Non-invasive biomarker for ALD liver injury and use

By detecting the ExPEC abundance in fecal samples, using kpsM gene-specific primers and E. coli 16SrRNA internal reference gene primers, the difficulties in early identification and evaluation of ALD were solved, and accurate assessment of liver damage and treatment basis were achieved.

WO2025176048A1PCT designated stage Publication Date: 2025-08-28XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/076916
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-21
Filing Date
2025-02-12
Publication Date
2025-08-28

AI Technical Summary

Technical Problem

The prior art is difficult to effectively identify and accurately evaluate alcoholic liver disease (ALD) in the early stage, especially due to the lack of specific non-invasive diagnostic methods, resulting in high missed diagnosis and difficulty in treatment.

Method used

Parenteral pathogenic E. coli (ExPEC) was used as a non-invasive biomarker for ALD liver injury, and the abundance of ExPEC in fecal samples was analyzed by detecting kpsM gene-specific primers and E. coli 16SrRNA internal reference gene primers, and a diagnostic kit and system were constructed for evaluation.

Benefits of technology

It realizes early identification of ALD patients and accurate assessment of liver damage, reduces the rate of missed diagnosis, and provides an accurate basis for treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025076916_28082025_PF_FP_ABST
    Figure CN2025076916_28082025_PF_FP_ABST
Patent Text Reader

Abstract

A non-invasive biomarker for ALD liver injury and the use. Extra-intestinal pathogenic Escherichia coli (ExPEC) as a non-invasive biomarker for ALD liver injury is used for early identification of an ALD patient and accurate evaluation of liver injury in the ALD patient, which has important significance for the treatment and prognosis of patients.
Need to check novelty before this filing date? Find Prior Art

Description

Non-invasive biomarkers of liver injury in ALD and their applications Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to non-invasive biomarkers of ALD liver damage and their applications. Background Art

[0002] Many studies have shown that alcohol has become one of the important socioeconomic and health risk factors. Excessive drinking can lead to serious health problems, such as alcohol-related liver disease (ALD). ALD is a multimodal disease, mainly composed of alcoholic fatty liver disease and alcoholic steatohepatitis. In the later stages of ALD, it can progress to liver fibrosis, cirrhosis, and even liver cancer. In the early stages of ALD, most patients often have no symptoms; it is not until liver function decompensation occurs that patients seek medical treatment for discomfort. In the early stages of ALD, abstinence from alcohol can effectively improve the pathological changes of ALD. Therefore, early identification of ALD patients and accurate assessment of their liver damage are particularly important for the treatment and prognosis of patients.

[0003] 1. Epidemiology of ALD

[0004] Chronic alcohol consumption has become a global health problem and the seventh leading cause of death. According to the World Health Organization (WHO), there are currently 2.3 billion alcohol users, of whom approximately 1 billion are classified as heavy intermittent drinkers. Data from a 2016 survey showed that the average alcohol consumption in my country was 7.2 liters for the general population and 12.9 liters for individuals who drink alcohol. my country has become the second-largest alcohol-drinking nation in the world. The proportion of drinkers in my country is also increasing. According to the Chinese Medical Association's Primary Care Diagnosis and Treatment Guidelines for Alcoholic Liver Disease, the proportion of heavy drinkers varies across different regions of my country. In North China, the proportion of heavy drinkers has increased to 14%, while in Northeast China, it's as high as 27%, and in Western China, it ranges from 30% to 66%. Excessive drinking is a major risk factor for preventable disability and death, with 3 million deaths annually attributable to alcohol. Besides death, alcohol is also a major cause of illness and disability. Alcohol abuse can lead to alcoholic fatty liver disease (ALD), including alcoholic fatty liver disease, alcoholic steatohepatitis (alcoholic hepatitis), alcoholic cirrhosis, and alcoholic liver cancer. According to the World Health Organization, my country ranks third in the world for disability-adjusted life years (DALYs) due to alcohol-induced cirrhosis and first in the world for DALYs due to alcohol-induced liver cancer. Therefore, ALD has become a major health threat to the Chinese population and imposes a heavy economic burden, necessitating effective diagnosis and treatment.

