A genetically engineered yeast containing a transhydrogenase enzyme with improved lactic acid production

Genetically engineered S. pombe strains with attenuated PDC and transhydrogenase enzymes, along with targeted gene deletions, enhance lactic acid production efficiency and productivity, addressing the challenges of byproduct diversion in yeast strains.

WO2025174841A1PCT designated stage Publication Date: 2025-08-21ARCHER DANIELS MIDLAND CO
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/015536
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-12
Filing Date
2025-02-12
Publication Date
2025-08-21

AI Technical Summary

Technical Problem

Existing yeast strains, particularly Schizosaccharomyces pombe, face challenges in optimizing lactic acid production due to variations in lactate dehydrogenase genes and other enzymes that divert pyruvate metabolites into unwanted byproducts like ethanol and glycerol, necessitating the selection of optimal alleles for genetic modifications.

Method used

Genetically engineered S. pombe strains with attenuated pyruvate decarboxylase (PDC) expression and heterologous transhydrogenase enzyme introduction, combined with specific deletions of ADH and GPD genes, enhance lactic acid yield and productivity.

Benefits of technology

The engineered strains achieve improved lactic acid yield and specific production, meeting commercial KPIs of 140g/L with 87% yield and 3.3g/L/hr productivity, while maintaining biomass propagation and minimizing byproduct formation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025015536_21082025_PF_FP_ABST
    Figure US2025015536_21082025_PF_FP_ABST
Patent Text Reader

Abstract

Described herein are Schizosaccharomyces pombe yeast strains genetically engineered to produce lactic acid by fermentation, wherein the strains have (i) a first genetic modification that introduces at least one exogenous lactate dehydrogenase (LDH) gene operably linked to a first promoter to express the LDH gene; and a second genetic modification that introduces a gene encoding an exogenous transhydrogenase enzyme operably linked to a second promoter to express the transhydrogenase enzyme in the strain, wherein the engineered strain produces more lactic acid by fermentation than a parent strain lacking the second genetic modification. In the exemplary embodiments, the strains further include attenuated expression of pyruvate decarboxylase in the strain. One method of attenuating the activity of the second gene is by replacing the native gene with a gene having a GC content of 45% to 62%. Another method is by promoter swap with a less active promoter.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] TITLE OF THE INVENTION

[0002] A Genetically Engineered Yeast Containing A Transhydrogenase Enzyme With Improved Lactic Acid Production

[0003] TECHNICAL FIELD

[0004] The invention relates to genetically engineered yeast that produces lactic acid.

[0005] BACKGROUND OF THE INVENTION

[0006] The production of lactic acid by fermentation using genetically engineered yeasts has been a field of endeavor for a number of years as a sustainable method of producing a product useful in materials as diverse as foods and polymers. Candidate host yeast strains for production of lactic acid include Saccharomyces cerevisiae, Schizosaccharomyces pombe, and various species from the genera Kluyveromyces, Pichia, Candida and Hansenula. Most of the publications describing use of these yeasts for lactate production include overexpression of an exogenous lactate dehydrogenase gene from various sources in the host cell. Lactate dehydrogenase reversibly catalyzes the NAD / NADH redox conversion between pyruvate and lactic acid.

[0007] As will be evident from the detailed description of the present invention, not all lactate dehydrogenase genes work alike, even when codon optimized for expression in a selected host organism. The enzymes from various sources have different equilibrium constants, different specific activities, different rates of reaction and have different physical conformations that may make the proteins more or less difficult to express in a given strain, so there is a need in the art to discover the best lactate dehydrogenases for lactate production in a selected host strain.

[0008] RU2539092C1 describes a Schizosaccharomyces pombe yeast named VKPM Y- 4041 that is transformed with a Lactobacillus plantarum lactate dehydrogenase gene (LDH).

[0009] RU2268304C1 describes a Schizosaccharomyces pombe yeast transformed with a Rhizopus oryzae LDH gene, resulting in the strain named VKPM Y-3127.

[0010] In addition to overexpression of an exogenous lactate dehydrogenase, efforts have been made to lower or eliminate the expression of other enzymes that may siphon off the pool of pyruvate metabolites in the host cell and / or which may result in converting a portion of 3 carbon metabolites into ethanol or glycerol, which are unwanted byproducts when seeking to produce lactic acid. Enzymes of this category include pyruvate decarboxylase (PDC) that catalyzes the conversion of pyruvate to acetaldehyde, alcohol dehydrogenase (ADH) that catalyzes the reduction of acetaldehyde to ethanol, and glycerol 3 phosphate dehydrogenase (GPD) that reduces glycerone 3 phosphate to glycerol 3 phosphate which is dephosphorylated to form glycerol, thereby siphoning off three carbon metabolites that could directed toward lactate.

[0011] Most yeast, and particularly in the context of the present invention, S. pombe, contain multiple alleles for the genes mentioned above. The alleles encode different proteins with the same enzymatic activity, but the expression level and activity level of the different alleles are not the same. If all alleles for these gene were inactivated the yeast could not sustain the energy metabolism necessary for lactate production. It is therefore critical to know which alleles can be inactivated to optimize lactate production. In the summary below, alleles of various genes in S. pombe are referenced by the gene name and the open reading frame designation from an annotated curated database of the 5. pombe genome called PomBase available at ADM strain identification number begin with "SP." s a S. pombe strain transformed with a human LDH and containing a deletion of one pyruvate decarboxylase 2 gene (i.e., pdc2A , aka pdclOlA) (SPAClF8.07c) while retaining a wild type (unmodified) PDC4 (aka PDC201) (SPAC3G9.11c). This strain is therefore pdcl01APDC201+.

[0012] US10597662B2 describes a 5. pombe strain containing two D-lactate dehydrogenase genes. One is from Pediococcus acidilactici and one is from either Lactobacillus bulgaricus or Lactobacillus brevis in combination with a pyruvate decarboxylase 2 gene deletion pdc2A (aka PDC101) (SPAClF8.07c) .

[0013] US9428777B2 describes a S. pombe strain containing a Lactobacillus pentosus

[0014] LDH and a human lactate LDH, in combination with a deletion of a the pdc2 gene (aka pdclOlA) (SPAClF8.07c). RU2614233C1 speculatively mentions construction of a S. pombe strain containing one or more Lactobacillus acidophilus LDH genes integrated into the chromosome and in which one or more genes of alcohol dehydrogenases (ADH) are inactivated or deleted. While the publication speculatively mentions inactivation of one or more ADH genes, the only ADH gene shown to have been deleted was the gene encoding ADH1 (SPCC13B11.01).

