Hybrid synthetic biology and chemistry based production systems for sustainable chemicals and transportation fuels

Abstract

The present invention relates generally to production methods, enzymes, recombinant microorganism and strains for the biosynthesis of monocyclic aromatic compounds and their chemical transformation into further valuable compounds that can be used in the sustainable chemicals industry and in renewable transportation fuels.

Description

HYBRID SYNTHETIC BIOLOGY AND CHEMISTRY BASED PRODUCTION SYSTEMS FOR SUSTAINABLE CHEMICALS AND TRANSPORTATION FUELSTECHNICAL FIELD

[0001] The present invention relates generally to production methods, enzymes, recombinant host strains, e.g., yeast strains, and catalytic chemistry for the hybrid biosynthesis and semi-synthetic production of important bio-based chemicals, including renewable transportation fuels.BACKGROUND

[0002] The element carbon has been described as the backbone of all life on Earth, which is clearly apparent in the multitude of both small and large molecules that are the major dynamic components of the energetics and structures of all living organisms on the planet. Accordingly, because of the essential nature of carbon to life on Earth, the carbon cycles that occur in the atmosphere, on the surface of the Earth, and in oceans and freshwater systems are important, and even critical to the stable existence of all of life forms on the planet. The huge recent expansion of the human population and the use of carbon, not only for human life-cycle processes, but for life-supporting heating, buildings, clothing, and other essential goods, together with transportation needs, has led inevitably to environmental problems associated with the release and disposal of spent carbon-based products. Much of the current disposal problems are a consequence of the continued mining of ancient fossil carbon as coal, natural gas or petroleum that, despite their having tremendous beneficial effects for human existence, survival and prosperity, has greatly increased the human input into the carbon-cycles on Earth, and has perturbed them measurably. Accordingly, there exists a very large unmet need to reduce or eliminate further fossil carbon-derived human waste to avoid further perturbation of these carbon-cycles. In addition, there is a need to make the entire chemical industry cleaner and less reliant on petroleum-based feedstocks.SUMMARY

[0003] In one aspect this disclosure describes a process for providing a first product comprising cyclic hydrocarbon compounds. The process comprises reacting 3 -methylanisole with hydrogen at a temperature between about 25° C and about 500° C and a hydrogen pressure between about 1 bar and about 100 bar in the presence of a first catalyst to provide a first product comprising cyclic hydrocarbon compounds.

[0004] The first product comprising cyclic hydrocarbon compounds comprises one or more compounds taken from the group comprising; methyl anisoles, cresols, xylenes, xylenols, benzene, toluene, xylene mixtures, cis,trans-l ,4-dimethylcyclohexane, cz's, trans-3-methylmethoxycyclohexane, cyclic alkanes, and methylcyclohexane .

[0005] In some aspects, the 3 -methylanisole used in the process to provide a first product is obtained from off-gasses of yeast fermentation. The 3 -methylanisole may be captured in molecular sieves. The molecular sieves may separate the 3 -methylanisole from water. A pore size of the molecular sieves maybe between about 2A and about 12A. The diameter of the molecular sieves may be about 5 A or about 10A.

[0006] In another aspect, the disclosure describes a process for providing a second product comprising cyclic hydrocarbon compounds. The process comprises reacting any of the first product with hydrogen at a temperature between about 25° C and about 500° C and a hydrogen pressure between about 1 bar and about 100 bar in the presence of a second catalyst to provide a second product comprising cyclic hydrocarbon compounds.

[0007] The first catalyst and / or the second catalyst may comprise a mixed metal oxide, a supported transition metal, a supported noble metal, functionalized tetrafluoroethylene-fluoropolymer copolymer, calcium apatite, silica-alumina, silica, titania, zeolite, sulfated zirconia, tungstated zirconia, alumina, or mixtures thereof.

[0008] The transition metal or noble metal may be lanthanum, magnesium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, zirconium, molybdenum, niobium, ruthenium, rhodium, silver, tin, tungsten, tantalum, iridium, platinum, gold or mixtures thereof.

[0009] The process may further include addition of a co-reactant wherein the co-reactant is an alternate hydrogen donor, methanol, alkyl alcohols, ethers, aromatic compounds, organic or inorganic acids, aldehydes, esters or combinations thereof.