[0005] 2. Diagnosis and Treatment of ALD

[0006] ALD is a complex disease that can affect all systemic systems. Its diagnosis often requires a comprehensive analysis of the medical history, particularly alcohol consumption history (according to Chinese guidelines, alcohol consumption >40g / day for men and >20g / day for women for more than 5 years), clinical manifestations of liver disease, and laboratory and imaging findings. Notably, 90% of ALD patients may have no obvious clinical manifestations in the early stages, while 63% of ALD patients are already in the decompensated stage at the time of diagnosis. Although liver biopsy is the gold standard for the diagnosis and staging of ALD, it is rarely used in clinical practice due to its invasive nature and associated morbidity risk. Consequently, identifying patients with early-stage ALD is challenging, and clinical misdiagnosis rates are high. In addition to liver biopsy, a number of non-invasive tests are available for the assessment of ALD. Biochemical markers, such as alanine aminotransferase (ALT) and aspartate aminotransferase (AST), are positively correlated with the degree of liver damage. The AST / ALT ratio and γ-glutamyltransferase can, to a certain extent, reflect the severity of liver damage. In addition, liver fibrosis scanners, including FibroScan and FibroTouch, can be used to grade alcohol-related liver fibrosis and assess the therapeutic efficacy of ALD. Conventional imaging modalities, such as ultrasound, CT, and MRI, can serve as auxiliary diagnostic tools for ALD and assess complications of advanced ALD, such as ascites, portal vein thrombosis, and hepatocellular carcinoma, as well as exclude other causes of liver dysfunction, such as biliary obstructive disease. While these non-invasive tests can aid in the diagnosis and assessment of ALD to a certain extent, they lack disease specificity. Furthermore, existing models for predicting ALD prognosis have limitations. Specifically, the indicators used in the Maddrey discriminant function are not standardized; high scores in the ABIC score have low predictive accuracy; the GAHS score is limited by steroid treatment; and the MELD score has low specificity and sensitivity.

[0007] To date, there is no recognized, approved treatment for ALD, aside from alcohol abstinence and, for advanced patients, liver transplantation. Current medical medications for ALD often carry significant side effects, including liver and kidney damage. Liver transplantation, however, is difficult to implement clinically due to limited liver resources, high costs, and the need for long-term anti-rejection medication. Therefore, the search for precise and effective treatments is crucial.

[0008] 3. ALD and intestinal flora

[0009] In recent years, with the deepening understanding of the gut microbiome, numerous studies have demonstrated that it plays a crucial role in the development and progression of various diseases, including cardiovascular, respiratory, neurological, and digestive diseases. The emergence of the concept of the "gut-liver axis" has sparked increasing interest in the role of the gut microbiome in liver diseases, including ALD. Indeed, numerous studies have demonstrated significant alterations in the composition and abundance of the gut microbiome in patients with ALD, and they have also found that the gut microbiome holds significant potential for the diagnosis and treatment of ALD. Candida albicans, an exotoxin from the intestinal bacteria Candida albicans, is associated with disease severity and mortality in patients with alcoholic hepatitis and can exacerbate the pathological progression of ALD. Cytolysin from the intestinal bacteria Enterococcus faecalis is also associated with mortality and can exacerbate the pathological progression of ALD. Furthermore, bacteriophages targeting Enterococcus faecalis can effectively ameliorate the pathological damage of ALD and may offer a potential therapeutic approach. In addition to Candida albicans and Enterococcus faecalis, recent studies have also revealed elevated levels of Escherichia coli in ALD patients and mouse models through fecal sequencing. Escherichia coli can be divided into commensal E. coli, enteropathogenic E. coli, and extraintestinal pathogenic E. coli (ExPEC). While ExPEC typically lack pathogenicity when colonizing the intestine, they can cause a variety of diseases and threaten health when they metastasize to other organs. ExPEC can colonize and cause disease in multiple extraintestinal sites, including surgical site infections and urinary tract infections, osteomyelitis, pneumonia, and meningitis. The intestine and liver communicate bidirectionally through the portal vein and biliary system. Once the intestinal barrier is damaged, intestinal microorganisms and their associated products can cross the damaged intestinal barrier and translocate into the liver, triggering a series of immune and inflammatory responses. Indeed, ExPEC have been shown to play a significant role in the pathogenesis of various liver diseases, such as non-alcoholic fatty liver disease and primary biliary cholangitis. In previous studies, we established an ALD mouse model and found elevated levels of E. coli in the feces of these mice, suggesting the potential for non-invasive biomarkers of liver damage in ALD. Summary of the Invention

