Plasmonic microarray-based multiple detection kit for genetic mutations, and multiple detection method for genetic mutations, using same

Abstract

The present invention relates to a plasmonic microarray-based multiple detection kit for genetic mutations, and a multiple detection method for genetic mutations, using same, and, specifically, to a plasmonic microarray-based multiple detection kit for genetic mutations, and a multiple detection method for genetic mutations, using same, the kit comprising: a nucleic acid amplification composition for a target gene; a multi-analysis substrate on which a capture probe for capturing both a wild-type gene and a mutation-type gene of the target gene as nucleic acid amplification products is fixed in an array form on a surface fluorescence amplification substrate; and a fluorescent probe that binds to both the wild-type gene and the mutation-type gene captured by the capture probe, wherein the nucleic acid amplification composition includes: a nucleic acid amplification primer set that can amplify both the wild-type gene and the mutation-type gene of the target gene; and a probe having a quencher that binds to the wild-type gene.

Description

Plasmonic microarray-based genetic mutation multiplexing kit and genetic mutation multiplexing method using the same

[0001] The present invention relates to a plasmonic microarray-based genetic mutation multiplex detection kit and a genetic mutation multiplex detection method using the same.

[0002]

[0003] Genotyping of living organisms is widely used in disease risk assessment, diagnosis, prognosis, and treatment recommendations. For example, mutation analysis of specific genes in a specific individual can predict disease risk and lead to proactive disease prevention. For example, epidermal growth factor receptor (EGFR) mutations have become a pivotal biomarker in oncology, particularly in the management of lung cancer. EGFR mutations are reported to be the most common in non-small cell lung cancer (NSCLC) patients, with approximately 40-50% of cases having EGFR mutations. Among these mutations, EGFR exon 19 deletion (E19Del) is known to account for about 50%, EGFR exon 21 point mutation (EGFR exon 21 L858R point mutation, E21 L858R) for about 40%, and EGFR exon 20 insertion (EGFR exon 20 insertion, E20Ins) for about 5%. However, these statistics are based on direct sequencing or next-generation sequencing (NGS) with relatively low sensitivity, so the analysis may not be completely accurate.

[0004] Meanwhile, liquid biopsy utilizing circulating tumor DNA (ctDNA) has emerged as a less invasive and patient-friendly approach for cancer screening, providing an alternative to conventional surgical tumor biopsy. However, NGS has disadvantages such as low analytical sensitivity (~1%), high cost, long processing time (approximately 9 days), and the need for specialized equipment. Recently, polymerase chain reaction (PCR) technology has shown promise by providing rapid detection and somewhat improved analytical sensitivity (~0.1-0.01%) compared to NGS. However, PCR still faces the problem of low analytical sensitivity and has the disadvantage of not covering the wide diversity of mutations between individuals. For example, the known E19Del occurs within a range of 25 base pairs, so it is approximately 2 25 Deletion scenarios are possible. However, FDA-approved EGFR mutation test kits, such as the cobas® EGFR Mutation Test and the Qiagen therascreen EGFR RGQ PCR Kit, can only detect the 29 and 14 most common deletion mutations, respectively, using specific deletion-targeting primers. Therefore, this approach may have low clinical sensitivity. Therefore, successful early cancer diagnosis and monitoring using ctDNA detection requires achieving very high analytical sensitivity and encompassing a wide diversity of mutations to ensure high clinical sensitivity.

[0005]

[0006] Meanwhile, as a method of amplifying DNA like PCR technology, Recombinase Polymerase Amplification (RPA) is a method that uses bacteriophage T4 recombinase to cause dissociation of DNA double strands and uses DNA polymerase and specific primers to amplify specific DNA. Like PCR, this can amplify DNA of a specific base sequence using a target substrate and a pair of primers, but unlike PCR, it can cause the amplification reaction under isothermal conditions in a certain temperature range (37℃ to 42℃) and has the advantage of a short reaction time of 20 to 40 minutes. However, the amplification efficiency, detection sensitivity, and specificity are low, so the detection capacity is not sufficient to detect trace amounts of target nucleic acids, and therefore, there are limitations in clinical application.

[0007] Accordingly, Korean Patent Publication No. 10-2022-0116761 discloses a recombinant enzyme-polymerase isothermal amplification device that improves sensitivity and specificity by simultaneously performing recombinant enzyme-polymerase amplification and causing surface fluorescence amplification.

[0008]

[0009] The present inventors, while studying a method capable of simultaneously detecting multiple mutations in a target gene with high sensitivity, developed a method capable of simultaneously detecting multiple mutant genes with high sensitivity by using nucleic acid amplification and surface fluorescence amplification together, amplifying mutant genes during nucleic acid amplification while binding a quencher to wild type (non-mutant) genes to suppress amplification of wild type genes, fixing capture probes that commonly capture wild type genes and mutant type genes on a surface fluorescence amplification substrate in an array form, and then binding a fluorescent probe in common to the wild type genes and mutant genes captured by the capture probes to cause fluorescent expression of the captured genes while suppressing fluorescence expression of the wild type genes by the quencher, and thereby completing the present invention.

[0010]

[0011] The purpose in one aspect is

[0012] The purpose is to provide a plasmonic microarray-based genetic mutation multiplex detection kit.

[0013]

[0014] The purpose in another aspect is

[0015] The present invention provides a method for multiplex detection of genetic mutations using the above plasmonic microarray-based genetic mutation multiplex detection kit.

[0016]

[0017] To achieve the above purpose,

[0018] On one hand,

[0019] Composition for amplifying nucleic acid for a target gene;

[0020] A multiplex analysis substrate having capture probes that commonly capture wild type genes and mutant type genes for the target genes as the nucleic acid amplification products fixed in an array form on a surface fluorescence amplification substrate; and

[0021] A fluorescent probe that binds commonly to the wild type gene and mutant gene captured by the above capture probe;

[0022] The above nucleic acid amplification composition

[0023] A nucleic acid amplification primer set capable of commonly amplifying the wild type gene and the mutant gene for the target gene; and

[0024] A plasmonic microarray-based genetic mutation multiplexing kit is provided, comprising a probe having a quencher that binds to the above wild-type gene.

[0025]

[0026] At this time, the surface fluorescence amplification substrate,

[0027] A substrate comprising nano-pillars;

[0028] A metal layer laminated on the above substrate; and

[0029] It may include a plurality of metal nanoparticles bonded to the metal layer.

[0030]

[0031] In addition, at this time, the metal in the metal layer and metal nanoparticles may be at least one selected from Au, Ag, Cu, Al, Pt, Pd, Ti, Rd, Ru, and alloys thereof.