[0015] RU2652877C1 and RU2650669C1 similarly discloses a strain of S. pombe having an inactivated ADH1 (SPCC13B11.01) gene and expression of one more copies of a lactate dehydrogenase gens from Lactobacillus plantarum or Lactobacillus acidophilus;

[0016] Ozaki et al, (Metabolic engineering of Schizosaccharomyces pombe via CRISPR- Cas9 genome editing for lactic acid production from glucose and cellobiose, Metabolic Engineering Communications 5 (2017) p60-67) describes introduction of a Lactobacillus plantarum LDH gene into S. pombe and mentions a failed attempt to simultaneously engineer an ADH1 mutant, (i.e, adhlA (SPCC13B11.01)). As an alternative they overexpressed bacterial acetaldehyde dehydrogenase genes to generate acetyl-CoA. The authors further describe making a strain with deletions of two pyruvate decarboxylase genes (i.e., pdclOlA (SPAClF8.07c) a d pdc202A (SPAC13A11.06)) along with a deletion in alcohol dehydrogenase gene ADH8 i.e adh8A (SPBC1773.06c) and overexpression of the Lactobacillus plantarum LDH gene. The authors further describe deletion of what is described as a minor alcohol dehydrogenase having the systematic gene name SPBC337.il. In Pombase, SPBC337.il is annotated as a "mitochondrial membrane CH-OH group oxidoreductase, human RTN4IP1 ortholog, implicated in mitochondrial organization or tethering." Lastly the authors describe deletions of the glycerol-3-phosphate dehydrogenase gene GPD2 (SPAC23D3.04c) and another predicted glycerol-3-phosphate dehydrogenase GUT2 (SPCC1223.03c) in combination with the foregoing deletions and overexpression of the same LDH gene.

[0017] US11041176 B2 describes a yeast cell genetically engineered to produce succinate from pyruvate that contains a heterologous transhydrogenase enzyme. The inventors disclose a recombinant yeast cell that contains a reductive TCA (rTCA) metabolic pathway to succinate from pyruvate or phosphoenolpyruvate that also contains a cytosolic NADP(H) / NAD(H) transhydrogenase. These cells need to contain at least one heterologous copy of the following: pyruvate carboxylase; malate dehydrogenase; fumarate dehydratase; or fumarate reductase. The strains of the present application contains none of those genetic modifications and the final product is the 3-carbon lactic acid, not 4-carbon succinic acid.

[0018] US6440688 Bl describes a non-human cell expressing a transhydrogenase enzyme with sequence identity of greater than 70% to its claimed enzyme amino acid. The sequences claimed in the present application range from 43.3% and 60.6% amino acid sequence identity to the claimed transhydrogenase sequence.

[0019] Cao et.al. (Curr Microbiol. 2021 Dec 20;79(l):32. doi: 10.1007 / s00284-021-02727- y.) reports on the biochemical characterization of three known and one previously unknown transhydrogenase variant, which were discovered based on a BLAST analysis of the E. coli STH amino acid sequence with a threshold of 40% identity. These STH variants included sequences derived from: 1) Acinetobacter baumannii; 2) Azotobacter vinelandii; 3) Escherichia coli; and 4) Klebsiella pneumoniae. The authors demonstrated in vitro kinetic enzyme activity.

[0020] There is a need in the art to continue to improve yeast strains, and particularly improve Schizosaccharomyces pombe strains to optimize production of lactic acid by fermentation. As will be apparent from the description that follows, it is important to select the best ADH, PDC and GPD alleles for deletion and to choose the best heterologous LDH genes for overexpression in S. pombe.

[0021] The foregoing prior art describes genetic modifications of two of the four pyruvate decarboxylase genes in 5. pombe restricted to complete deletion and therefore loss-of-expression of the PDC enzyme from those gene combined with the heterologous expression of exogenous LDH genes for the bio-production of lactic acid. This present invention describes complete inactivation of only the dominant PDC gene in S. pombe denoted PDC201 combined with partial deactivation (i.e. attenuation) of a second PDC gene that surprisingly results in better lactic acid (organic acid) yield over a parent strain only having a deletion of the PDD201 gene and better than a strain containing complete deletions of the two dominant PDC genes (PDC201 and PDC101). The inventive strains retain enough PDC activity to maintain a rigorous level of biomass propagation (Figure 4) while simultaneously reducing the loss of pyruvate substrate for LDH conversion to lactic acid otherwise caused by maintaining a fully active second PDC gene. The lactic acid yield improvement is controllable by the degree of PDC attenuation (Figure 7).

[0022] SUMMARY OF THE INVENTION

[0023] 1. In some embodiments the inventors describe the heterologous expression of a soluble bacterial NAD(H)-NADP(H) transhydrogenase (STH) enzyme in a genetically engineered S. pombe strain. Transhydrogenase enzymes catalyze the transfer of electrons from one redox cofactor to another using the following reaction: NADPH + NAD+< - > NADP++ NADH. In a physiological state in which NAD(H) is fully oxidized to NAD+and some NADPH is available, a cytoplasmic transhydrogenase will reduce cytoplasmic NAD+to NADH, which is then available for LDH to reduce pyruvate to lactate. In a strain containing a lactic acid biosynthetic pathway with attenuated PDC activity (e.g. Sp505) the heterologous expression of a transhydrogenase results in an increase in lactic acid yield, titer and lactic acid specific production (Figure 8). L-Lactate Dehydrogenase (LDH) requires pyruvate substrate and NADH as a cofactor to produce lactate. Strains genetically engineered to have attenuated PDC activity have a small amount of pyruvate remaining at the end of the fermentations, which is not observed in non-attenuated PDC+strains. Therefore, it is assumed that NADH is the limiting reactant for lactic acid production in these strains. Based on the small amounts of pyruvate remaining at the end of a fermentation of a PDC attenuated strain, the NADH deficit may be very small. Therefore, a small increase in NADH accumulation by STH improves fermentation KPIs. Three S. pombe promoters: SSA2 / SPCC1739.13;

[0024] ZYM1 / SPAC22H10.13; and ACTl / SPBC32H8.12c were used to transcribe one of four STH enzyme variants that were selected from public genome databases and codon optimized for expression in 5. pombe cells. These STH enzymes were sequence bioprospected from the bacteria: 1) Acidobacteriaceae bacterium; 2) Acinetobacter baumannii; 3) Azotobacter vinelandii; and 4) Klebsiella pneumoniae. All of these clones were transformed into Sp505, which has 14% PDC activity compared to Sp285.

[0025] 2. Accordingly, described herein is engineered yeast strain useful for the production of lactic acid by fermentation comprising, (i) a first genetic modification that introduces at least one exogenous lactate dehydrogenase (LDH) gene operably linked to a first promoter to express the LDH gene; and a second genetic modification that introduces a gene encoding an exogenous transhydrogenase enzyme operably linked to a second promoter to express the transhydrogenase enzyme in the strain, wherein the engineered strain produces more lactic acid by fermentation than its parent strain lacking the second genetic modification.

[0026] 3. In the exemplary embodiments, the engineered yeast strain is a Schizosaccharomyces pombe strain. In exemplary embodiments the the strain has a third genetic modification that attenuates, but does not inactivates expression of pyruvate decarboxylase in the strain. In exemplary embodiments the genetic modification that attenuates expression of pyruvate decarboxylase activity includes a) inactivation of a PDC201 gene and b) attenuation of expression of a PDC101 gene.

