Protein tanhx2 related to wheat drought stress, and gene encoding same and use thereof

Abstract

Disclosed are a protein TaNHX2 related to wheat drought stress, and a gene encoding same and the use thereof. The technical problem to be solved is how to improve the drought resistance of Angiospermae plants. Specifically, disclosed is the use of a protein as shown in sequence 2 or 4, a substance that up-regulates or enhances or improves the expression of the gene encoding the protein, or a substance that up-regulates or enhances or improves the activity or content of the protein, which use is characterized in that the use is any one of: A1) use in the improvement of the drought resistance of Angiospermae plants; and A2) use in the preparation of a product for improving the drought resistance of Angiospermae plants. Improving the expression of the protein in Angiospermae plants can improve the drought resistance of the plants. The present invention can be applied to agricultural production.

Description

Wheat drought stress-related protein TaNHX2 and its encoding gene and application

[0001] Cross-reference to related applications:

[0002] This application claims priority to the Chinese patent application (application number 202410191760.9) filed on February 21, 2024, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention relates to the field of biotechnology, and in particular to a wheat drought stress-related protein TaNHX2, a coding gene thereof, and applications thereof. Background Art

[0004] As one of the world's three major food crops and the world's leading cereal, wheat provides over 20% of humanity's total food calories and plays a crucial role in the human diet. Global wheat production in 2022-2023 was 790 million tons. To meet the growing population, global wheat production is expected to double by 2050. However, various abiotic stresses severely limit crop yields, adversely affecting the socioeconomic structures of many developing countries. Drought stress is a significant factor affecting wheat yield, with approximately half of the world's wheat-producing areas experiencing drought stress, resulting in varying degrees of yield reduction and quality degradation. Therefore, further research into the molecular mechanisms of wheat drought resistance and the development of molecular pathways that complement wheat drought resistance are crucial for wheat drought resistance breeding and improving yield and production.

[0005] Traditional genetic improvement of wheat drought resistance primarily involves sexual hybridization between wheat varieties with different drought resistance capabilities. Although this method has played an important role in the development of wheat drought resistance breeding, it does have certain limitations. Reproductive isolation prevents the effective utilization of superior genes or QTLs in closely or distantly related wheat species. Furthermore, sexual hybridization is susceptible to linkage effects. If undesirable genes consistently appear in linkage, significant manpower and resources are required to test genetically segregated populations in subsequent generations. Furthermore, the success of sexual hybridization gene transfer often requires the measurement of relevant indicators, which are easily affected by environmental factors. These issues have greatly limited the role of conventional breeding methods in the genetic improvement of wheat drought resistance.

[0006] In recent years, with the advancement of DNA sequencing and bioinformatics, various omics-based analytical methods have been increasingly utilized in research on the genetic improvement of wheat drought resistance. The advancement of the omics era, combined with traditional gene mapping methods, has enabled more efficient and precise localization of key drought-resistance genes in wheat. Advances in genetic engineering have further advanced the understanding of the molecular mechanisms regulating wheat drought resistance. Genetic engineering breeding can effectively overcome the limitations of traditional breeding, such as long breeding cycles, limited germplasm resources, and susceptibility to environmental influences. It can effectively shorten the breeding cycle, break down interspecies boundaries, and maximize the potential of limited genetic resources. Transgenic technology allows for precise, targeted research and analysis, which is crucial for the functional analysis of individual genes. Furthermore, multi-omics-based research can more quickly and accurately identify candidate genes for drought resistance and conduct functional validation, effectively improving research efficiency and fulfilling a crucial strategic need to ensure national food security.

[0007] Transgenic technology is widely used in the field of wheat drought resistance research today. To date, many key wheat drought-resistant genes have been discovered and their functions have been analyzed. Mao et al. cloned the wheat drought-resistant gene TaNAC071-A through genome-wide association analysis and revealed its molecular mechanism of drought resistance (Mao et al. 2022, Variation in cis-regulation of a NAC transcription factor contributes to drought tolerance in wheat. Mol Plant 15:276-29,). At the same time, they also discovered the wheat drought-resistant gene TaDTG6-B and revealed the molecular genetic mechanism by which its gain-of-function allele variation regulates wheat drought resistance (Mei et al. 2022, A gain-of-function allele of a DREB transcription factor gene ameliorates drought tolerance in wheat. Plant Cell 34:4472-4494). Tian et al. discovered and obtained a new drought-resistant gene TaWD40-4B.1 in wheat and its drought-resistant haplotype, and elucidated the molecular mechanism of TaWD40-4B.1 in regulating ROS homeostasis under drought (Tian et al. 2023a, Allelic variation of TaWD40-4B.1 contributes to drought tolerance by modulating catalase activity in wheat. Nat Commun 14: 1200). Studies have found that TaNAC69-1 promotes root development under drought stress by inhibiting the expression of TaSHY2 and TaIAA7, thereby improving wheat drought resistance (Chen et al. 2016, Drought-up-regulated TaNAC69-1 is a transcriptional repressor of TaSHY2 and TaIAA7, and enhances root length and biomass in wheat. Plant Cell Physiol 57: 2076-2090).Wheat TaBZR1 enhances the antioxidant capacity of wheat by interacting with TaGST1, improving its drought resistance (Cui et al. 2019, BES / BZR transcription factor TaBZR2 positively regulates drought responses by activation of TaGST1. Plant Physiol 180: 605-620). Drought stress induces the expression of TaSAP5, which interacts with DRIP and ubiquitinates and degrades DRIP, thereby causing protein accumulation of DREB2A and activating the expression of downstream drought stress-related genes, improving wheat drought resistance (Zhang et al. 2017, The E3 ligase TaSAP5 alters drought stress responses by promoting the degradation of DRIP proteins. Plant Physiol 175: 1878-1892). Overexpression of TaERF87 can significantly activate the expression of TaP5CS1 and increase the plant's proline content, thereby enhancing wheat drought resistance (Du et al. 2023, TaERF87 and TaAKS1 synergistically regulate TaP5CS1 / TaP5CR1-mediated proline biosynthesis to enhance drought tolerance in wheat. New Phytol 237:232-250). TaVQ4-D, as a phosphorylation substrate of MPK3 / 6, regulates the wheat drought stress response process (Zhang et al. 2023). The wheat E3 ubiquitin ligase TaSDIR1-4A mediates the ubiquitination and degradation of the membrane-bound transcription factor TaWRKY29, thereby enhancing wheat drought resistance (Meng et al. 2024, E3 ubiquitin ligase TaSDIR1-4A activates membrane-bound transcription factor TaWRKY29 to positively regulate drought resistance. Plant Biotechnol J 22:987-1000).

[0008] Wheat is one of the world's three major food crops. With the increase of global population, the demand for food is increasing. However, in recent years, frequent extreme weather events have led to droughts, which have become one of the main limiting factors of agricultural production. Therefore, excavating and identifying key genes for wheat drought resistance is of great significance for analyzing the regulation mechanism of wheat drought resistance and improving wheat drought resistance using molecular breeding methods. Although some wheat drought resistance genes have been identified by genetic engineering technology, compared with other crops, the research depth is still seriously lacking, and the application breadth of related technologies is still not high. The continuous excavation of key drought resistance genes is still imperative. Therefore, continuing to develop and utilize genetic engineering technology to improve the adaptability of wheat and other crops to adversity has further enriched the molecular basis and genetic regulatory network formed by wheat drought resistance traits, provided important information and gene resources for wheat drought resistance and high-yield molecular design breeding, and has important strategic significance. How to further improve wheat drought resistance by genetic engineering is a technical problem faced by those in this field.

[0009] Invention Disclosure

[0010] The technical problem solved by the present invention is how to improve the drought resistance of angiosperms.

[0011] In order to solve the above problems, the present invention provides the following applications.

