Pharmaceutical composition for treating cancer
The use of ASOs to inhibit CHMP4B expression addresses the limitations of current gastric cancer treatments by offering a targeted and adaptive therapeutic strategy through personalized medicine.
Patent Information
- Application Number
- PCT/JP2025/006109
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-22
- Filing Date
- 2025-02-21
- Publication Date
- 2025-08-28
AI Technical Summary
Current treatments for unresectable advanced gastric cancer are limited, and there is a need for personalized medicine that can adapt to dynamic changes in cancer characteristics during treatment.
A pharmaceutical composition that inhibits the expression of CHMP4B using antisense oligonucleotides (ASOs) to target specific cancers, particularly gastric cancer, by suppressing the CHMP4B gene expression.
The ASOs effectively reduce CHMP4B expression, leading to potential therapeutic benefits for gastric cancer by altering protein expression levels of epithelial and mesenchymal cell-related genes, thereby providing a targeted treatment approach.
Smart Images

Figure JP2025006109_28082025_PF_FP_ABST
Abstract
Description
Pharmaceutical compositions for treating cancer
[0001] The present application relates to pharmaceutical compositions for treating cancer.
[0002] Gastric cancer is the third most common cause of morbidity and mortality after lung cancer and colorectal cancer, and the prognosis for unresectable advanced gastric cancer in particular is extremely poor, with a median survival time of approximately 12 months. There are limitations to standard therapy and the development of treatments based on genomic mutation information, so it is essential to establish personalized medicine based on a new concept that can respond to the dynamic changes in cancer characteristics that occur during treatment.
[0003] The present application aims to provide a pharmaceutical composition for treating cancer.
[0004] As a result of extensive research, the present inventors have discovered CHMP4B as a therapeutic target specific to certain cancers, leading to the completion of the present invention. Specifically, the present application provides a pharmaceutical composition for treating cancer, which comprises a substance that inhibits the expression of CHMP4B.
[0005] The present application also provides an antisense oligonucleotide (ASO) that suppresses the expression of the CHMP4B gene.
[0006] The present application provides a pharmaceutical composition for treating cancer.
[0007] Changes in protein expression levels of epithelial cell-related genes (CDH1 and OCLN) and mesenchymal cell-related genes (VIM and FN1) in three subtypes of treatment-naive gastric cancer patients classified by high-sensitivity phosphoproteome analysis. Schematic diagram showing the timing of biopsy specimen acquisition before second-line treatment, during second-line treatment, and at progression. Changes in protein expression levels of epithelial cell-related genes (CDH1 and OCLN) and mesenchymal cell-related genes (VIM and FN1) in biopsy specimens before second-line treatment, during second-line treatment, and at progression. Gene set enrichment analysis (GSEA) using proteomic information from three subtypes of treatment-naive patients and biopsy specimens before second-line treatment, during second-line treatment, and at progression. Selection of gastric cancer cell lines with epithelial and mesenchymal characteristics. The diagram above shows the expression levels of epithelial cell-related genes (CDH1 and OCLN) and mesenchymal cell-related genes (CDH2) in 41 gastric cancer cell lines. The figures below show the expression levels of epithelial cell marker-related genes (CDH1) and mesenchymal cell-related genes (CDH2) in selected gastric cancer cell lines. Results of therapeutic target discovery for mesenchymal gastric cancer cell lines using CRISPR-CAS9 screening. Relative CHMP4B mRNA expression levels in A549 cells transfected with the seven ASOs described herein and a control ASO. Relative CHMP4B mRNA expression levels in A549 cells transfected with various concentrations of ASO2, ASO4, ASO6, and ASO7 (top panel) and relative viable cell counts measured using WST8 reagent in A549 cells transfected with various concentrations of ASO2 (bottom panel). Cell viability of Hs746 T cells transfected with various concentrations of ASO8. Cell viability of Hs746 T cells transfected with various concentrations of ASO9. Cell viability of Hs746 T cells transfected with various concentrations of ASO10. Cell viability of Hs746 T cells transfected with various concentrations of ASO11. Cell viability of Hs746 T cells transfected with various concentrations of ASO12. Cell viability of Hs746 T cells transfected with various concentrations of ASO13. Cell viability of Hs746 T cells transfected with various concentrations of ASO14. Cell viability of Hs746 T cells transfected with various concentrations of ASO15. Cell viability of Hs746 T cells transfected with various concentrations of ASO2. Cell viability of Hs746 T cells transfected with various concentrations of ASO16. Cell viability of Hs746 T cells transfected with various concentrations of ASO17.Cell viability of Hs746 T cells transfected with various concentrations of ASO18. Cell viability of Hs746 T cells transfected with various concentrations of ASO19. Cell viability of Hs746 T cells transfected with various concentrations of ASO20. Cell viability of LMSU cells transfected with various concentrations of ASO8. Cell viability of LMSU cells transfected with various concentrations of ASO9. Cell viability of LMSU cells transfected with various concentrations of ASO10. Cell viability of LMSU cells transfected with various concentrations of ASO11. Cell viability of LMSU cells transfected with various concentrations of ASO12. Cell viability of LMSU cells transfected with various concentrations of ASO13. Cell viability of LMSU cells transfected with various concentrations of ASO14. Cell viability of LMSU cells transfected with various concentrations of ASO15. Cell viability of LMSU cells transfected with various concentrations of ASO2. Cell viability of LMSU cells transfected with various concentrations of ASO16. Cell viability of LMSU cells transfected with various concentrations of ASO17. Cell viability of LMSU cells transfected with various concentrations of ASO18. Cell viability of LMSU cells transfected with various concentrations of ASO20. Cell viability and EMT scores of five types of cancer cells transfected with ASO2. Relative expression levels of CHMP4B mRNA in A549 cells transfected with an ASO that has an altered chemical modification pattern of ASO17.
[0008] In this disclosure, when a numerical value is accompanied by the term "about," it is intended to encompass a range of ±10% of that value. For example, "about 20" is intended to include "18 to 22." A range of numerical values includes all values between and at the endpoints. "About" in reference to a range applies to both endpoints of the range. Thus, for example, "about 20 to 30" is intended to include "18 to 33."
[0009] Pharmaceutical Composition The present application provides a pharmaceutical composition for treating cancer, comprising a substance that suppresses the expression of CHMP4B.
[0010] The substance that suppresses the expression of CHMP4B is not particularly limited, and may be, for example, a nucleic acid molecule that suppresses the expression of CHMP4B. Examples of nucleic acid molecules that suppress the expression of CHMP4B include CHMP4B siRNA, CHMP4B shRNA, and CHMP4B ASO.