[0027] 4. In exemplary embodiment attenuation of expression of the PDC101 gene is accomplished by substituting the native PDC101 gene with a nucleotide sequences encoding the same protein but having 45% to 62% GC content.

[0028] 5. In some embodiments, the S. pombe strain may include a fourth genetic modification that inactivates expression of an alcohol dehydrogenase (ADH1) gene. In other embodiments the strain includes a fifth genetic modification that inactivates expression of a glycerol phosphate dehydrogenase 1 (GDD1) gene.

[0029] 6. In exemplary embodiments of the S. pombe strain, the exogenous transhydrogenase enzyme includes a nucleotide sequence encoding an amino acid sequences selected from the group consisting of SEQ ID NO: 49-52. In these exemplary embodiments the second promoter driving expression of the transhydrogenase gene is an operation portion of a sequences elected from the group consisting of SEQ ID NOs: 1, 47 and 48. 7. Other embodiment include any lactic acid producing yeast strain of wherein the gene encoding the exogenous transhydrogenase enzyme includes a nucleotide sequence encoding an amino acid sequences selected from the group consisting of SEQ ID NO: 49-52. In exemplary embodiments the second promoter driving expression of is an operation portion of a sequences elected from the group consisting of SEQ ID NOs: 1, 47 and 48.

[0030] 8. Embodiments of Schizosaccharomyces pombe strain include where the exogenous LDH gene encodes a LDH enzyme having an amino acid sequence selected from the group consisting of SEQ ID NOs 9-31.

[0031] 9. These embodiments further comprise (iii) an inactivated alcohol dehydrogenase 1 (ADH1) gene; and (iv) an exogenous lactate dehydrogenase (LDH) gene operably linked to a promoter to express the LDH gene in the engineered Schizosaccharomyces pombe strain.

[0032] 10. Other embodiment include where the engineered Schizosaccharomyces pombe strain of has at least two copies of the exogenous lactate dehydrogenase (LDH) gene.BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 shows lactic acid yield of several engineered S. pombe strains, each containing a unique LDH expressed in 5. pombe cells. Data was ranked from highest yield (most efficient LDH) to lowest yield (least efficient LDH).

[0034] Figure 2 shows specific production resulting from different LDH variants expressed in 5. pombe cells. Data was ranked from highest specific production (most efficient LDH) to lowest specific production (least efficient LDH).

[0035] Figure 3 shows the level of correlation between lactic acid yield and specific production. There is only a weak correlation between yield and specific production (R2=0.4698). This is caused by a subset of LDH variants that result in high yield but result in low specific productivity and vice versa. Though the mechanism is unknown, this indicates the underlying LDH enzyme properties between variants within this library are unique. This may be important for stacking multiple LDH variants into a single commercial strain to maximize total carbon flux from pyruvate to lactic acid. Therefore, each of these LDH variants has potential to be included in the commercial production strain and should be patent-protected.

[0036] Figure 4 shows the growth characteristics of the functional PDC strain (Sp285), non-functional PDC strain (Sp336) and partially functional PDC strains.

[0037] Figure 5 shows the relative PDC enzyme activity of yeast strains containing a modified PDC compared to the parent strain.

[0038] Figure 6 shows the relative lactic acid fermentation yield of yeast strains containing a modified PDC compared to the parent strain

[0039] Figure 7 shows a correlation between PDC enzyme activity and lactic acid fermentation yield, showing the inverse relationship.

[0040] Figure 8 shows the lactic acid yield, lactic acid titer and lactic acid specific production (titer / OD) of strains containing a transhydrogenase gene according to the present invention. These data show that expressing a transhydrogenase gene improves fermentation KPIs in a genetically engineered lactic acid S. pombe strain.

[0041] DETAILED DESCRIPTION OF THE INVENTION

[0042] The present disclosure provides examples of genetically engineered Schizosaccharomyces pombe yeast strains that ferment dextrose to produce lactic acid in an attempt to meet certain Key Performance Indicators (KPIs) believed to be desirable for large scale commercial production of lactic acid. The KPI targets for commercially suitable strains were set by the present inventor to be 140g / L of lactic acid with 87% yield at a productivity of 3.3g / L / hr, preferably with minimal pH control so that a final fermentation pH a of around 2.5 obtained. Yield is calculated as wt lactic acid / wt carbohydrate feedstock used in the fermentation.

[0043] To achieve these target KPIs, one particular pyruvate decarboxylase gene (PDC201) of the four known PDC was inactivated while a second of the three remaining pyruvate decarboxylase genes was attenuated, but no inactivated. In the exemplary embodiments, the PDC101 gene was choses for attenuation. These genetic modifications of pyruvate decarboxylase expression were combined with inactivation of two particular alleles of the four known S. pombe alcohol dehydrogenase genes (ADH1 and ADH4). In some embodiments at least one particular glycerol 3 phosphate dehydrogenase alleles (GPD2) involved in the glycerol biosynthetic pathway was also inactivated. In all embodiments at least two exogenous lactate dehydrogenase (LDH) genes having an amino acid sequence according to SEQ ID NO 9-31 were overexpressed in the strains. In preferred embodiments the overexpression was accomplished by use of the endogenous S. pombe actin 1 promoter (pActl) operably linked to the exogenous LDH genes.

[0044] As used herein "inactivated" with respect to a gene means the naturally occurring protein product of the gene is no longer expressed in the cell. Gene inactivation may be accomplished by many genetic manipulations well known to one of ordinary skill in the art including for example, by deletion of all or a portion of the coding portion of the gene, by deletion of the promoter or ribosome binding site controlling expression of the gene, by introduction of premature transcription terminator sequence into the gene, by introduction of a nonsense mutation or termination codon in the coding portion of the gene, or by insertion of an exogenous genetic sequence into the endogenous gene so that the coding sequence of the gene is disrupted. In embodiments exemplified herein, the respective coding sequences were deleted by insertion of at least one of the LDH genes at the loci of the deleted gene. . In addition to inactivation of the foregoing genes, the overexpression of at least two copies of a exogenous LDH genes was necessary to produce sufficient L-lactic acid to meet the KPIs.

[0045] The strains of the present disclosure differ from the closest prior art Ozaki et al in one or more of the following nonexclusive ways: With respect to pyruvate decarboxylase, the present strains inactivates the PDC201 gene and attenuates the PDC101 gene while Ozaki and inactivates each the PDC101 and PDC202 genes. With respect to alcohol dehydrogenase, the present strains inactivates each of the ADH1 and ADH4 genes, while Ozaki et al leaves both these genes intact and deletes only ADH8 and the minor ADH gene. With respect to glycerol 3 phosphate dehydrogenase, the present disclosure inactivates GPD1, while Ozaki et al leaves this gene intact and deletes each of GPD2 and GUT2. With respect to two copies of the LDH gene, the present disclosure provides 23 possible heterologous LDH genes from different sources, each of which have higher activity LDH activity when expressed in 5. pombe than the L. plantarum LDH described of Ozaki et al.