[0032]

[0033] The above nucleic acid amplification composition commonly amplifies a wild type gene and a mutant type gene, but the amplification of the wild type gene can be inhibited by a probe having a quencher that binds to the wild type gene.

[0034]

[0035] The mutant gene captured by the above capture probe is bound to the fluorescent probe and fluorescence is expressed,

[0036] The wild-type gene captured by the above capture probe can have its fluorescence expression suppressed by the quencher, although the fluorescent probe is bound to it.

[0037]

[0038] The above primer set can specifically amplify the target gene.

[0039]

[0040] The above primer set includes a forward primer and a reverse primer, and at least one of the forward primer and the reverse primer may be phosphorylated at the 5' end.

[0041]

[0042] It includes a quencher that binds to a wild-type gene, and may further include a wild-type inhibitor that suppresses fluorescence expression of the wild-type gene.

[0043]

[0044] The above genetic mutation multiplex detection kit can simultaneously detect one or more of insertion mutations, deletion mutations, and point mutations.

[0045]

[0046] The above genetic mutation multiple detection kit is a kit that multiplexes genetic mutations and can simultaneously detect one or more of exon 19 deletion, EGFR (Epidermal Growth Factor Receptor) exon 20 insertion, and exon 21 point mutation.

[0047]

[0048] On another note,

[0049] As a method for multiplex detection of genetic mutations using the above plasmonic microarray-based genetic mutation multiplex detection kit,

[0050] A step of preparing a composition for nucleic acid amplification, comprising a primer set for common nucleic acid amplification of a wild type gene and a mutant gene for a target gene; and a probe having a quencher that binds to the wild type gene;

[0051] A step of mixing and reacting a sample containing a target gene with the nucleic acid amplification composition to commonly amplify a wild-type gene and a mutant gene for the target gene, wherein the amplification of the wild-type gene is inhibited by the quencher-equipped probe;

[0052] A method for multiplex detection of genetic mutations is provided, comprising the steps of mixing the product of the above reaction with a fluorescent probe that binds commonly to a wild-type gene and a mutant gene, and applying the mixture to a surface fluorescence amplification substrate on which capture probes that commonly capture the wild-type gene and the mutant gene for the target gene are fixed in an array form, thereby causing the mutant gene to express fluorescent light.

[0053]

[0054] At this time, the reaction between the target gene-containing sample and the nucleic acid amplification composition can be performed at a temperature of 37°C to 42°C for 20 to 40 minutes.

[0055]

[0056] In addition, the step of making the mutant gene fluoresce

[0057] It includes a quencher that binds to a wild-type gene, and a wild-type inhibitor that suppresses fluorescence expression of the wild-type gene can be further mixed.

[0058]

[0059] A plasmonic microarray-based genetic mutation multiplexing kit according to one embodiment has the advantage of being able to detect all deletion and insertion mutations within a target region of a target gene with high sensitivity and simultaneously detecting multiple mutations.

[0060] The effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0061]

[0062] FIGS. 1A and 1B are schematic diagrams illustrating multiplex detection of genetic mutations using a plasmonic microarray-based genetic mutation multiplex detection kit according to one embodiment.

[0063] FIGS. 2A to 3B are drawings showing the results of evaluating the plasmon-enhanced fluorescence (PEF) effect on DNA of a multiplex analysis substrate included in a plasmonic microarray-based genetic mutation multiplex detection kit according to one embodiment.

[0064] FIGS. 4A to 4D are drawings showing the results of evaluating the amplification inhibition effect of a wild-type inhibitor included in a plasmonic microarray-based genetic mutation multiplex detection kit according to one embodiment.

[0065] Figures 5a to 9 are drawings showing the results of evaluating the mutation detection sensitivity of a plasmonic microarray-based genetic mutation multiplexing kit according to one embodiment.

[0066] FIGS. 10A and 10B are drawings showing the results of evaluating the detection specificity of a plasmonic microarray-based genetic mutation multiplex detection kit according to one embodiment.

[0067] Figures 11a to 11d are drawings showing the results of evaluating the mutation detection sensitivity for clinical samples of a plasmonic microarray-based genetic mutation multiplex detection kit according to one embodiment.

[0068]

[0069] Hereinafter, preferred embodiments of the present invention will be described with reference to the attached drawings. However, the embodiments of the present invention may be modified in various other forms, and the scope of the present invention is not limited to the embodiments described below. In addition, the following embodiments are provided to more completely explain the present invention to those with average knowledge in the relevant technical field. Therefore, the shape and size of elements in the drawings may be exaggerated for clearer description, and elements indicated by the same reference numerals in the drawings are the same elements. In addition, the same reference numerals are used throughout the drawings for parts with similar functions and actions. In addition, the term "including" a certain element throughout the specification does not exclude other elements, but rather means that other elements may be included, unless specifically stated otherwise.

[0070]

[0071] On one hand,

[0072] Composition for amplifying nucleic acid for a target gene;

[0073] A multiplex analysis substrate having capture probes that commonly capture wild type genes and mutant type genes for the target genes as the nucleic acid amplification products fixed in an array form on a surface fluorescence amplification substrate; and

[0074] A fluorescent probe that binds commonly to the wild type gene and mutant gene captured by the above capture probe;

[0075] The above nucleic acid amplification composition

[0076] A nucleic acid amplification primer set capable of commonly amplifying the wild type gene and the mutant gene for the target gene; and

[0077] A plasmonic microarray-based genetic mutation multiplex detection kit is provided, comprising a probe having a quencher that binds to the above wild-type gene.

[0078]

[0079] Hereinafter, a plasmonic microarray-based genetic mutation multiplexing kit according to one embodiment will be described in detail for each component with reference to the drawings.

[0080]

[0081] A plasmonic microarray-based genetic mutation multiplexing kit according to one embodiment has the advantage of being able to simultaneously detect one or more mutant genes excluding a wild-type gene in a mixture containing a wild-type gene and one or more mutant genes.

[0082] For example, a plasmonic microarray-based genetic mutation multiplexing kit according to one embodiment can simultaneously detect mutations in the EGFR gene, namely exon 19 deletion (E19Del), exon 20 insertion (E20Ins), and exon 21 point mutation (L858R).

[0083]

[0084] FIG. 1 is a schematic diagram showing multiplex detection of genetic mutations using a plasmonic microarray-based genetic mutation multiplex detection kit according to one embodiment. The upper drawing of FIG. 1 is a schematic diagram showing mutations of the EGFR (Epidermal Growth Factor Receptor) gene, such as exon 19 deletion (E19Del), exon 20 insertion (E20Ins), and exon 21 point mutation (Exon 21 L858R point mutation, L858R), and a schematic diagram showing detection of exon 19 deletion (E19Del) using a plasmonic microarray-based genetic mutation multiplex detection kit, and the lower drawing of FIG. 1 is a schematic diagram showing that a wild type gene is not detected.