[0012] Use of a protein, a substance that regulates the expression of a gene encoding the protein, or a substance that regulates the activity or content of the protein, wherein the use is any of the following:

[0013] A1) Application in regulating drought resistance in angiosperms;

[0014] A2) Application in the preparation of products for regulating drought resistance in angiosperms;

[0015] The protein is any of the following:

[0016] B1) The amino acid sequence is the protein shown in SEQ ID NO: 4 or 2;

[0017] B2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in B1) and having an identity of 80% or more to the protein described in B1) and having the same function;

[0018] B3) A fusion protein obtained by linking the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

[0019] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0020] In the above-mentioned proteins, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, blastp can be used as the program, with the Expect value set to 10, all filters set to OFF, BLOSUM62 as the matrix, and the Gap existence cost, Per residue gap cost, and Lambda ratio set to 11, 1, and 0.85 (default values), respectively. The identity of a pair of amino acid sequences can be calculated and the identity value (%) can be obtained.

[0021] In the above proteins, the above 80% or greater identity may be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0022] In the above protein, the protein is derived from wheat. The wheat may be Chinese Spring. The amino acid sequence of the protein may be Sequence 2. Sequence 2 (SEQ ID No. 2) consists of 541 amino acid residues.

[0023] In the above protein, the protein is derived from wheat. The wheat may be a wheat variety Fielder. The amino acid sequence of the protein may be Sequence 4. Sequence 4 (SEQ ID No. 4) consists of 541 amino acid residues.

[0024] In the present application, the regulation may be upregulation, enhancement, or increase, and / or knockout, reduction, or decrease.

[0025] In the present application, the substance that upregulates, enhances, or increases the expression of the gene encoding the protein, or the activity or content of the protein, can improve the drought resistance of angiosperms. Knocking out, reducing, or decreasing the expression of the gene encoding the protein, or the activity or content of the protein, can reduce the drought resistance of angiosperms.

[0026] In the above application, the protein is derived from wheat.

[0027] In the above text, the wheat may be Chinese Spring. The wheat may also be the wheat variety Fielder. The protein sequence derived from Chinese Spring is Sequence 2. The protein sequence derived from the wheat variety Fielder is Sequence 4.

[0028] In the above, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the cell nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0029] In the above application, the substance that regulates the expression of the gene encoding the protein is any one of the following:

[0030] B1), a nucleic acid molecule encoding the above protein;

[0031] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0032] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0033] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0034] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0035] B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0036] B7) a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0037] D8), a nucleic acid molecule that knocks out, inhibits, reduces, or downregulates the expression of the gene encoding the above-mentioned protein;

[0038] D9), expressing the coding gene of the nucleic acid molecule described in D8);

[0039] D10), an expression cassette containing the gene described in D9);

[0040] D11), a recombinant vector containing the gene described in D9), or a recombinant vector containing the expression cassette described in D10);

[0041] D12), a recombinant microorganism containing the gene described in D9), or a recombinant microorganism containing the expression cassette described in D10), or a recombinant microorganism containing the recombinant vector described in D11);

[0042] D13), a transgenic plant cell line containing the gene described in D9), or a transgenic plant cell line containing the expression cassette described in D10), or a transgenic plant cell line containing the recombinant vector described in D11);

[0043] D14), a transgenic plant tissue containing the gene described in D9), or a transgenic plant tissue containing the expression cassette described in D10), or a transgenic plant tissue containing the recombinant vector described in D11);

[0044] D15), a transgenic plant organ containing the gene described in D9), or a transgenic plant organ containing the expression cassette described in D10), or a transgenic plant organ containing the recombinant vector described in D11).

[0045] In the nucleic acid molecules described in B1), those skilled in the art can readily mutate the nucleotide sequences encoding the proteins of the present invention using known methods, such as directed evolution or point mutagenesis. Artificially modified nucleotide sequences that are 80% or more identical to the nucleotide sequences of the isolated proteins of the present invention are derived from and are equivalent to the nucleotide sequences of the present invention, as long as they encode the protein and possess the protein's function.

[0046] The aforementioned 80% or more identity may be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0047] As used herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a search to calculate the identity of the amino acid sequence, the value (%) of identity can then be obtained.

[0048] Herein, the vector is well known to those skilled in the art, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage), cosmid (i.e., cosmid), Ti plasmid or viral vector. Specifically, it can be pMDC85 vector;

[0049] In the above biological materials, the expression cassette described in B2) refers to a DNA capable of expressing the gene in a host cell, and the DNA may include not only a promoter for initiating gene transcription, but also a terminator for terminating gene transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue-, organ- and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically inducible promoters from tobacco, pathogenesis-related (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible by methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent No. 200710099169.7)), promoters specific for seed storage proteins (e.g., promoters for phaseolin, napin, oleosin, and rice beta-conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters.All references cited herein are incorporated in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0050] In B3) above, the recombinant vector can be a recombinant expression vector containing the gene expression cassette constructed using a plant expression vector. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85, or pCAMBIA1391-Xb. When using OsMAK7 to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific or inducible promoter can be added before its transcription start nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are extensive and can be natural or synthetic. The translation initiation region can come from a transcription start region or a structural gene. As a specific embodiment, the present application uses the pCAMBIA-super1300 vector as an expression vector.

[0051] As a specific embodiment, the present application uses p110 vector as an expression vector. As a specific embodiment, the present application uses pBUE411 vector as a knockout vector. As a specific embodiment, the microbial strain in the recombinant microorganism can be Agrobacterium GV3101.

[0052] In the above application, the nucleic acid molecule described in B3) is a DNA molecule having a nucleotide sequence as shown in Sequence 1 or Sequence 3.

[0053] In order to solve the above problems, the present invention also provides a method for cultivating angiosperms with high drought resistance.

[0054] The method comprises upregulating or enhancing or increasing the expression level of the gene encoding the protein in the target angiosperm plant, and / or the activity and / or content of the protein, to obtain a highly drought-resistant angiosperm plant, wherein the drought resistance of the highly drought-resistant angiosperm plant is higher than that of the target angiosperm plant.

[0055] In order to solve the above problems, the present invention also provides a method for improving the drought resistance of angiosperms.

[0056] The method comprises improving the drought resistance of angiosperms by upregulating, enhancing or increasing the expression of the gene encoding the above protein in angiosperms, and / or the activity and / or content of the above protein.

[0057] In the above method, the upregulation, enhancement or improvement of the expression of the gene encoding the above protein in the angiosperm plant includes introducing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3) into the target angiosperm plant.

[0058] In the above, the angiosperm plant may be Arabidopsis thaliana. The Arabidopsis thaliana may be Columbia type Arabidopsis thaliana. The protein may be the protein described in Sequence 2. The nucleic acid molecule may be Sequence 1.

[0059] In the above, the angiosperm plant may be wheat. The wheat may be the wheat variety Fielder. The protein may be the protein described in Sequence 4. The nucleic acid molecule may be Sequence 3.

[0060] In any of the above uses or methods, the angiosperm plant is any of the following:

[0061] J1) Cruciferae or Poaceae plants;

[0062] J2) Arabidopsis thaliana or Triticum aestivum;

[0063] J3) Arabidopsis or wheat.

[0064] In the present application, the Arabidopsis thaliana may be the Columbia type Arabidopsis thaliana. The wheat may be the wheat variety Fielder.

[0065] The above-mentioned protein or the above-mentioned substance.

[0066] In order to solve the above problems, the present invention also provides a kit.

[0067] The kit comprises the above-mentioned nucleic acid molecules and / or expression cassettes and / or recombinant vectors and / or recombinant microorganisms and / or transgenic plant cell lines and / or transgenic plant tissues and / or transgenic plant organs. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 is an analysis diagram of the NHX evolutionary tree of different species.

[0069] Figure 2 is a comparison analysis of the amino acid sequences of TaNHX2 from different species. Note: the black box represents the cation / H+ exchanger core domain of NHX2; AtNHX2 is a protein with an amino acid sequence as shown in sequence 10 (protein encoded by the NHX2 gene of Arabidopsis thaliana), BdNHX2 is a protein with an amino acid sequence as shown in sequence 11 (protein encoded by the NHX2 gene of Brachypodium distachyon), OsNHX2 is a protein with an amino acid sequence as shown in sequence 12 (protein encoded by the NHX2 gene of rice), TaNHX2-A is a protein with an amino acid sequence as shown in sequence 6, TaNHX2-D is a protein with an amino acid sequence as shown in sequence 8, and TaNHX2-D is a protein with an amino acid sequence as shown in sequence 4.