[0010] The purpose of the present invention is to provide extraintestinal pathogenic Escherichia coli (ExPEC) as a non-invasive biomarker of ALD liver damage, which can be used for the early identification of ALD patients and the accurate assessment of their liver damage, which is of great significance for the treatment and prognosis of patients.

[0011] In view of this, the scheme of the present invention is as follows:

[0012] The first aspect of the present invention provides the use of an extraintestinal pathogenic Escherichia coli detection reagent in the preparation of an ALD liver injury diagnosis kit.

[0013] Furthermore, the detection reagent is selected from primers, probes, antisense oligonucleotides, aptamers or antibodies specific for extraintestinal pathogenic Escherichia coli.

[0014] Furthermore, the detection reagent includes primers specific for extraintestinal pathogenic Escherichia coli and internal reference primers.

[0015] Furthermore, the detection reagent includes primers specific for the kpsM gene of extraintestinal pathogenic Escherichia coli and primers using Escherichia coli 16SrRNA as an internal reference gene.

[0016] Preferably, the nucleotide sequences of the kpsM gene-specific primers are shown in SEQ ID NOs: 1-2; and the nucleotide sequences of the internal reference gene primers are shown in SEQ ID NOs: 3-4.

[0017] Furthermore, the diagnostic kit includes a standard control for providing an average amount of extraintestinal pathogenic Escherichia coli in a normal sample.

[0018] Preferably, the diagnostic kit diagnoses ALD liver damage by in vitro determining whether the amount of extraintestinal pathogenic Escherichia coli in a sample exceeds the average amount of a normal sample.

[0019] Preferably, the sample is derived from feces of the subject.

[0020] A second aspect of the present invention provides a system for predicting ALD liver damage using microbial markers, comprising:

[0021] Nucleic acid sample separation unit: used to separate intestinal flora nucleic acid samples from the test subject;

[0022] Detection unit: used to sequence isolated intestinal flora nucleic acid samples to obtain extraintestinal pathogenic Escherichia coli sequencing results;

[0023] A data processing unit is used to process the relative abundance of the extraintestinal pathogenic Escherichia coli according to the sequencing results, and obtain the relative abundance value;

[0024] The result determination unit is used to compare the relative abundance value obtained by the data processing unit with the normal value.

[0025] Furthermore, the detection unit uses an extraintestinal pathogenic Escherichia coli detection reagent, which includes a primer specific for the extraintestinal pathogenic Escherichia coli kpsM gene and a primer using Escherichia coli 16SrRNA as an internal reference gene.

[0026] Preferably, the nucleotide sequences of the kpsM gene-specific primers are shown in SEQ ID NOs: 1-2; and the nucleotide sequences of the internal reference gene primers are shown in SEQ ID NOs: 3-4.

[0027] Compared with the prior art, the beneficial effects of the present invention include but are not limited to:

[0028] The present invention provides extraintestinal pathogenic Escherichia coli (ExPEC) as a non-invasive biomarker of ALD liver damage, which is used for the early identification of ALD patients and the accurate assessment of their liver damage, which is of great significance for the treatment and prognosis of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0030] FIG1 is a graph showing the effect of alcohol on liver enzyme levels in mouse serum in Example 1.

