Fumonisin degrading enzyme and use thereof

Abstract

The present application relates to a variant polypeptide having fumonisin degrading activity, a composition comprising the variant polypeptide, use of at least any one of the variant polypeptide and a host cell expressing same for detoxifying fumonisin present in food and / or feed, and a fumonisin degrading method using same.

Description

Fumonisin-decomposing enzyme and uses thereof

[0001] The present application relates to a fumonisin decomposing enzyme and its use.

[0002]

[0003] Fumonisins are mycotoxins produced primarily by the plant pathogenic fungi Fusarium verticillioides and Fusarium proliferatum. These fungi often contaminate corn and corn-based products, and can cause various diseases in humans and animals when ingested through food or feed. They are generally known to be hepatotoxic and nephrotoxic in animals, and are known to be associated with esophageal cancer and neural tube defects in humans. Therefore, Fumonisin B1, the most frequently found fumonisin, is classified by the International Agency for Research on Cancer (IARC) as Group 2B, which means it may cause cancer in humans.

[0004] Therefore, there is a need for an effective composition or method for detoxifying fumonisins present in corn or corn-based products.

[0005] [Prior Art Literature]

[0006] (Patent Document 1) WO2022-243722 A1

[0007]

[0008] The problem to be solved by the present application relates to a fumonisin-decomposing enzyme and its use.

[0009]

[0010] One object of the present application is to provide a mutant polypeptide having fumonisin decomposition activity.

[0011] Another object of the present application is to provide a composition comprising the mutant polypeptide.

[0012] Another object of the present application is to provide a use of any one or more of the above mutant polypeptides and host cells expressing the same for reaction with fumonisin.

[0013] Another object of the present application is to provide a use of any one or more of the above mutant polypeptides and host cells expressing the same for detoxifying fumonisins present in food and / or feed.

[0014] Another object of the present application is to provide a method for decomposing fumonisin, comprising reacting at least one of the mutant polypeptide and a host cell expressing the mutant polypeptide with fumonisin.

[0015] Another object of the present application is to provide a polynucleotide encoding the mutant polypeptide.

[0016] Another object of the present application is to provide a host cell comprising at least one of the above mutant polypeptides and polynucleotides encoding the same.

[0017] Another object of the present application is to provide a method for producing the mutant polypeptide.

[0018]

[0019] The polypeptide having the fumonisin decomposition activity of the present application can effectively decompose fumonisin, a fungal toxin.

[0020]

[0021] Figure 1 shows the relative activities of fumonisin decomposing enzyme CB1 (SEQ ID NO: 1) and its variants M1 to M7.

[0022] Figure 2 shows the relative activities of fumonisin decomposing enzyme variants M3 and M8 to M12.

[0023] Figure 3 shows the relative activities of fumonisin decomposing enzyme variants M3 and M13 to M16.

[0024] Figure 4 shows the relative activities of fumonisin decomposing enzyme variants M15 and M17 to M21.

[0025] Figure 5 shows the relative activities of fumonisin decomposing enzyme variant M17 and its variants M22 to M23.

[0026]

[0027] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0028] Furthermore, those skilled in the art will recognize or be able to ascertain, using only routine experimentation, numerous equivalents to the specific embodiments described in this application. Furthermore, such equivalents are intended to be encompassed by this application.

[0029] Additionally, numerous papers and patents are referenced and cited throughout this specification. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety, thereby providing a clearer understanding of the technical field to which this application pertains and the content of this application.

[0030]

[0031] As used in the specification and appended claims of this application, the singular articles "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Unless the context clearly dictates otherwise, the singular terms include the plural and the plural terms include the singular. In the specification and appended claims of this application, unless the context clearly dictates otherwise, the use of "or" is intended to include "and / or."

[0032]

[0033] In this application, the term "about" may be used before a specific numerical value. As used herein, the term "about" encompasses not only the exact number described after the term, but also a range that is or is nearly that number. Whether a number is or is nearly the specific number described can be determined based on the context in which it is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. In another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, this is not a limitation.

[0034]

[0035] In this application, the terms "first, second, third…" "i), ii), iii)…" or "(a), (b), (c), (d)…" are used to distinguish similar configurations, and these terms do not imply that the steps are performed consecutively or in order. For example, when the terms are used in relation to steps of a method, use, or analysis, these steps may be performed simultaneously, without a time interval, or may be performed at intervals of seconds, minutes, hours, days, or months.

[0036] In this application, the term "consisting essentially of" means that a non-specific component may be present if the characteristics of the subject matter claimed in this application are not substantially affected by the presence of the non-specific component.

[0037] In this application, the term "consisting of" means that the proportion of a specific component(s) totals 100%. The components or features listed below the term "consisting of" may be essential or mandatory. In some embodiments, other than the components or features listed below "consisting of," other optional or nonessential components may be excluded.

[0038] In this application, the term "comprising" means the presence of a feature, step, or component described below, and does not exclude the presence or addition of one or more features, steps, or components. The components or features described below "comprising" in this application may be essential or mandatory, but in some embodiments, other optional or non-essential components or features may be further included.

[0039] In this application, the term “comprising” may, in some embodiments, be modified to refer to “consisting essentially of” or “consisting of.”

[0040] In the present application, with respect to an amino acid sequence, even if it is described as a polypeptide “comprising” an amino acid sequence set forth in a specific sequence number, a polypeptide “consisting of” an amino acid sequence set forth in a specific sequence number, or a polypeptide or protein “having” an amino acid sequence set forth in a specific sequence number, it is obvious that a protein having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be used in the present application, as long as it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding sequence number. For example, it may be a case in which the amino acid sequence has an addition of a sequence that does not alter the function of the protein at the N-terminus and / or C-terminus, a mutation that may occur naturally, a silent mutation thereof, or a conservative substitution, but is not limited thereto.

[0041]

[0042] In this application, the term "protein" or "polypeptide" refers to a polymer or oligomer of consecutive amino acid residues. In this application, "polypeptide," "protein," and "peptide" may be used interchangeably with "amino acid sequence."

[0043] In some cases, an amino acid sequence that exhibits activity may be referred to as an "enzyme." In this application, amino acid sequences are described in N-terminal → C-terminal orientation, unless otherwise indicated.

[0044]

[0045] In relation to a cell, nucleic acid, polypeptide, or vector, the term "recombinant" in this application means that the cell, nucleic acid, polypeptide, or vector has been modified by the introduction of a heterologous nucleic acid or polypeptide or by alteration of a native nucleic acid or polypeptide, or that the cell is derived from a cell so modified. Thus, for example, a recombinant cell may express a gene not found in the native (non-recombinant) form of the cell, or may express a native gene that is expressed or not expressed at all, or otherwise abnormally expressed.

[0046]

[0047] As used herein, the term "isolated" refers to a substance that exists in an environment where it does not occur naturally, or in a form that does not occur naturally. This includes the substance (sequence, enzyme, or nucleic acid) being at least substantially free from at least one other component with which it is naturally associated and found in nature, such as a sequence, enzyme, or nucleic acid.

[0048] For example, the isolated sequences, enzymes or nucleic acids provided in the present application may be provided in a form substantially free of one or more contaminants.

[0049] Examples of isolated substances may include, but are not limited to, i) any non-naturally occurring substance, ii) any substance from which one, more, or all naturally occurring components associated with it in nature have been removed (e.g., an enzyme, variant, nucleic acid, protein, peptide, or cofactor), iii) any substance found in nature that has been artificially modified, or iv) a substance that has been modified to alter the amount of that substance relative to other naturally associated components (e.g., increasing the number of copies of a gene encoding the substance; modifying a promoter naturally associated with a gene encoding the substance to a more active promoter, etc.).

[0050]

[0051] In this application, the term "wild type" means a naturally occurring polypeptide without any artificial modifications. When the term "wild type" is used in relation to a polypeptide, it means a naturally occurring polypeptide that does not have any artificial mutations (substitutions, insertions, deletions, etc.) at one or more amino acid positions. Similarly, when the term "wild type" is used in relation to a polynucleotide, it means a polypeptide that does not have any artificial modifications (substitutions, insertions, deletions) at one or more nucleotides. However, a polynucleotide encoding a wild type polypeptide is not limited to a naturally occurring polynucleotide, and also includes a sequence encoding any wild type polypeptide.

[0052]

[0053] In the present application, the parent sequence or backbone refers to a reference sequence into which a modification is introduced to become a mutant polypeptide. That is, the parent sequence may be a starting sequence into which mutations such as substitutions, insertions, and / or deletions are introduced. The parent sequence may be a naturally occurring or wild type, or a variant in which one or more substitutions, insertions, or deletions have occurred in the natural or wild type, or may be an artificially synthesized sequence. If the parent sequence is an amino acid sequence that exhibits activity, i.e., an amino acid sequence of an enzyme, it may be referred to as a parent enzyme.

[0054]

[0055] In this application, the term "reference sequence" refers to a sequence used to determine the position of an amino acid within an arbitrary amino acid sequence. By aligning an arbitrary amino acid sequence with a reference sequence, the position of an amino acid corresponding to a specific position of the reference sequence within the arbitrary amino acid sequence can be determined.

[0056]

[0057] In the present application, with respect to an amino acid or nucleic acid sequence, the term "fragment" means a portion of a parent sequence. For example, it may be a polypeptide in which one or more amino acids from the parent sequence are removed from the C or N terminus.

[0058] In the present application, a "fragment" of an enzyme may refer to a "functional fragment." A "functional fragment," also referred to as an "active fragment," refers to a polypeptide that is part of a parent enzyme and possesses the enzymatic activity of the parent enzyme. For example, a functional fragment of an enzyme may include the catalytic site of the enzyme.

[0059] The enzyme fragment may comprise a portion of the full length of the parent enzyme, for example, but not limited to, at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or less than 100% of the amino acids of the full length of the parent enzyme.

[0060]

[0061] In this application, "mutating / modifying" means changing or altering. This may be a change from a naturally occurring sequence. For example, an enzyme may be modified in such a way that it is altered from its parent sequence or reference sequence.

[0062] In the present application, the modified enzyme may be a non-naturally occurring enzyme, i.e., an enzyme that does not exist in nature itself.

[0063] The term "modified" in this application means, for example, something that has been altered from its naturally occurring form. The modified enzymes of this application include enzymes that do not occur naturally or naturally occurring variants. For example, the modified enzymes of this application are enzymes that are not found in nature. For example, the modified enzymes of this application may be, but are not limited to, enzymes that do not occur spontaneously.