[0011] siRNA is a double-stranded RNA consisting of an RNA strand (antisense strand) with a sequence complementary to part or all of the target mRNA and an RNA strand (sense strand) with a sequence complementary to the antisense strand. The antisense strand does not need to be completely complementary to the target gene as long as it is effective in inhibiting the expression of the target mRNA. siRNA may contain a single-stranded portion (overhang). The nucleotide molecules constituting siRNA may contain various chemical modifications to improve stability and activity. For example, to prevent degradation by hydrolases such as nucleases, phosphate residues may be replaced with chemically modified phosphate residues such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. Furthermore, at least a portion of the siRNA may be composed of a nucleic acid analog such as peptide nucleic acid (PNA).
[0012] shRNAs are single-stranded RNAs consisting of an RNA strand (antisense strand) with a sequence complementary to part or all of a target mRNA and an RNA strand (sense strand) with a complementary sequence linked by a short spacer sequence. The antisense strand does not need to be perfectly complementary to the target gene, as long as it is effective in inhibiting the expression of the target mRNA. The nucleotide molecules that make up shRNAs may contain various chemical modifications to improve stability and activity. For example, to prevent degradation by hydrolases such as nucleases, phosphate residues may be replaced with chemically modified phosphate residues, such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. Furthermore, at least a portion of the shRNA may be composed of nucleic acid analogs, such as peptide nucleic acids (PNAs).
[0013] ASOs are single-stranded nucleic acids that contain a base sequence complementary to part or all of a target gene. ASOs do not need to be completely complementary to the target gene, as long as they are effective in inhibiting target gene expression. ASOs can be DNA, RNA, or DNA-RNA chimeras.
[0014] siRNA, shRNA and ASO can be designed and synthesized by the method known in the art.For example, based on the base sequence information of target gene, the base sequence of siRNA, shRNA and ASO can be designed by conventional method, and then can be synthesized by known nucleic acid synthesis reaction based on this design.Alternatively, siRNA, shRNA and ASO can be ordered and obtained from manufacturer by specifying nucleic acid base sequence and modification position and type.
[0015] "Sequence identity" is determined by comparing two optimally aligned sequences across the entire region of the sequences being compared. The sequences being compared may have additions or deletions (e.g., gaps) in the optimal alignment of the two sequences. Sequence identity can be calculated using programs such as FASTA, BLAST, and CLUSTAL W provided in public databases (e.g., DDBJ (http: / / www.ddbj.nig.ac.jp)). Alternatively, it can be determined using commercially available sequence analysis software (e.g., Vector NTI® software, GENETYX® ver. 12).
[0016] An example of the mRNA sequence of the human CHMP4B gene is the nucleotide sequence shown in SEQ ID NO: 41 (NM_176812.5). CHMP4B siRNA, CHMP4B shRNA, and CHMP4B ASO can be designed and synthesized by conventional methods based on the nucleotide sequence shown in SEQ ID NO: 41. In one embodiment, the substance that suppresses CHMP4B expression is a CHMP4B ASO.
[0017] A substance that suppresses the expression of CHMP4B can be, for example, an ASO that contains or consists of a 13-24 nucleotide sequence complementary to a portion of the nucleotide sequence shown in SEQ ID NO: 41. A substance that suppresses the expression of CHMP4B can be an ASO that contains or consists of a nucleotide sequence in which 1-5, 1-3, 1-2, or 1 nucleotide has been substituted, deleted, or inserted in a nucleotide sequence complementary to a portion of SEQ ID NO: 41, as long as it is capable of inhibiting the expression of CHMP4B. The ASO of the present application may be in the range of 13-24 nucleotides in length, and can be, for example, 14-23 nucleotides in length, 15-22 nucleotides in length, or 16-20 nucleotides in length.
[0018] In one embodiment, the substance that suppresses the expression of CHMP4B is an ASO comprising or consisting of a 13-24 nucleotide sequence complementary to the nucleotide sequence at positions 228-246, 278-304, 294-312, 615-633, 730-748, 748-766, or 753-771 in the nucleotide sequence set forth in SEQ ID NO: 41, or a nucleotide sequence in which 1-3, 1-2, or 1 nucleotide has been substituted, deleted, or inserted relative to said nucleotide sequence. In one embodiment, the ASO of the present application comprises or consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-20, or a nucleotide sequence in which 1-3, 1-2, or 1 nucleotide has been substituted, deleted, or inserted relative to said nucleotide sequence. In a further embodiment, the ASO of the present application comprises or consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 21-40, or a nucleotide sequence in which 1-3, 1-2, or 1 nucleotide has been substituted, deleted, or inserted relative to said nucleotide sequence.
[0019] An example of a 13-24 base sequence complementary to the base sequence from positions 228 to 246 in the base sequence shown in SEQ ID NO:41 is the base sequence shown in SEQ ID NO:1. In one embodiment, the oligonucleotide of the present application comprises or consists of the base sequence shown in SEQ ID NO:1, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to the base sequence. An example of the present oligonucleotide is the ASO referred to as ASO1 in the Examples. In a further embodiment, the oligonucleotide of the present application comprises or consists of the base sequence shown in SEQ ID NO:21, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to the base sequence.
[0020] Examples of 13-24 nucleotide sequences complementary to the nucleotide sequence from positions 278 to 304 in the nucleotide sequence of SEQ ID NO:41 include the nucleotide sequences shown in SEQ ID NOs:2 and 8 to 20. In certain embodiments, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NOs:2 and 8 to 20, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence. Examples of the present oligonucleotide include the ASOs described as ASO2 and ASO8 to 20 in the Examples. In a further embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NOs:22 and 28 to 40, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence.
[0021] An example of a 13-24 nucleotide sequence complementary to the nucleotide sequence from positions 294 to 312 in the nucleotide sequence shown in SEQ ID NO:41 is the nucleotide sequence shown in SEQ ID NO:3. In one embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NO:3, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence. An example of the present oligonucleotide is the ASO referred to as ASO3 in the Examples. In a further embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NO:23, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence.
[0022] An example of a 13-24 nucleotide sequence complementary to the nucleotide sequence from positions 615 to 633 in the nucleotide sequence shown in SEQ ID NO:41 is the nucleotide sequence shown in SEQ ID NO:4. In one embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NO:4, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence. An example of the present oligonucleotide is the ASO referred to as ASO4 in the Examples. In a further embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NO:24, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence.
[0023] An example of a 13-24 nucleotide sequence complementary to the nucleotide sequence of positions 730 to 748 in the nucleotide sequence of SEQ ID NO:41 is the nucleotide sequence of SEQ ID NO:5. In one embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence of SEQ ID NO:5, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence. An example of the present oligonucleotide is the ASO referred to as ASO5 in the Examples. In a further embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence of SEQ ID NO:25, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence.