[0031] FIG2 is a diagram showing the beta diversity analysis results of the fecal flora of each group of mice in Example 1.

[0032] FIG3 is a bar graph of the Wilcoxon rank sum test at the species level of fecal flora in each group of mice in Example 1.

[0033] FIG4 shows the expression results of the kpsM gene in each group of mice in Example 2.

[0034] FIG5 is a graph showing the effect of ExPEC on the levels of liver enzymes in the serum of ALD mice in Example 3.

[0035] FIG6 is a graph showing the effect of ExPEC on the expression of genes related to liver inflammation in ALD mice in Example 3.

[0036] FIG7 is a graph showing the effects of ExPEC on fatty degeneration and inflammation in liver tissue of ALD mice in Example 3. DETAILED DESCRIPTION

[0037] The following provides definitions of some terms used in this specification. Unless otherwise specified, all terms used herein have the meanings commonly understood by those skilled in the art to which this solution belongs.

[0038] As used herein, the term "sample" or "test sample" refers to any liquid or solid material containing nucleic acids. In some embodiments, the test sample is obtained from a biological source, such as cells in culture, or a tissue sample from an animal, and most preferably, a human. In a preferred embodiment, the sample is feces.

[0039] The term "amplification" as used in the text represents one or more methods known in the art for replicating a target nucleic acid and increasing the number of copies of a selected nucleic acid sequence. Amplification can be exponential or linear. The target nucleic acid can be a DNA or RNA. The sequence amplified in this way forms an "amplicon". Although the exemplary method described below relates to amplification using polymerase chain reaction ("PCR"), many other methods (e.g., isothermal method, rolling circle method, etc.) known in the art for amplifying nucleic acids are also included in the present invention. It will be appreciated by those skilled in the art that these other methods can replace the PCR method or can be used together with the PCR method.

[0040] As used herein, a "primer" for amplification is an oligonucleotide that specifically anneals to a target nucleotide sequence or a marker nucleotide sequence. The 3' nucleotide of the primer should be identical to the target sequence or marker sequence at the corresponding nucleotide position to achieve optimal primer extension by the polymerase.

[0041] As used herein, the term "antibody" is used in the broadest sense and specifically encompasses, for example, monoclonal antibodies, polyclonal antibodies, antibodies with multiple epitope specificities, single-chain antibodies, multispecific antibodies, and antibody fragments. Such antibodies can be chimeric, humanized, human, and synthetic.

[0042] As used herein, the term "aided diagnosis" refers to assisting in differentiating or identifying a disease, syndrome, or condition, or to assisting in differentiating or identifying a person who has a particular disease, syndrome, or condition.

[0043] The term "ALD model" or NIAAA model used herein represents a standard model in this field, that is, people in this field can confirm that the model represents a real alcohol-related liver disease sample, so there is no difference between the model and the real sample, and there is no difference between the models.

[0044] In order to make the purpose, technical solution and beneficial technical effects of the present invention more clearly understood, the technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and examples. Experimental methods in which specific conditions are not specified in the examples are generally based on conventional conditions. It should be understood that the specific embodiments described in this specification are only for the purpose of explaining the present invention and are not intended to limit the present invention.

[0045] ExPEC has a complex array of serotypes, virulence factors, gene structure, and gene expression regulation, and its pathogenic mechanisms remain incompletely understood. The capsule, the primary polysaccharide covering the surface of ExPEC, protects the bacteria from clearance by the host immune system and is therefore considered a virulence factor of ExPEC. The phylogenetic groups of Escherichia coli include group A, group B1, group B2, and group D. Groups B2 and D are the dominant groups of ExPEC. The kps gene locus in the genome of group B2, where the capsule is expressed, is a conserved structure consisting of three regions. kpsM, a highly conserved gene locus within region 3 of the flail gene cluster, encodes a transmembrane channel protein of an ABC transporter. Studies have shown that knocking out the kpsM gene significantly reduces the virulence of ExPEC strains. Therefore, kpsM can be considered a key virulence gene of ExPEC. In an embodiment of the present invention, the abundance of extraintestinal pathogenic Escherichia coli (ExPEC) in patient feces was detected using kpsM-specific primers and Escherichia coli 16SrRNA internal reference gene primers, and it was found that there was a difference in the ALD model compared with the control group. Therefore, it can be used to evaluate liver damage in alcohol-related liver disease, that is, ExPEC can be used as a non-invasive biomarker for evaluating ALD liver damage.