[0064] When the term "modification" is used in relation to an amino acid / nucleic acid sequence in this application, it may include substitution of an amino acid / nucleic acid residue of the parent sequence for a different amino acid / nucleic acid residue at one or more sites in the amino acid sequence, deletion of an amino acid / nucleic acid residue (or a series of amino acid / nucleic acid residues) of the parent sequence at one or more sites, insertion of an amino acid / nucleic acid residue (or a series of amino acid / nucleic acid residues) of the parent sequence at one or more sites, truncation of the N-terminal and / or C-terminal amino acid sequence or 5' and / or 3' nucleic acid sequence, and any combination thereof.

[0065]

[0066] In the present application, a "variant" or "modified polypeptide" of an enzyme refers to a protein that differs from the parent enzyme in one or more amino acids by conservative substitution and / or modification. The terms "variant" and "modified polypeptide" may be used interchangeably. The variant or modified polypeptide may be, but is not limited to, a non-naturally occurring one.

[0067] The variant differs from the sequence of the parent enzyme by one or more modifications, e.g., amino acid substitutions, deletions and / or insertions.

[0068] Such variants can generally be identified by altering one or more amino acids in the parent enzyme and evaluating the properties of the altered protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the parent enzyme.

[0069] Additionally, some variants may comprise mutant polypeptides in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted.

[0070] Other variants may include variants in which portions are removed from the N- and / or C-terminus of the mature protein.

[0071] The term "variant" or "variant polypeptide" may be used interchangeably with terms such as variant, modification, mutated protein, and mutation (in English, modification, modified protein, mutant, mutein, divergent, variant, etc.), and is not limited thereto if the term is used in the meaning of variant.

[0072] Variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of the protein that is involved in co-translational or post-translational protein transfer. Furthermore, the polypeptide may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis of the polypeptide.

[0073]

[0074] In this application, the term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0075]

[0076] Throughout this application, the conventional one-letter and three-letter codes for naturally occurring amino acids are used. Furthermore, amino acids referred to by abbreviations in this application are described according to the IUPAC-IUB nomenclature.

[0077]

[0078] Alanine Ala, A Arginine Arg, R

[0079] Asparagine Asn, N Aspartic acid Asp, D

[0080] Cysteine ​​Cys, C Glutamic acid Glu, E

[0081] Glutamine Gln, Q Glycine Gly, G

[0082] Histidine His, H Isoleucine Ile, I

[0083] Leucine Leu, L Lysine Lys, K

[0084] Methionine Met, M Phenylalanine Phe, F

[0085] Proline Pro, P Serine Ser, S

[0086] Threonine Thr, T Tryptophan Trp, W

[0087] Tyrosine Tyr, Y Valine Val, V

[0088]

[0089] Meanwhile, any amino acid can be written as Xaa, X.

[0090] Additionally, the generally accepted three-letter codes for other amino acids, such as Aib (2-Aminoisobutyric acid), Sar (N-methylglycine), and α-methyl-glutamic acid, may be used, as well as for naturally occurring amino acids.

[0091]

[0092] Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Accordingly, amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0093] For example, among the amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid; among the amino acids having uncharged side chains, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and polar or hydrophilic amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and among the nonpolar amino acids, aromatic amino acids include phenylalanine, tryptophan, and tyrosine.

[0094]

[0095] As used herein, the term "gene" refers to a polynucleotide encoding a polypeptide and a polynucleotide comprising regions preceding and following the coding region. In some embodiments, a gene may have a sequence (intron) inserted between each coding region (exon).

[0096]

[0097] As used herein, the terms "homology" or "identity" refer to the degree of relationship between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0098] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions, typically along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its entire length. It should be appreciated that hybridization also encompasses polynucleotides containing common codons or codons that are considered codon degenerate.

[0099] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al.](1988) SIAM J Applied Math 48: 1073). Homology, similarity, or identity can be determined using, but is not limited to, BLAST from the National Center for Biotechnology Information Database, or ClustalW.

[0100] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) a unitary matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a matrix of 1s for identity and 0s for non-identity, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al. (1986) Nucl. Acids Res. 48:443. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0101] Additionally, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions are within the scope of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, but are not limited thereto).

[0102]

[0103] In this application, the term "mature polypeptide" refers to a polypeptide in a form that lacks a signal sequence or a propeptide sequence. A mature protein / polypeptide / peptide may be a functional form of a protein / polypeptide / peptide. A mature polypeptide may be a final form that has undergone post-translational or post-translational modifications. Examples of post-translational modifications include, but are not limited to, N- or C-terminal modifications, glycosylation, phosphorylation, and leader sequence removal.

[0104]

[0105] The term "nucleic acid construct" in this application means a single or double-stranded nucleic acid molecule that contains one or more regulatory sequences and is artificially synthesized, engineered to contain a specific sequence in a manner that does not exist in nature, or isolated from nature.

[0106]

[0107] As used herein, the term “expression” includes, but is not limited to, any step involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0108] As used herein, the term "expression vector" means a linear or circular nucleic acid molecule comprising a coding sequence and regulatory sequences operably linked thereto for expression thereof.

[0109]

[0110] As used herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned appropriately to direct the expression of a coding sequence. Therefore, "operably linked" includes a regulatory region of a functional domain with known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, attached or linked to a target (gene or polypeptide) so as to regulate the expression, secretion, or function of the target in accordance with the known or desired activity.

[0111]

[0112] As used herein, the term "cDNA" refers to a DNA sequence that can be produced by reverse transcription from a mature, spliced ​​mRNA molecule, which can be obtained from a eukaryotic or prokaryotic cell. The cDNA sequence does not include intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is a precursor to mRNA before being processed through a series of steps, including splicing, to form the mature, spliced ​​mRNA.

[0113]

[0114] As used herein, the term "regulatory sequence" refers to a polynucleotide sequence necessary for the expression of a coding sequence. Each regulatory sequence may be native to the coding sequence (having the same origin) or foreign (derived from another gene). Examples of the regulatory sequence include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.

[0115]

[0116] To describe the variants provided in this application, the following nomenclature is used.

[0117] In this application, reference to a specific position in an amino acid sequence may include reference to an amino acid present or substituted at that position. Reference to an amino acid at a specific position may be described in various ways. For example, "position 003" may be described as "position 3," "amino acid 3," or "the third amino acid." Furthermore, for example, if the amino acid at position 3 is serine (S), it may be described as "S3" or "Ser3."

[0118] Amino acid substitutions can be expressed by listing the amino acid before substitution, the position, and the amino acid being replaced. These amino acids can be expressed using conventional one-letter and three-letter codes. For example, if alanine, the amino acid at position 6 of a specific sequence, is replaced with valine, it can be written as "A8V" or "Ala8Val."

[0119] Any amino acid at a particular position can be designated as "X". For example, X6 refers to any amino acid at position 6. Also, when a substituted amino acid is designated as X, it means that it is replaced with an amino acid different from the amino acid present before the substitution. For example, "V6X" indicates that V is replaced with any amino acid other than V at position 6.

[0120] Different alternations can be expressed by listing multiple amino acids simultaneously using the " / " or "," symbol. For example, a substitution of the amino acid (D) at position 12 with S or K can be written interchangeably as D12S / K or D12S,K. As another example, P / S197K means that the amino acid P or S at position 197 before substitution is replaced with K.

[0121] Multiple mutations can be described using a "+" sign. For example, a description such as "G2A+ M8V" means that the amino acid at position 2, glycine, is replaced with alanine, and the amino acid at position 8, methionine, is replaced with valine, respectively.

[0122]

[0123] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a protein or polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the protein or polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0124] In the present application, SEQ ID NO. 1 can be used as a reference sequence to determine the position of an amino acid in any amino acid sequence.

[0125] That is, SEQ ID NO. 1 disclosed in the present application can be used to determine the corresponding amino acid residue in a polypeptide having any fumonisin decomposition activity, and unless otherwise specified in the present application, residues of a specific amino acid sequence are numbered based on SEQ ID NO. 1.

[0126] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0127] These alignments can be performed using, but are not limited to, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), and Trends Genet. 16: 276-277).

[0128] Additionally, multiple sequence alignment can be used to identify corresponding amino acid residues in other fumonisin-degrading enzymes. Examples of multiple sequence alignment programs known in the art include MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS using ClustalW. EMMA (1.83 or higher; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), etc., and the default parameters of each of the above programs can be used, but are not limited thereto.

[0129] Additionally, if enzymes diverged from the mature polypeptide of SEQ ID NO: 1 and their relationships cannot be detected by conventional sequence-based comparison, other pairwise sequence comparison algorithms can be used (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615). Higher sensitivity can be achieved in sequence-based searches by using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and can detect remote homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has more than one representation in a protein structure database. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) use information from a variety of sources, such as PSI-BLAST, secondary structure predictions, structural alignment profiles, and solvation potentials, as input to a neural network that predicts the structural folding of a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919 can be used to align an unknown sequence with superfamily models available in the SCOP database. These alignments can in turn be used to build homology models for the polypeptide, and these models can be evaluated for accuracy using a variety of tools developed for the purpose.

[0130] For proteins with known structures, several tools and resources are available for searching and generating structural alignments. For example, the SCOP superfamily of proteins is structurally aligned, and these alignments are accessible and downloadable. Two or more protein structures can be aligned using various algorithms, such as distance alignment matrix alignment (Holm and Sander, 1998, Proteins 33: 88-96) or Combinatorial extension (CE) (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747). Implementations of these algorithms can additionally be used to query structural databases containing the target structure to discover possible structural homologues (Holm and Park, 2000, Bioinformatics 16: 566-567).

[0131] The above methods are examples and are not limiting.

[0132]

[0133] Hereinafter, specific examples of the present application will be described in more detail as follows.

[0134]

[0135] In the present application, the degradation of fumonisin includes detoxification of fumonisin, inactivation of fumonisin, and decontamination of fumonisin. Fumonisin can be degraded by some carboxylesterases through a process in which two tricarboxylic acids (TCAs) are sequentially generated through a de-esterification reaction, thereby generating hydrolytic FB1 (HFB1).

[0136] In the present application, fumonisin decomposition activity can be measured and evaluated using methods known in the art, including the embodiments described in the present application. For example, it can be evaluated by measuring the concentration of fumonisin remaining after enzyme treatment.

[0137]

[0138] In the present application, the term "parent fumonisin degrading enzyme" refers to a fumonisin degrading enzyme that is modified to produce a variant or mutant polypeptide of the present application. Specifically, the parent fumonisin degrading enzyme, parent enzyme, or parent sequence may be a naturally occurring polypeptide or a wild-type polypeptide, may be a mature polypeptide thereof, may include a variant or functional fragment thereof, but is not limited thereto as long as it is a polypeptide that has fumonisin degrading activity and can be a parent of a variant.