[0024] An example of a 13-24 nucleotide sequence complementary to the nucleotide sequence from positions 748 to 766 in the nucleotide sequence shown in SEQ ID NO:41 is the nucleotide sequence shown in SEQ ID NO:6. In one embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NO:6, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence. An example of the present oligonucleotide is the ASO shown in the Examples as ASO6. In a further embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NO:26, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence.
[0025] An example of a 13-24 nucleotide sequence complementary to the nucleotide sequence of positions 753 to 771 in the nucleotide sequence shown in SEQ ID NO:41 is the nucleotide sequence shown in SEQ ID NO:7. In one embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NO:7, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence. An example of the present oligonucleotide is the ASO shown in the Examples as ASO7. In a further embodiment, the oligonucleotide of the present application comprises or consists of the nucleotide sequence shown in SEQ ID NO:27, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to the nucleotide sequence.
[0026] In the present application, 13 types of ASOs were further designed for ASO2 shown in SEQ ID NO: 22 by varying the length and position of the natural nucleic acid region while fixing the number of artificial nucleic acids introduced, resulting in ASOs 8 to 20 shown in SEQ ID NOs: 28 to 40. That is, the present application provides oligonucleotides comprising or consisting of any of the base sequences shown in SEQ ID NOs: 28 to 40, or base sequences in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to the base sequence.
[0027] Of the 13 ASOs obtained by optimization from ASO2, ASO13-01 to ASO13-09 shown in SEQ ID NOs: 47 to 55 were obtained by altering the chemical modification pattern based on ASO13 shown in SEQ ID NO: 33. That is, the present application provides oligonucleotides containing or consisting of any of the nucleotide sequences shown in SEQ ID NOs: 47 to 55, or nucleotide sequences in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to said nucleotide sequence.
[0028] ASOs may be linked to one or more components or conjugates thereof that enhance the activity or cellular uptake of ASOs. Such components include, but are not limited to, cholesterol components, cholic acid, thioethers (e.g., hexyl-S-tritylthiol), thiocholesterol, aliphatic chains (e.g., dodecanediol or undecyl residues), phospholipids (e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate), polyamines or polyethylene glycol chains, adamantane acetic acid, palmityl components, or octadecylamine, hexylamino-carbonyl-t-oxycholesterol, or octaguanidine dendrimer components. Oligonucleotides containing such components and methods for preparing such oligonucleotides are known in the art.
[0029] As used herein, "suppression" of gene expression refers to reducing the amount (abundance) of mRNA produced by transcription of the gene. Suppression includes suppressing mRNA levels by 20% or more, 30% or more, or 40% or more, preferably 50% or more, and more preferably 80% or more, 90% or more, or 95% or more, compared to a control. Suppression of gene expression may be determined by any method known in the art, particularly by PCR-based methods such as real-time PCR using cells, such as human or mouse cells.
[0030] As used herein, "nucleobase" or "base" refers to a heterocyclic moiety that is a base component of a nucleic acid and can pair with a base of another nucleic acid. As used herein, "nucleobase sequence" can refer to the sequence of consecutive nucleic acid bases, without taking into account the sugars, internucleoside linkages, or nucleic acid base modifications that make up the nucleic acid.
[0031] Generally, a "nucleoside" is a combination of a sugar and a nucleic acid base. A "nucleotide" further comprises a phosphate group covalently linked to the sugar portion of the nucleoside. The phosphate group generally forms the internucleoside linkage of an oligonucleotide. An oligonucleotide is formed by covalently linking adjacent nucleosides to each other to form a linear polymeric oligonucleotide.
[0032] As used herein, a "modified nucleoside" refers to a nucleoside having, independently, a modified sugar and / or a modified nucleobase. A "modified nucleotide" refers to a nucleotide having, independently, a modified internucleoside linkage, a modified sugar, and / or a modified nucleobase. Oligonucleotides containing modified nucleotides are preferred over unmodified forms due to desirable properties such as enhanced affinity for target nucleic acids and increased nuclease resistance.
[0033] As used herein, the term "modified internucleoside linkage" refers to an internucleoside linkage that is substituted or otherwise altered from a naturally occurring internucleoside linkage (i.e., a phosphodiester linkage). Modified internucleoside linkages include, but are not limited to, phosphorothioate linkages, phosphorodithioate linkages, phosphorodiamidate linkages, and phosphoramidate linkages. A phosphorothioate linkage refers to an internucleoside linkage in which the non-bridging oxygen atom of a phosphodiester bond is replaced with a sulfur atom. Preferably, the modified internucleoside linkage is more nuclease-resistant than a naturally occurring internucleoside linkage.
[0034] As used herein, "modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. "Unmodified nucleobase" or "natural nucleobase" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Examples of modified nucleobases include, but are not limited to, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, or 5-iodocytosine; 5-fluorouracil, 5-bromouracil, 5-iodouracil, or 5-hydroxyuracil; 2-thiothymine; N6-methyladenine or 8-bromoadenine; and N2-methylguanine or 8-bromoguanine.
[0035] As used herein, the term "modified sugar" refers to a sugar that has a substitution or some other alteration from a natural sugar moiety (i.e., a sugar moiety found in DNA (2'-H) or RNA (2'-OH)). Modified sugars can confer upon an oligonucleotide enhanced affinity for a target nucleic acid, increased nuclease resistance, and the like. Examples of modified sugars include, for example, bicyclic sugars, 5'-vinyl, 5'-methyl, 4'-S, 2'-F, 2'-OCH3 (2'-methoxy or 2'-O-methyl groups), and 2'-O(CH2)2OCH3 substituents.