[0046] Example 1 Detection of fecal flora in ALD mice

[0047] 1. Objective: To establish an internationally recognized mouse ALD model (i.e., the NIAAA model) and analyze the differences in fecal flora between the model and the control group through sequencing to determine whether the intestinal flora of the ALD model mice has changed.

[0048] 2. Experimental Methods: C57 mice (8 weeks old) were used and acclimated for one week before modeling. For the first 5 days of modeling, all mice were fed a Lieber-DeCarli control liquid diet with free access to food. From days 6 to 15 of modeling, mice were divided into a "control" (ND) group and a "model" (ALD) group based on the liquid diet they received. Mice in the "ALD" group were fed a Lieber-DeCarli alcohol liquid diet with a 5% vol / vol alcohol content and free access to food; mice in the "ND" group were fed a Lieber-DeCarli control liquid diet with an equal caloric content as the "ALD" group. On day 16 of modeling, mice in the "ALD" group were given a large dose of alcohol (5 g / kg, 40% vol / vol) by gavage at 9:00 AM. The "ND" group was also gavaged with an equal volume of PBS. Nine hours after the alcohol gavage, the mice were anesthetized, and blood, liver, intestine, and intestinal contents were collected for subsequent experiments.

[0049] 3. Experimental Results

[0050] (1) Alcohol causes an increase in liver enzymes (alanine aminotransferase ALT and aspartate aminotransferase AST, which are positively correlated with the degree of liver damage).

[0051] Figure 1 shows the effects of alcohol on liver enzymes in mouse serum. Figure A: Alanine aminotransferase (ALT) levels in each group of mice; Figure B: Aspartate aminotransferase (AST) levels in each group of mice. Differences between the two groups were analyzed using a t-test (*p<0.05, **p<0.01, ***p<0.001). As shown in Figure 1, ALT and AST levels in the ALD group were significantly higher than those in the ND group, preliminarily indicating that alcohol can cause liver damage and that the ALD model was successfully established.

[0052] (2) Alcohol causes intestinal flora disorders.

[0053] Figures 2-3 show the effects of alcohol on the intestinal microbiota of mice. Figure 2 shows the beta diversity analysis of the fecal microbiota of each group of mice; Figure 3 shows a bar chart of the Wilcoxon rank sum test for species-level fecal microbiota of each group of mice. The composition of the fecal microbiota of mice in the ALD and ND groups was significantly different, with E. coli significantly enriched in the ALD group.

[0054] 4. Experimental Conclusions: Alcohol can alter the composition and abundance of intestinal flora. Specifically, the proportion of Escherichia coli in the intestines of ALD model mice increased significantly.

[0055] Example 2 ExPEC detection in feces of ALD mice

[0056] 1. Experimental purpose: To further clarify whether ExPECs are elevated in the intestinal flora of ALD model mice.

[0057] 2. Experimental Methods: Currently, there are no kits or recognized methods for detecting ExPEC. As previously mentioned, kpsM is one of the key pathogenic genes of ExPEC. Therefore, the expression of the kpsM gene can be used to indirectly indicate changes in ExPEC abundance. DNA was extracted from the intestinal contents of mice in the ALD and ND groups. Quantitative quantitative PCR (qPCR) was performed, using Escherichia coli 16S rRNA as an internal reference gene, to analyze the expression of the kpsM gene in the feces of both groups of mice.