[0139] The mo-fumonisin decomposing enzyme provided in the present application may be, but is not limited to, a polypeptide of SEQ ID NO: 1. In addition, as long as it has fumonisin decomposing activity, it may be a polypeptide having a sequence identity of at least about 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% with the polypeptide of SEQ ID NO: 1, and as long as it has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, it may be included in the scope of mo-fumonisin decomposing enzymes without limitation.

[0140] The mutant fumonisin decomposing enzyme provided in the present application may be derived from the genus Bradyrhizobium (Bradyrhizobium sp.).

[0141] Meanwhile, the above-mentioned microorganism is an example of a microorganism from which the mo-fumonisin decomposing enzyme provided in the present application can be derived, and includes a microorganism derived from a taxonomically homologous microorganism, regardless of the name of the microorganism.

[0142] The above-mentioned microorganisms can be obtained from known microorganism depositories such as ATCC, DSMZ, CBS, NRRL, KCTC, and KCCM.

[0143] In the present application, a sequence "derived from" a particular microorganism is not limited to a sequence that is naturally produced or can be produced in the microorganism, but also includes a sequence encoded by a gene that is produced and isolated from the microorganism containing the gene.

[0144] For example, a fumonisin-degrading enzyme derived from Bradyrhizobium sp. includes not only an enzyme having fumonisin-degrading activity naturally produced by the microorganism, but also an enzyme having carboxylesterase activity derived from the microorganism, produced from the Bradyrhizobium source, and also a genetically modified enzyme known in the art (e.g., produced in another host cell through transformation with a sequence encoding the enzyme).

[0145]

[0146] The fumonisin of the present application includes fumonisin B1, fumonisin B2, fumonisin B3, fumonisin B4, fumonisin A1, and fumonisin A2; and derivatives thereof. For example, the fumonisin of the present application may be selected from fumonisin B1, fumonisin B2, fumonisin B3, fumonisin B4, fumonisin A1, and fumonisin A2. For example, the fumonisin of the present application may be fumonisin B1.

[0147] In the present application, the “variant polypeptide having fumonisin decomposition activity” may be a variant of the parent fumonisin decomposition enzyme.

[0148] In the present application, the term "fumonisin degrading enzyme variant" or "variant polypeptide having fumonisin degrading activity" refers to a protein having one or more amino acids different from the amino acid sequence of the parent fumonisin degrading enzyme and having fumonisin degrading activity.

[0149] The above “mutant polypeptide having fumonisin decomposition activity”, “mutant of parent fumonisin decomposition enzyme” and “mutant fumonisin decomposition enzyme” can be used interchangeably.

[0150] The variant provided in the present application may have a fumonisin-degrading activity and include a modification of one or more amino acids in a parent fumonisin-degrading enzyme sequence. In addition, the variant is i) a polypeptide having a sequence identity of at least 70% and less than 100% with SEQ ID NO: 1; and / or ii) a polypeptide encoded by a polynucleotide having a sequence identity of at least 70% and less than 100% with a sequence encoding a mature polypeptide of SEQ ID NO: 1; and / or iii) a polypeptide encoded by a polynucleotide that hybridizes with (a) the mature polypeptide coding sequence of SEQ ID NO: 1, (b) a cDNA thereof, or (c) the full-length complement of (a) or (b) under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions; and / or iv) the variant may be a functional fragment of i), ii) or ii) polypeptide having fumonisin decomposition activity.

[0151] Specifically, the variants provided in the present application may have one or more altered functions or properties compared to the parent fumonisin decomposing enzyme, including modification of one or more amino acids in the parent fumonisin decomposing enzyme sequence, while having fumonisin decomposing activity.

[0152] In one specific example, the variant provided in the present application has fumonisin decomposition activity, and has one or more altered functions or properties compared to the parent fumonisin decomposition enzyme, including modification of one or more amino acids in the parent fumonisin decomposition enzyme sequence, and may have one or more conservative substitutions.

[0153]

[0154] The variant provided in the present application is a variant of a fumonisin-decomposing enzyme, and may be a polypeptide having fumonisin-decomposing activity.

[0155] In one specific example, the variant provided in the present application may include a modification at one or more of positions 29, 90, 135, 147, 155, 170, 199, 209, 252, 290, 293, 354, 407, and 452 of SEQ ID NO: 1.

[0156] In one specific example, the variant provided in the present application may comprise a substitution at one or more of positions 29, 90, 135, 147, 155, 170, 199, 209, 252, 290, 293, 354, 407, and 452 of SEQ ID NO: 1.

[0157]

[0158] In this application, the position number is a position corresponding to the position of the polypeptide of sequence number 1, and “corresponding” is as described above.

[0159] In one specific example, the variant provided in the present application may include a modification of an amino acid corresponding to one or more of G29, N90, A135, A147, A155, L170, V199, V209, T252, T290, 1293, R354, A407 and M452 of SEQ ID NO: 1.

[0160]

[0161] In one specific example, the amino acid corresponding to position 29 of the modified SEQ ID NO: 1 provided in the present application may be G; the amino acid corresponding to position 90 may be N; the amino acid corresponding to position 135 may be A; the amino acid corresponding to position 147 may be A; the amino acid corresponding to position 155 may be A; the amino acid corresponding to position 170 may be L; the amino acid corresponding to position 199 may be V; the amino acid corresponding to position 209 may be V; the amino acid corresponding to position 252 may be T; the amino acid corresponding to position 290 may be T; the amino acid corresponding to position 293 may be I; the amino acid corresponding to position 354 may be R; the amino acid corresponding to position 407 may be A; and / or the amino acid corresponding to position 452 may be M.

[0162]

[0163] In one specific example, the variant provided in the present application may comprise a substitution of the amino acid corresponding to position 29 of SEQ ID NO: 1 with A, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, and specifically may comprise a substitution with alanine (A).

[0164] In one specific example, the variant provided in the present application may include a substitution of the amino acid corresponding to position 90 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, T, C, Y, Q, D, E, K, R, or H, and specifically may include a substitution with valine (V) or alanine (A).

[0165] In one specific example, the variant provided in the present application may comprise a substitution of the amino acid corresponding to position 135 of SEQ ID NO: 1 with G, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, and specifically may comprise a substitution with leucine (L).

[0166] In one specific example, the variant provided in the present application may include a substitution of the amino acid corresponding to position 147 of SEQ ID NO: 1 with G, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, specifically with S, T, C, Y, N, Q, and more specifically with serine (S) or threonine (T).

[0167] In one specific example, the variant provided in the present application may include a substitution of the amino acid corresponding to position 155 of SEQ ID NO: 1 with G, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, and specifically may include a substitution with serine (S).

[0168] In one specific example, the variant provided in the present application may comprise a substitution of the amino acid corresponding to position 170 of SEQ ID NO: 1 with G, A, V, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, and specifically may comprise a substitution with valine (V).

[0169] In one specific example, the variant provided in the present application may include a substitution of the amino acid corresponding to position 199 of SEQ ID NO: 1 with G, A, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, and specifically may include a substitution with leucine (L).

[0170] In one specific example, the variant provided in the present application may include a substitution of the amino acid corresponding to position 209 of SEQ ID NO: 1 with G, A, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, and specifically may include a substitution with phenylalanine (F).

[0171] In one specific example, the variant provided in the present application may include a substitution of the amino acid corresponding to position 252 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, C, Y, N, Q, D, E, K, R, or H, and specifically may include a substitution with leucine (L).

[0172] In one specific example, the variant provided in the present application may comprise a substitution of the amino acid corresponding to position 290 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, C, Y, N, Q, D, E, K, R, or H, and specifically may comprise a substitution with alanine (A).

[0173] In one specific example, the variant provided in the present application may comprise a substitution of the amino acid corresponding to position 293 of SEQ ID NO: 1 with G, A, V, L, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, and specifically may comprise a substitution with glutamine (Q).

[0174] In one specific example, the variant provided in the present application may comprise a substitution of the amino acid corresponding to position 354 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, or H, and specifically may comprise a substitution with alanine (A).

[0175] In one specific example, the variant provided in the present application may include a substitution of the amino acid corresponding to position 407 of SEQ ID NO: 1 with G, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, and specifically may include a substitution with glycine (G).

[0176] In one specific example, the variant provided in the present application may include a substitution of the amino acid corresponding to position 452 of SEQ ID NO: 1 with G, A, V, L, I, F, W, P, S, T, C, Y, N, Q, D, E, K, R, or H, and specifically may include a substitution with glycine (G).

[0177]

[0178] In one specific example, the variant provided in the present application may include one or more substitutions among A147S / T, A155S, N90V, A135L, L170V, V209F, T252L, I293Q, R354A, A407G, V199L, G29A, M452G and T290A of SEQ ID NO: 1.

[0179] Specifically, a variant comprising an A147S+A155S substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 9, a variant comprising an N90V substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 10, a variant comprising an A135L substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 3, a variant comprising an A155S substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 11, a variant comprising an L170V substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 12, a variant comprising a V209F substitution of SEQ ID NO: 13, a variant comprising a T252L substitution of SEQ ID NO: 14, a variant comprising an A135L+ N90V substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 29, a variant comprising an A135L+A147S+A155S substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 30, and a variant comprising an A155S substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 11, a variant comprising an L170V substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 12, a variant comprising an V209F substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 13, a variant comprising an T252L substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 14. A variant comprising an A135L+A155S substitution is represented by SEQ ID NO: 31, a variant comprising an A135L+L170V substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 32, a variant comprising an A135L+I293Q substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 33, a variant comprising an A135L+N90A+R354A substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 36, a variant comprising an A135L+A147T substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 37, a variant comprising an A135L+A407G substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 5, a variant comprising an A135L+V199L substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 38, a variant comprising an A135L+A407G+G29A substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 7, A variant comprising the A135L+A407G+M452G substitution is represented by SEQ ID NO: 49, a variant comprising the A135L+ A407G+A147T substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 50, a variant comprising the A135L+A407G+T290A substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 51, a variant comprising the A135L+A407G+V199L substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 52, and a variant comprising the A135L+A407G+G29A+M452G substitution of SEQ ID NO: 1 is represented by SEQ ID NO: 59.A variant containing the A135L+A407G+G29A+V199L substitutions of SEQ ID NO: 1 may be represented by SEQ ID NO: 60.

[0180]

[0181] In one specific example, the variants provided in the present application include all possible combinations of the modifications described above.

[0182] As a specific example, the variant may have any one of amino acids at positions 90, 135, 155, 170, 209 and 225 substituted with another amino acid.