[0010] In one aspect, provided herein are modified recombinant host cells, yeast strains, engineered for cyclic hydrocarbon compound expression and volatilization from the yeast broth, downstream processing of products and their catalytic conversion to further desirable renewable chemicals. In some embodiments, the host cells are genetically modified to express one or more exogenous polynucleotides that encode a 6-MSAS enzyme that utilizes an acetyl-CoA starter unit and three malonyl-CoA extender units to synthesize 6-MSA / HMBA (FIG. 1).

[0011] Such host cells may also be genetically modified to express further enzymes that sequentially catalyze the decarboxylation of 6-MSA / HMBA to a meta-cresol intermediate followed by methylation of this intermediate to 3 -methylanisole (3-MA). 3-MA volatilizes from the fermentation media and can be captured and derivatized to a wide variety of important and valuable bio-based sustainable chemicals, chemical intermediates, fuels, or fuel components. 3-MA may be captured from the fermenter using techniques known in the art such as, but not limited to, adsorption, condensation, cryogenic methodologies, and membrane-based separation / capture.BRIEF DESCRIPTION OF THE DRAWINGS

[0012] FIG. 1 depicts the biosynthetic pathway to 3-MA from sugars or cellulosic feedstocks via an acetyl-CoA starter unit and three malonyl-CoA extender molecules, catalyzed by the enzyme 6-MSAS. The 6-MSA / HMBA is a short-lived intermediate that is decarboxylated to the also short-lived intermediate m-cresol in vivo. The final in vivo step to 3-MA is implemented by an O-methyltransferase and the cofactor S-adenosylmethionine, leading to 3-MA that volatilizes immediately from the fermentation broth.

[0013] FIG. 2A depicts a representative HPLC profile of pure biologically derived 3-MA that was volatilized and captured from the headspace of a fed-batch fermentation of a .S', cerevisiae strain that was engineered to produce 3-MA from glucose. A 50mL syringe was used to extract 30mL of the headspace gases via a septum port on the fermenter. This was dissolved in situ in ImL of isopropanol and injected directly onto a reverse phase HPLC column.

[0014] FIG. 2B demonstrates the purity of volatilized 3-MA that was adsorbed to 10A molecular sieves and eluted with isopropanol.

[0015] FIG. 3 depicts the wealth of cyclic hydrocarbon compounds, and further derivatives that are accessible directly from bio-based 3-MA. Reduction may be carried out with hydrogen or hydrogen equivalents. Prominent among these compounds with respect to current global usage volumes are p- xylene and toluene. Total fossil-based carbon reduction potential for these, and other aromatics, as well as cycloalkanes such as MCH, and other related compounds, when aggregated globally, is extremely significant.

[0016] FIG. 4 depicts chemical conversion pathways from 3-MA, and / or MCH or 3-MA via MCH to substituted (in some products, heavily substituted) cyclohexanes using Friedel-Crafts-like acylation with alcohols, preferably bio-based, such as biomethanol, bioethanol, bioisobutanol, bioisoprenol, and also with bioisoprenyl acetate and bio-based alkenes such as bioisobutylene and bioisoprene or alcohols subjected to water elimination. Catalysts for this process can be strong mineral acids or zeolites as well as traditional Bronsted Lewis acids.

[0017] FIG. 5 depicts chemical conversions of 3-MA, and / or MCH or 3-MA via MCH to further important sustainable fuel molecules, such as cyclopentanes and linear or branched 7-carbon aliphatic molecules (adapted from Phuong DT, et al., Catalysis 20 (2007): 33-64). Toluene is also included here to emphasize its growing role along with MCH in a catalytically reversible liquid organic hydrogen carrier (LOHC) system, and that system’s growing use in the hydrogen transport economy.

[0018] FIG. 6 depicts chemical conversion pathways from 3-MA, and / or MCH or 3-MA via MCH to high energy sustainable bicyclic dimer cycloalkanes that are in the medium to high carbon-number range of cycloalkanes found in jet fuels.

[0019] FIG. 7 depicts chemical conversions of 3-MA, and / or MCH or 3-MA via MCH to additional high energy sustainable bicyclic dimer cycloalkanes of the bridgehead fused and bridged bicyclic groups of molecules, under Diels-Alder reaction conditions. Such compounds are in the medium to high carbon- number range of cycloalkane-type molecules found in jet fuels.

