The instant specification further describes in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless so specified. Thus, the present specification should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0214] Example 1: A KLF2-BMPER-Smadl / 5 checkpoint regulates high fluid shear stress- mediated artery remodeling

[0215] Vascular remodeling to match arterial diameter to tissue requirements commonly fails in ischemic disease. Endothelial cells sense fluid shear stress (FSS) from blood flow to maintain FSS within a narrow range in healthy vessels. Thus, high FSS induces vessel outward remodeling, but mechanisms are poorly understood. Smadl / 5 is maximally activated at physiological FSS. Smadl / 5 limits Akt activation, suggesting that inhibiting Smadl / 5 may facilitate outward remodeling. Here the present study reports that high FSS suppresses Smadl / 5 by elevating KLF2, which induces the bone morphogenetic protein (BMP) pathway inhibitor, BMP-binding endothelial regulator (BMPER), thereby de-inhibiting Akt. In mice, surgically induced high FSS elevated BMPER expression, inactivated Smadl / 5 and induced vessel outward remodeling. Endothelial BMPER deletion impaired blood flow recovery and vascular remodeling. Blocking endothelial cell Smadl / 5 activation with BMP9 / 10 blocking antibodies improved vascular remodeling in mouse models of type 1 and type 2 diabetes. Suppression of Smadl / 5 is thus a therapeutic approach for ischemic disease.

[0216] Cardiovascular diseases such as coronary artery disease (CAD) and peripheral artery disease (PAD) remain the leading global cause of morbidity and mortality', usually associated with maladaptive artery remodeling that leads to tissue ischemial. Artery remodeling is a complex process involving structural changes that result in inward remodeling to reduce or outward remodeling to increase lumen diameter. In healthy vessels, it is an essential physiological mechanism that matches vessel diameter to blood flow requirements. Pathological vessel remodeling in CAD and PAD leads to tissue ischemia and disease symptoms. Diabetes is a major risk factor for these conditions, with highly accelerated CAD and severe PAD / critical limb ischemia that can result in limb amputation.

[0217] Endothelial cells (ECs) lining the inner layer of blood vessels are continuously exposed to blood flow, which exerts a frictional drag force called fluid shear stress (FSS). Current evidence supports a model in which ECs encode an FSS set point that mediates homeostatic artery remodeling. Increased or decreased flow through an artery stimulates outward or inward remodeling, respectively. According to this view, low FSS stimulates inward remodeling, physiological FSS stabilizes vessels to suppress remodeling and high (above physiological) FSS promotes outward remodeling. One instance of vessel remodeling in response to sustained high FSS is autologous arteriovenous fistula (AVF), a surgical procedure connecting an artery to a vein. In mice, this enables analysis of the specific segment of artery’ subject to high flow. A similar procedure is used in patients to provide vascular access with increased blood supply for hemodialysis.

[0218] Bone morphogenetic proteins (BMPs) are important regulators of vascular development, integrity7, inflammatory7responses and insulin sensitivity7. BMP family members bind to type I and type II trans-membrane receptors that contain cytoplasmic serine / threonine kinase domains. BMP binding initiates receptor activation and C-terminal phosphorylation of Smadl , Smad5 and Smad8, though in ECs, Smadl and Smad5 predominate! 8. C-terminal Smadl / 5 phosphorylation promotes their binding to Smad4, nuclear entry7and induction of target genes. BMP-binding endothelial regulator (BMPER) is a secreted protein expressed mainly in ECs that binds BMPs and BMP receptors and modulates BMP signaling in the endothelium and potentially in adjacent smooth muscle cells. BMPER plays important roles in disease-associated vascular processes including angiogenesis, atherosclerosis, inflammation and diabetes.

[0219] Artery outward remodeling is impaired in CAD and PAD. for which (in addition to diabetes), age, genetics and hyperlipidemia are major risk factors. A well-established mouse PAD model is hind limb ischemia (HLI) after femoral artery ligation. After surgery7, blood flow in the thigh is redirected to preexisting parallel small collateral arteries and capillaries. Higher shear stress in these vessels then induces arteriogenesis. The resultant outward remodeling and increased blood flow through these vessels bypasses the blockade to restore blood flow. The calf also undergoes vascular remodeling, mainly angiogenesis, in response to hypoxia in this region. Together, these two processes mediate blood flow recovery. In mice, both type 1 diabetes (T1D) and obesity-related type 2 diabetes (T2D) slow blood flow recovery from HLI.

[0220] Low FSS activates Smad2 / 3 to induce inward artery remodeling. The present study set out to elucidate the mechanism that governs high flow-induced outward artery' remodeling. The present study shows that elevated Klf2 expression induces BMPER to terminate Smadl / 5 activation, which de-represses Akt to permit remodeling. The present study also shows that artificially blocking Smadl / 5 potently rescues poor remodeling in both T1D and T2D mice. Elucidation of a key mechanism of artery outward remodeling thus indicates a therapeutic approach for treating ischemic disease.