[0058] kpsM:

[0059] F: GCAAGCTTTCATGACGTCAGCATTGCC (SEQ ID NO: 1);

[0060] R: GCGGTACCATGGCAAGAAGTGGATTTGAA (SEQ ID NO: 2);

[0061] 16S rRNA:

[0062] F: CGGTGAATACGTTCYCGG (SEQ ID NO: 3);

[0063] R:GGWTACCTTGTTACGACTT (SEQ ID NO: 4).

[0064] 3. Experimental results: Alcohol caused a significant increase in the abundance of intestinal ExPECs.

[0065] Figure 4 shows the expression levels of the kpsM gene in the feces of mice in each group. Differences between the two groups were analyzed using a t-test (***p < 0.001). The expression level of the kpsM gene in the feces of mice in the ALD group was significantly higher than that in the ND group, which indirectly indicates that the abundance of ExPEC in the feces of mice in the ALD group was significantly higher than that in the ND group.

[0066] 4. Experimental conclusion: Alcohol causes a significant increase in the abundance of ExPEC in the intestine.

[0067] Example 3 Effect of ExEPC on ALD

[0068] 1. Objective: To establish an internationally recognized mouse ALD model (i.e., the NIAAA model) and treat it with ExPEC to investigate the effect of ExPEC on the pathological progression of ALD.

[0069] 2. Experimental Methods: C57 mice (8 weeks old) were used and acclimated for one week before modeling. For the first 5 days of modeling, mice were given a Lieber-DeCarli control liquid diet with free access to food. From days 6 to 15 of modeling, mice were given a Lieber-DeCarli alcohol liquid diet with a 5% vol / vol alcohol content and free access to food. Depending on the treatment, mice were divided into an "ALD + PBS group" (each mouse was gavaged with 100 μl of PBS on days 6, 9, 12, and 15 of modeling) and an "ALD + ExPEC group" (each mouse was gavaged with 100 μl of ExPEC on days 6, 9, 12, and 15 of modeling, with an ExPEC concentration of 10^9 CFU / mouse). ExPEC was isolated from the brain of a diseased pig in Hunan Province, China. The strain was ExPEC PCN033 carrying kpsM and was a gift from Huazhong Agricultural University. On day 16 of modeling, mice were gavaged with a large dose of alcohol (5 g / kg, 40% vol / vol) at 9:00 AM. At noon, each mouse in the ALD + ExPEC group received 100 μl of ExPEC (109 CFU / mouse). Simultaneously, each mouse in the ALD + PBS group received 100 μl of PBS. Nine hours after the alcohol gavage, the mice were anesthetized, and blood, liver, intestine, and intestinal contents were collected for subsequent experiments.

[0070] 3. Experimental Results

[0071] (1) ExPEC can significantly increase the levels of ALD liver enzymes (alanine aminotransferase ALT, aspartate aminotransferase AST, which are positively correlated with the degree of liver damage).

[0072] Figure 5 shows the effects of ExPEC on serum liver enzymes in ALD mice. Panel A: ALT levels in serum of mice in each group; Panel B: AST levels in serum of mice in each group. Differences between the two groups were analyzed using a t-test. (*: p < 0.05, **p < 0.01, ***p < 0.001). ALT and AST levels in the ALD + ExPEC group were significantly higher than those in the ALD + PBS group. This biochemical analysis suggests that ExPEC can significantly exacerbate ALD liver damage.

[0073] (2) ExPEC can further upregulate the expression of inflammation-related genes (IL-1β, Cxcl1, Cxcl2) in ALD.

[0074] Figure 6 shows the effects of ExPEC on the expression of genes associated with liver inflammation in ALD mice. Panel A: Liver IL-1β expression; Panel B: Liver Cxcl1 expression; Panel C: Liver Cxcl2 expression. Differences between the two groups were analyzed using a t-test (*p<0.05, **p<0.01, ***p<0.001). IL-1β, Cxcl1, and Cxcl2 levels were significantly higher in the ALD+ExPEC group than in the ALD+PBS group, demonstrating that ExPEC can exacerbate liver inflammation in ALD at the transcriptomic level.

[0075] (3) ExPEC can further aggravate fatty degeneration and inflammation in ALD liver tissue.