[0020] FIG. 8 depicts chemical conversions of 3-MA, and / or MCH or 3-MA via MCH to further high energy sustainable bicyclic dimer cycloalkanes of the decalin family of molecules. Such molecules, obtained by reaction of the precursors with sustainable isoprene, under Diels-Alder reaction conditions are in the middle to higher ranges of cycloalkanes found in current jet fuels.

[0021] FIG. 9 depicts chemical conversions of 3-MA and / or MCH to mixed cycloalkane / isoalkane and branched isoalkane molecules through hydrocracking reactions using bifunctional catalysts, including acid zeolite catalysts, and hydrogen.

[0022] FIG. 10 depicts chemical conversions of meta-cresol to compounds in further rapidly growing chemical and consumer product economies. Examples here include the vitamin E and menthol global markets, in addition to well-established insecticide and antioxidant markets (adapted from Wang, W. et al., Applied Microbiology and Biotechnology 105 (2021): 6333 - 6343). Afeta-cresol can also be isomerized to its isomers ortho- and para-cresols that, individually, can replace or open up further pathways to additional bio-based products that replace petroleum-based counterparts.

[0023] FIG. 11 depicts representative examples of gas chromatographic standards and catalytic reaction products (a), Standards containing cis, trans-dimethylcyclohexane (DMCH), and p-Xylene (0.2uL of O.lmg / mL each), (b), Reaction of p-xylene to give civ, t a / z. - DMCH in almost quantitative yield, (c), Standards containing MCH, Toluene, DMCH isomers, p-Xylene and 3-MA, (also 0.2uL of O.lmg / mL each), (d), Reaction of 3-MA to give p-Xylene. (e), Reaction of 3-MA to MCH in 72% yield. Also observed here are the cis, trans isomers of the intermediate 3-methylcyclohexanol. In some cases, residual pentane can be observed following washing of the injector with pentane.DETAILED DESCRIPTION DEFINITIONS

[0024] When referring to the compounds, compositions and methods provided herein, the following terms have the following meanings unless indicated otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art. In the event that there is a plurality of definitions for a term herein, those in this section prevail unless stated otherwise.

[0025] The term “a,” “an,” and “the” means “at least one” unless the context clearly indicates otherwise. Use of the plural herein includes the singular unless the context clearly indicates otherwise. For example, “articles” would refer to one article as well as two or more articles unless the context clearly indicates otherwise.

[0026] Where elements of the disclosure, such as chemical compounds or intermediates, are presented in list format, it is understood that each possible subgroup of the elements is also disclosed, and any one or more elements can be removed from the list or group.

[0027] It is further understood that the disclosure of a numerical range is a specific disclosure of all the possible subranges and all the possible individual numbers (whether whole numbers or fractions) within that range regardless of the breadth of that range.

[0028] It is also understood that, unless clearly indicated to the contrary, in any method described or claimed herein that includes more than one act or step, the order of the acts or steps of the method is not necessarily limited to the order in which the acts or steps of the method are recited, but the disclosure encompasses embodiments in which the order is so limited.

[0029] It is further understood that, in general, where an embodiment in the description or the claims is referred to as comprising one or more features, the disclosure also encompasses embodiments that consist of, or consist essentially of, such feature(s).

[0030] It is also understood that any embodiment of the disclosure, e.g., any embodiment or compound found within the prior art, can be explicitly excluded from the claims, regardless of whether or not the specific exclusion is recited in the specification.

[0031] It is further understood that the present disclosure encompasses salts, solvates, hydrates, isotopes, clathrates, and polymorphs of all of the compounds disclosed herein. The specific recitation of “salts”, “isomers”, “cis-”, or “trans-” with respect to a compound or a group of compounds in certain instances of the disclosure shall not be interpreted as an intended omission of any of these forms in other instances of the disclosure where the compound or the group of compounds is mentioned without recitation of any of these forms, unless stated otherwise or the context clearly indicates otherwise.

[0032] In some embodiments, the term “about” or “approximately” means within + 10% or 5% of the given value. Whenever the term “about” or “approximately” precedes the first numerical value in a series of two or more numerical values or in a series of two or more ranges of numerical values, the term “about” or “approximately” applies to each one of the numerical values in that series of numerical values or in that series of ranges of numerical values.