[0085]

[0086] A plasmonic microarray-based genetic mutation multiplexing kit according to one embodiment comprises a composition for amplifying nucleic acids for a target gene.

[0087] The above nucleic acid amplification composition

[0088] A nucleic acid amplification primer set capable of commonly amplifying the wild type gene and the mutant gene for the target gene; and

[0089] A probe having a quencher that binds to the above wild type gene;

[0090]

[0091] The above composition for nucleic acid amplification may preferably be a composition for recombinase-polymerase amplification (RPA).

[0092]

[0093] The above primer set is characterized in that it specifically amplifies the target gene, but also commonly amplifies nucleic acids of the wild type gene and the mutant gene for the target gene.

[0094] For example, primer sequences for detecting deletion and insertion mutant genes are identical to those of the wild-type gene, except for the region where the mutation occurs. Therefore, the primer set includes common sequences in the mutant and wild-type genes, allowing amplification of both the wild-type and mutant genes.

[0095]

[0096] Meanwhile, forward primers for point mutation detection can specifically amplify point mutation genes through sequences that match the point mutation. For example, a forward primer for detecting the E21 L858R point mutation in EGFR can specifically amplify the point mutation gene by having a 3'-terminal sequence that matches the point mutation.

[0097]

[0098] The above primer set includes a forward primer and a reverse primer, and at least one of the forward primer and the reverse primer may be phosphorylated at the 5' end.

[0099] This is to form single-stranded DNA (ss DNA) by enzymatically decomposing the phosphorylated strand, thereby enabling effective hybridization of wild type genes and mutant type genes as nucleic acid amplification products with capture probes fixed on a surface fluorescence amplification substrate.

[0100]

[0101] In addition, the probe with a quencher that binds to the wild-type gene may be a wild-type inhibitor, which is identical to the sequence of the region where a mutation occurs in the wild-type gene sequence, but may have a quencher labeled at the 3' end.

[0102]

[0103] Accordingly, the probe with the quencher binds only to the wild-type gene and does not bind to the mutant gene.

[0104]

[0105] Accordingly, by performing multiple RPA, which is one of the rapid isothermal amplification methods, using a nucleic acid amplification composition including the above primer set and a wild-type inhibitor, a mutant type gene can be amplified, but amplification of the wild-type gene can be suppressed, thereby significantly increasing the amplification ratio of the mutant type gene compared to the wild-type gene.

[0106]

[0107] A plasmonic microarray-based genetic mutation multiplexing kit according to one embodiment includes a multiplexing substrate having capture probes that commonly capture wild type genes and mutation type genes for target genes as amplification products generated by the nucleic acid amplification fixed in an array form on a surface fluorescence amplification substrate.

[0108]

[0109] At this time, the surface fluorescence amplification substrate,

[0110] A substrate comprising nano-pillars;

[0111] A metal layer laminated on the above substrate; and

[0112] It may include a plurality of metal nanoparticles bonded to the metal layer.

[0113]

[0114] At this time, the nanopillar is a pillar-shaped nanostructure with a diameter of about 10 nanometers. The nanopillar may be referred to as a nanofiller. The substrate including the nanopillar may have a form in which a plurality of nanopillars are spaced apart and arranged on the surface. The substrate may be a polymer, glass, ceramic, metal, paper, resin, silicon, or metal oxide.

[0115] Additionally, the nanopillars may be formed by plasma etching, soft lithography, nanoimprint lithography, photo lithography, or holographic lithography.

[0116] The above metal layer and metal nanoparticles may be formed using thermal deposition, vapor deposition, or solution process.

[0117] At this time, the metal in the metal layer and metal nanoparticles may be at least one selected from Au, Ag, Cu, Al, Pt, Pd, Ti, Rd, Ru, and alloys thereof.

[0118] For example, the surface fluorescence amplification substrate may be an Au / PET nanopillar in which gold nanoparticles (AuNPs) are formed at a high density on a PET film.

[0119]

[0120] The above multi-analysis substrate is one in which the capture probes are fixed in an array form on the surface fluorescence amplification substrate.

[0121] At this time, the multi-analysis substrate can be formed by combining streptavidin with an excess of biotinylated capture probes to fix the capture probes to the surface fluorescence amplification substrate, spotting them on the surface fluorescence amplification substrate to form an array, and coating the remaining portion except for the portion where the capture probe array is formed with BSA to suppress non-specific binding, thereby further increasing specificity.

[0122] Plasmonic enhancement is a phenomenon in which the interaction of light and metal nanostructures enhances the electromagnetic field, thereby enhancing the signal of nearby fluorophores, improving sensitivity, and lowering the detection limit. According to one embodiment, a plasmonic microarray-based genetic mutation multiplexing kit is characterized in that the detection sensitivity is further improved by fixing a capture probe on the surface fluorescence amplification substrate and causing the mutant gene captured by the capture probe to express fluorescence.

[0123]

[0124] At this time, the sequence of the capture probe is identical to the reverse primer of the primer set, but may be labeled with biotin at the 5' end.

[0125] At this time, the mutant gene and the wild-type gene can be generated as single-stranded DNA (ssDNA) by enzymatically decomposing the phosphorylated strand of the nucleic acid amplification product using lambda exonuclease for the hybridization, and the single-stranded DNA (ssDNA) thus formed can hybridize with the capture probe.

[0126]

[0127] A plasmonic microarray-based genetic mutation multiplexing kit according to one embodiment comprises a fluorescent probe that binds commonly to a wild-type gene and a mutant gene captured by the capture probe.

[0128] At this time, the sequence of the fluorescent probe is complementary to the forward primer of the primer set and is labeled with a cyanine dye (Cy5) at the 3' end.

[0129] Accordingly, the fluorescent probe can hybridize with both mutant genes and wild-type genes.

[0130] Meanwhile, the wild type gene is bound to a probe with a quencher, so that even if hybridized with a fluorescent probe, no fluorescence is expressed.

[0131] Accordingly, in a plasmonic microarray-based genetic mutation multiplexing kit according to one embodiment, when an amplified product and a fluorescent probe by the nucleic acid amplification composition are applied to a multiple analysis substrate on which the capture probe is fixed in an array form, the amplified mutant gene can exhibit a greatly enhanced fluorescent signal due to the plasmon-enhanced fluorescence (PEF) effect, while the amplified wild-type gene does not exhibit fluorescence due to the quencher, so that only the mutant gene can be selectively detected.