[0070] Figure 3 is a diagram of protein structure analysis.

[0071] Figure 4 shows the phenotypic identification of TaNHX2 transgenic Arabidopsis thaliana under drought stress in soil. Note: Figure a shows the phenotypic image after drought stress treatment, and Figure b shows the statistical results of survival rate.

[0072] Figure 5 shows the drought stress phenotype identification of TaNHX2 knockout transgenic wheat.

[0073] Figure 6 shows the statistical graph of the survival rate and dry and fresh weight of TaNHX2 knockout transgenic wheat under drought stress.

[0074] FIG7 is a diagram showing the drought stress phenotype identification of TaNHX2 overexpressing transgenic wheat.

[0075] Figure 8 is a statistical chart of the survival rate and dry and fresh weight of TaNHX2 overexpressing transgenic wheat under drought stress.

[0076] FIG9 is a graph showing the water loss rate of detached leaves of TaNHX2 transgenic wheat under drought stress.

[0077] FIG10 is a graph showing stomatal conductance analysis of TaNHX2 transgenic wheat before and after drought stress.

[0078] FIG11 is a graph showing the expression level detection of TaNHX2 overexpressing transgenic Arabidopsis thaliana.

[0079] Figure 12 is a graph showing the expression level detection of TaNHX2 overexpressing transgenic wheat.

[0080] Best Mode for Carrying Out the Invention

[0081] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0082] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0083] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results were expressed as mean ± standard deviation and tested using One-way ANOVA. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated an extremely significant difference.

[0084] In this application, "sequence*" and "SEQ ID No.*" have the same meaning.

[0085] Example 1 Discovery and structural analysis of wheat drought stress-related protein TaNHX2 and its encoding gene

[0086] The amino acid sequence of the rice OsNHX1 gene was used as a query sequence for a BLASTN search, comparison, and collection of sequences from the wheat gene annotation database. A total of 18 candidate NHX genes were identified, which were grouped into six groups based on homology. Subsequently, a phylogenetic tree (Figure 1) was constructed based on the sequence information of NHX family members from wheat, rice, Brachypodium distichum, and Arabidopsis thaliana. Analysis revealed the wheat TaNHX2 gene, which clustered with the NHX2 genes of other species. The gene encoding this protein was named TaNHX2, as shown in Sequence 2 in the sequence listing.

[0087] Comparison of the amino acid sequences of TaNHX2 from different species revealed that TaNHX2 shares 89.77%, 85.53%, and 68.6% sequence similarity with BdNHX2, OsNHX2, and AtNHX2, respectively. The similarity between the three partially homologous genes reached 97% (Figure 2), demonstrating the high degree of conservation of NHX2 across species and suggesting that they may share similar functions. Protein structure prediction using the structure prediction website TMHMM revealed that TaNHX2 contains 11 transmembrane domains and a core cation / H+ exchanger domain (Figure 3).

[0088] Example 2: Acquisition and identification of transgenic plants

[0089] 1. Construction of recombinant plasmid

[0090] 1. Primers (TaNHX2-F and TaNHX2-R) were designed to amplify the ORF fragment of TaNHX2-D from the cDNA of wheat leaves at the peak of the Chinese spring tillering period, and restriction sites (XbaⅠ and KpnⅠ) were introduced. PCR amplification was performed using primers TaNHX2-F and TaNHX2-R.

[0091] TaNHX2-F: 5′-TGCTCTAGACATGATGGGGTTGGGGCT-3′ (SEQ ID NO: 13);

[0092] In TaNHX2-F, the underlined site is the XbaⅠ enzyme recognition site.

[0093] TaNHX2-R: 5′-CGGGGTACCCTAGTTCTCACTTCCATG-3′ (SEQ ID NO: 14);

[0094] In TaNHX2-R, the underlined site is the KpnⅠ enzyme recognition site.

[0095] 2. Recover and purify the amplified product fragments with enzyme cleavage site adapters.

[0096] 3. Double-digest the PCR amplification product of step 2 with restriction endonucleases XbaⅠ and KpnⅠ, recover the digestion product, and obtain the PCR digestion product.

[0097] 4. Double-digest the pCAMBIA-super1300 vector with restriction endonucleases XbaⅠ and KpnⅠ to obtain the enzyme-digested vector fragment.

[0098] 5. Ligate the PCR digestion product from step 3 and the digested vector fragment from step 4 using T4 ligase to obtain a recombinant plasmid. Based on the sequencing results, the plasmid with the correct sequencing results was named pCAMBIA-super1300-TaNHX2 recombinant plasmid. The pCAMBIA-super1300-TaNHX2 recombinant plasmid is constructed by replacing the small fragment between the restriction endonuclease Xba I and Kpn I recognition sites of the pCAMBIA-super1300 (abcam, ab275754) vector with the DNA fragment of sequence 1, while keeping the other sequences of the pCAMBIA-super1300 vector unchanged. The resulting recombinant vector is named pCAMBIA-super1300-TaNHX2 (also known as pCAMBIA-super1300-TaNHX2 recombinant plasmid, pCAMBIA-super1300-TaNHX2 recombinant vector, recombinant plasmid pCAMBIA-super1300-TaNHX2, or recombinant vector pCAMBIA-super1300-TaNHX2).

[0099] Sequence 1 is as follows:

[0100] Sequence 1 is the CDS sequence of the TaNHX2 gene in the wheat variety Chinese Spring, which encodes the protein shown in Sequence 2.

[0101] Sequence 2 is as follows:

[0102] 2. Obtaining transgenic Arabidopsis plants

[0103] 1. The recombinant plasmid pCAMBIA-super1300-TaNHX2 constructed in step 1 was transformed into Agrobacterium GV3101 to obtain pCAMBIA-super1300-TaNHX2 / Agrobacterium GV3101. pCAMBIA-super1300-TaNHX2 / Agrobacterium GV3101 is Agrobacterium GV3101 containing the recombinant plasmid pCAMBIA-super1300-TaNHX2.

[0104] 2. Take WT (Columbia type Arabidopsis wild material) seeds and use 0.75% sodium hypochlorite solution (0.75% sodium hypochlorite and 0.01% Triton-X 100 mixed solution) for 15 min, then rinsed 6 times with distilled water, vernalized at 4°C for 3 days, sown on MS medium, and cultured at 22°C / 18°C, 16 h light / 8 h dark, 60%-70% humidity. When the plants grew to two true leaves, they were transplanted into planting pots filled with culture medium (equal volumes of nutrient soil and vermiculite mixed). After the plants bloomed, the tops of the main branches were cut off to promote the development of lateral branches. The plants 4-6 days after pruning were inverted and immersed in a recombinant Agrobacterium suspension (pCAMBIA-super1300-TaNHX2 / Agrobacterium GV3101). The plants were then taken out, wrapped in an air-filled black plastic bag, laid flat, and cultured in the dark at 22°C for 24 h. The plastic bags were then removed and the planting pots were upright. The light and temperature were restored and the plants were cultured until they were firm, and the T0 generation seeds were harvested.

[0105] 3. Take T0 generation seeds, vernalize at 4℃ for 3 days, and sow them on MS medium containing 80μL / 100mL hygromycin. After culturing at 22℃ / 18℃, 16h light / 8h dark conditions for 7 days, select positive plants (positive plants are characterized by healthy dark green true leaves and roots extending into the culture medium), transfer the positive plants to MS medium, and transfer them to soil after 10 days. Cultivate the plants until they are fruitful, and harvest T1 generation seeds.

[0106] 4. Plant T1 seeds using the same method, observe them on screening medium, and select strains that statistically segregate in a 3:1 ratio based on the survival / death ratio. Then, plant them in soil and harvest individual plants upon maturity to obtain T2 seeds for further observation and testing.