[0221] Example 2: High FSS inhibits Smadl / 5 activation though KLF2

[0222] Smadl / 5 is maximally activated at physiological FSS and suppressed at high (that is, supraphysiological) FSS. KLF2 and its close homology Klf4 are major EC transcription factors induced by FSS in a dose-dependent manner. The present study therefore tested the role of Klf2 in Smadl / 5 suppression under high FSS. Human umbilical vein ECs (HUVECs) were treated with control (siCtrl) and KLF2 (siKLF2) small interfering (si)RNA, then subjected to FSS at 3 (low), 12 (physiological) or 40 dynes cm2(high) for 12 h. The present study examined Smadl nuclear translocation as a marker of its activation. In Ctrl cells, nuclear Smadl was maximal around physiological shear stress and then decreased at high FSS as expected; in KLF2 knockdown (KD) cells, nuclear Smadl was similar to Ctrl under low and physiological FSS but remained high under high FSS (Figs. 1 A-1B). This result was confirmed in human aortic ECs (HAECs; Figs. 9A-9C). Assaying Smadl / 5 phosphorylation by immunostaining and western blotting gave similar results (Figs. 1C-1F & 9D-9E). Thus, KLF2 is required for suppression of Smadl activation under high FSS.

[0223] Example 3: KLF2 regulates Smadl / 5 through BMPER

[0224] KLF2 is a transcription factor, suggesting that its increased expression under high shear (confirmed in Fig. 10D) could induce a gene that suppresses Smadl / 5 phosphorylation. The present study therefore performed RNA sequencing (RNAseq) on HUVECs with or without KLF2 KD, focusing on genes connected to the BMP pathway and that decreased after KLF2 KD (Figs. 10A-10B; affected relevant genes summarized in Fig. 10C). Smad7 and Smad6 were both KLF2 dependent; however, when knocked down, neither affected Smadl activation under high FSS (Figs. 11 A-l IE and 12A-12E). Then another candidate, BMPER, caught the attention of the present study. BMPER is an extracellular modulator of BMP signaling, which binds BMPs and BMP receptors and can block Smad activation BMPER showed Klf2-dependent induction at high flow (Fig. 10D).

[0225] Whether BMPER is a direct Klf2 target gene could be addressed by chromatin immunoprecipitation and sequencing (ChlP-seq); however, suitable antibodies to Klf2 are not available. But, ChlP-seq has been done for its coregulated homolog Klf4 that activates many of the same target genes through the same consensus motif. The present study therefore re-analyzed a published Klf4 ChlP-seq dataset from ECs in which constitutively active MEK5 (caMEK5) drove induction of Klf4. caMEK5 triggered increased binding of Klf4 to an intronic region within the BMPER gene, correlating with a near-consensus Klf2 / Klf4 motif. This KLF4 binding peak was also enriched for the H3K27Ac chromatin modification (a marker of active enhancers) and for ERG binding, a vascular transcription factor commonly associated with endothelial enhancers (Fig. 10E). These data suggest that BMPER is probably a direct target gene of Klf2 / 4 in ECs.

[0226] To test its function, HUVECs were transfected with control (siCtrl) or BMPER (siBMPER) siRNA, then subjected to FSS at 3, 12 and 40 dynes cm2for 12 h. Like KLF2 KD, BMPER KD had little effect at low or physiological FSS but potently blocked the decrease in Smadl nuclear translocation and phosphory lation under high FSS (Figs. 2A-2F and 13A-13E). Together, these results show that KLF2-dependent BMPER induction is required for Smadl / 5 suppression by high FSS.

[0227] Example 4: High flow-induced outward remodeling in vivo

[0228] To study high FSS in vivo in a system where the endothelium can be readily analyzed, the present study developed an AVF model in which the right carotid artery’ (RCA) is connected to the external jugular vein (Fig. 3A), resulting in high flow through both vessels. At days 3 and 14 after surgery, serial cross-sections of the proximal RCA close to the anastomosis or the comparable location in the Ctrl, unoperated left carotid artery (LCA) were examined. The circumference of the operated RCA was substantially increased compared with the Ctrl LCA at day 3, with a further increase at day 14 (Figs. 3B-3C). Mice without anastomosis showed no difference in the circumference of LCA and RCA (Figs. 14A-14B). These results demonstrate robust outward remodeling after surgery’. Suitable antibodies to Klf2 are not available, but staining for its coregulated homolog Klf4 showed a significant increase in the RCA compared with the LCA, supporting higher shear stress in RCA after surgery7(Figs. 14C-14E). BMPER immunostaining strongly increased in the proximal RCA while expression was barely detectable in the LCA (Figs. 3D-3E). In contrast, Smadl / 5 phosphorylation was low in the proximal RCA, consistent with a decrease at high shear (Figs. 3F-3G). Together, those results show that induction of BMPER under high FSS correlates with Smadl / 5 inactivation during artery outward remodeling.