[0132]

[0133] According to one embodiment, a plasmonic microarray-based genetic mutation multiplexing kit can simultaneously detect one or more of an insertion mutation, a deletion mutation, and a point mutation, and specifically, can simultaneously detect one or more of an exon 19 deletion, an exon 20 insertion, and an exon 21 L858R point mutation, which are mutations of the EGFR (Epidermal Growth Factor Receptor) gene, with high sensitivity.

[0134]

[0135] On another note,

[0136] As a method for multiplex detection of genetic mutations using the above plasmonic microarray-based genetic mutation multiplex detection kit,

[0137] A step of preparing a composition for nucleic acid amplification, comprising a primer set for common nucleic acid amplification of a wild type gene and a mutant gene for a target gene; and a probe having a quencher that binds to the wild type gene;

[0138] A step of mixing and reacting a sample containing a target gene with the nucleic acid amplification composition to commonly amplify a wild-type gene and a mutant gene for the target gene, wherein the amplification of the wild-type gene is inhibited by the quencher-equipped probe;

[0139] A method for multiplex detection of genetic mutations is provided, comprising the steps of mixing the product of the above reaction with a fluorescent probe that binds commonly to a wild-type gene and a mutant gene, and applying the mixture to a surface fluorescence amplification substrate on which capture probes that commonly capture the wild-type gene and the mutant gene for the target gene are fixed in an array form, thereby causing the mutant gene to express fluorescent light.

[0140]

[0141] Hereinafter, a method for multiple detection of genetic mutations according to an embodiment is described in detail step by step.

[0142] A method for multiplexed detection of genetic mutations according to one embodiment comprises the steps of preparing a nucleic acid amplification composition comprising a nucleic acid amplification primer set capable of commonly amplifying nucleic acids of a wild-type gene and a mutant gene for a target gene; and a probe having a quencher that binds to the wild-type gene.

[0143]

[0144] The above primer set is characterized in that it specifically amplifies the target gene, but also commonly amplifies nucleic acids of the wild type gene and the mutant gene for the target gene.

[0145] The above primer set includes a forward primer and a reverse primer, and at least one of the forward primer and the reverse primer may be phosphorylated at the 5' end.

[0146] This is to form single-stranded DNA (ss DNA) by enzymatically degrading the subsequently purified strand, thereby enabling effective hybridization of wild type genes and mutant type genes as nucleic acid amplification or RPA amplification products with capture probes fixed on a surface fluorescence amplification substrate.

[0147]

[0148] In addition, the probe with a quencher that binds to the wild-type gene may be a wild-type inhibitor, which is identical to the sequence of the region where a mutation occurs in the wild-type gene sequence, but may have a quencher labeled at the 3' end.

[0149] Accordingly, the probe with the quencher binds only to the wild-type gene and does not bind to the mutant gene.

[0150]

[0151] A method for multiplexing genetic mutations according to one embodiment includes a step of mixing and reacting a sample containing a target gene with the nucleic acid amplification composition to commonly amplify a wild-type gene and a mutant gene for the target gene, wherein amplification of the wild-type gene is inhibited by the quencher-equipped probe.

[0152]

[0153] The above nucleic acid amplification composition comprises a primer set and a wild-type inhibitor, thereby performing multiple RPA, which is one of the rapid isothermal amplification methods, thereby amplifying a mutant type gene, while suppressing amplification of a wild type gene, thereby significantly increasing the amplification ratio of a mutant type gene compared to a wild type gene.

[0154] At this time, the reaction between the target gene-containing sample and the nucleic acid amplification composition can be performed at a temperature of 37°C to 42°C for 20 to 40 minutes.

[0155]

[0156] A method for multiplexing genetic mutations according to one embodiment includes a step of mixing the product of the above reaction with a fluorescent probe that binds commonly to a wild-type gene and a mutant gene, applying the mixture to a multiplex analysis substrate in which capture probes that commonly capture the wild-type gene and the mutant gene for the target gene are fixed in an array form on a surface fluorescence amplification substrate, thereby causing the mutant gene to fluoresce.

[0157]

[0158] At this time, the surface fluorescence amplification substrate may include a substrate including nano-pillars; a metal layer laminated on the substrate; and a plurality of metal nanoparticles bonded to the metal layer.

[0159] In addition, at this time, the metal in the metal layer and metal nanoparticles may be at least one selected from Au, Ag, Cu, Al, Pt, Pd, Ti, Rd, Ru, and alloys thereof.

[0160]

[0161] The above multi-analysis substrate is a surface fluorescence amplification substrate in which capture probes that commonly capture wild-type genes and mutant genes for target genes are fixed in an array form.

[0162] At this time, the sequence of the capture probe is identical to the reverse primer of the primer set, but may be labeled with biotin at the 5' end.

[0163] Additionally, the sequence of the fluorescent probe is complementary to the forward primer of the primer set and is labeled with a cyanine dye (Cy5) at the 3' end.

[0164] Accordingly, the capture probe and fluorescent probe can hybridize with both mutant genes and wild-type genes.

[0165] Meanwhile, the wild type gene is bound to a probe with a quencher, so that even if hybridized with a fluorescent probe, no fluorescence is expressed.

[0166]

[0167] The step of causing the mutant gene to express fluorescence includes a quencher that binds to the wild-type gene, and a wild-type inhibitor that suppresses fluorescence expression of the wild-type gene can be further mixed, thereby further suppressing fluorescence expression of the wild-type gene.

[0168]

[0169] Accordingly, a method for multiplexing genetic mutations according to one embodiment applies an amplified product and a fluorescent probe by the nucleic acid amplification composition to a multiplexing substrate on which the capture probe is fixed in an array form, thereby enabling amplified mutant genes to exhibit a greatly enhanced fluorescent signal due to the plasmon-enhanced fluorescence (PEF) effect, while the amplified wild-type genes do not exhibit fluorescence due to the quencher, thereby enabling high sensitivity detection of only mutant genes.

[0170]

[0171] Hereinafter, the present invention will be described in detail through examples and experimental examples.

[0172] However, the following examples and experimental examples are only illustrative of the present invention, and the content of the present invention is not limited by the following examples.

[0173] In the manufacturing examples and examples below, the primers and probes in Table 1 below were used.