[0033] Whenever the term “at least” or “greater than” precedes the first numerical value in a series of two or more numerical values, the term “at least” or “greater than” applies to each one of the numerical values in that series of numerical values.

[0034] Whenever the term “no more than” or “less than” precedes the first numerical value in a series of two or more numerical values, the term “no more than” or “less than” applies to each one of the numerical values in that series of numerical values.

[0035] As used herein, the term “bio-based compound” or “bio-based molecule” refer to chemical entities that are biologically produced from microorganisms, in particular, genetically modified microorganisms, by fermentation of renewable carbon sources such as C5 and / or Ce sugars.

[0036] As used herein, the term “a hydrocarbon compound derived from bio-based 3 -methylanisole or bio-based 3-MA” refers to a compound comprising organic material consisting of carbon, hydrogen and in some cases oxygen, that is produced from bio-based 3-MA by catalytic reaction, chemical reaction, thermal reaction, electrochemical reaction, hydrogenation, hydrodeoxygenation, hydrocracking or any combination thereof.

[0037] 3 -Methylanisole or 3-MA refers to a compound having the structure shown above and in FIGS. 1, 3, 5, 6, 7, 8 and 9.

[0038] C2, C5, Ce, C7, Cs, C10, C12, and C14 through C22 compounds refer to chemical compounds that contain 2, 5, 6, 7, 8, 10, 12 and 14 through 22 carbons, respectively. In some cases, and in particular, for C2 (ethanol), C5 (xylose and related sugar feedstocks) and Ce (glucose, galactose, cleaved lactose and related sugar feedstocks) these compounds may also contain oxygen atoms.

[0039] “MCH” or “methylcyclohexane” refers to the major product of hydrodeoxygenation of bio-based 3-MA whose structure is shown in FIGS. 3, 4, 5, 6, and 7.

[0040] Dienophile refers to an olefinic component (such as a cyclic intermediate) that is seeking a diene in the Diels-Alder reaction.

[0041] As used herein, % with reference to hydrocarbon compositions refers to % measured as wt. % or as area % by GC-MS and / or HPLC.

[0042] The term “renewable carbon” or “sustainable carbon” source refers to a carbon source that is incorporated into biomass fermentation feedstocks, primarily from atmospheric carbon dioxide, which can be reabsorbed within several months, years or decades without adding to the atmospheric carbon load caused by the ubiquitous use of fossil carbon-based fuels, etc. The terms “renewable carbon,” “sustainable carbon” and “bio-based carbon” are used interchangeably herein. “Atmospheric carbon” refers to carbon atoms from natural carbon cycles and / or carbon dioxide molecules that have been freed into earth's atmosphere recently, e.g., in the most recent few decades. For example, bio-based chemical compounds used in any one of the embodiments described herein can be made from microorganisms, including bioengineered microorganisms, using a renewable carbon source.

[0043] While various embodiments of the present disclosure are described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous modifications and changes to, and variations and substitutions of, the embodiments described herein will be apparent to those skilled in the art without departing from the disclosure. It is understood that various alternatives to the embodiments described herein can be employed in practicing the disclosure. It is also understood that every embodiment of the disclosure can optionally be combined with any one or more of the other embodiments described herein which are consistent with that embodiment.DESCRIPTION

[0044] The present invention provides methods and materials for producing sustainable aromatic molecules, cycloalkanes, isoalkanes and related compounds of interest in a rapid, inexpensive, and efficient manner. Since such compounds are made from natural, sustainable bio-based feedstocks, the present invention satisfies a wealth of commercial and, of further importance, environmentally sensitive industrial needs.

[0045] Increased fossil-derived atmospheric carbon, almost exclusively in the form of carbon dioxide, can be reutilized sustainably by a number of methods that have great promise to fulfil the unmet need of stabilization of carbon cycles at close to current or even pre-industrial levels. One such method, with a successful track record, is the production of ethanol from numerous naturally sourced feedstocks. As opposed to simply sequestering CO2 from the atmosphere, the bioethanol industry has demonstrated that CO2 and biomass can be recycled as a useful transportation product, ethanol, leading to close to zero net emissions of fossil carbon as carbon dioxide via internal combustion engine (ICE) exhaust gases. Furthermore, various chemical methodologies have been used to convert ethanol to additional chemicals and fuels, including aviation fuel. Such bio-based jet fuel is referred to as sustainable aviation fuel (SAF).