[0107] 5. Take T2 generation seeds and screen positive plants according to the method in step 3.

[0108] For a certain T1 generation plant, if all its T2 generation plants are positive plants, the T1 generation plant and its self-pollinated offspring are a homozygous transgenic line.

[0109] 6. Self-pollinate the T2 generation plants to obtain T3 generation seeds (also known as TaNHX2 overexpression T3 generation homozygous seeds).

[0110] Expression level identification is as follows:

[0111] T3 seeds and WT (Columbia-type Arabidopsis wild material) seeds were planted. When the bolting stage began (about 25 days old), RNA was extracted from leaves and reverse transcribed into cDNA using a reverse transcription kit (Vazyme Biotech, R223-01). The expression level was monitored using quantitative primers.

[0112] Detection primers: TaNHX2-qF: AGGTGCCGTGTCAATTGC (sequence 15); TaNHX2-qR: GCCCAAAGACAATTGTGCTG (sequence 16); TaACTIN was used as an internal reference, internal reference primers: TaACTIN-F: GGAATCCATGAGACCACCTAC (sequence 17); TaACTIN-R: GACCCAGACAACTCGCAAC (sequence 18).

[0113] The results are shown in Figure 11 (in Figure 11, WT is the Columbia type Arabidopsis wild material, N-OE1 is the TaNHX2 overexpression T3 generation homozygous seedling (seedlings developed from TaNHX2 overexpression T3 generation homozygous seeds)), compared with the WT seedlings, the expression level of the TaNHX2 gene in the TaNHX2 overexpression T3 generation homozygous seedlings was significantly increased.

[0114] 3. Phenotypic Identification of Drought Stress in Transgenic Arabidopsis Lines Overexpressing TaNHX2

[0115] To further analyze the differences in drought tolerance between transgenic lines and wild-type Arabidopsis seeds, we set up the following experiments:

[0116] 1. After vernalization at 4°C, the disinfected Arabidopsis wild-type seeds (WT seeds) and transgenic strain seeds (TaNHX2 overexpression T3 generation homozygous seeds) were sown on ordinary MS culture medium under normal culture conditions (22°C-18°C, 16 hours of light / 8 hours of darkness, 60%-70% humidity) and grown for 5 days. Seedlings with consistent growth and development (WT and TaNHX2 overexpression T3 generation homozygous plants) were selected and transplanted into pots with 4 seedlings (the cultivation matrix in the pot was obtained by mixing vermiculite and nutrient soil in a volume ratio of 1:1). After transplanting, they were irrigated with 100 g of cultivation matrix / 80 ml of water to obtain pots for WT plants and pots for TaNHX2 overexpression T3 generation homozygous plants.

[0117] Drought resistance experiments were conducted on WT plant pots and WT and TaNHX2 overexpression T3 generation homozygous plant pots. The drought resistance experiments were divided into two groups, namely the control group and the drought group.

[0118] The drought treatment group underwent the following experiment:

[0119] Three WT plant pots and TaNHX2 overexpression T3 generation homozygous plant pots were randomly selected and cultured at 22°C-18°C, 16 hours of light / 8 hours of darkness, and 60%-70% humidity (ambient humidity). After the first watering (water consumption was 100 g of cultivation medium / 80 ml of water) was complete, watering was performed every 3 days, and each watering was carried out according to 100 g of cultivation medium / 40 ml of water. After watering twice, no watering was allowed to continue. The culture was continued until the 9th day, and then the drought treatment period began and lasted for 6 days. The phenotypes were recorded by photographing (the results are shown in the drought treatment group in Figure 4a, WT is the WT plant, OE is the TaNHX2 overexpression T3 generation homozygous plant). Subsequently, sufficient watering was performed until the soil in the pot was completely imbibed. After 3 days of rehydration, the survival rate was calculated (the results are shown in Figure 4b), where the survival rate = the number of surviving seedlings / the total number of seedlings.

[0120] The experimental group performed the following experiments:

[0121] Three WT plant pots and WT and TaNHX2 overexpression T3 generation homozygous plant pots were randomly selected and cultured at 22°C-18°C, 16 hours of light / 8 hours of darkness, and 60%-70% humidity (ambient humidity). After complete swelling due to the first watering (water usage was 100 g of cultivation substrate / 80 ml of water), water was applied every 3 days, and each watering was carried out according to 100 g of cultivation substrate / 40 ml of water. After culture for 15 days, photos were taken to record the phenotype (the results are shown in the control group in Figure 4a, WT is the WT plant, and OE is the TaNHX2 overexpression T3 generation homozygous plant).

[0122] The criteria for survival are: the stem remains green and the leaves partially or completely turn green again.

[0123] The criteria for determining death are: leaves turn yellow and die, and the stems completely wither and die with no signs of greening again.

[0124] The experimental results are shown in Figure 4. In the normally watered control group, the overexpression lines and the wild-type plants grew normally, with no significant differences. In the drought-treated group, the wild-type plants nearly wilted and died, while the overexpression plants showed reduced growth, though some plants still managed to grow. Subsequently, we analyzed the survival rates of the overexpression plants after drought stress (drought-treated groups) and found that the survival rate of the overexpression plants exceeded 80%, while under the same drought stress conditions, the survival rate of the wild-type plants was only 30% (the results are shown in Figure 4(b)). WT is the WT plant, and OE is the T3 generation homozygous plant with TaNHX2 overexpression. This indicates that TaNHX2 overexpression can improve plant drought resistance.

[0125] 4. Obtaining TaNHX2 Overexpressing Transgenic Wheat

[0126] TaNHX2 overexpression primers: TaNHX2-p110-F: AGGTCGACTCTAGAGGATCCATGATGGGGTTGGGGCTG (SEQ ID NO: 19); TaNHX2-p110-R: TCGAGGGTACCCGGGGATCCGTTCTCACTTCCATGGGC (SEQ ID NO: 20).

[0127] Using the cDNA of wheat variety Fielder as a template, the TaNHX2 ORF fragment containing the restriction site BamH1 vector linker was amplified using primers TaNHX2-p110-F and TaNHX2-p110-R to construct an overexpression vector.

[0128] The p110 vector is described in the following document: Wang, K., Shi, L., Liang, X. et al. The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation. Nat. Plants 8, 110–117 (2022). https: / / doi.org / 10.1038 / s41477-021-01085-8, and is named pWMB111 in this document.

[0129] 2. The amplified DNA fragment (the ORF fragment of TaNHX2 containing the restriction site BamH1 vector linker) was recovered by agarose gel and then TaNHX2 was constructed into the p110 vector using homologous recombination to form a TaNHX2 overexpression vector. The recombinant vector p110-TaNHX2 was obtained. The recombinant vector p110-TaNHX2 was obtained by cutting the restriction endonuclease BamHI recognition site of the p110 vector, replacing the sequence between fragment 1 (5'-AGGTCGACTCTAGAGGATCC-3' (sequence 21)) and fragment 2 (5'-TCGAGGGTACCCGGGGATCC-3' (sequence 22)) of the p110 vector with a DNA fragment of sequence 3, and keeping other sequences of the p110 vector unchanged. The resulting recombinant vector was named p110-TaNHX2 (also known as recombinant vector p110-TaNHX2 recombinant plasmid or recombinant vector p110-TaNHX2 recombinant vector or recombinant plasmid recombinant vector p110-TaNHX2 or recombinant vector recombinant vector p110-TaNHX2).

[0130] Sequence 3 is as follows:

[0131] Sequence 3 is the CDS sequence of the TaNHX2-D gene in the wheat variety Fielder, which encodes the protein shown in Sequence 4.

[0132] Sequence 4 is as follows:

[0133] 3. Transform the recombinant vector p110-TaNHX2 into Escherichia coli.

[0134] 4. Positive clones were screened by PCR reaction and sequenced. At the same time, the plasmid was extracted and transformed into Agrobacterium GV3101 to obtain p110-TaNHX2 / Agrobacterium GV3101. p110-TaNHX2 / Agrobacterium GV3101 is Agrobacterium GV3101 containing p110-TaNHX2, which was sent to the wheat transgenic platform for wheat genetic transformation (the recipient plant is the wheat variety Fielder).