[0229] Example 5: BMPER KD impairs Akt activation under high FSS

[0230] The Smadl / 5 pathway is reported to suppress activation of VEGFR2 and Akt34,35, suggesting that Smadl / 5 suppresses VEGFR2 and Akt under physiological FSS to stabilize vessels and prevent unwanted vascular remodeling. However, suppression of Smadl / 5 at high FSS would release this inhibition to enable outw ard remodeling. This hypothesis predicts that suppressing BMPER should elevate Smadl / 5 and decrease Akt activity in arteries under high FSS. The present study first confirmed that Akt was activated by high FSS (Figs. 4A-4B). To test the effect of BMPER on Akt activation under high FSS, HUVECs treated with control (siCtrl) or BMPER (siBMPER) siRNA were subjected to FSS at 40 dynes cm2. BMPER KD reduced Akt activation under high FSS, as assayed by immunostaining and western blotting (Figs. 4C-4F). Thus, BMPER induction under high FSS facilitates Akt activation under this condition.

[0231] Example 6: Deletion of BMPER in ECs in vivo

[0232] To investigate the role of BMPER in vivo. BMPER floxed mice were crossed with Cdh5-CreERT2 to generate inducible endothelial-specific BMPER knockout mice (BMPER iECKO). At 5-6 weeks, tamoxifen was injected for five consecutive days (Fig. 5A), with BMPER deletion confirmed in isolated lung ECs by qPCR and in the intact carotid by immunostaining (Figs. 5B-5C). The present study then tested the role of BMPER using the HLI model in which ligation of the femoral artery results in high flow remodeling of small vessels parallel to the blockade, which leads to recovery of blood flow in the low er limb. BMPER iECKO and Ctrl mice were subject to HLI and blood flow recovery assessed by laser Doppler flow-imaging (LDI) before and at various times after ligation, using the unoperated right leg as an internal control. BMPER ECKO strongly impaired blood flow recovery (Figs. 5D-5E). Staining tissue sections for smooth muscle actin (SMA) to identify muscular arteries, The present study observed that in wild-type mice, thigh tissue parallel to the ligation had a higher density of muscular arteries than in the unoperated thigh, indicating arteriogenesis. In tissue from BMPER ECKO mice, muscular arteries in the ligated thigh showed no increase relative to the Ctrl group (Fig. 5F). Ctrl versus BMPER iECKO mice were also subject to AVF surgery. At day 3 postsurgery, serial cross-sections of the proximal RCA close to the anastomosis or the comparable location in the Ctrl LCA showed that BMPER ECKO impaired outward remodeling (Figs. 6A-6B). BMPER expression was induced in the proximal RCA in Ctrl group, but not in BMPER iECKO mice (Figs. 6C-6D and 14F). Smadl / 5 activation was suppressed in the proximal RCA in Ctrl group but remained high in BMPER iECKO mice (Figs. 6E-6F and 14G). Together, these data provide in vivo evidence that BMPER upregulation suppresses Smadl / 5 to permit artery outward remodeling.

[0233] Example 7: BMP9 / 10 blocking Abs in BMPER iECKO mice in HLI

[0234] FSS activation of Smadl / 5 requires the presence of soluble BMP9 and 10, which are circulating factors produced by hepatocytes and cardiac myocytes, respectively. BMP9 / 10 blocking antibodies (bAbs) thus prevent FSS activation of Smadl / 5 ECs. BMPER iECKO and Ctrl mice were subject to HLI then injected intraperitoneally (i.p.) once per week with control IgG or BMP9 / 10 bAbs (Fig. 7A). The poor blood flow recovery’ after BMPER iECKO was effectively reversed by BMP9 / 10 bAbs (Figs. 7B-7C). with comparable improvement in arterialization (Figs. 7D-7E). BMP9 / 10 bAbs also restored the expression of angiogenic factors Vegfa and Pdgfb in BMPER iECKO mice in HLI model (Figs. 15A-15B). These results confirm that BMPER works through the BMP-Smadl / 5 pathway.

[0235] Example 8: BMP9 / 10 blocking Abs in T1D

[0236] BMPER plasma levels reportedly decrease in metabolic syndrome patients and obese mice, conditions that are major risk factors for PAD. Mouse models of T1D, also show slow recovery from HLI4. To explore whether BMP9 / 10 bAbs might improve blood flow recovery in T1D, The present study used the streptozotocin (STZ) model in C57BL / 6 mice. Mice with confirmed hyperglycemia (Fig. 16A) were subjected to HLI surgery then injected with control IgG or BMP9 / 10 bAbs (Fig. 8A). BMP9 / 10 bAbs markedly improved blood flow recovery (Figs. 8B-8C), as well as arterialization in the thigh (Figs. 8D-8E), with slightly increased angiogenesis in the calf (Figs. 16B-16C). Efficacy was similar in male and female mice. These results indicate the therapeutic potential of BMP9 / 10 blocking Abs to inhibit Smadl / 5 and improve remodeling in ischemic disease.