[0183] In one specific example, the variant may have one or more amino acids substituted with another amino acid among amino acids 293, 407, 29, 452, and 290.

[0184] For example, the variant may comprise a modification of an amino acid at a position selected from the following, in combination with the modifications described above.

[0185] 147+155;

[0186] 90;

[0187] 135;

[0188] 155;

[0189] 170;

[0190] 209;

[0191] 252;

[0192] 135+90;

[0193] 135+147+155;

[0194] 135+155;

[0195] 135+170;

[0196] 135+293;

[0197] 135+90+354;

[0198] 135+147;

[0199] 135+407;

[0200] 135+199;

[0201] 135+407+29;

[0202] 135+407+452;

[0203] 135+407+147;

[0204] 135+407+290;

[0205] 135+407+199;

[0206] 135+407+29+452; and

[0207] 135+407+29+199.

[0208] As another example, the variant may include, but is not limited to, one or more of the following substitutions: i) to xiv):

[0209] i) Substitution of amino acid 29 with alanine (A);

[0210] ii) Substitution of amino acid 90 with valine (V) or alanine (A);

[0211] iii) Substitution of amino acid 135 with leucine (L);

[0212] iv) Substitution of amino acid 147 with serine (S) or threonine (T);

[0213] v) Substitution of amino acid 155 with serine (S);

[0214] vi) Substitution of amino acid 170 with valine (V);

[0215] vii) Substitution of amino acid 199 with leucine (L);

[0216] viii) Substitution of amino acid 209 with phenylalanine (F);

[0217] ix) Substitution of amino acid 252 with leucine (L);

[0218] x) Substitution of amino acid 290 with alanine (A);

[0219] xi) Substitution of amino acid 293 with glutamine (Q);

[0220] xii) Substitution of amino acid 354 with alanine (A);

[0221] xiii) substitution of amino acid 407 with glycine (G); and

[0222] xiv) Substitution of amino acid 452 with glycine (G);

[0223]

[0224] As another example, the variant may include, but is not limited to, one or more modifications selected from the following:

[0225] A147S+A155S;

[0226] N90V;

[0227] A135L;

[0228] A155S;

[0229] L170V;

[0230] V209F;

[0231] T252L;

[0232] A135L+N90V;

[0233] A135L+A147S+A155S;

[0234] A135L+A155S;

[0235] A135L+L170V;

[0236] A135L+I293Q;

[0237] A135L+N90A+R354A;

[0238] A135L+A147T;

[0239] A135L+A407G;

[0240] A135L+V199L;

[0241] A135L+A407G+G29A;

[0242] A135L+A407G+M452G;

[0243] A135L+A407G+A147T;

[0244] A135L+A407G+T290A;

[0245] A135L+A407G+V199L;

[0246] A135L+A407G+G29A+M452G; and

[0247] A135L+A407G+G29A+V199L.

[0248]

[0249] In one specific example, the variant provided in the present application may have a sequence identity of at least about 60%, for example, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% and less than 100%, to a mature polypeptide or functional fragment thereof of the mo-fumonisin degrading enzyme.

[0250] In one specific example, the variant provided in the present application may have a sequence identity of at least about 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% and less than 100% with SEQ ID NO: 1.

[0251] In one specific example, the variant provided in the present application may be a polypeptide encoded by a polynucleotide having a sequence identity of at least about 60%, for example, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% and less than 100%, with a sequence encoding a mature polypeptide of SEQ ID NO: 1.

[0252] In one specific example, the variant provided in the present application may have a sequence identity of at least about 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% and less than 100% with a functional fragment of SEQ ID NO: 1.

[0253]

[0254] The variants provided in the present application may have one or more altered properties or attributes of the polypeptide that can be selected or detected compared to other fumonisin degrading enzymes, such as wild type fumonisin degrading enzymes, parent fumonisin degrading enzymes, other fumonisin degrading enzyme variants, etc.

[0255] The above properties or attributes include, but are not limited to, oxidative stability, substrate specificity, catalytic activity, thermal stability, alkaline stability, pH activity profile, resistance to proteolysis, Km, kcat, kcat / Km ratio, protein folding, induction of an immune response, ability to bind a ligand, ability to bind a receptor, ability to be secreted, ability to be displayed on the surface of cells, ability to form oligomers, ability to signal, ability to promote cell proliferation, ability to inhibit cell proliferation, ability to induce apoptosis, ability to be modified by phosphorylation or glycosylation, and / or ability to treat a disease.

[0256]

[0257] Specifically, the variants provided in the present application may have one or more of the following altered activities compared to the parent sequence:

[0258] i) increase or decrease in enzyme activity; and

[0259] ii) Increase or decrease in specific activity.

[0260]

[0261] More specifically, the variants provided in the present application may have increased enzyme activity and / or increased specific activity compared to the parent sequence, but are not limited thereto.

[0262]

[0263] In the present application, "enzymatic activity" refers to at least one catalytic activity. Specifically, it may be, but is not limited to, the conversion efficiency of an enzyme, which is mainly expressed as kcat / Km.

[0264] kcat is the catalytic constant for the conversion of a single enzyme to a product per unit time when the enzyme is completely saturated with substrate, and is also called the turnover number. Km is the substrate concentration when the reaction rate is half of the maximum value (Vmax).

[0265] Examples of ways to express enzyme activity include specific activity (umol of converted substrate x mg -1 x min -1) or volumetric activity (umol of converted substrate x mL -1 x min -1).

[0266] However, the definition of enzyme activity is not limited to the above-mentioned content, and can be defined and evaluated based on the known content such as Irwin H. Segel, Enzyme kinetics, John Wiley & Sons, 1979; AG Marangoni, Enzyme kinetics, Wiley-Interscience, 2003; A. Fersht, Enzyme structure and mechanisms, John Wiley & Sons, 1981; Structure and Mechanism in Protein Science: A guide to enzyme catalysis and protein folding, Alan Fersht, WH Freeman, 1999; Fundamentals of Enzyme Kinetics, Athel Cornish-Bowden, Wiley-Blackwell 2012 and Voet ef al., "Biochemie" [Biochemistry], 1992, VCH-Verlag, Chapter 13, pages 331-332 with respect to enzymatic activity. As another example, it can be evaluated by measuring the concentration of the substrate fumonisin.

[0267]

[0268] In one specific example, the variants provided in the present application may have an increased enzyme activity of about 100%, about 110%, about 120%, about 130%, about 140%, about 150%, about 160%, about 170%, about 180%, about 190%, or about 200% or more compared to the parent enzyme.

[0269]

[0270] The term "specific activity" in this application refers to the activity of an enzyme per unit weight of protein, expressed as unit / mg. Protein quantification can be performed, for example, using SDS-PAGE or the Bradford assay.

[0271]

[0272] A polynucleotide encoding a variant of the present invention may comprise the coding sequence of the aforementioned variant. The polynucleotide may undergo various modifications to the coding region, without altering the amino acid sequence of the polypeptide, due to codon degeneracy or in consideration of codon preference in the organism intended to express the polypeptide.

[0273] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known gene sequence, for example, a sequence that hybridizes under stringent conditions with a complementary sequence to all or part of the base sequence, so long as it encodes a variant of the present application.

[0274] The above "stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0275] For example, conditions under which polynucleotides having a high degree of homology or identity hybridize with each other, specifically at least 40%, specifically at least 90%, more specifically at least 95%, at least 96%, at least 97%, at least 98%, and even more specifically at least 99%, and polynucleotides having a lower degree of homology or identity than that hybridize, or conditions under which washing is performed once, specifically twice or three times, at a salt concentration and temperature corresponding to 60°C, 1ХSSC, 0.1% SDS, specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, can be listed.

[0276] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0277] Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C and can be appropriately adjusted by those skilled in the art depending on the purpose.

[0278] The appropriate stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0279] For example, “high stringency” may occur at about 5 to 10°C below the Tm of the probe; “medium stringency” may occur at about 10 to 20°C below the Tm of the probe; and “low stringency” may occur at about 20 to 25°C below the Tm, but is not limited thereto.

[0280] For example, “low stringency conditions” can be prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 25% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 2 X SSC, 0.1 to 0.2% SDS at 50°C.

[0281] For example, “medium stringency conditions” can be prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 35% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 2 X SSC, 0.1 to 0.2% SDS at 55°C. For example, “medium-high stringency conditions” can be prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 35% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 1 to 2 X SSC, 0.1 to 0.2% SDS at 60°C.

[0282] For example, “high stringency conditions” can be prehybridization and hybridization at 42°C in 5 X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 35% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 2 X SSC, 0.1 to 0.2% SDS at 65°C.

[0283]

[0284] The nucleic acid construct provided in the present application comprises a polynucleotide encoding a variant provided in the present application, operably linked to one or more regulatory sequences that direct expression of the coding sequence in a suitable host cell under conditions suitable for the regulatory sequences.

[0285] Polynucleotides can be manipulated in a variety of ways to enable expression of variants. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide before inserting it into the vector. Such manipulations can be performed using methods known in the art.

[0286]

[0287] The "vector" provided in this application refers to a DNA construct containing a base sequence of a polynucleotide encoding a variant of the present application, operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the variant in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.

[0288] The vector that can be used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0289] For example, a polynucleotide encoding a variant provided in the present application can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0290]

[0291] The host cell of the present application may include, without limitation, any cell capable of expressing the variant of the present application.

[0292] The host cell of the present application may comprise the above-described variant, a polynucleotide encoding the variant, a nucleic acid construct comprising the same, and / or a vector.

[0293] The nucleic acid construct or vector may be integrated into a chromosome as described above, or may be maintained as an extrachromosomal vector that replicates autonomously.

[0294] The host cell of the present invention includes any progeny of the parent cell that are not identical to the parent cell due to mutations that occur during replication.

[0295] The host cell can be any cell useful for recombinant production of variants, e.g., a prokaryotic or eukaryotic cell.

[0296] The prokaryotic host cell can be any gram-positive or gram-negative bacterium.

[0297] Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces.

[0298] Gram-negative bacteria include, but are not limited to, Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Iliobacter, Neisseria, Pseudomonas, Salmonella, Vibrio (e.g., Vibrio natriegens), and Ureaplasma.

[0299] In one specific example, the bacterial host cell can be a Bacillus genus host cell, specifically including but not limited to Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis cells.

[0300] In one specific example, the bacterial host cell can be a Streptococcus genus host cell, specifically including but not limited to Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis and Streptococcus equi subspecies Zooepidemicus cells.

[0301] In one specific example, the bacterial host cell can be a host cell of the genus Streptomyces, specifically including but not limited to Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicol, Streptomyces griseus and Streptomyces lividans cells.