[0046] Biologically sourced ethanol, however, because of its hydrophilicity and other distinct physicochemical differences from gasoline and other hydrocarbon fuels, is generally considered to be a sub-optimal gasoline blending agent. Its hydrophilicity is known to induce the accumulation of water ingasoline, thereby causing major problems with pipelines and tankage, and a requirement for blending with gasoline immediately prior to its use.

[0047] In addition to the drawbacks of high ethanol content in gasoline, numerous energy-intensive steps are required for its conversion to sustainable aviation fuel. Technologies for the conversion of ethanol to jet fuels suffer from a number of additional drawbacks. First, jet fuels in general are comprised of carbon compounds mainly in the Cs-Cu range, with internationally used fuel specifications leading to various compositions of alkanes, isoalkanes, cycloalkanes and aromatics that contain virtually zero oxygen (see, e.g., Lahijani et al., 2022, Energy Conversion and Management 268, 115956). Because ethanol is a C2 compound that contains a high proportion of oxygen, its conversion to higher-length carbon backbone jet fuel requires dehydration, oligomerization, and further hydrogenation. Modern synthetic biology, however, has now provided the means to use fermentation technologies to produce more advanced jet fuel precursors that are already in the Cv / Cs range, requiring only dimerization, hydrocracking, reforming and the like, to be within the branched carbon chain length or ring size for all the components of jet fuel. Such compounds are more similar or identical to currently used jet fuel components and have much greater energy densities than ethanol. Furthermore, such molecules can also be used in numerous important industrial chemical processes, as well as in commercial and personal land transportation, and hydrogen transport sectors.

[0048] Synthetic biology, whereby products of interest are biosynthesized using isolated, often totally heterologous genetic pathways in engineered microorganisms, offers potential solutions to the large-scale commercial manufacturing problems of many very large volume compounds where sustainability would be highly desirable.

[0049] One major class of molecules that are currently recalcitrant to high level sustainable production technologies are bio-based monocyclic aromatic compounds. This class includes compounds such as toluene and other substituted benzenes including xylenes, xylenols, phenols, anilines, benzoic and other phenolic acids, cresols, anisoles and methylanisoles, that have many diverse and very high volume uses. Furthermore, catalytic processes have been shown to readily convert such molecules to cycloalkanes and their derivatives, a class of compounds that, for example, currently represent major constituents of aviation fuels and gasolines.

[0050] Approximately half of chemical compounds known currently are described as aromatic to some extent (See, e.g., Balaban et al., Chemical Reviews, 2004, 104 (5): 2777-2812). In nature, there are two major pathways for the biosynthesis of monocyclic aromatics. The aromatic amino acids phenylalanine, tyrosine and tryptophan are constructed via the shikimate / chorismate pathway. This pathway is then further utilized in the plant world to form the very large array of building block compounds of lignin and lignocellulose. These major components of biomass can be and have been broken down in various ways to give mixtures of useful monocyclic aromatic compounds and further derivatives. However, the heterogeneity of such products remains a problem for large-scale applications.

[0051] Aromatic compounds, and in particular the monocyclic aromatic compounds are common within and are often the major constituents of the polyketide class of compounds. These encompass a largefamily of medicinally important natural products that are biosynthesized by polyketide synthase (PKS) enzymes. Such compounds are formed through the condensation of acyl-thioester units such as malonyl- CoA and methylmalonyl-CoA to yield metabolites with diverse structures and biological activities, and with many uses outside of the medical field.

[0052] Polyketides generally are synthesized by condensation of two-carbon units in a manner analogous to fatty acid synthesis. In general, the synthesis involves a starter unit and extender units; these starter units are derived from, for example, acylthioesters, typically acetyl-, coumaroyl-, propionyl-, malonyl- or methylmalonyl-coenzyme-A (CoA) thioesters. The simplest and prototypic aromatic polyketides are orsellinic acid (OSA) and 6-methylsalicylic acid (6-MSA), also known by its IUPAC name as 2-hydroxy- 6-methylbenzoic acid (HMBA). These, and other simple monocyclic aromatic polyketides, such as olivetolic and divarinic acids are produced enzymatically by type I and some type III iterative PKSs. These are enzymes with sites that are used repeatedly to reach the aromatic portions of the final polyketide product, with certain type III PKSs, including olivetolic acid synthase, also requiring the action of a cyclase enzyme to effect catalysis of the final steps, namely cyclization, dehydration and aromatization of the linear tetraketide precursor.