[0237] Example 9: BMP9 / 10 blocking Abs in T2D

[0238] Obesity-related T2D also impairs blood flow recovery’ in HLI. To test the effect of BMP9 / 10 bAbs in this model, C57BL / 6 mice were fed a high-fat diet (HFD, 60 kcal% fat) for 8 weeks. Body weight and blood glucose confirmed induction of obesity and hyperglycemia (Figs. 17A-17B). Mice were then subjected to HLI surgery and injected with control IgG or BMP9 / 10 bAbs (Fig. 8F). As expected, recovery from HLI was severely reduced in T2D mice, with stronger inhibition in females. However, BMP9 / 10 bAbs substantially improved blood flow recovery in both male and female mice (Figs. 8G-8H). Treatment also improved arterialization in the thigh (Figs. 8I-8J) and modestly increased angiogenesis in the calf (Figs. 18A-18B). Akt activation and BMPER expression were also restored after BMP9 / 10 bAbs treatment (Fig. 18C-18F). Together, these results indicate that inhibiting the Smadl / 5 pathway improves homeostatic remodeling in ischemic disease.

[0239] Example 10:

[0240] This study aimed to elucidate essential aspects of the homeostatic high FSS outward remodeling pathway that adjusts artery inner diameter to meet tissue requirements. Smadl / 5 was activated in ECs by FSS at physiological levels but then decreased at higher shear. Flow stimulation of Smadl / 5 was found to occur through increased clustering of the membrane receptors Alkl and Endoglin, which enhanced sensitivity to their circulating ligands BMP9 and 10. Smadl / 5 also inhibits Akt activation via induction of casein kinase 2 and subsequent activation of the PI3 -lipid phosphatase PTEN. Smadl / 5 may also limit VEGFR2 activation. These data suggest anon-limiting model in which Smadl / 5 activation under physiological FSS confers vessel stability by limiting remodeling pathways that could otherwise be activated by transient or subthreshold stimuli. Outward remodeling under sustained high shear thus proceeds in part by de-repressing these mediators. Loss of the Smadl / 5 pathway due to mutations in the receptors Alkl or endoglin, or Smad4 leads to vascular malformations due to loss of this stabilization pathway. A recent study showed that loss of Smad4 specifically increased sensitivity7of ECs to FSS, consistent with this perspective. However, in adult mice, complete loss of Alkl or Smad4 is not sufficient for malformations, leading to the notion that additional hits are required, which helps to explain the sporadic nature of the disease.

[0241] Our results demonstrate that outward remodeling requires high FSS suppression of the Smadl / 5 pathway via increased expression of Klf2, a well-known flow-dependent gene. Klf2 in turn induces expression of BMPER, which blocks the flow- and BMP9 / 10-dependent activation of Smadl / 5. thereby releasing PI3-kinase and Akt from inhibition (pathway diagram in Fig. 18G). Decreased vessel lumen diameter is an essential element in ischemic disease.

[0242] Atherosclerosis is widespread but generally asymptomatic due to compensatory remodeling by the unaffected part of the vessel wall that preserves lumen diameter. However, in severe disease, remodeling fails, lumen diameter is compromised and tissue ischemia ensues. The ability to remodel surrounding vessels after an occlusive event is a major factor in recovery' from stroke and myocardial infarction. However, many of the same risk factors (age, hyperlipidemia, diabetes / hyperglycemia and hypertension) that promote atherosclerosis also limit remodeling responses. Diabetes and associated hyperglycemia are especially severe, with diabetic PAD leading to acute limb ischemia and even limb amputation in some cases. Tissue ischemia is generally accompanied by high VEGF levels and high FSS at sites of artery’ blockade, indicating that sensitivity to these stimuli is the limiting factor.

[0243] The present study therefore considered yvhether blocking the Smadl / 5 pathway might improve vessel remodeling. In both T1D and T2D mouse models, antibodies to BMP9 / 10, a well -characterized method for blocking this pathway (Chen et al., Proc. Natl Acad. Sci. USA 110, 11887-11892 (2013)), substantially improved recovery’ from HLI (Fig. 18G). The present study observed that T2D reduced recovery' from HLI more strongly in female mice, but BMP9 / 10 therapy was similarly effective in both sexes. These results indicate that BMP9 / 10 antibodies or other methods to inhibit EC Smadl / 5 are a safe and effective means to treat ischemic disease.

[0244] Example 11 : Materials and Methods

[0245] Animals

[0246] Bmperfl / fl mice and Cdh5-CreERT2 mice described in Mao et al. (Nat. Commun. 12, 1927 (2021)) and Fisher et al. (Nat. Commun. 6. 7937 (2015)). All mice in this study are on the C57BL / 6 background. To induce gene deletion, mice were i.p. injected with 1.5 mg tamoxifen (Sigma, T5648) for five consecutive days. All mice were housed in a specific pathogen-free facility' with a light (12 h light cycle), 50% humidity’ and ambient temperature (69 °F) controlled environment. They were fed a pellet rodent diet and had free access to water.