[0046] The LDH enzymes were expressed using a functional portion of the S. pombe actin promoter (pACTl - SEQ ID. NO 1) located upstream of the 5. pombe actin open reading frame (systematic open reading frame name:. SPBC32H8.12c ) which based on transcriptomics experiments was identified by the present inventor as being a constitutive and high activity S. pombe promoter. A "functional portion" of the promoter according to SEQ ID NO: 1. means any nucleotide sequence having at least 75% sequence identity across any stretch of 20 or more nucleotides present in SEQ ID NO:1 that when inserted upstream of a target gene, is able to transcribe the target gene at least 75% as well as the whole of SEQ ID NO 1, which was used in the exemplary embodiments. Although exemplified herein with the actin promoter, any strong constitutive S. pombe promoter having similar high levels of transcriptional activity may be used in other embodiments. In exemplary embodiments, the transcriptional terminator from the ADH1 gene ((SEQ ID NO: 2) was used as the terminator for the LDH genes, but any terminator may be used in other embodiments.

[0047] Das GIP Lactic Fermentation Protocol

[0048] All strains described herein were evaluated for the production of lactic acid and other metabolites using a DasGIP fermentation protocol. This main fermentation protocol uses an Eppendorf DasGIP 1.3 liter fermenter cultured with a 10% inoculation volume containing 100 to 300 million cells per milliliter from the seed shake-flask fermentation, with media containing 10 g / L autoclave-sterilized dextrose and 15g / L autoclave-sterilized Corn Steep Liquor (CSL) obtained from Roquette (Beinheim, France). . The fermenter was cooled and temperature controlled at 33 ° C. A seed culture was inoculated into the fermenter at 10% v / v. Glucose was fed to the fermenter to maintain a concentration of 5-20 g / L throughout the run. The air flow going through the tank was controlled at 1 volume per minute (vvm) for the first 20 hours, then ramped down to 0.1 vvm and controlled the rest of the fermentation. The dissolved oxygen level of the media was controlled at 16% the first 24 hours via agitation, after which it is not controlled. The pH of the media was controlled at 3 the first 16-20 hours, after which it is not controlled and the pH dropped due to the production of lactic acid. Samples were taken throughout the fermentation to measure cell growth, cell viability, glucose and lactic acid concentration. The fermentation was stopped at 64 hours. The metabolites made by the fermentation were determined by HPLC.

[0049] Development of Strains.

[0050] S. pombe strains were genetically engineered to add one to three copies of an exogenous LDH gene and to inactivate one or more of PDC201, the pyruvate decarboxylase gene with the highest expression level in the parental strain along with inactivation of ADH1, ADH4 and / or GPD1 genes. In addition the PDC101 gene, which in the parental strains is the second highest expressed pyruvate decarboxylase gene was attenuated, but not inactivated. For all genetic transformations, the lithium acetate method first described by Gietz, et. at. (Schiestl RH, Gietz RD. High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr Genet. 1989 Dec;16(5-6):339-46. doi: 10.1007 / BF00340712.PMID: 2692852) was used to make the genetic manipulations.

[0051] First, the wild type strain had the URA4 coding sequence deleted from the genome by co-transforming a synthetic linear DNA that contains a unique molecular- barcoded DNA (BC4241) with universal primer sequences (barcode in bold): GGTTACACTGTGACAGATGCCATACGAACTGCACAGACGGTTCGCCTGACTGTTGAGCGTGA TAGACTGTGATCGACACG (SEQ ID NO 34) flanked by lkb of homology to the URA4 locus with a plasmid based CRISPR-Mad7 device using the PAM-protospacer sequence TTTGTGATATGAGCCCAAGAAGCAA (SEQ ID NO 35) within the URA4 gene. Transformants were selected on EMM + uracil + 5-FOA media.

[0052] Second, PDC201 was then deleted by replacing the PDC201 coding sequence with a synthetic 5. pombe URA4 selection marker. Transformants were selected on

[0053] EMM - uracil media plates. The URA4 selection marker was then replaced with a LDH expression cassette (PACTI-LCLDH-TADHI), which was genome-integrated by cotransforming linear PCR product containing the LDH expression cassette flanked by lkb of homology to the PDC201 locus with a plasmid based CRISPR-Mad7 device that targeted the PAM-protospacer sequence (SEQ ID NO 35). Transformants were recovered on EMM + uracil + 5-FOA media.

[0054] Third, ADH1 was then deleted by replacing the ADH1 coding sequence with a synthetic S. pombe URA4 selection marker (SEQ ID NO 32). Transformants were selected on EMM - uracil media plates. The URA4 selection marker was then replaced with a LDH expression cassette (PACTI-LCLDH-TADHI), which was genome-integrated by co-transforming linear PCR product containing the LDH expression cassette flanked by lkb of homology to the ADH1 locus with a plasmid based CRISPR-Mad7 device that targeted the PAM-protospacer sequence (SEQ ID NO 35). Transformants were recovered on EMM + uracil + 5-FOA media.

[0055] Fourth, ADH4 was then deleted by replacing the ADH4 coding sequence with the synthetic S. pombe URA4 selection marker (SEQ ID NO 32). Transformants were selected on EMM - uracil media plates. The URA4 selection marker was then replaced with a molecular barcode (BC59) of the sequence: GGTTACACTGTGACAGATGCTGGTAGAGTTTAGCTCCTCGGACAGTCGGAGATTACATAGAT AGACTGTGATCGACACG, (SEQ ID NO 46) which was genome-integrated by cotransforming linear synthetic DNA with lkb of homology to the ADH4 locus with a plasmid based CRISPR-Mad7 device that targeted the PAM-protospacer sequence (TSEQ ID NO 35). Transformants were recovered on EMM + uracil + 5-FOA media.

[0056] GPD1 was then deleted by replacing the GPD1 CDS with a synthetic S. pombe URA4 selection marker (SEQ I NO 32). Transformants were selected on EMM - uracil media plates. The final strain genotype is pdc201::PACTi-LcLDH-TADHi adhlA::P ACTI-LCLDH-TADHI adh4A::BC2 gpdlA::ura4 ura4A::BCl

[0057] The initial strain used to develop the strains of the present disclosure was designated Sp38. This strain contained one copy of the LDH gene from Lactobacillus cerevisiae encoding the protein sequence according to SEQ ID NO 14 with codons optimized for expression in S. pombe under control of the actin promoter (SEQ ID NO: 1) and terminated by the ADH1 terminator (SEQ ID NO 2) which construct is designated herein as pAct:LDHt,. (referred to above as PACTI-LCLDH-TADHI )■ The construct pActLDHt was inserted at the loci of the pyruvate decarboxylase PDC201 allele, thereby inactivating PDC201. Strain Sp38 demonstrated the following results in the Das GIP lactic production protocol:

[0058] The yield from strain Sp38 was 34% (g lactic acid / g dextrose).