[0302] In one specific example, the bacterial host cell may be a host cell of the genus Corynebacterium, such as Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes. ammoniagenes), Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens.

[0303] The host cell may be a eukaryote, such as a mammalian, insect, plant, or fungal cell.

[0304] The host cell may be a fungal cell. In the present application, "fungus" includes the Ascomycota, Basidiomycota, Fasciomycota, and Zygomycota, as well as the Oomycota and all imperfect fungi.

[0305] The fungal host cell may be a yeast cell. The term "yeast" in the present application includes yeasts belonging to the order ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts, and Fungi imperfecti (Blastomycetes). However, this classification may vary and may be defined according to the Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0306] The yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Komagataella, Saccharomyces, Schizosaccharomyces or Yarrowia cell, for example, Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces These may be cells of Saccharomyces norbensis, Saccharomyces oviformis, Komagataella phaffii or Yarrowia lipolytica.

[0307] The fungal host cell may be a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the phylum Eumycota and the subphylum Oomycota (as defined in the above reference (Hawksworth et al., 1995)). Filamentous fungi are typically characterized by a hyphal wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation, and carbonation is strictly aerobic. In contrast, vegetative growth in yeasts, such as Saccharomyces cerevisiae, is by germination of a unicellular thallus, and carbonation may be fermentative.

[0308] The filamentous fungal host cells are Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Mycellioptora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, It may be a cell of Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma.

[0309] For example, the filamentous fungal host cells include Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense,Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Mysellioptora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum,It may be a cell of Trichoderma reesei or Trichoderma viride, but is not limited thereto.

[0310]

[0311] The composition of the present application can be used to decompose fumonisin.

[0312] In one embodiment, the fumonisin may be present in a food.

[0313] In one embodiment, the fumonisin may be present in the feed.

[0314] The composition of the present application can be used to decompose and detoxify fumonisin present in food and / or feed.

[0315] The composition of the present application may further include other components in addition to the variants provided in the present application. Those skilled in the art can appropriately select the components to be added to the composition of the present application.

[0316] In one specific example, the composition of the present application may further comprise any component suitable for use in decomposing fumonisin.

[0317] In one specific example, the composition of the present application may further comprise any component suitable for application as a food and / or feed additive.

[0318] Examples of substances that may be added include, but are not limited to, stabilizers, surfactants, builders, chelating agents, dispersants, enzymes, enzyme stabilizers, catalysts, activators, carriers, compounding agents, lubricants, disintegrants, excipients, solubilizers, suspending agents, colorants, flavorings, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, diluents, lubricants, preservatives, and the like.

[0319] In one specific example, the composition provided in the present application may further include a naturally occurring substance or a non-naturally occurring substance in addition to the variant provided in the present application.

[0320] In one specific example, the composition provided in the present application may further comprise an additional enzyme used in a food and / or feed additive in addition to the variant provided in the present application.

[0321]

[0322] A method for producing a variant of the present invention may include a step of culturing a host cell; and a step of recovering a variant expressed in the culturing step.

[0323] In this application, the term "cultivation" refers to growing the host cells under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, or fed-batch, but is not limited thereto.

[0324] In this application, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the host cells, and supplies nutrients and growth factors, including water, which is essential for survival and development. Specifically, the medium and other culture conditions used for culturing the host cells of the present application may be any medium used for culturing conventional host cells without particular limitation, but the host cells of the present application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0325] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0326] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0327] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0328] In addition, during the cultivation of the host cells, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas can be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas can be injected without injecting gas, but is not limited thereto.

[0329] The temperature of the medium may be, but is not limited to, 20°C to 40°C, specifically 25°C to 37°C. The incubation period may continue until the desired amount of useful material is obtained, and specifically may be, but is not limited to, 10 to 120 hours.

[0330]

[0331] In one specific example, the mutant expressed in the above-described culturing step can be recovered using methods known in the art. For example, the mutant can be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

[0332] The above recovery method may be to collect the mutant using a suitable method known in the art according to the culture method of the host cell of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC and a combination of these methods may be used, and the mutant may be recovered from the medium or host cell using a suitable method known in the art.

[0333] In another specific embodiment, the variant expressed by the host cell during the culture step may not be recovered. In this specific embodiment, the host cell expressing the variant itself may be used as a source of the variant.

[0334]

[0335] Hereinafter, this application will be described in more detail through examples and experimental examples. However, these examples and experimental examples are intended to exemplify this application and the scope of this application is not limited to these examples and experimental examples.

[0336]

[0337] Example 1: Preparation of CB1 variants

[0338] Example 1-1. Production of CB1

[0339] A polynucleotide encoding a mutant having multiple mutations in the sequence of a carboxylesterase family protein derived from Bradyrhizobium sp. (hereinafter referred to as CB1, sequence number 1) was synthesized by Cosmo genetech and cloned into a pET vector (Novagen) to produce an expression vector.

[0340]

[0341] Example 1-2. Production of CB1 point mutations and combination mutants

[0342] To improve the activity of CB1, mutation sites were selected and primers were designed to produce seven point mutations and combination mutants (hereinafter referred to as M1, M2, M3, M4, M5, M6, and M7; SEQ ID NOs: 9, 10, 3, 11, 12, 13, and 14). The mutation sites, amino acids after mutation, and primer sequences for producing mutants based on the amino acid sequence of SEQ ID NO: 1 are listed in order in Table 1 below.

[0343]

[0344] 변이체명칭변이 내용서열번호프라이머 서열(5' →3')M1A147S+A155SForward15GGCCCACCCAGCGTTGAGCGCTGAATCTCCTCACCACTCAAGCGGGAATTACGGTATTTTReverse16AAAATACCGTAATTCCCGCTTGAGTGGTGAGGAGATTCAGCGCTCAACGCTGGGTGGGCCM2N90VForward17TTTGAATATTTGGGCACCAGCCCAAGTGTCGGGTGGGGCTCReverse18GAGCCCCACCCGACACTTGGGCTGGTGCCCAAATATTCAAAM3A135LForward19GTTGTTACGTTCAATTACCGCCTGGGGATCTTAGGTTTTTTGGCCReverse20GGCCAAAAAACCTAAGATCCCCAGGCGGTAATTGAACGTAACAACM4A155SForward21GGCTGCTGAATCTCCTCACCACTCAAGCGGGAATTACGGTATTTTReverse22AAAATACCGTAATTCCCGCTTGAGTGGTGAGGAGATTCAGCAGCCM5L170VForward23AGCCGCGTTAAGATGGGTGAAATCTAACGTAGCGGReverse24CCGCTACGTTAGATTTCACCCATCTTAACGCGGCTM6V209FForward25GCCATTATCGGAAGGGTTGTTTCATGGGGCCATATTACAGAReverse26TCTGTAATATGGCCCCATGAAACAACCCTTCCGATAATGGCM7T252LForward27GCCGACGCTGGGGAGTTACTGAAGATAGCCCAGTCACGReverse28CGTGACTGGGCTATCTTCAGTAACTCCCCAGCGTCGGC

[0345] Specifically, seven CB1 point mutations and combination mutants were produced by PCR using primers (SEQ ID NOs: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 in Table 1) and PCR premix (iNtRON, cat no. 25185) as templates cloned into a pET vector containing a polynucleotide encoding CB1 (SEQ ID NO: 1) produced in Example 1-1. PCR was performed using an Eppendorf Mastercycler Nexus GX2, and the reaction conditions were as follows.

[0346] Initial denaturation - 94℃, 2 min

[0347] Denaturation - 94℃, 20sec

[0348] Annealing - 55℃, 10sec

[0349] Extension - 68℃, 14 min (16 cycles from denaturation to extension)

[0350] Final Extension - 68℃, 5min

[0351]

[0352] The generated truncated mutants were ligated using the QuickChange Site-Directed Mutagenesis kit (Agilent, Cat# 200518), and then transformed into the E. coli Dh5α strain to confirm sequence mutations through sequencing.

[0353]

[0354] Example 1-3. Comparative evaluation of the activity of CB1 and variants.

[0355] The expression vectors of CB1 and 7 mutants produced in the above Examples 1-1 and 1-2 were transformed into E. coli BL21 (DE3), inoculated into sterilized LB medium (BD Difco), and pre-cultured at 37°C and 200 rpm for 16 hours. Afterwards, 1 / 100 of the medium volume was inoculated into a flask containing sterilized LB medium, and then the absorbance (OD) was measured at 37°C and 200 rpm. 600 ) was cultured until the confluency was between 0.4 and 0.5, then IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to a final concentration of 1 mM, and cultured for an additional 16 hours. Then, the cells were harvested by centrifugation. 20 ml of lysis buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 10 mM imidazole) was added to the harvested cells, redispersed, and the crude enzyme solution was secured through sonication and centrifugation. The crude enzyme solution was adsorbed on Ni-NTA resin (Qiagen, Cat no. 30230), and then the enzyme was purified by sequentially flowing the washing buffer (20 mM imidazole concentration in the lysis buffer composition) and the elution buffer (250 mM imidazole concentration in the lysis buffer composition).

[0356] Protein concentration was determined by mixing 5 μl of diluted enzyme solution and 250 μl of Bradford solution (Quick Start™ Bradford 1x Dye Reagent, #5000205) and measuring the absorbance at a wavelength of 595 nm.

[0357] To analyze the activity of purified CB1 and CB1 mutants against Fumonisin B1 (hereinafter referred to as FUM), the purified enzyme reaction solution (50 mM Tris-HCl, pH 7.4) was treated with Fumonisin B1 (CAS 116355-83-0, Fumonisin B1 from Fusarium moniliforme) dissolved in a 1:1 ratio of acetonitrile and distilled water, and the reaction was performed at 25°C for 30 minutes. After sampling at 5-minute intervals, the reaction was stopped by adding 4 times the volume of methanol. The Fumonisin B1 content of each sample was analyzed using LC-FLD, and the analysis conditions are as follows.

[0358]

[0359] - Fumonisin B1 concentration analysis conditions (LC-FLD)

[0360] Liquid chromatography-fluorescence detection analysis was performed using Waters' Acquity UPLC and fluorescence detector. After column separation, the sample was analyzed after post-column derivatization with OPA (o-phthalaldehyde) solution before entering the fluorescence detector. Detailed analysis conditions are as follows.