[0174] Target gene Oligo type Sequence 5'-3' Size (nt) EGFR E19Del Template Wild type GTGAGAAAAGTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGT Deletion GTGAGAAAAGTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGT Primer & Probe Forward primer GTGAGAAAAGTTAAAATTCCCGTCGCTATCAAG Reverse primer P-ACAGCAAAGCAGAAACTCACATCGAGGATT Wild type inhibitor TTCGGAGATGTTGCTTCTCTTAATTC-BHQ226 Fluorescence Probe CTGATAGCGACGGGAATTTTAACTTTCTCAC-Cy532 Capture Probe Biotin-ACAGCAAAGCAGAAACTCACATCGAGGATT30EGFR E20 Ins Template Wild type CACTGACGTGCCTCTCCCTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCAC92 Insertion CACTGACGTGCCTCTCCCTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAGCGTGGACAGACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCAC102 Primer & Probe Forward Primer CACTGACGTGCCTCTCCCTCCCTC24 Reverse Primer P-GTGAGGCAGATGCCCAGCAGGCG23 Wild type Inhibitor GCACACGTGGGGGTTGTCCACGCTGGCCATCACGTAGGCTTCCTG-BHQ245 Fluorescent probe GAGGAGGGAGAGGCACGTCAGTG-Cy524 Capture probe Biotin-GTGAGGCAGATGCCCAGCAGGCG23 EGFR E21L858R Template Wild typetype)CGCAGCATGTCAAGATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGTGGCTTTAGGT103Point mutation (L858R mutation)CGCAGCATGTCAAGATCACAGATTTTGGGCGGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGTGGCTTTAGGT103Primers & ProbeForward primerCGCAGCATGTCAAGATCACAGATTTTGGGCG31Reverse primerP-ACCTAAAGCCACCTCCTTACTTTGCCTCCTTC32Wild type inhibitorCCAGC-BHQ25Fluorescent probeCCCGC-Cy55Capture probeBiotin-ACCTAAAGCCACCTCCTTACTTTGCCTCCTTC32

[0175] Primer sequences for detecting E19Del or E20Ins mutations are designed to be identical to the wild type except for the regions prone to E19Del and E20Ins occurrence.

[0176]

[0177] <Materials>

[0178] Polyethylene terephthalate (PET) film with a thickness of 188 μm was purchased from TORAY INDUSTRIES, INC. (Tokyo, Japan). A 97% solution of 1H,1H,2H,2H-PFDT (Perfluorodecanethiol) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Gold was purchased from iTASCO (Seoul, Korea). Synthetic templates, primers, probes, and MagListo® cfDNA Extraction Kit (Daejeon, Korea) were purchased from Bioneer (Daejeon, Korea). The TwistAmp® basic kit for RPA (Recombinase Polymerase Amplification) was purchased from TwistDx (Babraham, UK). PCR Master Mix (2X) and Lambda Exonuclease were purchased from Thermo Fisher (Carlsbad, CA, USA).

[0179]

[0180] <Manufacturing Example 1> Manufacturing of a 3D plasmonic substrate

[0181] The PET film was treated with Ar plasma for 2 min using a custom-built RF ion-etching instrument (LAT, Korea) with fixed parameters of 5 sccm Ar flow, 80 mTorr pressure, and 100 W plasma power to form a nanopillar substrate. Afterwards, a thermal evaporation system (LAT, Korea) was used to etch the PET film with 2.0 Ås Ar plasma. -1 Speed ​​of 9.6 Х 10 -6 Under a base pressure of 10 Torr, a 100 nm thick Au layer was formed on a PET nanopillar substrate. Subsequently, the substrate was treated with a PFDT solution and then deposited at 0.3 Ås using a thermal evaporation system. -1Au was thermally evaporated at a rate of 1000 rpm to form a high-density Au particle-coated Au / PET nanopillar substrate on a PET substrate, which was named a 3D plasmonic substrate. For analysis, the 3D plasmonic substrate was cut into 8 mm x 8 mm pieces and manufactured in the form of an analysis chip.

[0182]

[0183] <Manufacturing Example 2> Manufacturing of EGFR mutation multiplex assay chip

[0184] A mixture of 1 μL (0.1 mg / mL) of streptavidin, 5 μL (10 μM) of biotin-modified oligonucleotide capture probes targeting exon 19, exon 20, and exon 21, and 14 μL of DEPC (diethylpyrocarbonate)-treated water was dropped onto the analysis chip of Manufacturing Example 1 in the form of spots with a volume of 50 nL using BIOSPOT® Custom (BioFluidix, Germany), such that each spot had a 3X3 arrangement and the gap between each spot was 1.5 mm. This was then stored in a refrigerator at 4°C overnight to fix the spots to the analysis chip.

[0185] Afterwards, to remove the residual components (streptavidin and capture probe) that were not bound to the chip, the chip was washed three times with DEPC-treated water, and the area where no spots were formed was coated with a 0.5% bovine serum albumin (BSA) solution at 25°C for 2 hours. The analysis chip was then washed three more times with DEPC-treated water to produce an EGFR mutation multiplex analysis chip. The produced EGFR mutation multiplex analysis chip was stored in a refrigerator at 4°C until needed.

[0186]

[0187] <Manufacturing Example 3>

[0188] In the above Manufacturing Example 2, an EGFR mutation multiplex analysis chip was manufactured by performing the same method as Manufacturing Example 2, except that a polystyrene substrate was used instead of the analysis chip of Manufacturing Example 1.

[0189]

[0190] <Example 1> Multiple detection of genetic mutations

[0191] Step 1: Nucleic acid amplification was performed using the following RPA method.

[0192] RPA

[0193] RPA reaction reagents included in TwistAmp® Liquid Basic, 500 nM each of forward primer and 5' end phosphorylated reverse primer targeting each of exon 19, exon 20, and exon 21, and 10 μM each of 3' end quencher (BHQ2)-labeled wild-type inhibitor targeting each of exon 19, exon 20, and exon 21, were mixed with the mutual type DNA templates with exon 19 deletion (E19Del), exon 20 insertion (E20Ins), or exon 21 point mutation (E21 L858R) and the wild type DNA templates for exon 19, exon 20, and exon 21 to a total volume of 20 μL.

[0194] The reaction was performed at a constant temperature of 39°C for 30 min using a ThermoMixer C (Eppendorf, Hamburg, Germany).

[0195] Step 2: Hybridization on the analysis chip was performed using the following method.

[0196] The RPA solution generated after the amplification reaction in Step 1 was mixed with 1 μL of Lambda Exonuclease, 5 μL of 10X reaction buffer, and DEPC-treated water to make a reaction volume of 50 μL, and incubated at 37°C for 30 minutes. Thereafter, 1 μL of fluorescent probes (5 μM) that bind to the mutant type and wild type exons 19, 20, and 21, respectively, and 1 μL of wild-type inhibitor (500 μM) that binds to the wild type exons 19, 20, and 21, respectively, were additionally added, and then applied to the analysis chip of Manufacturing Example 2 contained in a sealed container. Afterwards, it was incubated at 37°C for 15 minutes for hybridization, washed three times with DEPC-treated water, and dried.

[0197]

[0198] <Example 2> Clinical specimen testing

[0199] In step 1 of Example 1, the same method as Example 1 was performed, except that instead of using a mutant type DNA template and a wild type DNA template, cfDNA was isolated from a human blood sample as follows.