[0135] 5. Perform PCR identification on the T0 generation plants obtained.

[0136] 6. After the positive strains are harvested, they are grown in the greenhouse for generations, and the T1 generation plants are positively identified using PCR.

[0137] Take T0 generation seeds, transfer positive plants to a culture medium, and then transfer them to soil after 10 days. Cultivate the plants until they are strong and harvest T1 generation seeds. Plant T1 generation seeds in the same way, observe them on the screening medium, and select strains that statistically meet the 3:1 segregation rule based on the survival / death ratio. Then plant them in soil, harvest the individual plants after maturity, and obtain T2 seeds for the next step of observation and testing. Take T2 generation seeds and screen for positive plants according to the above method. For a certain T1 generation plant, if its T2 generation plants are all positive plants, the T1 generation plant and its self-pollinated offspring are a homozygous transgenic line, and a total of two TaNHX2 overexpression T2 generation homozygous lines are obtained, namely, the N-OE1 T2 generation homozygous line and the N-OE2 T2 generation homozygous line. The T2 generation plants are self-pollinated to obtain T3 generation seeds (also known as TaNHX2 overexpression T3 generation homozygous seeds), namely, the N-OE1 T3 generation homozygous seeds and the N-OE2 T3 generation homozygous seeds.

[0138] Expression level identification is as follows:

[0139] T3 seeds (N-OE1 T3 homozygous seeds and N-OE2 T3 homozygous seeds) and WT (wheat variety Fielder) seeds were planted. At the three-leaf stage, RNA was extracted from leaves and reverse transcribed into cDNA using a reverse transcription kit (Vazyme Biotech, R223-01). Expression levels were monitored using quantitative primers. (Expression level identification is a complete process that requires the sampling time of WT, OE1, and OE2, the specific primers and internal reference primers for detection, and the fluorescence quantitative kit and specific conditions.)

[0140] Detection primers: TaNHX2-qF: AGGTGCCGTGTCAATTGC (SEQ ID NO: 15); TaNHX2-qR: GCCCAAAGACAATTGTGCTG (SEQ ID NO: 16). TaACTIN was used as an internal reference, with internal reference primers: TaACTIN-F: GGAATCCATGAGACCACCTAC (SEQ ID NO: 17); TaACTIN-R: GACCCAGACAACTCGCAAC (SEQ ID NO: 18).

[0141] The results are shown in Figure 12 (in Figure 12, WT is the wheat variety Fielder, N-OE1 is the TaNHX2 overexpression T3 generation homozygous seedling (seedlings developed from N-OE1 T3 generation homozygous seeds), and N-OE2 is the TaNHX2 overexpression T3 generation homozygous seedling (seedlings developed from N-OE2 T3 generation homozygous seeds)). Compared with the WT seedlings, the expression level of the TaNHX2 gene was significantly increased in the TaNHX2 overexpression T3 generation homozygous seedlings (N-OE1 T3 generation homozygous seedlings and N-OE2 T3 generation homozygous seedlings).

[0142] 5. Obtaining TaNHX2 transgenic knockout wheat

[0143] 1. TaNHX2 knockout primers:

[0144] TaNHX2-p411-F: 5′-ATATATGGTCTCTGGCGTGCGATGGGGCTAATATCAGTT-3′ (SEQ ID NO: 23);

[0145] TaNHX2-p411-F0: 5′-TGTGCGATGGGGCTAATATCAGTTTTAGAGCTAGAAATAGC-3′ (SEQ ID NO: 24);

[0146] TaNHX2-p411-R0: 5′-AACACACCCTTCTTGTACAGTTCGCTTCTTGGTGCC-3′ (SEQ ID NO: 25);

[0147] TaNHX2-p411-R: 5′-ATTATTGGTCTCTAAACACACCCTTCTTGTACAGTTC-3′ (SEQ ID NO: 26).

[0148] 2. Using the pMT1T2 plasmid as a template, perform PCR amplification using the four primers listed above to obtain a DNA fragment containing the vector linker and target site, and then gel-cleave and purify the fragment. The pMT1T2 plasmid is described in the following literature: Xing, HL, Dong, L., Wang, ZP, Zhang, HY, Han, CY, Liu, B., Wang, XC, & Chen, QJ (2014). A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology, 14, 327.3, and is referred to as pCBC-MT1T2 in this literature.

[0149] 3. Use BsaI to digest the vector pBUE411 to obtain the pBUE411 digestion fragment, and ligate the pBUE411 digestion fragment with the above product (DNA fragment containing the vector linker and the target site) using T4 ligase overnight and transform Escherichia coli.

[0150] Vector pBUE411 was purchased from Addgene, catalog number 62200 (https: / / www.addgene.org / 62200 / )

[0151] 4. Screen positive clones by PCR reaction and sequence to obtain

[0152] The pBUE411-TaNHX2 knockout vector is prepared by opening the restriction endonuclease BsaI recognition site of the pBUE411 vector, replacing the sequence between fragment 1 (5'-TGCAGATGATCCGTGGC-3' (sequence 27)) and fragment 2 (5'-ATTTCTAGCTCTAAAAC-3' (sequence 28)) of the pBUE411 vector with a DNA fragment containing the target linker sequence MT1T2 (sequence 9), while keeping the other sequences of the pBUE411 vector unchanged. The resulting recombinant vector is named pBUE411-TaNHX2 knockout vector (also known as pBUE411-TaNHX2 knockout vector or pBUE411-TaNHX2 knockout plasmid or knockout plasmid pBUE411-TaNHX2 or knockout vector pBUE411-TaNHX2). At the same time, the pBUE411-TaNHX2 knockout vector was extracted and transformed into Agrobacterium GV3101, and then sent to the wheat transgenic platform for wheat (the recipient plant was the wheat Fielder variety) genetic transformation.

[0153] Sequence 9 is as follows:

[0154] TGCGATGGGGCTAATATCAgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttttcgttttgcattgagttttctccgtcgcatgtttgcagttttattttccgttttgcattgaaatttctccgtctcatgtttgcagcgtgttcaaaaagtacgcagctgtatttcacttatttacggcgccacattttcatgccgtttgtgccaactatcccgagctagtgaatacagcttggcttcacacaacactggtgacccgctgacctgctcgtacctcgtaccgtcgtacggcacagcatttggaattaaagggtgtgatcgatactgcttgctgctcatgaatccaaaccacacggagttcaaattcccacagattaaggctcgtccgtcgcacaaggtaatgtgtgaatattatatctgtcgtgcaaaattgcctggcctgcacaattgctgttatagttggcggcagggagagttttaacattgactagcgtgctgataatttgtgagaaataataattgacaagtagatactgacatttgagaagagcttctgaactgttattagtaacaaaaatggaaagctgatgcacggaaaaaggaaagaaaaagccatacttttttttaggtaggaaaagaaaaagccatacgagactgatgtctctcagatgggccgggatctgtctatctagcaggcagcagcccaccaacctcacgggccagcaattacgagtccttctaaaagctcccgccgaggggcgctggcgctgctgtgcagcagcacgtctaacattagtcccacctcgccagtttacagggagcagaaccagcttataagcggaggcgcggcaccaagaagcgACACCCTTCTTGTACAGTT. Among them, the underlined sequence is the target sequence.

[0155] 5. Perform PCR and sequencing identification on the obtained T0 generation plants.

[0156] Samples were taken from T0 generation plants and DNA was extracted. Specific primers for three subgenomes were designed near the target site, and amplified for first-generation sequencing to determine whether the area near the target site was edited and changed.