[0053] For an extensive description of the biosynthetic mechanism of production of such monocyclic aromatic polyketide acids, (see, H. Potter, 2010, Doctoral thesis, Cambridge University), and for a simplified schematic representation of the yeast biosynthetic process from sugar, see FIG. 1.

[0054] OSA is biosynthesized by both Type I and Type III PKSs. Upon decarboxylation by specific decarboxylase enzymes and methylation by the action of O-methyltransferases, the final product, 3,5- dimethylorcinol is a scent molecule that is a major component of the fragrance(s) of several plant species. Natural biosynthesis of 3, 5 -dimethylorcinol is prominent in the petals, and contributes to the volatile products, of roses such as the Chinese rose Rosa chinensis. (Scalliet et al., Proc. Nat. Acad. Sci. USA, 2008, 105 (15): 5927-32). Similarly, OSA’s partially reduced relative 6-MSA / HMBA is biosynthesized by the same mechanism, by the enzyme 6-methylsalicylic acid synthase (6-MSAS), except that a ketoreductase (KR) domain in this enzyme leads to the loss of one hydroxyl group on the final product. 6- MSA / HMBA is decarboxylated as the next step in the biosynthesis of patulin in Penicillium griseofulvum, Aspergillus clavatus and other organisms. See, e.g., Artigot et al., Microbiology, 2009, 155:1738-47). Specific decarboxylase enzymes here, such as the PatG gene product, have also been used in heterologous systems, such as yeast, to generate the 6-MSA / HMBA decarboxylation product meta- cresol, also known as m-cresol, 3-cresol or 3 -hydroxy toluene (See, e.g., Barr, U.S. Pat. No. 9,637,763: 2017, Hitschler and Boles, Metab. Eng. Comm., 9; e00093; 2019, Wang et al., Appl. Microbiol.Biotechnol., 105:6333-43; 2021). As with other cresol isomers, the meta-isomer is a valuable chemical, with use as a stabilizer in human insulin clinical formulations and also, as a precursor to many other valuable products, such as menthol and vitamin E. Currently, however, m-cresol is not obtained at industrial scale as a sustainable bio-based product. Rather, it is obtained by fractionation of coal tar or is synthesized chemically from petroleum-based starting compounds, primarily benzene. Accordingly, there exists a need for bio-based production for, not only the meta- isomer, but for all the cresols. The volumeof use of p-cresol as a specialty chemical over the past decades has consistently outpaced that of m-cresol, and o-cresol which have also experienced significant growth in production volume, demonstrating a clear and present need for bio-based manufacturing technologies for these important monocyclic aromatic phenolic compounds. See, e.g., Badanthadka and Mehendale (Encyclopedia of Toxicology Third Edition-. 1061-65, 2014).

[0055] In the engineered host cell, or in a co-culture, the biosynthesized m-cresol can be methylated in situ by, amongst other heterologously-expressed enzymes, the rose petal-derived O-methyl transferases 00MT1 and 00MT2 (Barr, U.S. Pat. No. 9,637,763, Scalliet et al., Proc. Nat. Acad. Sci. USA 105 (15): 5927-32; 2008, Lavid et al., Plant. Physiol. 129(4): 1899-1907; 2002). In yeast, this engineered process proceeds extremely efficiently and, likely because of its hydrophobicity, 3-MA volatilizes quantitatively from the yeast broth and the host cells, such that HPLC analysis of media or whole cultures (cells and media combined) following full fermentation, results in the three principle products (6-MSA / HMBA, m- cresol and 3-MA) being below the limit of detection. In contrast, head-space or off-gas measurements during fermentation, using a number of techniques, including HPLC and GC-MS, show 3-MA as the only volatile aromatic product (FIG. 2). Surprisingly, the purity of the volatilized 3-MA is generally >99% of the condensable organic fraction with the associated water vapor, or water droplets being removed by methodologies well-known in the art.