[0361]

[0362] (1) Chromatography: Waters Acquity UPLC System

[0363] (2) Column: Waters Acquity UPLC BEH C18 1.7um 2.1x150mm

[0364] (3) Column temperature: 40 ℃

[0365] (4) Flow rate: 0.25 mL / min

[0366] (5) Sample injection: 10.0 μL

[0367] (6) Moving phase:

[0368] A: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in DW (pH 2.1, by H3PO4)

[0369] B: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in 50% Acetonitrile(pH 2.1, by H3PO4)

[0370] (7) Dissolution conditions:

[0371] Time(min)%A%B0.025758.025758.1010010.5010010.6257516.02575

[0372] (8) Detection wavelength: Excitation wavelength 338 nm, Emission wavelength 425 nm

[0373] (9) Post-column derivatization method

[0374] Reagent: 5.2mM o-phthalaldehyde (OPA) in borate buffer

[0375] Reagent flow rate: 0.25 mL / min

[0376] Reactor temperature: 40 ℃

[0377]

[0378] Under the above conditions, the residual amount of FUM in the above reactant was measured, and the slope value of the residual amount of FUM measured by sampling at 5-minute intervals was calculated, and the relative activity was expressed by comparing the specific activity of each enzyme, and the results were as shown in Table 3 and Fig. 1.

[0379]

[0380] VariantFUM residual slope Relative Activity (%) CB1-0.049100.0M1-0.061123.2M2-0.087176.1M3-0.114231.8M4-0.098198.4M5-0.083168.4M6-0.075152.3M7-0.066133.5

[0381] As a result, it was confirmed that the activity of seven CB1 mutants (M1, M2, M3, M4, M5, M6, M7) was improved by 123.2-231.8% compared to the template CB1. This confirmed that the decomposition activity for Fumonisin B1 was improved through point mutations and combination mutations.

[0382] Example 2: Preparation of M3 variant (1)

[0383] Example 2-1. Production of M3 point mutations and combination mutants (1)

[0384] To improve the activity of M3 produced in Example 1-2, mutation sites were selected and primers were designed to produce five point mutation and combination mutants (hereinafter referred to as M8, M9, M10, M11, and M12, SEQ ID NOs: 29, 30, 31, 32, and 33). The mutation sites, amino acids after mutation, and primer sequences for producing mutants based on the amino acid sequence of SEQ ID NO: 3 are sequentially described in Table 4 below.

[0385]

[0386] Variant NameMutant ContentSequence NumberPrimer Sequence (5' → 3')M8N90VForward17TTTGAATATTTGGGCACCAGCCCAAGTGTCGGGTGGGGCTCReverse18GAGCCCCACCCGACACTTGGGCTGGTGCCCAAATATTCAAAM9A147S+A155SForward15GGCCCACCCAGCGTTGAGCGCTGAATCTCCTCACCACTCAAGCGGGAATTACGGTATTTTReverse16AAAATACCGTAATTCCCGCTTGAGTGGTGAGGAGATTCAGCGCTCAACGCTGGGTGGGCCM10A155SForward21GGCTGCTGA ATCTCCTCACCACTCAAGCGGGAATTACGGTATTTTReverse22AAAATACCGTAATTCCCGCTTGAGTGGTGAGGAGATTCAGCAGCCM11L170VForward23AGCCGCGTTAAGATGGGTGAAATCTAACGTAGCGGR everse24CCGCTACGTTAGATTTCACCCATCTTAACGCGGCTM12I293QForward34CTTTTGCCACCGGAGAGCAGCATCGCGTCCCCCTGATReverse35ATCAGGGGGACGCGATGCTGCTCTCCGGTGGCAAAAG

[0387] Specifically, five types of M3 point mutations and combination mutants were produced by PCR using the polynucleotide encoding M3 (SEQ ID NO: 3) produced in Example 1-2 cloned into a pET vector as a template, and primers (SEQ ID NOs: 17, 18, 15, 16, 21, 22, 23, 24, 34, 35 in Table 4) and PCR premix (iNtRON, cat no. 25185). PCR was performed using Eppendorf Mastercycler Nexus GX2, and the reaction conditions were as follows.

[0388]

[0389] Initial denaturation - 94℃, 2 min

[0390] Denaturation - 94℃, 20sec

[0391] Annealing - 55℃, 10sec

[0392] Extension - 68℃, 14 min (16 cycles from denaturation to extension)

[0393] Final Extension - 68℃, 5min

[0394]

[0395] The generated truncated mutants were ligated using the QuickChange Site-Directed Mutagenesis kit (Agilent, Cat# 200518), and then transformed into the E. coli Dh5α strain to confirm sequence mutations through sequencing.

[0396]

[0397] Example 2-2. Comparative evaluation of the activity of M3 and variants (1)

[0398] The expression vectors of M3 and five mutants produced in the above Example 1-2 were transformed into E. coli BL21 (DE3), inoculated into sterilized LB medium (BD Difco), and pre-cultured at 37°C and 200 rpm for 16 hours. Afterwards, 1 / 100 of the medium volume was inoculated into a flask containing sterilized LB medium, and then the absorbance (OD 600) was cultured until the confluency was between 0.4 and 0.5, then IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to a final concentration of 1 mM, and cultured for an additional 16 hours. Then, the cells were harvested by centrifugation. 20 ml of lysis buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 10 mM imidazole) was added to the harvested cells, redispersed, and the crude enzyme solution was secured through sonication and centrifugation. The crude enzyme solution was adsorbed on Ni-NTA resin (Qiagen, Cat no. 30230), and then the enzyme was purified by sequentially flowing the washing buffer (20 mM imidazole concentration in the lysis buffer composition) and the elution buffer (250 mM imidazole concentration in the lysis buffer composition).

[0399] Protein concentration was determined by mixing 5 μl of diluted enzyme solution and 250 μl of Bradford solution (Quick Start™ Bradford 1x Dye Reagent, #5000205) and measuring the absorbance at a wavelength of 595 nm.

[0400] To analyze the activity of purified M3 and M3 variants against Fumonisin B1 (hereinafter referred to as FUM), the purified enzyme reaction solution (50 mM Tris-HCl, pH 7.4) was treated with Fumonisin B1 (CAS 116355-83-0, Fumonisin B1 from Fusarium moniliforme) dissolved in a 1:1 ratio of acetonitrile and distilled water. The reaction was performed at 25°C for 30 minutes, and sampling was performed at 5-minute intervals. The reaction was stopped by adding 4 times the volume of methanol. The Fumonisin B1 content of each sample was analyzed using LC-FLD, and the analysis conditions were as follows.

[0401] - Fumonisin B1 concentration analysis conditions (LC-FLD)

[0402] Liquid chromatography-fluorescence detection analysis was performed using Waters' Acquity UPLC and fluorescence detector. After column separation, the sample was analyzed after post-column derivatization with OPA (o-phthalaldehyde) solution before entering the fluorescence detector. Detailed analysis conditions are as follows.

[0403]

[0404] (1) Chromatography: Waters Acquity UPLC System

[0405] (2) Column: Waters Acquity UPLC BEH C18 1.7um 2.1x150mm

[0406] (3) Column temperature: 40 ℃

[0407] (4) Flow rate: 0.25 mL / min

[0408] (5) Sample injection: 10.0 μL

[0409] (6) Moving phase:

[0410] A: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in DW (pH 2.1, by H3PO4)

[0411] B: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in 50% Acetonitrile(pH 2.1, by H3PO4)

[0412] (7) Dissolution conditions:

[0413] Time(min)%A%B0.025758.025758.1010010.5010010.6257516.02575

[0414] (8) Detection wavelength: Excitation wavelength 338 nm, Emission wavelength 425 nm (9) Post-column derivatization method

[0415] Reagent: 5.2mM o-phthalaldehyde (OPA) in borate buffer

[0416] Reagent flow rate: 0.25 mL / min

[0417] Reactor temperature: 40 ℃

[0418]

[0419] Under the above conditions, the residual amount of FUM in the above reactant was measured, and the slope value of the residual amount of FUM measured by sampling at 5-minute intervals was calculated, and the relative activity was expressed by comparing the specific activity of each enzyme, and the results were as shown in Table 6 and Fig. 2.

[0420]

[0421] VariantFUM residual slope slope Relative Activity (%) M3-0.060100.0 M8-0.131218.2 M9-0.144239.5 M10-0.067111.8 M11-0.106177.6 M12-0.084140.6

[0422] As a result, it was confirmed that the activity of five M3 mutants (M8, M9, M10, M11, and M12) was improved by 111.8–239.5% compared to the template M3. Through this, it was confirmed that the decomposition activity against Fumonisin B1 was improved through point mutations and combination mutations.

[0423] Example 3: Preparation of M3 variant (2)

[0424] Example 3-1. Production of M3 point mutations and combination mutants (2)

[0425] To improve the activity of M3, additional mutation sites were selected and primers were designed to produce four point mutations and combination mutants (hereinafter referred to as M13, M14, M15, and M16; SEQ ID NOs: 36, 37, 5, and 38). The mutation sites, amino acids after mutation, and primer sequences for producing the mutants based on the amino acid sequence of SEQ ID NO: 3 are listed in order in Table 7 below.

[0426]

[0427] Variant Name Variant Content Sequence Number Primer Sequence (5' → 3') M13N90A+R354AForward 39tttgaatatttgggcaccagcccaagcgtcgggtggggctcReverse 40gagccccacccgacgcttgggctggtgcccaaatattcaaaForward 41AGCCGCAGTAGCCGCCTTGTTCGGAGATAGTCReverse 42GACTATCTCCGAACAAGGCGGCTACTGCGGCTM14A147TForward 43gcccacccagcgttgaccgctgaatct cctcacReverse44gtgaggagattcagcggtcaacgctgggtgggcM15A407GForward45cgagatcccttacgtgtttggcaatttgggtccttccagtgReverse46cactgga aggacccaaattgccaaacacgtaagggatctcgM16V199LForward47gcctgcttgatatgctgctggtgtcgccattReverse48aatggcgacaccagcagcatatcaagcaggc

[0428] Specifically, four types of M3 point mutations and combination mutants were produced by PCR using the polynucleotide encoding M3 (SEQ ID NO: 3) produced in Example 1-2 cloned into a pET vector as a template, and primers (SEQ ID NOs: 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 in Table 7) and PCR premix (iNtRON, cat no. 25185). PCR was performed using Eppendorf Mastercycler Nexus GX2, and the reaction conditions were as follows.

[0429]

[0430] Initial denaturation - 94℃, 2 min

[0431] Denaturation - 94℃, 20sec

[0432] Annealing - 55℃, 10sec

[0433] Extension - 68℃, 14 min (16 cycles from denaturation to extension)

[0434] Final Extension - 68℃, 5min

[0435]

[0436] The generated truncated mutants were ligated using the QuickChange Site-Directed Mutagenesis kit (Agilent, Cat# 200518), and then transformed into the E. coli Dh5α strain to confirm sequence mutations through sequencing.