[0059] Strain Sp38 was modified by inactivation of the alcohol dehydrogenase ADH1 gene (SEQ ID NO 4) by insertion of the URA4 gene (SEQ ID NO32) as a selective marker at the loci of the ADH1 gene thereby producing a strain designated Sp45 that demonstrated the following results in the Das GIP lactic production protocol:

[0060] The significantly higher titer of lactic acid and significantly reduced titer of ethanol indicated the importance of inactivation of the ADH1 gene. The yield from strain Sp45 was 45%.

[0061] Another strain designated Spl58 was made containing the same pActLDHt construct inactivating the PDC201 gene, but containing a second copy of the same LDH gene inserted at the site of the ADH1 open reading frame and driven by the endogenous ADH1 promoter, which inactivated the ADH1 gene while simultaneously adding an additional LDH gene. In addition, the ADH4 gene (SEQ ID NO 6) was inactivated in Spl58 by insertion of URA4 at the site of the ADH 4 gene. Spl58 demonstrated the following results in the Das GIP lactic production protocol:

[0062] This result demonstrated the importance of inactivating both the ADH1 and ADH4 genes to greatly reduce ethanol production, and showed that the additional copy of the LDH gene improved lactate production, he yield from strain Spl58 was 65%.

[0063] Another strain designated Spl94 was made containing the same pActLDHt construct inactivating the PDC201 gene and with a second copy of pActLDHt inserted at the site of the ADH1 inactivating that gene with the second copy of LDH driven by the actin promoter, but with no inactivation of ADH4. Instead, the glycerol 3 phosphate gene GPD1 (SEQ ID NO 8) was inactivated in Spl94 by insertion of the URA4 gene at the site of the GPD1 gene. Spl94 demonstrated the following results in the Das GIP lactic production protocol:

[0064] This result demonstrated that inactivation of GPD1 combined with ADH1 and PDC201 and expression of two copies of LDH substantially increased lactic production with a substantial reduction in glycerol production, albeit with some sacrifice in productivity due to the increase in doubling time, he yield from strain Spl94 was 81.5%.

[0065] Another strain designated Spl95 was made containing the same pActLDHt construct inactivating the PDC201 gene and also with a second copy of pActLDHt construct inserted at the site of the ADH1 inactivating that gene. In addition, inactivation of ADH4 was done by insertion of the URA4 gene at that site. Spl95 demonstrated the following results in the Das GIP lactic production protocol:

[0066] This result demonstrated that inactivation of ADH4 combined with inactivation of ADH1 and PDC201 and expression of two copies of LDH substantially increased lactic production while maintaining a substantially reduced production ethanol and dis wo without sacrificing doubling time, he yield from strain Spl95 was 73.5%.

[0067] Another strain designated Sp211 was made from parent strain Spl94. Sp211 retained all the changes made ins Spl94 but instead of inactivating GPD1 by insertion of URA4, GPD1 was inactivated by insertion of a third copy of the LDH gene under control of the actin promoter. Sp211 demonstrated the following results in the Das GIP lactic production protocol:

[0068] This result demonstrated that very high expression of LDH is highly detrimental to cell growth, greatly reducing the final titer of lactic acid even with complete loss of glycerol production and very low ethanol production, he yield from strain Sp211 was 90%.

[0069] Another strain designated Sp212 was made from parent strain Spl95 Sp212 retained all the changes made ins Spl95 but additionally contained a third copy of the LDH gene under control of the actin promoter. Sp212 demonstrated the following results in the Das GIP lactic production protocol: The results with Sp212 confirmed again that over expression of LDH by using three copies greatly reduces growth rates and final titers of lactic acid, even with substantial reduction in ethanol accumulation. The yield from strain Sp212 was 78%.

[0070] Another strain designated Sp214 was made that like Spl94 contained two copies of the LDH gene inactivating both PDC201 and ADH1 and containing the URA4 gene inactivating GPD1, bur further contained an artificial bar code marker sequence designated BC59 (SEQ ID. NO 46) inserted at the locus of the ADH4 gene, inactivating that gene as well. Sp214 demonstrated the following results in the Das GIP lactic production protocol:

[0071] These results demonstrated that inactivation of PDC201 combined with inactivation of ADH1, ADH4 and GPD1 and expression of two LDH genes resulted in a strain with relatively high titers of lactic, and very low titers of glycerol, but with an unacceptably reduced growth rate. The yield from strain Sp214 was 84%.

[0072] The inventors sought to overcome the suppression in growth rate to improve seed growth and volumetric productivity in strains Sp214 by using controlled adaptive laboratory evolution (ALE) provided as a service by ALTAR (Evry, France; https: / / www.altar.bio / ) . Sp285 is deposited as NRRL B-6805 that demonstrated the following results in the Das GIP lactic production protocol:

[0073] This demonstrated that the reduced growth phenotype could be overcome by natural selection resulting in strain with very high lactic production and very good growth rate, even though the strain makes more glycerol and ethanol than other strains containing the same inactivated PDC, ADH1, ADH1 and GPD1 genes. The yield from strain Sp285was 75%.

[0074] L-Lactate Dehydrogenase (LDH) screening and evaluation

[0075] The foregoing strain development was based on use of the LDH gene from Lactobacillus cerevisiae (SEQ ID NO 14) expressed in S. pombe cells. Both of the L. cerevisiae LDH genes were synthetic DNAs that were codon optimized for expression in S. pombe. Both heterologous LDH enzymes were expressed using a cassette that contained the constitutive and highly expressed actin promoter, encoded by the gene ACT1 (SPBC32H8.12c - SEQ ID NO 1) to drive transcription and both contained the transcriptional terminator from the endogenous ADH1 gene (SEQ ID NO 2).

[0076] The present inventors also separately screened other LDH variant genes to determine LDH variants that may be more active in S. pombe. Candidate LDH variants were selected by searching for L-Lactate Dehydrogenase in NCBI (https: / / www.ncbi.nlm.nih.gov / ). Sequences were downloaded and aligned using Geneious software. LDH variants were selected from genera under every kingdom of life, including: 1) Animal; 2) Archaea; 3) Bacillus; 4) Fungus; 5) Lactobacillus; 6) Plant; 7) Protist; 8) Proteobacteria; and 9) Green Sulfur Bacteria. Ninety-six (96) LDH variants were selected based on sequence similarity (i.e. protein alignment tree) to capture sequence and putative functional diversity throughout the biosphere. Each of these LDH variants were codon optimized for gene expression in S. pombe cells using IDT codon optimization tool (https: / / www.idtdna.com / CodonOpt) and obtained as synthetic linear dsDNA from Twist Bio (https: / / ecommerce.twistdna.com / ). Each LDH was cloned for genome integration at the PDC201 (SPAC3G9.11c) locus and expressed using the ACT1 promoter with the terminator from the ADH1 gene. The resultant genotype for each strain was pdc201A::pACTl-LDHt , meaning the PACTl-LDHt construct was inserted at the PDC201 locus to inactivate the PDC201 gene.