[0036] As used herein, the term "bicyclic sugar" refers to a sugar having two rings. Nucleic acids containing bicyclic sugar moieties are commonly referred to as bridged nucleic acids (BNAs). A bicyclic sugar may be a sugar in which the 2' and 4' carbon atoms are bridged by two or more atoms. Examples of bicyclic sugars include, but are not limited to, sugars with methyleneoxy (4'-CH2-O-2') bridges (LNA®, also known as 2',4'-BNA), sugars with ethyleneoxy (4'-(CH2)2-O-2') bridges (also known as ENA), sugars with 4'-CH(CH3)-O-2' bridges (cEt, constrained ethyl), sugars with 4'-CH(CHOCH3)-O-2' bridges (cMOE, constrained MOE), and sugars with amide bridges (AmNA, Amido-bridged nucleic acid). An example of a sugar having an amide bridge is a sugar having a 4'-C(O)-N(CH3)-2' bridge. For the structure and preparation method of a sugar having an amide bridge, see, for example, Yahara, A., et al., Amido-bridged nucleic acids (AmNAs): synthesis, duplex stability, nuclease resistance, and in vitro antisense potency, ChemBioChem, 2012, 13(7): 2513-2516; Yamamoto, T., et al., Amidobridged nucleic acids with small hydrophobic residues enhance hepatic tropism of antisense oligonucleotides in vivo, Org. Biomol. Chem., 2015, 13: 3757-3765; and International Publication No. WO2011 / 052436.For sugars with a 4'-CH(CH)-O-2' bridge (cEt) and sugars with a 4'-CH(CHOCH)-O-2' bridge (cMOE), see Punit, PS, et al., Short antisense oligonucleotides with novel 2'-4' conformationally restricted nucleoside analogues show improved potency without increased toxicity in animals, J. Med. Chem., 2009, 52(1): 10-13.
[0037] In the present invention, ASOs may comprise nucleotide mimetics such as peptide nucleic acids, morpholino nucleic acids, and the like.
[0038] Generally, different nucleotides in the same strand can be independently modified. Also, for example, to enhance nuclease resistance, the same nucleotide can have a modified internucleoside linkage (e.g., phosphorothioate linkage) and a modified sugar (e.g., bicyclic sugar). The same nucleotide can also have a modified nucleobase (e.g., 5-methylcytosine) and a modified sugar (e.g., bicyclic sugar).
[0039] In certain embodiments, the ASOs of the present application may comprise at least one modified nucleotide, which may comprise a modified internucleoside linkage, a modified sugar moiety, and / or a modified nucleobase.
[0040] In some embodiments, at least one internucleoside linkage in the ASO of the present application is a modified internucleoside linkage. In further embodiments, at least 50%, at least 70%, at least 80%, at least 90%, or 100% (all) of the internucleoside linkages in the ASO of the present application are modified internucleoside linkages. The modified internucleoside linkages may be, for example, phosphorothioate linkages.
[0041] In some embodiments, at least one sugar moiety of the ASO is a bicyclic sugar. The bicyclic sugar may have a methyleneoxy (4'-CH2-O-2') bridge or an amide bridge (e.g., a 4'-C(O)-N(CH3)-2' bridge). In some embodiments, the oligonucleotides of the present application contain 1 to 10, 2 to 8, 2 to 6, e.g., 6, 2',4'-bridged nucleotides. In further embodiments, the oligonucleotides of the present application have 2',4'-bridged nucleotides at positions 1 to 3 from the 5' and 3' ends. The 2',4'-bridged nucleotides may be, for example, LNA.
[0042] In one embodiment, at least one nucleobase in the ASO is a modified nucleobase. The modified nucleobase may be a 5-methylcytosine base. In one embodiment, in the oligonucleotide of the present application, the cytosine bases located at positions 1 to 3 from the 5'-terminus and 3'-terminus are 5-methylcytosine bases. In one embodiment, when the oligonucleotide of the present application contains a 2',4'-bridged nucleotide, the cytosine base in the 2',4'-bridged nucleotide is a 5-methylcytosine base.
[0043] In certain embodiments, the ASO may be a gapmer. As used herein, the term "gapmer" refers to an oligonucleotide consisting of a central region (DNA gap region) containing at least four consecutive deoxyribonucleosides, and regions (5' wing region and 3' wing region) containing unnatural nucleosides located on the 5'- and 3'-terminal sides of the central region. The length of the DNA gap region may be 4 to 16 bases, 5 to 14 bases, 6 to 12 bases, or 8 to 10 bases. The lengths of the 5' wing region and the 3' wing region may independently be 1 to 6 bases, 1 to 5 bases, or 2 to 4 bases. The 5' wing region and the 3' wing region may contain at least one unnatural nucleoside, and may also contain natural nucleosides. The 5' wing region and the 3' wing region may each contain one or more types of unnatural nucleosides. All nucleosides in the 5' and 3' wing regions may be unnatural nucleosides. Alternatively, the nucleosides at one or both of the 5' and 3' ends of the gapmer (particularly the 3' end) may be natural nucleosides (particularly deoxyribonucleosides). The unnatural nucleosides contained in the 5' and 3' wing regions may be nucleosides having a bicyclic sugar. The bicyclic sugar may be a sugar having a methyleneoxy (4'-CH2-O-2') bridge or an amide bridge (e.g., a 4'-C(O)-N(CH3)-2' bridge). The unnatural nucleosides contained in the 5' and 3' wing regions may contain modified nucleobases (e.g., 5-methylcytosine).
[0044] The ASO of the present application can be delivered into cells using any method commonly used in the art, such as lipofection, electroporation, microinjection, particle gun technology, and transduction using viruses or plasmids as vectors. Alternatively, the ASO can be directly transfected into cells. For example, the ASO can be suitably delivered into cells in vitro and in vivo using the CEM method (Nucleic Acids Research, 2015, Vol. 43, No. 19, e128; doi: 10.1093 / nar / gkv626).
[0045] The type of cancer is not particularly limited as long as it expresses CHMP4B. The cancer may be primary or metastatic. Examples of cancer include leukemia, lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, multiple myeloma, hematopoietic cell malignancies, floor of the mouth cancer, gingival cancer, tongue cancer, buccal mucosa cancer, salivary gland cancer, paranasal sinus cancer, head and neck cancer, brain tumor, breast cancer, uterine cancer, cervical cancer, ovarian cancer, esophageal cancer, gastric cancer, appendix cancer, colorectal cancer, liver cancer, gallbladder cancer, bile duct cancer, pancreatic cancer, kidney cancer, adrenal cancer, gastrointestinal stromal tumor, mesothelioma, thyroid cancer, lung cancer, osteosarcoma, bone cancer, prostate cancer, testicular tumor, bladder cancer, skin cancer, and anal cancer. In some embodiments, the cancer has undergone epithelial-mesenchymal transition. In some embodiments, the cancer is characterized by the expression of epithelial-mesenchymal transition (EMT)-related genes. Epithelial-mesenchymal transition-associated genes include, for example, CDH2, VIM, FN1, ZEB1, SNAIL, and TWIST. In one embodiment, the cancer is gastric cancer.