[0247] Arteriovenous fistula model

[0248] Mice were anesthetized yvith ketamine / xylazine (100 mg kg1and 10 mg kg '). and surgical procedures were performed under 0.5-1% isoflurane anesthesia delivered via a precision vaporizer. Mice received pre-emptive analgesia of buprenorphine (Ethiqa XR) and local anesthetic bupivacaine. and surgical procedures were performed using aseptic and microsurgery techniques. A ventral midline incision (about 2 cm) was made in the neck. The right external jugular vein branch and RCA were dissected and rinsed with saline containing 100 IU ml-1 heparin after the vein and artery were cut. The A-V fistula was created with end-to-side anastomoses using 11-0 monofilament sutures. The opposite LCA was approached but not cut and served as a control. The skin was closed with a 7-0 monofilament suture. 0.5 ml saline was injected subcutaneously and the animals were kept warm until full recovery. At days 3 and 14 after surgery, proximal RCA and LCA samples were collected for further analysis.

[0249] HI. I model

[0250] Surgical procedures were performed in mice under anesthesia. Briefly, a 10-mm longitudinal incision was made in the left hind limb. The left common femoral artery and its side branches were dissected and ligated with 10-0 monofilament sutures spaced 5 mm apart, and the arterial segment between the ligatures was excised. Assessment of tissue perfusion by LDI was done by scanning rear paws with the LDI analyzer (Moor Infrared Laser Doppler Imager Instrument). Low or no perfusion is displayed as dark blue, high perfusion is displayed as red. Images were quantitatively converted into histograms with Moor LDI processing software V5.3. Data are reported as the ratio of flow in the left / right (L / R) hind limb and calf regions. Measurement of blood flow was done before and immediately after surgery and then at days 3, 7, 14 or 21 .

[0251] Mouse T1D model

[0252] C57BL / 6J mice (12 weeks) were purchased from the Jackson Laboratory (stock no. 000664). Mice were injected i.p. with STZ (diluted in citrate buffer, pH 4.2-4.5; 50 mg kg-1 for male and 75 mg kg-1 for female; Sigma S 1030) for five consecutive days. At 3 weeks after the first STZ injection, blood glucose was measured to confirm hyperglycemia. At 4 weeks after the first STZ injection, mice were used for HLI surgery.

[0253] Mouse T2D model

[0254] C57BL / 6J mice (Jackson Laboratory', stock no. 000664), 12 weeks old, were fed a HFD (60 kcal% fat; research diet, D12492) for 8 weeks, then subject to HLI surgery. Body weight and blood glucose were measured before and after HFD (before surgery). Cell culture and siRNA transfection

[0255] HUVECs pooled from multiple donors were obtained from Yale Vascular Biology and Therapeutics tissue-culture core laboratory at passage 1. Primary HAECs were purchased from American Type Culture Collection (PCS-100-011). Both cell types were maintained in EGM2 EC Growth Media (Lonza) and used for experiments between P2 and P5. SiRNA transfection used Opti-MEM medium (Gibco, 31985070) and lipofectamine RNAiMAX (Invitrogen). ON-TARGET plus Smartpool siRNAs from Dharmacon were used against human KLF2 (L-006928-00-0005), human Smad6 (L-015362-00-0005), human Smad7 (L- 020068-00-0005) and human BMPER (L-021489-02-0005).

[0256] Shear Stress

[0257] HUVECs or HAECs were seeded on tissue-culture plastic slides coated with 20 pg ml1fibronectin and grown to confluence. Shear stress with the calculated intensities indicated in each figure was applied in parallel flow chambers.

[0258] Immunofluorescence

[0259] For cells, samples were fixed in 4% paraformaldehyde (Electron Micros-copy Sciences) for 10 min at room temperature. For tissues, samples were fixed in 4% paraformaldehyde overnight at 4 °C and incubated with 30% sucrose (Sigma) solution in PBS overnight at 4 °C. Specimens were embedded in optimal cutting temperature medium (Sakura) and 8-10-pm sections were cut in a cryostat (Leica). For immunofluorescence (IF), cells or sections were blocked in 5% donkey serum, 0.2% bovine serum albumin and 0.3% Triton X-100 in PBS, followed by incubation with primary and secondary antibodies diluted in blocking buffer. Negative controls used nonimmune species- and isotype-matched IgG. Images were taken using an SP8 confocal microscope (Leica).

[0260] Image analysis

[0261] To quantify Smadl nucleus / cytoplasm intensity ratio, images were opened in ImageJ (National Institutes of Health) and converted to 8-bits, then thresholds adjusted to segment the nucleus and individual cell regions. Nuclear translocation w as determined by masking the cell nuclei (from 4,6-diamidino-2-phenylindole (DAPI) images), and then the integrated fluorescence intensity' in the nucleus and cytoplasm were measured, respectively. The nucleus / cytoplasm intensity ratio was then calculated.