[0077] Each LDH-containing strain that produced lactic acid in an otherwise wild type cell was then deleted for ADH1 (SPCC13B11.01) with a synthetic URA4 selection marker and evaluated for lactic acid production in the benchtop 24 well Applikon MicroMatrixsystem The MicroMatrix is an automated fermentation instrument that contains 24 independent bioreactor wells that controlpH, dissolved oxygen, temperature, feed rate. In the MicroMatrix experiments, cells were propagated in seed fermentation conditions consisting of corn steep liquor obtained from the Archer Daniels Midland Company (5 g / L suspended solids), yeast extract (25 g / L), ammonium sulfate (5 g / L), and dextrose (30 g / L). An aliquot of each tube culture was transferred at an inoculation rate of 10% to a 250 mL baffled flask and incubated at 33° C, in a shaker ser at 250 rpm for 48 hours. For bioconversion in MicroMatrix, the cells from the seed culture are normalized to a starting OD600 of 2.5. Fermentation conditions were maintained at 33°C and 10% dissolved oxygen (DO) with Ramp feeding of 35% dextrose. Fermentation was terminated at elapsed fermentation time (EFT) of 71 hours. The final main fermentation OD600 and the final pH of the main fermentation broth was measured. After centrifugation to remove biomass the supernatant was analyzed by HPLC for lactic acid, ethanol, glycerol, pyruvic acid, acetic acid and dextrose.

[0078] Yield was calculated using the formula: (lactic acid tite r) / g glucose consumed. Specific production (i.e, a measure of production per cell) was calculated using the formula: lactic acid titer) / (optica I density at end of the experiment. Different LDH variants (SEQ 9-31) were then ranked highest to lowest based on in vivo lactic acid yield (Table 2).

[0079] Table 2

[0080] Lactate dehydrogenase activity in S. pombe cells measured by yield, titer and specific production

[0081] Figure 1 is a graph that shows lactic acid yield of the above engineered S. pombe strains, each containing a unique LDH expressed in S. pombe cells. Data was ranked from highest yield (most efficient LDH) to lowest yield (least efficient LDH).

[0082] Figure 2 is a graph that shows specific production resulting from different LDH variants expressed in S. pombe cells. Data was ranked from highest specific production (most efficient LDH) to lowest specific production (least efficient LDH).

[0083] Figure 3 is a graph that shows the level of correlation between lactic acid yield and specific production. There is only a weak correlation between yield and specific production (R2=0.4698). This is caused by a subset of LDH variants that result in high yield but but low specific productivity and vice versa. Though the mechanism is unknown, this indicates the underlying LDH enzyme properties between variants within this library are unique. This may be important for stacking multiple LDH variants into a single commercial strain to maximize total carbon flux from pyruvate to lactic acid. Therefore, each of these LDH variants has potential to be included in the commercial production strain for lactic acid.

[0084] The forging shows that LDHs from different sources perform differently when expressed in S. pombe in an unpredictable way. Although strain development process described herein before carried two copies of the L. cerevisiae LDH in combination with deletions of PDC201, ADH1, ADH4 and / or GPD1, the present invention can also be embodied by use of any of the LDH's according to SEQ ID NOS 9-31 in combination with the same deletions to yield similar results.

[0085] Attenuation of pyruvate decarboxylase gene expression

[0086] Pyruvate decarboxylase (PDC) converts pyruvate to acetaldehyde and carbon dioxide and competes for pyruvate with lactate dehydrogenase (LDH) for the pyruvate substrate.. In yeast cells, the acetaldehyde is either oxidized to cytoplasmic acetate or reduced to ethanol, whereas the CO2 is lost from the cell. Cytoplasmic acetate is converted to acetyl-CoA, which is converted to malonyl-CoA for fatty acid biosynthesis. Fatty acids have many uses in yeast cells including the production of lipids and membranes that are essential for cell function and viability. Accordingly, the inventors recognized that some PDC activity is beneficial for healthy cell growth, while too much PDC activity would lead to less synthesis of lactic acid by LDH.

[0087] A commercial fermentation consist of two phases: 1) seed growth and 2) production. Cells lacking PDC activity are slow growing and risk having too long of a seed fermentation to achieve target biomass or are never capable of achieving target biomass because the seed fermentation stalls. The inventors therefore sought to attenuate but not eliminate PDC synthesis by reducing, but not eliminating expression of at least one of the three remaining PDC genes in at least one of the foregoing strains of S. pombe. Each of the foregoing strains has a deletion in PDC201. The inventors first sought to further delete PDC101, leaving the PDC102 and PDC202 genes intact, but as described below discovered that complete inactivation of PDC101 was detrimental to adversely affect cell growth and lactic production. Because of this, the inventors instead sought to attenuate expression of PDC101 by promoter swap or allele swap to achieve reduced but continued PDC expression from that gene.

[0088] PDC101 (a.k.a SPAClF8.07c SEQ ID NO: 37) was deleted from the genome by cotransforming linear DNA coding for a synthetic PDC alleles designated synlPDC and syn2PDC (SEQ ID NOs 39, 40) in an expression cassette. The synlPDC gene contains an unnaturally high GC content of 61.4%, which is >10% higher than the natural 5. pombe PDC101 gene. The synlPDC is designed to lower translational efficiency from an mRNA transcript that contains unnatural and significantly higher GC content. The GC content of S. pombe protein-coding sequence overall is reported to be 39.6% GC (Wood et.al., The Genome of Schizosaccharomyces pombe. Nature, Feb. 2002), which means that the synlPDC has 21.8% higher GC content than the average S. pombe protein coding gene. As shown hereafter, the lower translational efficiency of the GC-rich synlPDC mRNA results in lower cellular enzyme activity of PDC. The syn2PDC contains a similar GC content as the endogenous S. pombe PDC101 gene of 46.3% . Strains containing syn2PDC were therefore designed to have attenuated PDC activity at the level of mRNA transcription, which is controlled via heterologous promoters (SEQ ID 41-43) that have reduced transcriptional potential relative to the native PDC101 promoter.

[0089] Expression cassettes were used to introduce the non-native promoters and / or the synthetic PDC genes at that site of the naturally occurring PDC101 gene using Sp285 described herein above as the parent strain. The linear expression cassettes are flanked by lkb of homology to the PDC101 genomic locus. Genome targeting was facilitated by a plasmid based CRISPR-Mad7 device containing the PAM-protospacer sequence TTTG GTCG ACAG CAACACCACTTTG (SEQ ID NO 36) within the PDC101 gene. Transformants were recovered on YPD + G418 (lOOmg / L) plates to select for the CRISPR-Mad7 plasmid and later inoculated in YPD media to lose the plasmid. The pdcl01A::synPDC mutant strains were genotype confirmed by diagnostic PCR. The resulting strains were named: Sp435; Sp505; Sp501; and Sp504. The panorama of PDC genotypes in the engineered strains is show in Table 3 in which PDC101A is inactivation of PDC101 by deletion, PDC101 followed by double colons means replacement of the PDC101 by the sequence that follows.