[0200] cfDNA isolation

[0201] Human blood samples were ethically collected at Samsung Medical Center (Seoul, Korea) after obtaining the participants' explicit consent for study participation. This study was conducted in accordance with the approval of the Institutional Review Board (IRB approval number: SMC 2021-06-083-015). Blood samples were collected using EDTA-treated vacuum tubes and immediately stored at 4°C. Plasma was separated within 8 hours of collection using a centrifuge (1600 × g, 10 min, 4°C) and then transferred to sterile tubes and stored at -80°C until analysis. The pathological classification of lung tumors as benign (noncancerous) and malignant (cancerous) was confirmed through tissue biopsy. Commercialized MagListo TM cfDNA was isolated from plasma samples using a cfDNA extraction kit. 1–2 μL of each cfDNA was used for RPA amplification.

[0202]

[0203] <Comparison Example 1>

[0204] The same method as Example 1 was performed except that the PCR below was performed instead of RPA in Step 1 of Example 1 above.

[0205] PCR

[0206] PCR master mix (2X), 500 nM each of forward primer and 5' end phosphorylated reverse primer targeting each of exon 19, exon 20, and exon 21, and 10 μM each of 3' end quencher-labeled blockers targeting each of exon 19, exon 20, and exon 21 were mixed with the mutual type DNA templates with exon 19 deletion (E19Del), exon 20 insertion (E20Ins), or exon 21 point mutation (E21 L858R) and the wild type DNA templates for exon 19, exon 20, and exon 21 to a total volume of 20 μL.

[0207] PCR was performed using a CFX96 Realtime System (BioRad, CA, USA) under the following conditions: 95°C for 5 min, followed by 40 cycles of 95°C for 1 min 30 s, 59°C for 30 s, and 72°C for 60 s, for a total cycling time of approximately 2 h 30 min.

[0208]

[0209] <Comparison Example 2>

[0210] The same method as Example 1 was performed, except that the analysis chip of Manufacturing Example 3 was used instead of the analysis chip of Manufacturing Example 2 in the above Example 1.

[0211]

[0212] <Analysis Method>

[0213] The analysis chips manufactured in Examples 1, 2, and Comparative Example 1 were scanned using an InnoScan 710 Microarray Scanner (Innopsys, Carbonne, France) with a laser excitation wavelength of 635 nm, and data intensity was extracted using Mapix software to perform data analysis for each chip. For comparison with Example 2, NGS panel analysis targeting 53 genes of cfDNA isolated in Example 2 was performed using Ion Torrent technology.

[0214]

[0215] <Experimental Example 1> PEF Effect of 3D Nanoplasmonic Substrate on DNA

[0216] To evaluate the plasmon-enhanced fluorescence (PEF) effect on the nanoplasmonic substrate for DNA by comparing the detection sensitivity with that of a polystyrene plate commonly used in ELISA, (1) a Cy5-labeled fluorescent probe and a DNA template (88 bp EGFR E19del mutant DNA was used as an example in Table 1) were hybridized to the analytical chips of Preparation Examples 2 and 3 using immobilized capture probes and analyzed by the above-described analytical method, and the results are shown in Fig. 2, and (2) the detection sensitivity of EGFR E19del mutant DNA was additionally evaluated in the presence of both EGFR E19 wild-type DNA (100 nM) and an excess of quencher-labeled wild-type inhibitor (10 μM), and the results are shown in Fig. 3.

[0217] At this time, the Cy5 label of the probe was designed to face the nanoplasmonic substrate located approximately 25 nm from the surface, as shown in Fig. 1 (5 nm for streptavidin, ~20 nm for 56 bp DNA).

[0218] As shown in Fig. 2, in the case of the analysis chip of Manufacturing Example 2, it can be confirmed that a signal can be detected up to 1 fM even without nucleic acid amplification, whereas in the case of the analysis chip of Manufacturing Example 3 using a polystyrene plate, it can be confirmed that a fluorescence signal that can be detected only up to 1 pM is shown under the same conditions.

[0219] From the above results, it can be confirmed that the surface fluorescence amplification substrate can improve DNA detection sensitivity by 1,000 times through the plasmon-enhanced fluorescence (PEF) effect.

[0220]

[0221] In addition, as shown in Fig. 3, in the case of the nanoplasmonic substrate of Manufacturing Example 2, when 100 nM of EGFR E19 wild-type DNA was present, EGFR E19del mutant DNA could be detected up to 100 fM, which showed a 100-fold decrease in sensitivity compared to when EGFR E19 wild-type DNA was not present. This indicates that EGFR E19del mutant DNA was present at 0.0001% (100 fM mutant / 100 nM wild-type) compared to wild-type DNA. In addition, no fluorescence signal was observed when only wild-type DNA (100 nM) was present, which is because the wild-type inhibitor was present in excess.

[0222] Meanwhile, in the case of the polystyrene plate of Manufacturing Example 3, when 100 nM of EGFR E19 wild-type DNA was present, EGFR E19del mutant DNA could only be detected up to 1 nM, which is a 1000-fold decrease in sensitivity compared to when EGFR E19 wild-type DNA was not present. This indicates that EGFR E19del mutant DNA exists at 1% compared to wild-type DNA.

[0223] As a result, the nanoplasmonic substrate of Manufacturing Example 2 has a mutation detection sensitivity of 10 compared to the polystyrene substrate. 4 You can see that the ship has improved.

[0224]

[0225] <Experimental Example 2> Amplification inhibition effect of wild-type inhibitor

[0226] To evaluate the inhibitory effect of wild-type inhibitors on wild-type DNA amplification compared to mutant DNA, SYBR green-based real-time PCR was performed on EGFR E19del DNA (ranging from 100 fM to 100 μM) and wild-type DNA (100 fM and 10 fM) using the same primers listed in Table 1 in the presence of excess quencher-labeled wild-type inhibitors (10 μM), and the results are shown in Figures 4a to 4d.

[0227] As shown in Figures 4a to 4d, even in the presence of the quencher-labeled wild-type inhibitor, EGFR E19del DNA was well amplified with a Ct value of 24.1 even at 100 fM, and showed a linear decrease in the Ct value as the concentration of EGFR E19del DNA increased. On the other hand, although the wild-type DNA was amplified, its Ct value was significantly increased compared to EGFR E19del DNA. At a concentration of 100 fM, the Ct value of the wild-type DNA was 17.5, which was an increase of 14.03 compared to the Ct value of 3.47 of EGFR E19del DNA. Similarly, at a concentration of 10 fM, the Ct value of the wild-type DNA was 23.56, which was an increase of 15.5 compared to the Ct value of 8.06 of EGFR E19del DNA. The concentration of the wild-type DNA showing the same Ct value was approximately 10 times higher than the concentration of EGFR E19del DNA. 4 ~10 5 was twice as high (see Figure 4B). These results confirm that the wild-type inhibitor significantly inhibits the amplification of wild-type DNA. Furthermore, gel electrophoresis further verified proper amplification, revealing a size difference between the wild-type amplicon (100 bp) and the EGFR E19del amplicon (88 bp) (see Figure 4D).