[0262] In the HLI model, arteriogenesis and angiogenesis were evaluated in the muscle territories located in the thigh and calf, respectively. To assess arteriogenesis, thigh muscle around the proximal femoral artery excision site was sectioned and stained with SMA antibody. The number of SMA-positive vessels was counted in five randomly selected fields from each mouse, and the mean value was used as a single data point for each mouse. To assess angiogenesis, gastrocnemius muscle in calf area was sectioned and stained with CD31 antibody. Angiogenesis was evaluated by calculating the CD31 -positive area using Image! This measurement was determined in five randomly selected fields from each animal, and the average value was used as a single data point for each mouse.

[0263] RNA isolation and quantitative real-time PCR

[0264] RNA was extracted from cells with RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions, and reverse transcription performed with the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). Complementary DNA was amplified by real-time PCR with iQ SYBR Green Supermix (Bio-Rad). Expression of target genes was normalized to the housekeeping gene GAPDH.

[0265] RNAseq analysis

[0266] Total RNA was extracted from HUVECs treated with Ctrl and KLF2 siRNA (four samples for each group) and quantitated by a NanoDrop. The RNA integrity number was measured with an Agilent Bioanalyzer. Samples were subjected to RNAseq using an Illumina NextSeq 500 sequencer (75-bp paired-end reads). The base calling data from sequencing were transferred into FASTQ files using bcl2fastq2 conversion software (version 2.20, Illumina). The raw reads were aligned to the human reference genome GRCh38 (GCF_000001405.26) using HISAT2 (version 2.1.0) alignment software and processed using HTSeq (version 0.11.1) to generate read counts for every gene. DESeq2 (version 1.24, using default parameter) was used to preprocess raw data to remove the noise, normalize each sample to correct the batch effect, perform principal component analysis for observing the similarity of replicates and identify differential expression genes. P values obtained from multiple tests were adjusted using Benjamini-Hochberg correction.

[0267] Western blotting

[0268] Cells were collected and incubated in RIPA buffer containing complete mini protease inhibitors and phosphatase inhibitors (Roche) for 30 min on ice. Lysates were centrifuged at 16,000g for 10 min at 4 °C, supernatants transferred to new 1.5 ml tubes, 4x loading buffer (250 mM Tris-HCl pH 6.8, 8% sodium dodecyl-sulfate. 40% glycerol, 20% P- mercaptoethanol and 0.008% bromophenol blue) added and heated to 95 °C for 5 min. Cell lysates were resolved by a 4-15% Criterion TGX Precast Gels (Bio-Rad) sodium dodecyl- sulfate-polyacrylamide gel electrophoresis, and transferred onto a polyvinylidene difluoride membrane (Millipore). The membranes were blocked with 5% non-fat milk and incubated with indicated antibodies diluted in 5% bovine serum albumin, followed by horseradish peroxi dase-conjugated secondary antibodies. Protein bands were imaged using Immobilon Western Chemiluminescent horseradish peroxidase substrate (Millipore). ImageJ was used for densitometry quantification.

[0269] Mouse lung EC isolation

[0270] Mouse lungs were collected and digested in a solution of 2 mg ml1collagenase (Sigma). The cell suspension was filtered through a 70-um sterile cell strainer (Falcon). ECs were isolated using magnetic beads coated with anti-rat IgG (Invitrogen) then incubated with rat anti-mouse CD31 antibody (BD Biosciences). Isolated cells were then lysed and RNA isolated using PicoPure RNA isolation kit (Applied Biosystems) according to the manufacturer’s instructions.

[0271] Antibodies

[0272] The present study used the following antibodies for IF and immunoblotting (IB): rat anti-Mouse CD31 (BD 550274, clone MEC13.3; IF 1 :200), GAPDH (Cell Signaling 5174 S; IB 1 :2,000), Smadl (Cell Signaling 9743 S; IB 1: 1,000, IF 1 :400), phospho-Smadl / 5 (p- Smadl / 5) (Cell Signaling 13820 S; IB 1: 1,000, IF 1 :400), Akt (Cell Signaling 2920 S; IB 1: 1,000), phospho-Akt S473 (Cell Signaling 4060 S; IB 1: 1,000, IF 1:400). BMPER (Abeam ab73900; IB 1: 1,000, IF 1 :400), KLF4 (Abeam ab215036; IF 1 :400). Anti -bodies for BMP9 (MAB3209, clone #360107), BMP10 (MAB2926, clone #462732), IgG2A isotype control (MAB003, clone #20102) and IgG2B isotype control (MAB004, clone #20116) were purchased from R&D Systems.