[0437]

[0438] Example 3-2. Comparative evaluation of the activity of M3 and variants

[0439] The expression vectors of M3 and four mutants produced in the above Examples 1-2 and 3-1 were transformed into E. coli BL21 (DE3), inoculated into sterilized LB medium (BD Difco), and pre-cultured at 37°C and 200 rpm for 16 hours. Afterwards, 1 / 100 of the medium volume was inoculated into a flask containing sterilized LB medium, and then the absorbance (OD 600 ) was cultured until the confluency was between 0.4 and 0.5, then IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to a final concentration of 1 mM, and cultured for an additional 16 hours. Then, the cells were harvested by centrifugation. 20 ml of lysis buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 10 mM imidazole) was added to the harvested cells, redispersed, and the crude enzyme solution was secured through sonication and centrifugation. The crude enzyme solution was adsorbed on Ni-NTA resin (Qiagen, Cat no. 30230), and then the enzyme was purified by sequentially flowing the washing buffer (20 mM imidazole concentration in the lysis buffer composition) and the elution buffer (250 mM imidazole concentration in the lysis buffer composition).

[0440] Protein concentration was determined by mixing 5 μl of diluted enzyme solution and 250 μl of Bradford solution (Quick Start™ Bradford 1x Dye Reagent, #5000205) and measuring the absorbance at a wavelength of 595 nm.

[0441] To analyze the activity of purified M3 and M3 variants against Fumonisin B1 (hereinafter referred to as FUM), the purified enzyme reaction solution (50 mM Tris-HCl, pH 7.4) was treated with Fumonisin B1 (CAS 116355-83-0, Fumonisin B1 from Fusarium moniliforme) dissolved in a 1:1 ratio of acetonitrile and distilled water. The reaction was allowed to react at 25°C for 15 minutes, and then 4 times the volume of methanol was added to stop the reaction. The Fumonisin B1 content of each sample was analyzed by LC-FLD, and the analysis conditions were as follows.

[0442]

[0443] - Fumonisin B1 concentration analysis conditions (LC-FLD)

[0444] Liquid chromatography-fluorescence detection analysis was performed using Waters' Acquity UPLC and fluorescence detector. After column separation, the sample was analyzed after post-column derivatization with OPA (o-phthalaldehyde) solution before entering the fluorescence detector. Detailed analysis conditions are as follows.

[0445]

[0446] (1) Chromatography: Waters Acquity UPLC System

[0447] (2) Column: Waters Acquity UPLC BEH C18 1.7um 2.1x150mm

[0448] (3) Column temperature: 40 ℃

[0449] (4) Flow rate: 0.25 mL / min

[0450] (5) Sample injection: 10.0 μL

[0451] (6) Moving phase:

[0452] A: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in DW (pH 2.1, by H3PO4)

[0453] B: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in 50% Acetonitrile(pH 2.1, by H3PO4)

[0454] (7) Dissolution conditions:

[0455] Time(min)%A%B0.025758.025758.1010010.5010010.6257516.02575

[0456] (8) Detection wavelength: Excitation wavelength 338 nm, Emission wavelength 425 nm

[0457] (9) Post-column derivatization method

[0458] Reagent: 5.2mM o-phthalaldehyde (OPA) in borate buffer

[0459] Reagent flow rate: 0.25 mL / min

[0460] Reactor temperature: 40 ℃

[0461]

[0462] Under the above conditions, the residual amount of FUM in the above reaction product was measured, and the relative activity of the mutants was measured using the ratio of the total decomposed FUM, and the results were as shown in Table 9 and Fig. 3.

[0463] Variant FUMFUM Remaining (%) FUMFUM Degradation (%) Relative Activity (%) M386.413.6100.0 M1382.917.1126.3 M1486.313.7100.5 M1584.915.1111.1 M1667.232.8241.2

[0464] As a result, when the enzyme activity was expressed as a relative ratio, it was confirmed that the activity of the four M3 mutants (M13, M14, M15, M16) was improved by 100.5-241.2% or more compared to the template M3. This confirmed that the decomposition activity for Fumonisin B1 was improved through point mutation and combination mutation.

[0465] Example 4: Preparation of M15 variants

[0466] Example 4-1. Production of M15 point mutations and combination mutants

[0467] To improve the activity of M15, additional mutation sites were selected and primers were designed to produce five point mutations and combination mutants (hereinafter referred to as M17, M18, M19, M20, and M21, and SEQ ID NOs: 7, 49, 50, 51, and 52). The mutation sites, amino acids after mutation, and primer sequences for producing the mutants based on the amino acid sequence of SEQ ID NO: 5 are listed in order in Table 10 below.

[0468]

[0469] Variant NameMutant ContentSequence NumberPrimer Sequence (5'→3')M17G29AForward53gggtaccgttcgcggcacctcccatReverse54atgggaggtgccgcgaacggtacccM18M452GForward55ggatcctaacgggggtggccttcctcactggccggReverse56ccggccagtgaggaaggccacccccgttaggatccM19A147TForward43gcccacccagcgttgaccgctgaatctcctc acReverse44gtgaggagattcagcggtcaacgctgggtgggcM20T290AForward57tactgctgcttttgccgcgggagagattcatcgcgReverse58cgcgatgaa tctctcccgcggcaaaagcagcagtaM21V199LForward47gcctgcttgatatgctgctggtgtcgccattReverse48aatggcgacaccagcagcatatcaagcaggc

[0470] Specifically, five types of M15 point mutations and combination mutants were produced by PCR using the polynucleotide encoding M15 (SEQ ID NO: 5) produced in Example 3-1 cloned into a pET vector as a template, and primers (SEQ ID NOs: 53, 54, 55, 56, 43, 44, 57, 58, 47, 48 in Table 10) and PCR premix (iNtRON, cat no. 25185). PCR was performed using Eppendorf Mastercycler Nexus GX2, and the reaction conditions were as follows.

[0471]

[0472] Initial denaturation - 94℃, 2 min

[0473] Denaturation - 94℃, 20sec

[0474] Annealing - 55℃, 10sec

[0475] Extension - 68℃, 14 min (16 cycles from denaturation to extension)

[0476] Final Extension - 68℃, 5min

[0477]

[0478] The generated truncated mutants were ligated using the QuickChange Site-Directed Mutagenesis kit (Agilent, Cat# 200518), and then transformed into the E. coli Dh5α strain to confirm sequence mutations through sequencing.

[0479]

[0480] Example 4-2. Comparative evaluation of the activity of M15 and variants

[0481] The expression vectors of M15 and five mutants produced in the above Examples 3-1 and 4-1 were transformed into E. coli BL21 (DE3), inoculated into sterilized LB medium (BD Difco), and pre-cultured at 37°C and 200 rpm for 16 hours. Afterwards, 1 / 100 of the medium volume was inoculated into a flask containing sterilized LB medium, and then the absorbance (OD) was measured at 37°C and 200 rpm. 600) was cultured until the confluency was between 0.4 and 0.5, then IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to a final concentration of 1 mM, and cultured for an additional 16 hours. Then, the cells were harvested by centrifugation. 20 ml of lysis buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 10 mM imidazole) was added to the harvested cells, redispersed, and the crude enzyme solution was secured through sonication and centrifugation. The crude enzyme solution was adsorbed on Ni-NTA resin (Qiagen, Cat no. 30230), and then the enzyme was purified by sequentially flowing the washing buffer (20 mM imidazole concentration in the lysis buffer composition) and the elution buffer (250 mM imidazole concentration in the lysis buffer composition).

[0482] Protein concentration was determined by mixing 5 μl of diluted enzyme solution and 250 μl of Bradford solution (Quick Start™ Bradford 1x Dye Reagent, #5000205) and measuring the absorbance at a wavelength of 595 nm.

[0483] To analyze the activity of purified M15 and M15 variants against Fumonisin B1 (hereinafter referred to as FUM), the purified enzyme reaction solution (50 mM Tris-HCl, pH 7.4) was treated with Fumonisin B1 (CAS 116355-83-0, Fumonisin B1 from Fusarium moniliforme) dissolved in a 1:1 ratio of acetonitrile and distilled water. The reaction was allowed to react at 25°C for 15 minutes, and then 4 times the volume of methanol was added to stop the reaction. The Fumonisin B1 content of each sample was analyzed by LC-FLD under the following conditions.

[0484]

[0485] - Fumonisin B1 concentration analysis conditions (LC-FLD)

[0486] Liquid chromatography-fluorescence detection analysis was performed using Waters Acquity UPLC and a fluorescence detector. After column separation, the sample was analyzed after post-column derivatization with OPA (o-phthalaldehyde) solution before entering the fluorescence detector. Detailed analysis conditions are as follows.

[0487]

[0488] (1) Chromatography: Waters Acquity UPLC System

[0489] (2) Column: Waters Acquity UPLC BEH C18 1.7um 2.1x150mm

[0490] (3) Column temperature: 40 ℃

[0491] (4) Flow rate: 0.25 mL / min

[0492] (5) Sample injection: 10.0 μL

[0493] (6) Moving phase:

[0494] A: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in DW (pH 2.1, by H3PO4)

[0495] B: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in 50% Acetonitrile(pH 2.1, by H3PO4)

[0496] (7) Dissolution conditions:

[0497] Time(min)%A%B0.025758.025758.1010010.5010010.6257516.02575

[0498] (8) Detection wavelength: Excitation wavelength 338 nm, Emission wavelength 425 nm

[0499] (9) Post-column derivatization method

[0500] Reagent: 5.2mM o-phthalaldehyde (OPA) in borate buffer

[0501] Reagent flow rate: 0.25 mL / min

[0502] Reactor temperature: 40 ℃

[0503]

[0504] Under the above conditions, the residual amount of FUM in the above reaction product was measured, and the relative activity of the mutants was measured using the ratio of the total decomposed FUM, and the results were as shown in Table 12 and Fig. 4.

[0505] Variant FUMFUM Remaining (%) FUMFUM Degradation (%) Relative Activity (%) M1542.857.2100 M1721.978.1136.5 M1839.860.2105.2 M1933.566.5 116.3 M2041.958.1101.7 M2127.572.5 126.8

[0506] As a result, when the enzyme activity was expressed as a relative ratio, it was confirmed that the activity of the five M15 mutants (M17, M18, M19, M20, M21) was improved by 101.7-136.5% or more compared to the template M15. This confirms that the decomposition activity for Fumonisin B1 was improved through point mutations and combination mutations.

[0507] Example 5: Preparation of M17 variants

[0508] Example 5-1. Production of M17 point mutations and combination mutants

[0509] To improve the activity of M17, additional mutation sites were selected and primers were designed to produce two point mutation and combination mutants (hereinafter referred to as M22 and M23, SEQ ID NOs: 59 and 60). The mutation sites, amino acids after mutation, and primer sequences for producing the mutants based on the amino acid sequence of SEQ ID NO: 7 are listed in order in Table 13 below.