[0046] The present application also provides pharmaceutical compositions containing ASO together with any formulation adjuvant commonly used in the pharmaceutical field. As used herein, the formulation adjuvant may be any of a variety of pharmaceutically acceptable carriers or additives, such as carriers (solid or liquid carriers), excipients, stabilizers, disintegrants, surfactants, binders, lubricants, emulsifiers, suspending agents, antioxidants, flavoring agents, fillers, solubilizers, coating agents, coloring agents, flavoring agents, preservatives, and buffers. Specific formulation adjuvants include water, saline, other aqueous solvents, pharmaceutically acceptable organic solvents, mannitol, lactose, starch, microcrystalline cellulose, glucose, calcium, polyvinyl alcohol, collagen, polyvinylpyrrolidone, carboxyvinyl polymers, sodium alginate, water-soluble dextran, water-soluble dextrin, sodium carboxymethyl starch, pectin, gum arabic, xanthan gum, casein, gelatin, agar, propylene glycol, polyethylene glycol, petrolatum, paraffin, glycerin, stearyl alcohol, stearic acid, and sorbitol. The formulation adjuvants may be selected appropriately or in combination depending on the dosage form of the formulation.
[0047] As used herein, "treat" or "treatment" means reducing or eliminating the cause of a disease, slowing or halting its progression, and / or reducing, alleviating, ameliorating or eliminating its symptoms in a subject with the disease.
[0048] As used herein, "preventing" or "prevention" means preventing the onset of a disease or reducing the likelihood of developing a disease in a subject, particularly in a subject who is likely to develop the disease but has not yet done so, where onset of the disease includes recurrence.
[0049] Subjects for disease treatment or prevention include animals, typically mammals (e.g., humans, mice, rats, hamsters, rabbits, cats, dogs, cows, sheep, monkeys, etc.), and particularly humans.
[0050] The administration route of the composition is not particularly limited, and includes oral administration or parenteral administration. Various known administration forms can be adopted depending on the application site and the target disease. For example, parenteral administration may be systemic or local administration, and more specifically, examples include intratracheal administration, intrathecal administration, subarachnoid administration, intracranial administration, intravenous administration, intraarterial administration, intraportal vein administration, intradermal administration, subcutaneous administration, intramuscular administration, intraperitoneal administration, gastrointestinal administration, rectal administration, vaginal administration, transdermal administration, intranasal administration, oral administration, and direct administration to an organ. In some embodiments, the composition is administered intravenously, orally, or through the gastrointestinal tract.
[0051] Dosage forms include granules, fine granules, powders, coated tablets, tablets, suppositories, powders, capsules, microcapsules, chewable tablets, liquids, suspensions, emulsions, etc. Dosage forms that extend the release of the active substance may also be used. Dosage forms for injection or infusion include aqueous and non-aqueous injection solutions (which may contain antioxidants, buffers, bacteriostats, isotonic agents, etc.) and aqueous and non-aqueous injection suspensions (which may contain suspending agents, thickeners, etc.). These dosage forms may be provided as liquids in sealed ampoules or vials, or as lyophilized products that can be prepared by adding sterile liquids (e.g., water for injection) immediately before use. Injection solutions or suspensions may be prepared from powders, granules, or tablets.
[0052] The dosage and frequency of administration of the present composition can be determined by those skilled in the art based on the species of the animal to be administered, the health condition, severity of the disease, age, body weight, route of administration, dosage form, etc., so that an effective amount of the active ingredient is administered to the subject. For example, the present composition can be administered in a single dose or multiple doses, and may be administered to a subject several times or several tens of times, for example, at regular time intervals, such as 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, or 1 month. The effective amount in a given situation can be easily determined by routine experimentation and is within the skill and judgment of an ordinary clinician. For example, when the active ingredient is an ASO, the ASO may be administered in a dose of about 0.000001 mg / kg body weight to about 1000 mg / kg body weight, about 0.001 mg / kg body weight to about 1 mg / kg body weight, about 0.005 mg / kg body weight to about 0.5 mg / kg body weight, or about 0.01 mg / kg body weight to about 0.1 mg / kg body weight. Alternatively, the pharmaceutical composition of the present application may be administered continuously using a continuous infusion pump. The dosage (rate), duration, etc. of continuous administration can be appropriately determined by those skilled in the art.
[0053] The composition can be used alone or in combination with one or more additional active ingredients, particularly active ingredients for the treatment or prevention of cancer. "Combining" ingredients means not only the use of a dosage form containing all ingredients and the use of a combination of dosage forms containing each ingredient separately, but also the simultaneous, sequential, or delayed administration of each ingredient, as long as they are used for the treatment and / or prevention of cancer. Two or more additional active ingredients can also be used in combination.
[0054] ASO The present application also provides an ASO that suppresses expression of the CHMP4B gene. Examples of ASOs are as described above. In one embodiment, the ASO of the present application comprises or consists of a 13-24 nucleotide sequence complementary to the nucleotide sequence at positions 228-246, 278-304, 294-312, 615-633, 730-748, 748-766, or 753-771 in the nucleotide sequence set forth in SEQ ID NO: 41, or a nucleotide sequence in which 1-3, 1-2, or 1 nucleotide has been substituted, deleted, or inserted relative to said nucleotide sequence. In one embodiment, the ASO of the present application comprises or consists of a nucleotide sequence set forth in any of SEQ ID NOs: 1-20, or a nucleotide sequence in which 1-3, 1-2, or 1 nucleotide has been substituted, deleted, or inserted relative to said nucleotide sequence. In a further embodiment, the ASO of the present application comprises or consists of a base sequence selected from the group consisting of SEQ ID NOs: 21 to 40, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to the base sequence. In a further embodiment, the ASO of the present application comprises or consists of a base sequence selected from the group consisting of SEQ ID NOs: 47 to 55, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to the base sequence.
[0055] In particular, the ASO of the present application comprises or consists of a 13-24 nucleotide sequence complementary to the nucleotide sequence at positions 278 to 304 in the nucleotide sequence set forth in SEQ ID NO: 41, or a nucleotide sequence in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to said nucleotide sequence. Examples of such ASOs include those comprising or consisting of the nucleotide sequences set forth in SEQ ID NOs: 22 and 28 to 40, or nucleotide sequences in which 1 to 3, 1 to 2, or 1 nucleotide has been substituted, deleted, or inserted relative to said nucleotide sequence. Examples of such ASOs include ASOs consisting of the nucleotide sequences set forth in SEQ ID NOs: 22, 28 to 40, and 47 to 55, for example, an ASO consisting of the nucleotide sequence set forth in nucleotide sequence 49.
[0056] Treatment Methods The present application also provides a method for preventing or treating cancer in a subject, comprising administering to a subject in need thereof an ASO or pharmaceutical composition of the present application. The present application also provides an ASO of the present application for use in preventing or treating cancer. The present application also provides use of an ASO of the present application in the manufacture of a medicament for preventing or treating cancer.
[0057] The present invention will be explained in more detail below by showing examples, but the present invention is not limited to these examples in any way.