[0273] Statistics and reproducibility)

[0274] Statistical analysis was performed using GraphPad Prism 9 software (GraphPad software Inc.). Data were analyzed for normality and equal variance using the Shapiro-Wilk test and Brown-Forsythe test, respectively. If both tests were passed, statistical significance was analyzed by unpaired t-test for two group comparisons or one-way ANOVA with Tukey’s post hoc test for multiple group comparison. Statistical significance between two groups plus treatment was calculated by two-way analysis of variance (ANOVA) with Tukey’s or Sidak’s multiple comparison tests. A P value less than 0.05 was considered significant (*P < 0.05, **P < 0.01 and ***P < 0.001). All experiments were repeated at least three times to confirm the conclusion, and the details of replications are clearly described in the legend of each figure.

[0275] Enumerated Embodiments:

[0276] In some aspects, the present invention is directed to the following non-limiting embodiments:

[0277] Embodiment 1 : A method of promoting outward remodeling of a blood vessel in a subject, the method comprising administering to the subject an effective amount of a compound that downregulates Smadl / 5 and / or BMP9 / 10.

[0278] Embodiment 2: The method of Embodiment 1, wherein the outward remodeling of the blood vessel eliminates, reduces, and / or compensates for blood flow restriction or disruption in the blood vessel caused by a plaque.

[0279] Embodiment 3: The method of any one of Embodiments 1-2, wherein the compound downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level.

[0280] Embodiment 4: The method of any one of Embodiments 1-3, wherein the compound downregulates Smadl / 5 and / or BMP9 / 10 in a vascular endothelial cell of the subject.

[0281] Embodiment 5: The method of any one of Embodiments 1-4, wherein the compound treats, ameliorates, and / or prevents a disease or disorder caused by or involving a plaque or a restricted or disrupted blood flow in the blood vessel.

[0282] Embodiment 6: The method of Embodiment 5, wherein the disease or disorder comprises atherosclerosis, ischemia caused by narrowing of blood vessels, peripheral artery disease, angina, cerebral large artery disease, or critical limb ischemia.

[0283] Embodiment 7: The method of any one of Embodiments 1-6, wherein the compound comprises: a small molecule inhibitor of Smadl / 5 and / or BMP9 / 10, a protein inhibitor of Smadl / 5 and / or BMP9 / 10, a nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference, a ribozyme that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level, and / or an expression vector expressing the ribozyme, an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by CRISPR knockout or CRISPR knockdown, or a trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10. and / or an expression vector that expresses the trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10.

[0284] Embodiment 8: The method of any one of Embodiment 1-7, wherein the compound comprises an antibody against BMP9 and / or BMP 10.

[0285] Embodiment 9: The method of Embodiment 8, wherein the antibody against BMP9 and / or BMP10 blocks the activation of Smadl / 5 by BMP9 / 10.

[0286] Embodiment 10: The method of any one of Embodiments 1-9, wherein the subject is a diabetic subject.

[0287] Embodiment 11: The method of any one of Embodiments 1-10, wherein the subject is a mammal, optionally a human.

[0288] Embodiment 12: A method of treating, ameliorating, and / or preventing a disease or disorder caused by or involving a plaque in the blood vessel, the method comprising administering to the subject an effective amount of a compound that downregulates Smadl / 5 and / or BMP9 / 10.

[0289] Embodiment 13: The method of Embodiment 12, wherein the plaque restricts and / or disrupts blood flow in the blood vessel, thereby causing the disease or disorder.

[0290] Embodiment 14: The method of any one of Embodiments 12-13, wherein the disease or disorder comprises atherosclerosis, ischemia caused by narrowing of blood vessels, peripheral artery disease, angina, cerebral large artery disease, or a critical limb ischemia.

[0291] Embodiment 15: The method of any one of Embodiments 12-14, wherein the compound causes outw ardly remodeling in the blood vessel which fully or partially restores a restriction or disruption of blood flow in the blood vessel caused by the plaque.

[0292] Embodiment 16: The method of any one of Embodiments 12-15, wherein the compound downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level.

[0293] Embodiment 17: The method of any one of Embodiments 12-16, wherein the method downregulates Smadl / 5 and / or BMP9 / 10 in a vascular endothelial cell of the subject.

[0294] Embodiment 18: The method of any one of Embodiments 12-17, wherein the compound comprises: a small molecule inhibitor of Smadl / 5 and / or BMP9 / 10, a protein inhibitor of Smadl / 5 and / or BMP9 / 10. a nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity' and / or expression level by RNA interference, a ribozyme that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level, and / or an expression vector expressing the ribozyme, an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that down reg ulate a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by CRISPR knockout or CRISPR knockdown, or a trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10, and / or an expression vector that expresses the trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10.

[0295] Embodiment 19: The method of any one of Embodiments 12-18, wherein the compound comprises an antibody against BMP9 and / or BMP10.

[0296] Embodiment 20: The method of Embodiment 19, wherein the antibody against BMP9 and / or BMP10 blocks the activation of Smadl / 5 by the BMP9 / 10.