[0157] The detection primers were: TaNHX2-A-CRI-F: CAATTCTTCCGCAACTTCATG (SEQ ID NO: 29);

[0158] TaNHX2-A-CRI-R:CCCTGGAGTTGTTTTGGTCAA (sequence 30);

[0159] TaNHX2-B-CRI-F: CAATTCTTCCGCAACTTCATG (SEQ ID NO: 31);

[0160] TaNHX2-B-CRI-R: CGCCTGGAGTTTGTTTGGTC (SEQ ID NO: 32);

[0161] TaNHX2-D-CRI-F: TCTCCCTCTCAAAATTTCACTCG (SEQ ID NO: 33);

[0162] TaNHX2-D-CRI-R: TCCACTCTGCAGTAACAACACG (SEQ ID NO: 34);

[0163] 6. After the positive lines were harvested, they were grown in the greenhouse and the T1 generation plants were positively identified by PCR sequencing. The T1 generation plants that were further edited were selected for planting and identification, resulting in two TaNHX2 knockout T2 generation homozygous lines, namely the N-cr1 T2 generation homozygous line and the N-cr2 T2 generation homozygous line. The T2 generation plants were self-pollinated to obtain T3 generation seeds (also known as TaNHX2 knockout T3 generation homozygous seeds), namely the N-cr1 T3 generation homozygous seeds and the N-cr2 T3 generation homozygous seeds.

[0164] The genome of the homozygous N-cr1 T2 generation plants contained the following mutations:

[0165] In the homozygous N-cr1 T2 generation plants, the region corresponding to the TaNHX2 gene in the genome mutated compared to the wheat variety Fielder:

[0166] In the TaNHX2-A subgenome, two oxyribonucleotide residues are missing between positions 383 and 386 of sequence 5 in the sequence list, resulting in a frameshift mutation in the TaNHX2-A gene, causing the encoded protein (sequence 6) to terminate prematurely at amino acid position 136, thereby knocking out the TaNHX2-A gene.

[0167] In the TaNHX2-B subgenome, two oxyribonucleotide residues are missing between positions 299 and 302 of sequence 7 in the sequence list, resulting in a frameshift mutation in the TaNHX2-B gene, causing the encoded protein (sequence 8) to terminate prematurely at amino acid position 108, thereby knocking out the TaNHX2-B gene.

[0168] In the TaNHX2-D subgenome, two oxyribonucleotide residues are missing between positions 386 and 389 of sequence 3 in the sequence list, resulting in a frameshift mutation in the TaNHX2-D gene, causing the encoded protein (sequence 4) to terminate prematurely at amino acid position 137, thereby knocking out the TaNHX2-D gene.

[0169] The genome of the homozygous N-cr2 T2 plants contained the following mutations:

[0170] In the homozygous N-cr2 T2 generation plants, the region corresponding to the TaNHX2 gene in the genome mutated compared to the wheat variety Fielder:

[0171] In the TaNHX2-A subgenome, two oxyribonucleotide residues are missing between positions 383 and 386 of sequence 5 in the sequence list, resulting in a frameshift mutation in the TaNHX2-A gene, causing the encoded protein (sequence 6) to terminate prematurely at amino acid position 136, thereby knocking out the TaNHX2-A gene.

[0172] In the TaNHX2-B subgenome, one oxyribonucleotide residue is missing between positions 299 and 301 of sequence 7 in the sequence list, resulting in a frameshift mutation in the TaNHX2-B gene, causing the encoded protein (sequence 8) to terminate prematurely at amino acid position 103, thereby knocking out the TaNHX2-B gene.

[0173] In the TaNHX2-D subgenome, 8 oxyribonucleotide residues are missing between positions 386 and 395 of sequence 3 in the sequence list, resulting in a frameshift mutation in the TaNHX2-D gene, causing the encoded protein (sequence 4) to terminate prematurely at amino acid position 135, thereby knocking out the TaNHX2-D gene.

[0174] Sequence 5 is as follows:

[0175] Sequence 5 is the CDS sequence of the TaNHX2-A gene, which encodes the protein shown in Sequence 6.

[0176] Sequence 6 is as follows:

[0177] Sequence 7 is as follows:

[0178] Sequence 7 is the CDS sequence of the TaNHX2-B gene, which encodes the protein shown in Sequence 8.

[0179] Sequence 8 is as follows:

[0180] VI. Drought stress treatment of TaNHX2 transgenic wheat

[0181] 1. TaNHX2 knockout wheat drought stress experiment

[0182] Two lines of knockout wheat materials, N-cr1 and N-cr2 (N-cr1 T3 generation homozygous seeds and N-cr2 T3 generation homozygous seeds), which have been determined to be pure lines, and seeds of the wild-type Fielder control were selected, disinfected with 1% hydrogen peroxide for 10 minutes, washed 3-4 times with distilled water, and placed in a culture dish. Two layers of filter paper were laid in the culture dish, a small amount of distilled water was added, and the dish was placed at room temperature for 48 hours. The seedlings with consistent germination were selected and transplanted into a culture box filled with nutrient soil (the culture medium in the culture box was obtained by uniformly mixing vermiculite and nutrient soil in a volume ratio of 2:1). Each pot was divided into two parts, one side was wild-type Fielder seeds, and the other side was knockout line (N-cr1 T3 generation homozygous seedlings or N-cr2 T3 generation homozygous seedlings) seeds (20 plants on each side). After transplanting, they were irrigated according to 100g culture medium / 80ml water to obtain N-cr1 T3 generation homozygous seedling culture box and N-cr2 The following experiments were performed using the T3 homozygous seedling culture boxes for N-cr1 and N-cr2.

[0183] The experiment was divided into a control group and a drought treatment group.

[0184] The drought treatment group underwent the following operations:

[0185] Four pots of N-cr1 T3 homozygous seedlings and four pots of N-cr2 T3 homozygous seedlings were randomly selected and cultured at 22°C-18°C, 16 hours of light / 8 hours of darkness, and 60%-70% humidity (ambient humidity). After the first watering (100 g of culture medium / 80 ml of water) was complete, no further watering was done until the soil moisture content reached 2.5%, which was a critical time point. Five days after this point, the soil was rehydrated (until the soil was fully imbibed). Phenotypes were observed and recorded five days after rehydration, along with survival rate and aboveground dry and fresh weight. Survival rate = number of surviving seedlings / total number of seedlings.

[0186] The control group underwent the following operations:

[0187] Four pots of N-cr1 T3 homozygous seedlings and four pots of N-cr2 T3 homozygous seedlings were randomly selected and cultured at 22°C-18°C, 16 hours of light / 8 hours of darkness, and 60%-70% humidity (ambient humidity). After the first watering (100 g of culture medium / 80 ml of water) was complete, water was applied every three days, with each watering using 100 g of culture medium / 40 ml of water. After the drought treatment group was rewatered, the phenotype of the control group was observed and recorded, and the survival rate was recorded. The aboveground dry and fresh weight was calculated. Survival rate = number of surviving seedlings / total number of seedlings.

[0188] Survival is determined by: the stem remaining green, the leaves partially or completely turning green again, or new leaves unfolding.

[0189] The criteria for determining death are: leaves turn yellow and die, and the stems completely wither and die with no signs of greening again.

[0190] Fresh weight of aboveground part: Cut the aboveground part of wheat seedlings from the base of the stem and weigh and record the weight. This is the fresh weight data.

[0191] Dry weight: The fresh weight of wheat seedlings was weighed and placed in a paper bag, and dried in an oven at 65℃. The bag was taken out and weighed, and recorded as a dry weight data.

[0192] The results are shown in Figure 5 (control group is the control group, drought treatment group is the drought treatment group, WT is the wheat variety Fielder, N-cr1 is the N-cr1 T3 generation homozygous plant, and N-cr2 is the N-cr2 T3 generation homozygous plant) and Figure 6 (in Figure 6, WT is the wheat variety Fielder, N-cr1 is the N-cr1 T3 generation homozygous plant, and N-cr2 is the N-cr2 T3 generation homozygous plant; the first row and first column bar graph is the survival rate of the drought treatment group, the first row and second column bar graph is the fresh weight of the control group, the first row and third column bar graph is the dry weight of the control group, the second row and first column bar graph is the fresh weight of the experimental group, and the second row and second column bar graph is the dry weight of the experimental group). Under normal conditions, there were no significant differences between the different knockout and control lines. However, after drought treatment, significant differences were shown, and the growth and recovery degree of the knockout lines were significantly weaker than those of the wild-type plants. Moreover, the survival rate of the knockout lines was significantly lower than that of the wild-type plants after rewatering. There was no significant difference in the aboveground dry and fresh weights of the control group, while the aboveground dry and fresh weights of the knockout transgenic lines in the treatment group were significantly lower than those of the wild-type plants (Figure 6). This indicates that the drought resistance of the knockout lines is significantly weaker than that of the wild-type lines, indicating that inhibiting TaNHX2 expression significantly reduces the plants' drought resistance.