[0228]

[0229] <Experimental Example 3> Mutation Detection Sensitivity Evaluation

[0230] The assay sensitivity for detecting EGFR mutant DNA in the presence of wild-type DNA was evaluated using the following method.

[0231] First, RPA (for 30 min) was performed on EGFR E19del DNA ranging from 1 fM to 100 μM in the presence of a fixed concentration of 10 fM wild-type DNA and a fixed concentration of 10 μM quencher-labeled wild-type inhibitor, using the method of Example 1 (wherein 500 nM of each primer was used to set the maximum amplicon concentration of both mutant and wild-type DNA to 500 nM), the amplified products were digested into ssDNA by Lambda exonuclease, and a fluorescent probe and additional wild-type inhibitor were further mixed to achieve complete fluorescence quenching from the wild-type DNA, and the mixture was hybridized to a nanoplasmonic substrate on which a capture probe was immobilized, and the results of analysis by the above-described analytical method are shown in FIG. 5.

[0232] As shown in Fig. 5, it can be confirmed that a clear fluorescent signal for the EGFR E19del amplicon of RPA appears even at a low concentration of 100zM (3 copies / rxn, 0.001%). In addition, the fluorescent signal slightly decreased as the concentration of EGFR E19del DNA decreased, but this decrease may be due to an increase in the ratio of the wild-type DNA amplicon as the concentration of E19del DNA decreased. It can be confirmed that when only the wild type is present as a control, no clear fluorescent signal appears due to the inhibitory effect of the wild-type inhibitor. These results indicate that the fluorescent signal is derived only from the E19del DNA amplicon.

[0233] Additionally, to determine the mutation detection limit compared to wild-type DNA, the concentration of EGFR E19del DNA was fixed at 100zM (3 copies / rxn) and the concentration of wild-type DNA was increased from 100fM to 100nM. The results of the analysis are shown in Fig. 6.

[0234] As shown in Fig. 6, a distinct fluorescence signal of EGFR E19del 100 zM (3 copies / rxn) was observed in the presence of up to 10 nM wild-type DNA, which indicates a mutation detection sensitivity of 10 compared to wild-type DNA. -9 This means %(100zM mutant / 10nM wild type).

[0235] In contrast, no fluorescence signal for EGFR E19del was detected at 100 nM in the presence of 100 nM wild-type DNA, and no fluorescence signal was detected in the presence of only 100 nM wild-type DNA. This very high sensitivity may be attributed to the synergistic effect of nanoplasmons and the wild-type inhibitor.

[0236]

[0237] Meanwhile, the results of the detection sensitivity analysis for EGFR E20ins DNA and E21 L858R are shown in Figs. 7 to 9. As shown in Figs. 7 and 8, E20ins and E21 L858R showed detectability up to 100zM (3 copies / rxn, 0.001%) in the presence of wild-type DNA at a fixed concentration of 10fM. In addition, as shown in Fig. 9, 100zM (3 copies / rxn) of E21 L858R DNA showed detectability even in the presence of up to 10nM of wild-type DNA, which means that the mutation detection sensitivity was 10 -9 It means %.

[0238] Therefore, we confirmed that the analytical sensitivities of EGFR E19del, E20ins, and E21 L858R were similar. The Cy5 label positions for EGFR E19del and E20ins are expected to vary depending on the mutation, but are within approximately 10 nm, so they are expected to exhibit similar sensitivities.

[0239]

[0240] <Experimental Example 4> Analytical Specificity Test of the EGFR Mutation Multiplex Assay Chip

[0241] In order to verify whether multiplex genetic mutation analysis is possible using a plasmonic microarray-based genetic mutation multiplex detection kit according to one embodiment, EGFR mutation multiplex analysis was performed to simultaneously detect E19Del, E20Ins, and E21 L858R mutations of EGFR, and the results are shown in Fig. 10.

[0242] At this time, 3-multiple RPA was performed using the method of Example 1, but using 3 primer sets (each 500 nM) and 3 wild-type inhibitors (each 10 μM) for detection of E19Del, E20Ins or E21 L858R, and each target template of E19Del, E20Ins or E21 L858R was added at a concentration of 1 fM.

[0243] As shown in Figure 10, fluorescence signals were observed only at the locations where target capture probes were immobilized for E19, E20, and E21. Conversely, in the absence of a target template, no distinguishable fluorescence signals were observed at any location. Consequently, we confirmed the high specificity of the 3D plasmonic microarray for E19Del, E20Ins, and E21 L858R.

[0244]

[0245] <Experimental Example 5> Clinical specimen testing using lung cancer patient plasma

[0246] To evaluate the EGFR mutation multi-analyzer chip for liquid biopsy, plasma samples were collected from patients with lung tumors (n=26), including malignant lung tumors (n=19) and benign (noncancerous) lung tumors (n=7). The malignant lung tumors were classified by stage: 1A (n=2), 2A (n=2), 2B (n=2), 3A (n=5), 3B (n=1), 4A (n=6), and 4B (n=1). Patient diagnoses were confirmed by tissue biopsy. Clinical characteristics are presented in Table 2 below.

[0247] ClassificationAgeSexHistological typeStageMutation detection using NGSMalignant lung tumor#164FAdenocarcinoma1A-#270MAdenocarcinoma1A-#368MSquamous cell carcinoma2A-#464MAdenocarcinoma2A-#551MSquamous cell carcinoma2B-#670MSquamous cell carcinoma2BTP53 (c.2313_2324dup)#750FAdenocarcinoma3AEGFR E19del (c.2236_2250del)#874MSmall cell carcinoma3A-#963MSquamous cell carcinoma3A-#1067M Adenocarcinoma3A-#1156F Adenocarcinoma3A-#1267M Adenocarcinoma3B-#1362MSmall cell carcinoma4A-#1466F Adenocarcinoma4A-#1545M Adenocarcinoma4AERBB2(c.2313_2324dup)#1669F Adenocarcinoma4AEGFR E19del(c.2235_2249del)FBXW7(c.1393C>T)#1771F Adenocarcinoma4AEGFR E21 L858RTP53(c.853G>A)#1850F Adenocarcinoma4AEGFR E21 L858R TP53(c.586C>T, c.566C>T)#1947M Adenocarcinoma4BEGFR E21 L858RTP53 (c.814G>A)MET (c.3334C>T)Benignlung tumor#2058M---#2166F---#2267M---#2373F---#2473F---#2560F---#2669F---