[0297] Embodiment 21 : The method of any one of Embodiments 12-20, wherein the subject is a diabetic subject.

[0298] Embodiment 22: The method of any one of Embodiments 12-21, wherein the subject is a mammal, optionally a human.

[0299] The foregoing outlines features of several embodiments so that those skilled in the art may better understand the aspects of the present disclosure. Those skilled in the art should appreciate that they may readily use the present disclosure as a basis for designing or modifying other processes and structures for carry ing out the same purposes and / or achieving the same advantages of the embodiments introduced herein. Those skilled in the art should also realize that such equivalent constructions do not depart from the spirit and scope of the present disclosure, and that they may make various changes, substitutions, and alterations herein without departing from the spirit and scope of the present disclosure.

Claims

CLAIMSWhat is claimed is:

1. A method of promoting outward remodeling of a blood vessel in a subj ect, the method comprising administering to the subject an effective amount of a compound that downregulates Smadl / 5 and / or BMP9 / 10.

2. The method of claim 1 , wherein the outward remodeling of the blood vessel eliminates, reduces, and / or compensates for blood flow restriction or disruption in the blood vessel caused by a plaque.

3. The method of any one of claims 1-2, wherein the compound dow nregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level.

4. The method of any one of claims 1-3, wherein the compound downregulates Smadl / 5 and / or BMP9 / 10 in a vascular endothelial cell of the subject.

5. The method of any one of claims 1-4, wherein the compound treats, ameliorates, and / or prevents a disease or disorder caused by or involving a plaque or a restricted or disrupted blood flow in the blood vessel.

6. The method of claim 5, wherein the disease or disorder comprises atherosclerosis, ischemia caused by narrowing of blood vessels, peripheral artery disease, angina, cerebral large artery disease, or critical limb ischemia.

7. The method of any one of claims 1-6, wherein the compound comprises: a small molecule inhibitor of Smadl / 5 and / or BMP9 / 10, a protein inhibitor of Smadl / 5 and / or BMP9 / 10. a nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference, a ribozyme that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level, and / or an expression vector expressing the ribozyme,an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by CRISPR knockout or CRISPR knockdown, or a trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10, and / or an expression vector that expresses the trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10.

8. The method of any one of claims 1-7, wherein the compound comprises an antibody against BMP9 and / or BMP 10.

9. The method of claim 8, wherein the antibody against BMP9 and / or BMP 10 blocks the activation of Smadl / 5 by BMP9 / 10.

10. The method of any one of claims 1-9, wherein the subject is a diabetic subject.

11. The method of any one of claims 1-10, wherein the subject is a mammal, optionally a human.

12. A method of treating, ameliorating, and / or preventing a disease or disorder caused by or involving a plaque in the blood vessel, the method comprising administering to the subject an effective amount of a compound that downregulates Smadl / 5 and / or BMP9 / 10.

13. The method of claim 12, wherein the plaque restricts and / or disrupts blood flow in the blood vessel, thereby causing the disease or disorder.

14. The method of any one of claims 12-13, wherein the disease or disorder comprises atherosclerosis, ischemia caused by narrowing of blood vessels, peripheral artery disease, angina, cerebral large artery disease, or a critical limb ischemia.

15. The method of any one of claims 12-14, wherein the compound causes outwardly remodeling in the blood vessel which fully or partially restores a restriction or disruption of blood flow in the blood vessel caused by the plaque.

16. The method of any one of claims 12-15, wherein the compound downregulates aSmadl / 5 and / or BMP9 / 10 activity and / or expression level.

17. The method of any one of claims 12-16, wherein the method downregulates Smadl / 5 and / or BMP9 / 10 in a vascular endothelial cell of the subject.

18. The method of any one of claims 12-17, wherein the compound comprises: a small molecule inhibitor of Smadl / 5 and / or BMP9 / 10, a protein inhibitor of Smadl / 5 and / or BMP9 / 10, a nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference, and / or an expression vector expressing the nucleic acid that downregulates a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by RNA interference, a ribozyme that downregulates a Smadl / 5 and / or BMP9 / 10 activity7and / or expression level, and / or an expression vector expressing the ribozyme, an expression vector comprising an expression cassette, wherein the expression cassette expresses CRISPR components that downregulate a Smadl / 5 and / or BMP9 / 10 activity and / or expression level by CRISPR knockout or CRISPR knockdown, or a trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10, and / or an expression vector that expresses the trans-dominant negative mutant protein of Smadl / 5 and / or BMP9 / 10.

19. The method of any one of claims 12-18, wherein the compound comprises an antibody against BMP9 and / or BMP 10.

20. The method of claim 19, wherein the antibody against BMP9 and / or BMP10 blocks the activation of Smadl / 5 by the BMP9 / 10.

21. The method of any one of claims 12-20, wherein the subject is a diabetic subject.

22. The method of any one of claims 12-21, wherein the subject is a mammal, optionally a human.

Images