[0076] Figure 7 shows the effect of ExPEC on liver histopathology in ALD mice (HE staining, 200x magnification). HE staining of the liver reveals hepatic steatosis and hepatitis, as determined by the presence of vacuoles of varying sizes within the hepatocyte cytoplasm and the distribution and composition of inflammatory cells. Compared with the ALD + PBS group, the ALD + ExPEC group showed a significant increase in fat vacuoles and inflammatory cell infiltration, primarily lymphocytes. This histological finding suggests that ExPEC can exacerbate hepatic steatosis and inflammation in ALD.

[0077] 4. Experimental conclusions: ExPEC can aggravate ALD at multiple levels: at the biochemical level, ExPEC can significantly increase the levels of serum biochemical indicators reflecting liver damage (ALT and AST); at the transcriptional level, it can significantly upregulate the expression of liver inflammation-related genes (IL-1β, Cxcl1 and Cxcl2); at the tissue level, it can aggravate lipid deposition and inflammatory cell infiltration in the liver.

[0078] Although the present invention is disclosed as above, the scope of protection disclosed by the present invention is not limited thereto. Those skilled in the art may make various changes and modifications without departing from the spirit and scope of the present invention, and these changes and modifications will fall within the scope of protection of the present invention.

Claims

1. Application of extraintestinal pathogenic Escherichia coli detection reagent in the preparation of ALD liver injury diagnostic kit.

2. The use according to claim 1, characterized in that The detection reagent is selected from primers, probes, antisense oligonucleotides, aptamers or antibodies specific to extraintestinal pathogenic Escherichia coli.

3. The use according to claim 1, characterized in that The detection reagent comprises primers specific to extraintestinal pathogenic Escherichia coli and internal reference primers.

4. The use according to claim 1, characterized in that The detection reagent comprises a specific primer for the kpsM gene of extraintestinal pathogenic Escherichia coli and a primer using Escherichia coli 16SrRNA as an internal reference gene.

5. The use according to claim 4, characterized in that The nucleotide sequences of the kpsM gene-specific primers are shown in SEQ ID NOs: 1-2; the nucleotide sequences of the internal reference gene primers are shown in SEQ ID NOs: 3-4.

6. The use according to claim 1, characterized in that The diagnostic kit includes a standard control for providing the average amount of extraintestinal pathogenic Escherichia coli in a normal sample.

7. The use according to claim 6, characterized in that The diagnostic kit diagnoses ALD liver damage by in vitro determining whether the amount of extraintestinal pathogenic Escherichia coli in a sample exceeds the average amount of a normal sample.

8. The use according to claim 7, characterized in that The sample is derived from feces of the subject.

9. A system for predicting ALD liver damage using microbial markers, characterized in that: include: Nucleic acid sample separation unit: used to separate intestinal flora nucleic acid samples from the test subject; Detection unit: used to sequence isolated intestinal flora nucleic acid samples to obtain extraintestinal pathogenic Escherichia coli sequencing results; A data processing unit is used to process the relative abundance of the extraintestinal pathogenic Escherichia coli according to the sequencing results, and obtain the relative abundance value; The result determination unit is used to compare the relative abundance value obtained by the data processing unit with the normal value.

10. The prediction system according to claim 9, characterized in that The detection unit uses an extraintestinal pathogenic Escherichia coli detection reagent, which includes a primer specific for the extraintestinal pathogenic Escherichia coli kpsM gene and a primer using Escherichia coli 16SrRNA as an internal reference gene.

Citation Information

Patent Citations

  • Faecalitalea related to nephrotic syndrome and application thereof

    CN111647670A

  • Intrahepatic flora marker related to liver cirrhosis and application thereof

    CN113025730A

  • Microbial combined marker for screening children non-alcoholic fatty liver disease as well as application and product thereof

    CN117286237A

  • Preparation method and application of ExPEC-targeted bacteriophage

    CN117987379A

  • Non-invasive biomarker for ALD liver injury and application

    CN118389661A