[0090] Table 3 Table 3 only shows the new genotypes of the PDC genes. The parent Sp285 has the genotype disclosed herein above with respect to containing multiple copies of LDH, inactivated ADH1 and inactivated GPD. The PDC engineered strains were evaluated for growth and cell fitness using the BioTek Epoch2 incubator / plate reader. In this experiment, 50 pL of the glycerol stock of each strain (1% inoculation rate) was resuspended into 5 mL of recovery media (25 g / L yeast extract + 30 g / L dextrose). One milliliter of the inoculated recovery media was loaded into each well of the 24-well plate with each strain evaluated in technical triplicates. The strains were cultured for 40 hours at 33 °C with spectrophotometric data collected at 30-minute intervals. Epoch growth rate data showed that attenuating PDC activity at the transcriptional level by promoter swap or translational level with increase GC content results in cellular growth similar to the parent strain, whereas the loss-of-function by complete deletion of PDC101 (Sp336) results in cells with very poor growth characteristics (Figure 4).

[0091] Specific PDC enzyme activity was quantified for Sp501; Sp504; Sp435; and Sp505 cell lysates. The total cellular PDC activity in each strain was compared to that of a strain containing wild type endogenous PDC101 in Sp285 (Figure 5). In this experiment, cells were grown in shake-flasks to mid-log (OD=1) and harvested for biochemical analysis. Cells were lysed with Zymolyase and the lysate protein content was quantified using the Bradford protein assay. The PDC assay uses spectrophotometric absorbance at 320 nm, which measures the depletion of pyruvate added to the reaction. The conversion rate of pyruvate from each reaction is divided by the amount of protein in the lysate to give specific pyruvate conversion rate per mg of protein (pmol / min / mg). Sp285 (PDC101+) had the highest specific PDC enzyme activity (1.14umol / min / mg) of all strains. Sp501, which is a promoter swap syn2PDC- containing strain had PDC activity of 92.9% of Sp285 (Figure 5). Sp504, which is a promoter swap syn2PDC-containing strain had PDC activity of 64.1% of Sp285 (Figure 5). Sp505, which is a promoter swap syn2PDC-containing strain had PDC activity of 14 % compared to Sp285 (Figure 5). Sp435, which is the GC-content enriched allele swap synlPDC-containing strain had PDC activity of 30.0% compared to Sp285 (Figure 5). It is therefore possible to control PDC enzyme activity to target lactic acid (organic acid) yield improvement via promoter or allele substitution to affect transcriptional or translational efficiency. Other methods to reduce translational efficiency that would work as well or better than altering GC content include substitution of the naturally occurring AUG methionine start codon of the target PDC gene with a non-AUG methionine start codon, or substituting multiple codons occurring in the target PDC with codons less efficiently used by S. pombe.

[0092] Sp435, Sp505, Sp501 and Sp504 were evaluated for lactic acid fermentation performance using the 1.3L Eppendorf DasGip fermentation system. These strains were quantified for lactic acid yield from dextrose and compared directly to Sp285 parent to measure the relative yield improvement of each strain. Sp505, which had the lowest PDC enzyme activity had the highest yield improvement of 3.2% over the Sp285. Sp435 (synlPDC) and Sp504 had intermediate yield improvement of 2.6% and 2.7%, respectively. Sp501, which had the highest PDC enzyme activity had the lowest yield improvement of 1.5% (Figure 6). These data show that attenuating, but not eliminating the cellular PDC activity is a precise way to increase lactic acid yield in a fermentation. Accordingly, any attenuation of PDC activity to a level of 14% to 93% of the activity of a parent strain having an inactivated PDC201 and fully active PDC101 increases lactic production in an S. pombe strain. Ideally, the attenuation should be to level of 14% to 65%.

[0093] PDC enzyme activity is anti-correlated to yield improvement and this is titratable through genetic modification (Figure 7). Methods for attenuating cellular enzymatic activity of competing pathways and enzymes for improved fermentation product yield therefore include transcriptional control by promoter swap or translational control by allelic swap to produce transcripts less efficiently translated that the native transcripts of the target PDC genes. Other methods of attenuation may include use of a non AUG start codon or use of codons across a portion or the entirety of the coding sequence that are that less preferentially utilized than the naturally occurring codon.

[0094] Introduction of transhydrogenase genes into Sp505 A gene designated SPAPB1A11.03, which has the nucleotide sequence according to SEQ ID NO 55 encoding the protein according to SEQ ID NO: 54 is annotated as a putative FMN-dependent alpha-hydroxy acid dehydrogenase in Pombase (https: / / www.pombase.org / ). The SPAPB1A11.03 gene was deleted from the genome of Sp505 cells and replaced with an STH variant transhydrogenase gene at that locus by co-transforming a synthetic linear DNA that contains a functional STH expression cassette flanked by Ikb of homology to the SPAPB1A11.03 locus with a plasmid based CRISPR-Mad7 device using the PAM-protospacer sequence TTTGAGAACAATTGGGCCATCCCAA (SEQ ID NO 44) within the SPAPB1A11.03 gene. Transformants were recovered on YPD + G418 (lOOmg / L) plates to select for the CRISPR-Mad7 plasmid and later inoculated in YPD media to lose the plasmid. Sp505 has attenuated PDC activity engineered by replacing the endogenous PDC101 with a synthetic low copy transcript of PDC (synPDC).

[0095] Sp505 has the PDC genotype pdcl01A::PiLvs-syn2PDC PFBAI-PCLDH. Five different STH variants under control of one of three heterologous promoters designated ZYM1 (SEQ ID NO: 47) SSA2 (SEQ ID NO: 48) or ACT1 (SEQ ID NO:1) were engineered into the Sp505 by replacing the SPAPB1A11.03 gene with the STH variant and promoter combination. The exemplary STH variants tested were from Acidobacteriaceae bacterium, having the amino acid sequence according to SEQ ID NO: 49, from Acinetobacter baumannii, having he amino acid sequence according to SEQ ID NO: 50, from Azotobacter vinelandii having he amino acid sequence according to SEQ ID N0:51, and from Klebsiella pneumoniae having he amino acid sequence according to SEQ ID NO:52. the STH engineered strains were genotype confirmed by diagnostic PCR. The spapblall.03A::STH strains were assigned the names: Sp645; Sp646; Sp647; Sp548; and Sp650. Table 4 shows the transhydrogenase variant, the promoter used to drive its expression and genotype of the forgoing strains. Strain Sp646 was deposited with the Agricultural Research Culture Collection (NRRL), at 1815 N. University Street, Peoria, IL 61604, on October 29, 2024, and has accession no. NRRL Y-68464.