[0058] Example 1. Identification of Subtypes in Untreated Gastric Cancer Patients. One hundred and twenty-seven endoscopic biopsy specimens were collected from 73 untreated gastric cancer patients and frozen in liquid nitrogen within 20 seconds of collection. Proteins were extracted from the specimens, and cysteine residues were reduced with tris(2-carboxyethyl)phosphine. After alkylation with iodoacetamide, the specimens were digested with trypsin and lysyl endopeptidase. The digested peptides were labeled with Tandem mass tag (TMT) reagent. A portion of the peptides was enriched for TMT-labeled phosphopeptides using immobilized metal affinity chromatography (IMAC) and used for phosphoproteome analysis. The remaining TMT-labeled peptides were used for proteome analysis. The TMT-labeled phosphopeptides and TMT-labeled peptides were fractionated by reverse-phase chromatography and then subjected to high-sensitivity phosphoproteome analysis using mass spectrometry. An average of 21,000 phosphorylation sites were quantified, revealing that untreated gastric cancer patients could be classified into three subtypes. Of these, subtype 2 accounted for 15% of the total, and had low protein expression levels of E-cadherin (CDH1) and elevated protein expression of mesenchymal cell-related genes such as fibronectin (FN1) and vimentin (VIM), strongly showing characteristics similar to epithelial-mesenchymal transition (EMT) (Subtype 2 in Figure 1).
[0059] Next, we investigated the changes in gastric cancer subtypes following treatment using the proteomic analysis method described in Example 1. After first-line chemotherapy with S-1 plus CDDP / L-OHP, endoscopic biopsy specimens were collected before second-line treatment, during second-line treatment, and at the time of progression. Based on the results of proteomic analysis, we compared the expression levels of epithelial cell-related genes (CDH1 and OCLN) and mesenchymal cell-related genes (VIM and FN1) (Figures 2 and 3). Compared with untreated and pre-secondary treatment, the expression levels of epithelial cell-related genes tended to decrease during second-line treatment and at the time of progression, while the expression levels of mesenchymal cell-related genes tended to increase.
[0060] In addition, we performed gene set enrichment analysis (GSEA) using proteomic analysis data obtained from biopsy specimens of gastric cancer patients who were untreated, before second-line therapy, during second-line therapy, and at progression (Figure 4). The results showed a tendency for increased expression of epithelial-mesenchymal transition-related genes during second-line therapy (Figure 4, On) and at progression (Figure 4, PD) compared with before second-line therapy (Figure 4, Pre). These results indicate that the proportion of gastric cancer subtypes with epithelial-mesenchymal transition (EMT)-like characteristics increased over the course of treatment.
[0061] Example 2. Identification of therapeutic targets specific to epithelial-mesenchymal transition (EMT)-like gastric cancer To identify gastric cancer cell lines with epithelial and mesenchymal characteristics, we performed the proteome and phosphoproteome analysis described in Example 1 on 41 gastric cancer cell lines. Based on the expression profiles of the epithelial cell marker CDH1 and the mesenchymal cell marker CDH2, MKN7, NCI-N87, SNU719, SNU16, MKN-74, and HuG1-N were identified as gastric cancer cell lines with strong epithelial cell characteristics, and SNU1, 58Asg, LMSU, ECC12, HS746T, SH-10-TC, and FU97 were identified as cell lines with strong mesenchymal cell characteristics (Figure 5).
[0062] Next, we retrieved CRISPR-Cas9 screening data from the Depmap database for each selected gastric cancer cell line and performed a comparative analysis of gene dependency between epithelial and mesenchymal cell groups. As a result, we identified the Chmp4B gene as a potential therapeutic target whose knockout specifically suppressed cell proliferation in cells with mesenchymal characteristics (Figures 6 and 7). The gene dependency of Chmp4B on mesenchymal cells was significantly stronger and more specific than that of transcription factors such as the Zeb family, Sanil, and Twist, and kinases such as AXL and SRC, which are potential therapeutic targets for mesenchymal cells.
[0063] Based on these findings, we have identified three subtypes of gastric cancer in untreated patients using highly sensitive phosphoproteome analysis. Furthermore, we found that one of these subtypes exhibits strong epithelial-mesenchymal transition (EMT)-like characteristics, and its proportion increases after chemotherapy. Furthermore, we identified the Chmp4B gene as a potential therapeutic target specific to the EMT-like gastric cancer subtype.
[0064] Example 3. Selection of ASO Candidate Sequences 1. When selecting ASO candidate sequences, the basic structure of the ASO was established. The total length was 18 bases, with artificial nucleic acid regions located at six positions: three from the 5' end and three from the 3' end, with natural nucleic acid regions located between them. The artificial nucleic acid was LNA, improving affinity with the target mRNA. The artificial nucleic acid region used 5-methylcytosine instead of the cytosine found in natural nucleic acids. Furthermore, the phosphate moiety contained a phosphorothioate bond instead of the phosphodiester bond found in natural nucleic acids, improving enzyme resistance.
[0065] 2. To select ASO candidates targeting the CHMP4B mRNA sequence NM_176812.5 (SEQ ID NO: 41), candidate sequences were first extracted, one base at a time from the 5' end, to a length of 18 bases. As a result, approximately 1,600 candidate sequences were obtained.
[0066] 3. Next, we selected ASOs that recognize regions predicted to form loop structures based on the secondary structure prediction of CHMP4B mRNA, resulting in the selection of 220 candidate sequences.
[0067] 4. Furthermore, the antisense strand sequences were obtained from the selected sequence candidates, and 36 candidate sequences were selected based on the physical properties of the ASO, such as GC content, double-strand formation ability, and whether the ASO itself forms a higher-order structure.
[0068] 5. Subsequently, sequences with a high risk of off-targeting were excluded, and seven candidate sequences were selected (Table 1). ASO molecules were then designed and synthesized based on these sequences. In the examples of this disclosure, the internucleoside linkages (phosphodiester linkages, phosphorothioate linkages) and chemical modifications applied to the sugar moiety are as follows: In the formula, B represents a base.
[0069] Here, "5" indicates 5-methylcytosine; "(L)" indicates that the sugar moiety is LNA; and "^" indicates that the internucleoside bond is a phosphorothioate bond.
[0070] 6. As a negative control, a control ASO, L2, designed not to bind to any known genes, was also synthesized in the same manner (Table 2). Here, "5" indicates 5-methylcytosine; "(L)" indicates that the sugar moiety is LNA; and "^" indicates that the internucleoside bond is a phosphorothioate bond. 7. The ASO was synthesized according to a method commonly used in the art.