[0248] Prior to the EGFR mutation multi-analysis chip, we analyzed plasma by next-generation sequencing (NGS) for a panel of 53 genes, including EGFR, using Ion Torrent. As shown in Table 1, mutations were detected in only 7 of 19 patients with lung cancer by NGS analysis, resulting in a clinical sensitivity of 37%. Among the early patients, only one patient in stage 2B (patient 6) showed a TP53 mutation, resulting in a clinical sensitivity of 17% (1 / 6). The remaining six patients were all in later stages: one in stage 3A (patient 7), four in stage 4A (patients 15-18), and one in stage 4B (patient 19), resulting in a clinical sensitivity of 46% (6 / 13). Of the seven patients with mutations by NGS analysis, EGFR mutations were observed in five patients in late stage (one in stage 3A, three in stage 4A, and one in stage 4B). Specifically, two patients (patients #7 and #16) showed E19 deletions (c.2236_2250del and c.2235_2249del), whereas three patients (patients #17, #18, and #19) showed E21 L858R mutations.

[0249] Using the plasma samples collected above, EGFR mutation multiplex analysis was performed using the method of Example 1, and the results are shown in Fig. 11.

[0250] As shown in Figure 11, the EGFR mutation multiplex analysis chip showed strong fluorescent signals in all malignant lung tumor patients, demonstrating a clinical sensitivity of 100% (19 / 19). EGFR E19del (12 / 19) was found in 63% of the malignant lung tumor patients, and EGFR E21 L858R mutation (7 / 19) was found in 36% of the patients. E20ins (0 / 19) was not found in the tested samples. All 19 malignant patients showed only one type of EGFR mutation, and no detectable fluorescent signal was observed in any of the benign lung tumor patients, confirming a clinical specificity of 100% (7 / 7). In other words, it showed 100% accuracy with the tissue biopsy results. In addition, it was confirmed that the EGFR mutation types detected in the NGS analysis exactly matched the types identified by the EGFR mutation multiplex analysis chip. Despite testing a small number of clinical samples, the EGFR mutation multi-analysis chip manufactured according to one embodiment can be confirmed to have excellent sensitivity for multiplex detection of genetic mutations by successfully distinguishing all malignant lung tumor patients, including early stage 1A, 2A, and 2B.

Claims

1. Composition for amplifying nucleic acid for a target gene; A multiplex analysis substrate in which capture probes that commonly capture wild type genes and mutant type genes for the target genes as the nucleic acid amplification products are fixed in an array form on a surface fluorescence amplification substrate; and A fluorescent probe that binds commonly to the wild type gene and mutant gene captured by the above capture probe; The above nucleic acid amplification composition A nucleic acid amplification primer set capable of commonly amplifying the wild type gene and the mutant gene for the target gene; and A plasmonic microarray-based genetic mutation multiplexing kit comprising a probe having a quencher that binds to the above wild type gene.

2. In paragraph 1, The above surface fluorescence amplification substrate is, A substrate comprising nano-pillars; A metal layer laminated on the above substrate; and A plasmonic microarray-based genetic mutation multiplexing detection kit comprising a plurality of metal nanoparticles bound to the metal layer.

3. In paragraph 2, A plasmonic microarray-based genetic mutation multiplex detection kit, wherein the metal in the metal layer and metal nanoparticles is at least one selected from Au, Ag, Cu, Al, Pt, Pd, Ti, Rd, Ru, and alloys thereof.

4. In paragraph 1, The above nucleic acid amplification composition is a plasmonic microarray-based genetic mutation multiplex detection kit that commonly amplifies mutant genes and wild-type genes through nucleic acid amplification, but amplification of wild-type genes is suppressed by the probe having the quencher.

5. In paragraph 1, The mutant gene captured by the above capture probe is bound to the above fluorescent probe and the fluorescent signal is amplified and expressed by the surface fluorescence amplification substrate. A plasmonic microarray-based genetic mutation multiplexing kit, wherein the wild-type gene captured by the above capture probe is bound to the above fluorescent probe, but fluorescence expression is suppressed by a quencher.

6. In paragraph 1, The above primer set is a plasmonic microarray-based genetic mutation multiplex detection kit that specifically amplifies the target gene.

7. In paragraph 1, A plasmonic microarray-based genetic mutation multiplex detection kit, wherein the primer set comprises a forward primer and a reverse primer, and at least one of the forward primer and the reverse primer is phosphorylated at the 5' end.

8. In paragraph 1, A plasmonic microarray-based genetic mutation multiplexing kit comprising a quencher that binds to a wild-type gene and further comprising a wild-type inhibitor that inhibits fluorescence expression of the wild-type gene.

9. In paragraph 1, The above genetic mutation multiplex detection kit is a plasmonic microarray-based genetic mutation multiplex detection kit that simultaneously detects one or more of insertion mutations, deletion mutations, and point mutations.

10. In paragraph 1, The above genetic mutation multiplex detection kit is a kit for multiplex detection of mutations in the EGFR (Epidermal Growth Factor Receptor) gene, and is a plasmonic microarray-based genetic mutation multiplex detection kit that simultaneously detects at least one of exon 19 deletion, exon 20 insertion, and exon 21 L858R point mutation.

11. A method for multiplexing genetic mutations using the plasmonic microarray-based genetic mutation multiplexing detection kit of Article 1, A step of preparing a nucleic acid amplification composition comprising a nucleic acid amplification primer set capable of commonly amplifying a wild type gene and a mutant gene for a target gene; and a probe having a quencher that binds to the wild type gene; A step of mixing and reacting a sample containing a target gene with the nucleic acid amplification composition to commonly amplify a wild-type gene and a mutant gene for the target gene, wherein the amplification of the wild-type gene is inhibited by the quencher-equipped probe; A method for multiplex detection of genetic mutations, comprising the steps of mixing the product of the above reaction with a fluorescent probe that binds commonly to a wild-type gene and a mutant gene, and applying the mixture to a surface fluorescence amplification substrate on which capture probes that commonly capture the wild-type gene and the mutant gene for the target gene are fixed in an array form, thereby causing the mutant gene to express fluorescently.

12. In paragraph 11, A method for multiplex detection of genetic mutations, wherein the reaction between the sample containing the target gene and the composition for nucleic acid amplification is performed at a temperature of 37°C to 42°C for 20 to 40 minutes.

13. In paragraph 11, The step of making the above mutant gene fluoresce A method for multiplex detection of genetic mutations, comprising a quencher that binds to a wild-type gene and further mixing a wild-type inhibitor that suppresses fluorescence expression of the wild-type gene.

Images