[0096] Table 4

[0097] Strain Number and Genotype of STH variant strains

[0098] The effects of the STH activity on fermentation performance were determined by testing Sp645; Sp646; Sp647; Sp648; and Sp650 for lactic acid yield, titer and specific production (titer / OD) in a 96 well plate batch fermentation. Strains were inoculated in a 96-well plate with five position-randomized technical replicates (n= 5) along with multiple copies of the Sp505 control. The strains were cultivated in a 96 well plate containing 450pl recovery media (25 g / L yeast extract, 30 g / L dextrose, 5.7 g / L ammonium sulfate) for 24h at 30 °C under 900rpm shaking condition using an Infers HT plate shaker. Cells were then cultivated in seed media that contained 450pl 5g / L roquette corn steep liquor (CSL), 25 g / L yeast extract, 30g / L dextrose and 5g / L ammonium sulfate for 24h at 30 °C under 900rpm shaking conditions. Seed cultures were then transferred into a pair of plates each containing 450pl production media (15g / L roquette CSL, 50g / L dextrose) and incubated for 24h at 30 °C under 900rpm shaking conditions. Growth was measured at each cultivation stage (e.g. recovery, seed, production) using a plate reader set at 600nm wavelength to measure optical density. Spent media was analyzed for lactic acid and residual sugar using an analytical instrument (Roche Cedex). Strains were ranked based on the amount of lactic acid produced (g / L), lactic acid yield from dextrose (%), and per cell lactic acid production (titer / OD).

[0099] Data analysis revealed that Sp645; Sp646; Sp647; Sp648; and Sp650 were all improved over the parent Sp505 for all KPIs (Figure 8).

[0100] Although the introduction of the transhydrogenase sequences into S. pombe were only tested using four exemplary transhydrogenase genes, the present invention is not limited to the genes tested. Indeed, one of ordinary skill in the art would recognize that any gene encoding the defined transhydrogenase activity described herein would also work to improve lactic acid production in any yeast strain that produces lactic acid and that includes over expression of exogenous lactate dehydrogenase activity.

[0101] Furthermore, although exemplified herein using Sp505 as the parent strain, which also includes genetic modifications that attenuates pyruvate dehydrogenase activity, the introduction of an exogenous transhydrogenase gene.would improve expression of lactic acid in any yeast strain that also includes over expression of exogenous lactate dehydrogenase activity.

[0102] Accordingly, the present invention is not limited to the exemplary embodiments provide herein, but may be extended to other embodiments that include other yeast, other transhydrogenase genes and other genetic backgrounds than those illustrated herein, inclusive of all the other genetic modifications that are disclosed herein, including inactivation of the alcohol dehydrogenase (ADH 1) gene and / or inactivation of the glycerol 3 phosphate dehydrogenase 1 (GPD1) gene.

Claims

CLAIMSWhat is claimed is:

1. An engineered yeast strain useful for the production of lactic acid by fermentation comprising, (i) a first genetic modification that introduces at least one exogenous lactate dehydrogenase (LDH) gene operably linked to a first promoter to express the LDH gene; and a second genetic modification that introduces a gene encoding an exogenous transhydrogenase enzyme operably linked to a second promoter to express the transhydrogenase enzyme in the strain, wherein the engineered strain produces more lactic acid by fermentation than its parent strain lacking the second genetic modification.

2. The engineered yeast strain of claim 1 wherein the engineered strain is a Schizosaccharomyces pombe strain.

3. The engineered Schizosaccharomyces pombe strain of claim 2 wherein the strain has a third genetic modification that attenuates, but does not inactivates expression of pyruvate decarboxylase in the strain.

4. The engineered Schizosaccharomyces pombe strain of claim 3 wherein the genetic modification that attenuates expression of pyruvate decarboxylase activity includes a) inactivation of a PDC201 gene and b) attenuation of expression of a PDC101 gene.

5. The engineered Schizosaccharomyces pombe strain of claim 4 wherein attenuation of expression of a PDC101 gene is accomplished by substituting the native PDC101 gene with a nucleotide sequences encoding the same protein but having 45% to 62% GC content.

6. The engineered Schizosaccharomyces pombe strain of claim 3, wherein the strain includes a fourth genetic modification that inactivates expression of an alcohol dehydrogenase (ADH1) gene.

7. The engineered Schizosaccharomyces pombe strain of claim 6, wherein the strain includes a fifth genetic modification that inactivates expression of a glycerol phosphate dehydrogenase 1 (GDD1) gene.

8. The engineered Schizosaccharomyces pombe strain of claim 2 wherein the gene encoding the exogenous transhydrogenase enzyme includes a nucleotide sequence encoding an amino acid sequences selected from the group consisting of SEQ ID NO: 49-52.

9. The engineered Schizosaccharomyces pombe strain of claim 8 wherein the second promoter is an operation portion of a sequences elected from the group consisting of SEQ ID NOs: 1, M and 48.

10. The engineered yeast strain of claim 1 wherein the gene encoding the exogenous transhydrogenase enzyme includes a nucleotide sequence encoding an amino acid sequences selected from the group consisting of SEQ ID NO: 49-52.

11. The engineered yeast strain of claim 10 wherein the second promoter is an operation portion of a sequences elected from the group consisting of SEQ ID NOs: 1, 47 and 48.

12. The engineered Schizosaccharomyces pombe strain of claim 10, wherein the exogenous LDH gene encodes a LDH enzyme having an amino acid sequence selected from the group consisting of SEQ ID NOs 9-31.

13. The engineered Schizosaccharomyces pombe strain of claim 3 further comprising (iii) an inactivated alcohol dehydrogenase 1 (ADH1) gene; and (iv) an exogenous lactate dehydrogenase (LDH) gene operably linked to a promoter to express the LDH gene in the engineered Schizosaccharomyces pombe strain.

14. The engineered Schizosaccharomyces pombe strain of claim 2 comprising at least two copies of the exogenous lactate dehydrogenase (LDH) gene.

15. The engineered Schizosaccharomyces pombe strain of claim 2, wherein the exogenous LDH gene encodes a LDH enzyme having an amino acid sequence selected from the group consisting of SEQ ID NOs 9-31.

16. The engineered Schizosaccharomyces pombe strain of claim 15 wherein the strain has a third genetic modification that attenuates, but does not inactivates expression of pyruvate decarboxylase in the strain.

17. The engineered Schizosaccharomyces pombe strain of claim 16 wherein the genetic modification that attenuates expression of pyruvate decarboxylase activityincludes a) inactivation of a PDC201 gene and b) attenuation of expression of a PDC101 gene.

18. The engineered Schizosaccharomyces pombe strain of claim 17 wherein attenuation of expression of a PDC101 gene is accomplished by substituting the native PDC101 gene with a nucleotide sequences encoding the same protein but having 45% to 62% GC content.

19. The engineered Schizosaccharomyces pombe strain of claim 15, wherein the strain includes a fourth genetic modification that inactivates expression of an alcohol dehydrogenase (ADH1) gene.

20. The engineered Schizosaccharomyces pombe strain of claim 19, wherein the strain includes a fifth genetic modification that inactivates expression of a glycerol phosphate dehydrogenase 1 (GDD1) gene.

Citation Information

Patent Citations

  • Transgenic plants with enhanced agronomic traits

    US20080148432A1

  • Genetically engineered yeast cell having increased nadph production, method of increasing nadph level in yeast cell, method of preparing yeast cell, and method of producing lactate using yeast cell

    US20160340698A1

  • A genetically engineered yeast producing lactic acid

    WO2023004336A1