[0071] Example 4 Screening Based on the Effect of Inhibiting CHMP4B mRNA Expression 1. Human adenocarcinoma-derived lung cancer cell line A549 (obtained from the JCRB Cell Bank of the National Institutes of Biomedical Innovation, Health and Nutrition) was cultured at 37°C under 5% CO2 in a medium containing DMEM (Nacalai Tesque, Low-Glucose) supplemented with 10% fetal bovine serum (FBS, Biowest) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque, Stabilized), and was seeded at a concentration of 2,500 cells / 50 μL per well into a 96-half-well plate containing 10% FBS-containing DMEM and cultured at 37°C under 5% CO2 for 24 hours.
[0072] 2. Cell transfection was performed using the CEM method (S. Hori, S. Obika et al. Nucleic Acids Res. 2015, 43, e128.). Specifically, 900 mM calcium chloride was added to 10% FBS-containing DMEM to achieve a 100-fold dilution, and the synthesized ASO was then added to a final concentration of 50 nM. The cells were then cultured at 37°C under 5% CO2 for an additional 24 hours.
[0073] 3. Extract the transfected cells using the Cell Lysis & RT Kit (TOYOBO Super Prep TM RNA was extracted using a Cell Lysis & RT Kit for qPCR and reverse transcribed into cDNA.
[0074] 4. Use ABI PowerUp to analyze the obtained cDNA. TM SYBR TM Real-time PCR (RT-PCR) was performed using Green Master Mix and the following primers (200 nM each): TMPCR was performed using a PCR system (Real-Time PCR System) under the following conditions: 95°C for 20 seconds, followed by 45 cycles of 95°C for 3 seconds and 60°C for 30 seconds. GAPDH forward primer: GAGTCAACGGATTTGGTCGT (SEQ ID NO: 43) GAPDH reverse primer: GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 44) CHMP4B forward primer: ACCGAGGTGCTCAAGAACATG (SEQ ID NO: 45) CHMP4B reverse primer: CTGTTGAAATCTCCTCTGCAAG (SEQ ID NO: 46)
[0075] 5. The relative expression level of CHMP4B mRNA was calculated from the measured values of CHMP4B mRNA and GAPDH mRNA (control) (Figure 7). All seven synthesized ASOs suppressed CHMP4B mRNA expression. In particular, four ASOs, ASO2, ASO4, ASO6, and ASO7, significantly suppressed CHMP4B mRNA expression.
[0076] 6. Next, we evaluated the concentration dependency of four types of ASOs that specifically suppressed CHMP4B mRNA expression.
[0077] 7. Among the conditions 1. to 5., the final concentration of ASO was changed to three points: 12.5 nM, 50 nM, and 200 nM, and evaluation was performed.
[0078] 8. As a result, it was demonstrated that the tested ASOs suppressed CHMP4B mRNA expression in a concentration-dependent manner (Figure 8, top panel).
[0079] In addition, among the conditions described in 1 and 2, the final concentration of ASO2 was changed to 12.5 nM, 50 nM, and 200 nM, and the viable cell count was assessed after 48 hours of culture. Specifically, after 48 hours of culture, WST-1 reagent (Roche) was added according to the recommended protocol, and the viable cell count was quantified by measuring the absorbance at 450 nm using a plate reader (GloMax® EXPLORER, Promega) (Figure 8, bottom panel). ASO2 was confirmed to have an inhibitory effect on the proliferation of cancer cell lines.
[0080] Example 5. Optimization of ASOs 1. For ASO2, whose favorable effects were confirmed in the above-mentioned screening test, 13 types of ASOs were designed and synthesized by varying the length and position of the natural nucleic acid region while fixing the number of artificial nucleic acids introduced (Table 3). Here, "5" indicates 5-methylcytosine; "(L)" indicates that the sugar moiety is LNA; and "^" indicates that the internucleoside bond is a phosphorothioate bond.
[0081] 2. The synthesized ASOs were examined for their inhibitory effects on the in vitro proliferation of cancer cells, Hs 746T and LMSU cells. ASOs were added to each cell line, and after 72 hours of incubation, the number of viable cells was quantified using CellTiter-Glo reagent. Although the results varied depending on the cell line used, each ASO demonstrated inhibitory effects on the proliferation of cancer cell lines (Figures 9–35).
[0082] 3. We investigated the inhibitory effect of ASO2 on the in vitro proliferation of cancer cells Hs746T, LMSU, SH-10-TC, SNU5, and MKN1. The results showed that ASO2 had an inhibitory effect on the proliferation of cancer cell lines (Figure 36). Furthermore, this inhibitory effect correlated with the EMT score calculated from the expression levels of mesenchymal cell markers.
[0083] Example 6. Design of ASOs with various chemical modification patterns ASO13 was selected based on the results of Example 5. Nine types of sequences with different chemical modification patterns were designed and synthesized based on ASO13.
[0084]
[0085] In Table 4, "5" indicates 5-methylcytosine. "(L)" indicates that the sugar moiety is LNA; "(Y)" indicates that the sugar moiety is AmNA. "(M)" indicates that the sugar moiety is 2'-MOE. "(m)" indicates that the sugar moiety is 2'-OMe. "^" indicates that the internucleoside bond is a phosphorothioate bond. "o" indicates that the internucleoside bond is a phosphodiester bond.
[0086] Test for CHMP4B mRNA Expression Inhibitory Effect The CHMP4B mRNA expression inhibitory effect of each synthesized ASO was examined using the same method as in Example 4. 1. Human adenocarcinoma-derived lung cancer cell line A549 (obtained from the JCRB Cell Bank of the National Institutes of Biomedical Innovation, Health and Nutrition) cultured at 37 ° C. and 5% CO2 in a medium containing DMEM (Nacalai Tesque, Low-Glucose) supplemented with 10% fetal bovine serum (FBS, Biowest) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque, Stabilized) was seeded at a concentration of 1,500 cells / 50 μL per well into a 96-half-well plate containing 10% FBS-containing DMEM and cultured at 37 ° C. and 5% CO2 for 24 hours.
[0087] 2. Cells were transfected using the CEM method (S. Hori, S. Obika et al. Nucleic Acids Res. 2015, 43, e128.). Specifically, 900 mM calcium chloride was added to 10% FBS-containing DMEM to achieve a 100-fold dilution, and then the synthesized antisense oligonucleotides (ASOs) were added to final concentrations of 12.5 nM, 50 nM, or 200 nM. The cells were then cultured at 37°C under 5% CO2 for an additional 24 hours.
[0088] 3. Extract the transfected cells using the Cell Lysis & RT Kit (TOYOBO Super Prep TM RNA was extracted using a Cell Lysis & RT Kit for qPCR and reverse transcribed into cDNA.