[0193] 2. Drought stress experiment of TaNHX2 overexpression wheat

[0194] Two lines of overexpression wheat materials, N-OE1 and N-OE2 (N-OE1 T3 generation homozygous seeds and N-OE2 T3 generation homozygous seeds), which have been determined to be pure lines, and seeds of the wild-type Fielder control were selected, disinfected with 1% hydrogen peroxide for 10 minutes, washed 3-4 times with distilled water, and placed in a culture dish. Two layers of filter paper were laid in the culture dish, a small amount of distilled water was added, and the dish was placed at room temperature for 48 hours. The seedlings with consistent germination were selected and transplanted into a culture box filled with nutrient soil (the culture medium in the culture box was a culture box with a volume ratio of vermiculite to nutrient soil of 2:1). Each pot was divided into two parts, one side was wild-type Fielder seeds, and the other side was overexpression line (N-OE1 T3 generation homozygous seedlings or N-OE T3 generation homozygous seedlings) seeds (20 plants on each side). After transplanting, they were irrigated according to 100g culture medium / 80ml water to obtain N-OE1 T3 generation homozygous seedling culture box and N-OE2 T3 generation homozygous seedling culture box. N-OE1 T3 generation homozygous seedling culture box and N-OE2 T3 generation homozygous seedling culture box were used for the following experiments.

[0195] The experiment was divided into a control group and a drought treatment group.

[0196] The drought treatment group underwent the following operations:

[0197] Four pots of N-OE1 T3 homozygous seedlings and four pots of N-OE2 T3 homozygous seedlings were randomly selected and placed in a culture box (phenotypes were recorded by photographing) under conditions of 22°C-18°C, 16 hours of light / 8 hours of darkness, and 60%-70% humidity (ambient humidity). After the first watering (100 g of culture medium / 80 ml of water) allowed for complete imbibition, no further watering was continued until the soil moisture content reached 2.5%, a critical time point. Five days after this point, the soil was rewatered (complete imbibition of the soil). Phenotypes were observed and recorded five days after rewatering, along with survival rate and aboveground dry and fresh weight. Survival rate = number of surviving seedlings / total number of seedlings.

[0198] The control group underwent the following operations:

[0199] Four pots of N-OE1 T3 homozygous seedlings and four pots of N-OE2 T3 homozygous seedlings were randomly selected and cultured at 22°C-18°C, 16 hours of light / 8 hours of darkness, and 60%-70% humidity (ambient humidity). Watering was performed every three days after complete imbibition (100 g of culture medium / 80 ml of water). After rehydration of the drought-treated group, the phenotype of the control group was observed and recorded. Survival rate was also recorded, and aboveground dry and fresh weights were calculated. Survival rate = number of surviving seedlings / total number of seedlings.

[0200] Survival is determined by: the stem remaining green, the leaves partially or completely turning green again, or new leaves unfolding.

[0201] The criteria for determining death are: leaves turn yellow and die, and the stems completely wither and die with no signs of greening again.

[0202] Fresh weight of aboveground part: Cut the aboveground part of wheat seedlings from the base of the stem and weigh and record the weight. This is the fresh weight data.

[0203] Dry weight: The fresh weight of wheat seedlings was weighed and placed in a paper bag, and dried in an oven at 65℃. The bag was taken out and weighed, and recorded as a dry weight data.

[0204] Two overexpression lines N-OE1 and N-OE2 that have been confirmed as positive, and seeds of wild-type Fielder were selected and subjected to drought treatment using the above method.

[0205] The results are shown in Figure 7 (Figure 7 shows the phenotypes of the control and drought-treated groups after rewatering of the drought-treated group. In Figure 7, the control group is the control group, the drought-treated group is the drought-treated group, WT is the wheat variety Fielder, N-OE1 is the N-OE1 T3 homozygous plant, and N-OE2 is the N-OE2 T3 homozygous plant) and Figure 8 (Figure 8, WT is the wheat variety Fielder, N-OE1 is the N-OE1 T3 homozygous plant, and N-OE12 is the N-OE12 T3 homozygous plant; the first row, first column bar graph shows the survival rate of the drought-treated group, the first row, second column bar graph shows the fresh weight of the control group, the first row, third column bar graph shows the dry weight of the control group, the second row, first column bar graph shows the fresh weight of the experimental group, and the second row, second column bar graph shows the dry weight of the experimental group). Under normal conditions, there were no significant differences between the overexpression plants and the wild-type plants. After drought treatment, the growth vigor of the overexpression lines was significantly stronger than that of the wild-type lines. After rehydration, the fresh and dry weights of the strains were significantly different, with the fresh weight of the overexpression strain being greater than that of the wild-type plant. Furthermore, the dry weight of the overexpression strain after rehydration was slightly higher than that of the wild-type strain (Figure 8).

[0206] 3. Determination of water loss rate and stomatal conductance of detached leaves

[0207] Stomatal morphology is an important indicator of plant leaf drought resistance. The water loss rate of detached leaves can be used to measure the degree of stomatal opening and closing in plant leaves. Therefore, to further verify whether the TaNHX2 gene is involved in regulating drought resistance, the water loss rate of detached leaves was measured. The experiment was repeated three times and the average value was calculated. The steps for each repetition were as follows:

[0208] (1) The seeds of the knockout strains (N-cr1 T3 homozygous seeds and N-cr2 T3 homozygous seeds), the seeds of the overexpression strains (N-OE1 T3 homozygous seeds and N-OE2 T3 homozygous seeds) and the seeds of the wild-type strain (wheat variety Fielder) were disinfected with 1% hydrogen peroxide for 10 minutes, washed with distilled water 3-4 times, and placed in a culture dish. Two layers of filter paper were laid in the culture dish, and a small amount of distilled water was added. The dish was left at room temperature for 48 hours. The seedlings with uniform germination were selected and transplanted into nutrient pots, with 8 seedlings per pot (one pot for each strain). After growing for about one month, N-cr1 T3 homozygous plants, N-cr2 T3 homozygous plants, N-OE1 T3 homozygous plants, N-OE2 T3 homozygous plants were obtained. From the T3 generation homozygous plants and the wheat variety Fielder, leaves of each strain in the above experiment were cut, and the initial weight of the leaves, M1, was recorded. The leaves were spread flat in an environment with constant relative humidity, and the leaf weight was recorded at different time intervals. The weight of the leaves after water loss weighed in different time periods was Mn, and the water loss rate of the detached leaves was calculated.

[0209] Detached leaf water loss rate (%) = (M1-Mn) / M1*100%

[0210] The results are shown in Figure 9 (in Figure 9, N-OE1 is a N-OE1 T3 generation homozygous plant, N-OE2 is a N-OE2 T3 generation homozygous plant, N-cr1 is a N-cr1 T3 generation homozygous plant, N-cr2 is a N-cr2 T3 generation homozygous plant, and WT is the wheat variety Fielder; the vertical axis is the water loss rate of detached leaves (water loss (% relative to fresh weight)). Under the same conditions, the water loss rate of detached leaves of the overexpression lines (N-OE1 T3 generation homozygous plants and N-OE2 T3 generation homozygous plants) was significantly lower than that of the wild-type line. On the contrary, the water loss rate of detached leaves of the knockout line was significantly higher than that of the wild-type line. The above results indicate that the stomatal water loss rate of the overexpression lines is lower than that of the wild-type line, while the knockout lines exhibit a higher water loss rate.