[0510] Variant NameMutant ContentSequence NumberPrimer Sequence (5' → 3')M22M452GForward55ggatcctaacgggggtggccttcctcactggccggReverse56ccggccagtgaggaaggccacccccgttaggatccM23V199LForward47gcctgcttgatatgctgctggtgtcgccattReverse48aatggcgacaccagcagcatatcaagcaggc

[0511] Specifically, two types of M17 point mutation and combination mutant were produced by PCR using the polynucleotide encoding M17 (SEQ ID NO: 7) produced in Example 4-1 cloned into the pET vector as a template, and primers (SEQ ID NOs: 57, 58, 48, 49 in Table 13) and PCR premix (iNtRON, cat no. 25185). PCR was performed using Eppendorf Mastercycler Nexus GX2, and the reaction conditions were as follows.

[0512]

[0513] Initial denaturation - 94℃, 2 min

[0514] Denaturation - 94℃, 20sec

[0515] Annealing - 55℃, 10sec

[0516] Extension - 68℃, 14 min (16 cycles from denaturation to extension)

[0517] Final Extension - 68℃, 5min

[0518]

[0519] The generated truncated mutants were ligated using the QuickChange Site-Directed Mutagenesis kit (Agilent, Cat# 200518), and then transformed into the E. coli Dh5α strain to confirm sequence mutations through sequencing.

[0520]

[0521] Example 5-2. Comparative evaluation of the activity of M17 and variants.

[0522] The expression vectors of M17 and two mutants produced in the above Examples 4-1 and 5-1 were transformed into E. coli BL21 (DE3), inoculated into sterilized LB medium (BD Difco), and pre-cultured at 37°C and 200 rpm for 16 hours. Afterwards, 1 / 100 of the medium volume was inoculated into a flask containing sterilized LB medium, and then the absorbance (OD 600 ) was cultured until the confluency was between 0.4 and 0.5, then IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to a final concentration of 1 mM, and cultured for an additional 16 hours. Then, the cells were harvested by centrifugation. 20 ml of lysis buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 10 mM imidazole) was added to the harvested cells, redispersed, and the crude enzyme solution was secured through sonication and centrifugation. The crude enzyme solution was adsorbed on Ni-NTA resin (Qiagen, Cat no. 30230), and then the enzyme was purified by sequentially flowing the washing buffer (20 mM imidazole concentration in the lysis buffer composition) and the elution buffer (250 mM imidazole concentration in the lysis buffer composition).

[0523] Protein concentration was determined by mixing 5 μl of diluted enzyme solution and 250 μl of Bradford solution (Quick Start™ Bradford 1x Dye Reagent, #5000205) and measuring the absorbance at a wavelength of 595 nm.

[0524] To analyze the activity of purified M17 and M17 variants against Fumonisin B1 (hereinafter referred to as FUM), the purified enzyme reaction solution (50 mM Tris-HCl, pH 7.4) was treated with Fumonisin B1 (CAS 116355-83-0, Fumonisin B1 from Fusarium moniliforme) dissolved in a 1:1 ratio of acetonitrile and distilled water. The reaction was allowed to react at 25°C for 15 minutes, and then 4 times the volume of methanol was added to stop the reaction. The Fumonisin B1 content of each sample was analyzed by LC-FLD, and the analysis conditions were as follows.

[0525]

[0526] - Fumonisin B1 concentration analysis conditions (LC-FLD)

[0527] Liquid chromatography-fluorescence detection analysis was performed using Waters' Acquity UPLC and fluorescence detector. After column separation, the sample was analyzed after post-column derivatization with OPA (o-phthalaldehyde) solution before entering the fluorescence detector. Detailed analysis conditions are as follows.

[0528]

[0529] (1) Chromatography: Waters Acquity UPLC System

[0530] (2) Column: Waters Acquity UPLC BEH C18 1.7um 2.1x150mm

[0531] (3) Column temperature: 40 ℃

[0532] (4) Flow rate: 0.25 mL / min

[0533] (5) Sample injection: 10.0 μL

[0534] (6) Moving phase:

[0535] A: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in DW (pH 2.1, by H3PO4)

[0536] B: 13.7mM Octanesulfonic acid + 25mM Potassium dihydrogen phosphate in 50% Acetonitrile(pH 2.1, by H3PO4)

[0537] (7) Dissolution conditions:

[0538] Time(min)%A%B0.025758.025758.1010010.5010010.6257516.02575

[0539] (8) Detection wavelength: Excitation wavelength 338 nm, Emission wavelength 425 nm (9) Post-column derivatization method

[0540] Reagent: 5.2mM o-phthalaldehyde (OPA) in borate buffer

[0541] Reagent flow rate: 0.25 mL / min

[0542] Reactor temperature: 40 ℃

[0543]

[0544] Under the above conditions, the residual amount of FUM in the above reaction product was measured, and the relative activity of the mutants was measured using the ratio of the total decomposed FUM, and the results were as shown in Table 15 and Fig. 5.

[0545]

[0546] VariantFUM Remaining(%)FUM Degradation (%)Relative Activity (%)M1739.960.1100M2234.066.0109.9M2325.674.4123.8

[0547] As a result, when enzyme activity was expressed as a relative ratio, it was confirmed that the activity of two M17 mutants (M22, M23) was improved by 109.9-123.8% or more compared to the template M17. Through this, it was confirmed that the activity against Fumonisin B1 was improved through point mutation and combination mutation.

[0548]

[0549] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A mutant polypeptide having fumonisin decomposition activity, i) the mutant polypeptide has a sequence identity of 70% or more and less than 100% with SEQ ID NO: 1; and / or ii) the mutant polypeptide is a polypeptide encoded by a polynucleotide having a sequence identity of 70% or more and less than 100% with the sequence encoding the mature polypeptide of SEQ ID NO: 1; and / or iii) the mutant polypeptide is a polypeptide encoded by a polynucleotide that hybridizes with (a) the mature polypeptide coding sequence of SEQ ID NO: 1, (b) a cDNA thereof, or (c) the full-length complement of (a) or (b) under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions; and / or iv) the above mutant polypeptide is a functional fragment of polypeptide i), ii) or iii) having fumonisin decomposition activity; and A variant polypeptide comprising any one of the following modifications: Deletion, insertion, substitution with another amino acid, and combinations thereof at one or more of positions 29, 90, 135, 147, 155, 170, 199, 209, 252, 290, 293, 354, 407, and 452; Here, the position number corresponds to the position of the polypeptide of sequence number 1.

2. In the first paragraph, a mutant polypeptide having the fumonisin decomposition activity, wherein amino acid position 29 before modification is G; amino acid position 90 is N; amino acid position 135 is A; amino acid position 147 is A; amino acid position 155 is A; amino acid position 170 is L; amino acid position 199 is V; amino acid position 209 is V; amino acid position 252 is T; amino acid position 290 is T; amino acid position 293 is I; amino acid position 354 is R; amino acid position 407 is A; and / or amino acid position 452 is M.

3. In the first paragraph, the mutant polypeptide is a mutant polypeptide comprising an amino acid substitution at one or more of the amino acids at positions 29, 90, 135, 147, 155, 170, 199, 209, 252, 290, 293, 354, 407, and 452. Here, the position number corresponds to the position of the polypeptide of sequence number 1.

4. In the first paragraph, the mutant polypeptide comprises at least one substitution among the following i) to xiv); i) Substitution of amino acid 29 with alanine (A); ii) Substitution of amino acid 90 with valine (V) or alanine (A); iii) Substitution of amino acid 135 with leucine (L); iv) Substitution of amino acid 147 with serine (S) or threonine (T); v) Substitution of amino acid 155 with serine (S); vi) Substitution of amino acid 170 with valine (V); vii) Substitution of amino acid 199 with leucine (L); viii) Substitution of amino acid 209 with phenylalanine (F); ix) Substitution of amino acid 252 with leucine (L); x) Substitution of amino acid 290 with alanine (A); xi) Substitution of amino acid 293 with glutamine (Q); xii) Substitution of amino acid 354 with alanine (A); xiii) Substitution of amino acid 407 with glycine (G); xiv) Substitution of amino acid 452 with glycine (G); Here, the position number corresponds to the position of the polypeptide of sequence number 1.

5. In the first paragraph, the mutant polypeptide comprises one or more modifications selected from the following: A147S+A155S; N90V; A135L; A155S; L170V; V209F; T252L; A135L+N90V; A135L+A147S+A155S; A135L+A155S; A135L+L170V; A135L+I293Q; A135L+N90A+R354A; A135L+A147T; A135L+A407G; A135L+V199L; A135L+A407G+G29A; A135L+A407G+M452G; A135L+A407G+A147T; A135L+A407G+T290A; A135L+A407G+V199L; A135L+A407G+G29A+M452G; A135L+A407G+G29A+V199L Here, the position number corresponds to the position of the polypeptide of sequence number 1.

6. In the first paragraph, the mutant polypeptide has at least one of the following i) and ii) altered characteristics compared to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1: i) increased enzyme activity; and ii) Increased specific activity.

7. A composition comprising a mutant polypeptide according to any one of claims 1 to 6; and at least one host cell expressing the mutant polypeptide.

8. A composition for decomposing fumonisin, comprising a mutant polypeptide according to any one of claims 1 to 6; or at least one host cell expressing the mutant polypeptide.

9. A mutant polypeptide according to any one of claims 1 to 6; and at least one host cell expressing the mutant polypeptide. Composition for feed additive.

10. A mutant polypeptide according to any one of claims 1 to 6; and at least one host cell expressing the mutant polypeptide. A composition for detoxifying fumonisins present in food, feed or both said food and feed.

11. A method for decomposing fumonisin, comprising the step of reacting a mutant polypeptide of any one of claims 1 to 6; and at least one host cell expressing the mutant polypeptide with fumonisin.

12. A polynucleotide encoding a mutant polypeptide of any one of claims 1 to 6.

13. A host cell comprising a mutant polypeptide according to any one of claims 1 to 6; and at least one of the polynucleotides according to claim 11.

14. A step of culturing the host cell of clause 13; and Comprising a step of recovering a mutant polypeptide having a fumonisin decomposition activity of any one of claims 1 to 6 expressed in the above culturing step. A method for producing a mutant polypeptide having fumonisin decomposition activity.

15. A use for decomposing fumonisin, wherein the mutant polypeptide of any one of claims 1 to 6; and a host cell expressing the mutant polypeptide.

Images