[0089] 4. The obtained cDNA was analyzed using ABI PowerUp TM SYBR TM Real-time PCR (qPCR) was performed using Green Master Mix and the following primers (200 nM each): TMPCR was performed using a PCR Real-Time PCR System under the following conditions: 95°C for 20 seconds, followed by 45 cycles of 95°C for 3 seconds and 60°C for 30 seconds. GAPDH forward primer: GAGTCAACGGATTTGGTCGT (SEQ ID NO: 43) GAPDH reverse primer: GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 44) CHMP4BP forward primer: GCTCAAGAACATGGGCTATGC (SEQ ID NO: 56) CHMP4BP reverse primer: TGCTGTTGAAATCTCCTCTGC (SEQ ID NO: 57)
[0090] 5. The relative expression level of CHMP4B mRNA was calculated from the measured values of the expression levels of CHMP4B mRNA and GAPDH mRNA (control). The results are shown in Figure 37. 6. As shown in Figure 37, the ASOs with altered chemical modification patterns tested were confirmed to suppress CHMP4B mRNA expression in a concentration-dependent manner, similar to the control ASO13.
Claims
1. A pharmaceutical composition for treating cancer, comprising a substance that suppresses the expression of CHMP4B.
2. The pharmaceutical composition according to claim 1, wherein the substance that inhibits the expression of CHMP4B is an antisense oligonucleotide.
3. The pharmaceutical composition according to claim 2, wherein the antisense oligonucleotide comprises or consists of a 13-24 base sequence complementary to the base sequence at positions 228-246, 278-304, 294-312, 615-633, 730-748, 748-766, or 753-771 in the base sequence shown in SEQ ID NO: 41, or a base sequence in which 1-3, 1-2, or 1 base has been substituted, deleted, or inserted relative to said base sequence.
4. The pharmaceutical composition according to claim 3, wherein the antisense oligonucleotide comprises or consists of a base sequence selected from the group consisting of SEQ ID NOs: 1 to 20, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to said base sequence.
5. The pharmaceutical composition according to any one of claims 2 to 4, wherein at least one nucleotide in the antisense oligonucleotide is a 2',4'-bridged nucleotide.
6. The pharmaceutical composition according to claim 5, wherein the first to third nucleotides from the 5' end and the first to third nucleotides from the 3' end of the antisense oligonucleotide are 2',4'-bridged nucleotides.
7. The pharmaceutical composition according to claim 5 or 6, wherein the 2',4'-bridged nucleotide is LNA.
8. A pharmaceutical composition according to any one of claims 5 to 7, wherein the cytosine base in the 2',4'-bridged nucleotide is a 5-methylcytosine base.
9. A pharmaceutical composition according to any one of claims 2 to 8, wherein at least one cytosine base in the antisense oligonucleotide is a 5-methylcytosine base.
10. The pharmaceutical composition according to any one of claims 2 to 9, wherein at least one internucleoside linkage in the antisense oligonucleotide is a phosphorothioate linkage.
11. The pharmaceutical composition of claim 10, wherein all internucleoside linkages in the antisense oligonucleotide are phosphorothioate linkages.
12. A pharmaceutical composition according to any one of claims 4 to 11, wherein the antisense oligonucleotide comprises or consists of a base sequence selected from the group consisting of SEQ ID NOs: 21 to 40 and 47 to 55, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to said base sequence.
13. The pharmaceutical composition according to any one of claims 2 to 12, wherein the antisense oligonucleotide is 16 to 19 bases in length.
14. The pharmaceutical composition according to claim 13, wherein the antisense oligonucleotide consists of a base sequence selected from the group consisting of SEQ ID NOs: 1 to 40 and SEQ ID NOs: 47 to 55.
15. The pharmaceutical composition according to claim 3, wherein the antisense oligonucleotide comprises a 13 to 24 base sequence complementary to the base sequence from positions 278 to 304 in the base sequence shown in SEQ ID NO: 41, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to said base sequence.
16. The pharmaceutical composition of claim 15, wherein the antisense oligonucleotide comprises or consists of the base sequence of SEQ ID NO: 22, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to said base sequence.
17. The pharmaceutical composition of claim 16, wherein the antisense oligonucleotide is selected from the group consisting of SEQ ID NOs: 22, 28-40, and 47-55.
18. The pharmaceutical composition according to any one of claims 1 to 17, wherein the cancer is gastric cancer.
19. The pharmaceutical composition of claim 18, wherein the gastric cancer is characterized by expression of EMT-related genes.
20. Antisense oligonucleotide that suppresses expression of the CHMP4B gene.
21. The antisense oligonucleotide according to claim 20, comprising or consisting of a 13 to 24 base sequence complementary to the base sequence at positions 228 to 246, 278 to 304, 294 to 312, 615 to 633, 730 to 748, 748 to 766, or 753 to 771 in the base sequence set forth in SEQ ID NO: 41, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to said base sequence.
22. The antisense oligonucleotide of claim 21, comprising or consisting of a base sequence selected from the group consisting of SEQ ID NOs: 1 to 20, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to said base sequence.
23. The antisense oligonucleotide of any one of claims 20 to 22, wherein at least one nucleotide is a 2',4'-bridged nucleotide.
24. The antisense oligonucleotide of claim 23, wherein the first to third nucleotides from the 5' end and the first to third nucleotides from the 3' end are 2',4'-bridged nucleotides.
25. The antisense oligonucleotide of claim 23 or 24, wherein the 2',4'-bridged nucleotide is LNA.
26. The antisense oligonucleotide of any one of claims 20 to 25, wherein at least one cytosine base is a 5-methylcytosine base.
27. The antisense oligonucleotide of any one of claims 23 to 26, wherein the cytosine bases in the first to third nucleotides from the 5' end and the first to third nucleotides from the 3' end of the antisense oligonucleotide are 5-methylcytosine bases.
28. The antisense oligonucleotide of any one of claims 23 to 27, wherein at least one internucleoside linkage is a phosphorothioate linkage.
29. The antisense oligonucleotide of claim 28, wherein all internucleoside linkages are phosphorothioate linkages.
30. An antisense oligonucleotide according to any one of claims 21 to 28, comprising or consisting of a base sequence selected from the group consisting of SEQ ID NOs: 21 to 40 and 47 to 46, or a base sequence in which 1 to 3, 1 to 2, or 1 base has been substituted, deleted, or inserted relative to said base sequence.
31. The antisense oligonucleotide of any one of claims 16 to 30, which is 16 to 19 bases in length.
32. The antisense oligonucleotide according to claim 31, which consists of a base sequence selected from the group consisting of SEQ ID NOs: 21 to 40 and SEQ ID NOs: 47 to 55.