[0211] Stomatal conductance is also an important indicator to measure the stomatal opening of plant leaves. The higher the stomatal conductance, the greater the degree of stomatal opening. Conversely, the lower the stomatal conductance, the smaller the degree of stomatal opening.

[0212] The experiment was divided into two groups, namely the control group and the drought treatment group.

[0213] The seeds of the above-mentioned knockout strains (N-cr1 T3 generation homozygous seeds and N-cr2 T3 generation homozygous seeds), the seeds of the overexpression strains (N-OE1 T3 generation homozygous seeds and N-OE2 T3 generation homozygous seeds) and the seeds of the wild-type strain (wheat variety Fielder) were disinfected with 1% hydrogen peroxide for 10 minutes, washed 3-4 times with distilled water, and placed in a culture dish. Two layers of filter paper were laid in the culture dish, and a small amount of distilled water was added. The dishes were left at room temperature for 48 hours. Seedlings with consistent germination were selected and transplanted into nutrient pots, with 8 seedlings per pot, and repeated two pots (one pot for each strain). After about 7 days, N-cr1 T3 generation homozygous plant pots, N-cr2 T3 generation homozygous plant pots, N-OE1 T3 generation homozygous plant pots, N-OE2 T3 generation homozygous plant pots and wheat variety Fielder pots were obtained respectively.

[0214] Drought treatment group: one wheat pot of each type of strain (N-cr1 T3 generation homozygous plant pot, N-cr2 T3 generation homozygous plant pot, N-OE1 T3 generation homozygous plant pot, N-OE2 T3 generation homozygous plant pot and wheat variety Fielder pot) was watered for the first time (water dosage was 100 g cultivation medium / 80 ml water) and watering was stopped after complete swelling. After 7 days of stopping watering, the stomatal conductance at the widest leaf of the second expanded leaf was measured using a stomatal conductance meter (SC-1, Decagon Devices, Inc.) and the data was recorded.

[0215] Control group: one wheat pot of each different strain (N-cr1 T3 generation homozygous plant pot, N-cr2 T3 generation homozygous plant pot, N-OE1 T3 generation homozygous plant pot, N-OE2 T3 generation homozygous plant pot and wheat variety Fielder pot). After the first watering (water dosage is 100 g cultivation medium / 80 ml water) is complete, water 100 mL / pot every three days. After culturing for 7 days, the stomatal conductance at the widest leaf of the second expanded leaf is measured using a stomatal conductance meter (SC-1, Decagon Devices, Inc.) and the data is recorded.

[0216] Therefore, the stomatal conductance of different strains before and after stress was further measured. The treatment and planting methods of the plant materials were as above. The results are shown in Figure 10 (in Figure 10, N-OE1 is the N-OE1 T3 generation homozygous plant, N-OE2 is the N-OE2 T3 generation homozygous plant, N-cr1 is the N-cr1 T3 generation homozygous plant, N-cr2 is the N-cr2 T3 generation homozygous plant, WT is the wheat variety Fielder, the control group is the control group, and the experimental group is the drought treatment group; the vertical axis is stomatal conductance (mmol / m2S)). Under normal conditions, there was no significant difference in stomatal conductance among different strains. Under stress conditions, compared with the wild-type plants, the overexpression strain showed lower stomatal conductance, while the knockout strain showed higher stomatal conductance. In summary, the TaNHX2 gene can significantly enhance the drought resistance of plants.

[0217] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

[0218] Industrial Applications

[0219] The present invention discloses a wheat drought stress-related protein TaNHX2, its encoding gene, and application. The technical problem to be solved is how to improve the drought resistance of angiosperms. Specifically disclosed are the applications of the protein described in sequence 2 or 4, substances that upregulate, enhance, or improve the expression of the encoding gene of the protein, or substances that upregulate, enhance, or improve the activity or content of the protein, characterized in that the application is any one of the following: A1) application in improving the drought resistance of angiosperms; A2) application in preparing products for improving the drought resistance of angiosperms. Increasing the expression of the protein in angiosperms can improve the drought resistance of the plant. It can be used in agricultural production.

Claims

1. Use of a protein, a substance for regulating the expression of a gene encoding the protein, or a substance for regulating the activity or content of the protein, characterized in that: The application is any of the following: A1) Application in regulating drought resistance in angiosperms; A2) Application in the preparation of products for regulating drought resistance in angiosperms; The protein is any of the following: B1) The amino acid sequence is the protein shown in SEQ ID NO: 4 or 2; B2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein described in B1) and having an identity of 80% or more to the protein described in B1) and having the same function; B3) A fusion protein obtained by linking the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

2. The use according to claim 1, characterized in that The protein is derived from wheat.

3. The method according to claim 1, wherein The angiosperm plant is any one of the following: J1) Cruciferae or Poaceae plants; J2) Arabidopsis thaliana or Triticum aestivum; J3) Arabidopsis or wheat.

4. The use according to claim 1, characterized in that The substance that regulates the expression of the gene encoding the protein is any one of the following: B1), a nucleic acid molecule encoding the protein according to claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3); D8), a nucleic acid molecule that knocks out or inhibits or reduces or downregulates the expression of the gene encoding the protein of claim 1; D9), expressing the coding gene of the nucleic acid molecule described in D8); D10), an expression cassette containing the gene described in D9); D11), a recombinant vector containing the gene described in D9), or a recombinant vector containing the expression cassette described in D10); D12), a recombinant microorganism containing the gene described in D9), or a recombinant microorganism containing the expression cassette described in D10), or a recombinant microorganism containing the recombinant vector described in D11); D13), a transgenic plant cell line containing the gene described in D9), or a transgenic plant cell line containing the expression cassette described in D10), or a transgenic plant cell line containing the recombinant vector described in D11); D14), a transgenic plant tissue containing the gene described in D9), or a transgenic plant tissue containing the expression cassette described in D10), or a transgenic plant tissue containing the recombinant vector described in D11); D15), a transgenic plant organ containing the gene described in D9), or a transgenic plant organ containing the expression cassette described in D10), or a transgenic plant organ containing the recombinant vector described in D11).

5. The use according to claim 4, characterized in that B3) The nucleic acid molecule is a DNA molecule whose nucleotide sequence is shown in Sequence 1 or Sequence 3.

6. A method for cultivating angiosperms with high drought resistance, characterized in that: The method comprises upregulating, enhancing or increasing the expression level of the gene encoding the protein described in claim 1 in the target angiosperm plant, and / or the activity and / or content of the protein, to obtain a highly drought-resistant angiosperm plant, wherein the drought resistance of the highly drought-resistant angiosperm plant is higher than that of the target angiosperm plant.

7. The method according to claim 6, wherein The upregulation, enhancement or improvement of the expression of the gene encoding the protein of claim 1 in an angiosperm plant comprises introducing the nucleic acid molecule described in B1) of claim 4, the expression cassette described in B2) of claim 4 or the recombinant vector described in B3) of claim 4 into the target angiosperm plant.

8. A method for improving drought resistance of angiosperms, characterized in that: The method comprises improving the drought resistance of angiosperms by upregulating, enhancing or increasing the expression of the gene encoding the protein of claim 1 in angiosperms, and / or the activity and / or content of the protein of claim 1.

9. The method according to claim 8, wherein The upregulation, enhancement or improvement of the expression of the gene encoding the protein of claim 1 in an angiosperm plant comprises introducing the nucleic acid molecule described in B1) of claim 4, the expression cassette described in B2) of claim 4 or the recombinant vector described in B3) of claim 4 into the target angiosperm plant.

10. The method according to claim 8, wherein The angiosperm plant is any one of the following: J1) Cruciferae or Poaceae plants; J2) Arabidopsis or Triticum J3) Arabidopsis or wheat.

11. The protein according to claim 1 or the substance according to claim 4.

12. A kit, characterized in that The kit comprises the nucleic acid molecule and / or expression cassette and / or recombinant vector and / or recombinant microorganism and / or transgenic plant cell line and / or transgenic plant tissue and / or transgenic plant organ according to claim 4.

Images