[0056] This surprising finding of volatility allows for a number of further novel commercially important steps to ensue. For example, following volatilization of 3-MA, the compound is captured, used essentially “as is”, with only pre-drying over molecular sieves or membranes, or is subjected to relatively inexpensive downstream processing such as drying and redistillation. It can be further subjected to numerous independent chemical procedures that can lead to a wealth of single pure, or mixed monocyclic aromatic compounds, cycloalkanes, bicyclic cycloalkane molecules and other compounds, such as isoalkanes and other branched paraffinic chain molecules, including alkylated cycloalkanes. Taken together, such molecules are diverse and have a plethora of uses in the sustainable chemical industry and in the personal and commercial aviation, and light and heavy land transportation sectors (FIGS. 3-10).

[0057] In one aspect, the present invention provides systems for the efficient production of specific aromatic polyketide and derivative products from renewable feedstocks. These products can be used in their current forms or can be further derivatized chemically or enzymatically to produce additional commercial molecules with specific and very high- volume applications.

[0058] In some embodiments, the yeast strains chosen as hosts belong to the Saccharomyces cerevisiae species or belong to other genera of yeast that do not produce such molecules naturally. Other genera of yeasts that may be employed include, but are not limited to, Kluyveromyces lactis, K. marxianus, Pichia pastoris now known as Komagataella pastoris and Hansenula polymorpha. In some embodiments, oleaginous yeasts may be used including, but not limited to Yarrowia lipolytica, Cutaneotrichosporon oleaginosus, previously known as Cryptococcus curvatus, and Rhodotorula toruloides, previously known as Rhodosporidium toruloides. Similarly, filamentous fungi species, such as certain Aspergillus species,for example, but not limited to A. clavatus, A. fumigatus A. nidulans, and A. oryzae, may also be engineered for production of the target molecules and their precursors.

[0059] In some embodiments, the host cells utilize Ce sugars as the major source of carbon. In other embodiments, the host cells are modified to utilize C5 sugars or a combination of both C5 and Ce sugars.

[0060] In some embodiments, host cells have undergone extensive amplification of copy number of the three key primary production genes, operons, and gene clusters. In other embodiments, these primary production genes, that encode 6-MSA / HMBA (6-MSAS and a phosphopantetheinyl transferase), a 6- MSA / HMBA decarboxylase, and an O-methyltransferase that is capable of methylating m-cresol with high efficiency to produce 3-MA may be expressed from extrachromosomal or genomically-integrated elements in one strain, or in more than one strain.

[0061] In some embodiments, modified host cells that contain expression systems for the high-level production, volatilization and capture of 6-MSA / HMBA that have been selected for enhanced stability of growth on rich media, minimal and defined media, and with suitably prepared carbon substrates from all classes of biomass, such as glucose, corn starch, cellulose, lignocellulose, lactose, glycerol etc. are provided.

[0062] In some embodiments, production of 3-MA is directed by yeast strains that have undergone further genetic manipulations known as metabolic engineering, wherein various pathways to important substrates for the process have been enhanced. Such substrates include, but are not limited to pyruvate, acetyl-CoA, malonyl-CoA and SAMe.

[0063] In some embodiments, the genetically engineered organism culture includes a strain or strains that are capable of producing a fermentation product at a production rate of at least 1.0 grams / liter / hour (g L1h ’), wherein the genetically engineered yeast has a functional gene system for 3-MA production. In other embodiments, the yeast cells are capable of producing a fermentation product at a fermentation production rate of at least 1.5g L1h ’, or at least 2.0 g L1h ’, or at least 3.0 g L1h ’, or at least 5.0 g L1h ’. In still other embodiments, the yeast cells are capable of producing a fermentation product at a pathway fermentation molar yield from the sugar feedstock of at least 55 percent, at least 70 percent, at least 80 percent, or at least 90 percent. In still other embodiments, the yeast cells are capable of producing a fermentation product at a final titer of at least 30 g / liter, at least 80 g / liter, or at least 100 g / liter in a fed-batch fermentation.

[0064] In some embodiments, fermentation may be carried out using a single 3-MA production strain or by co-culture of more than one 3-MA-producing strain. A suitable fermentation vessel may be any fermentation vessel known in the art. Non-limiting examples of suitable fermentation vessels include culture plates, shake-flasks, fermenters (e.g., stirred tank fermenters, airlift fermenters, bubble column fermenters, fixed bed bioreactors, laboratory fermenters, industrial fermenters, or any combination thereof), used at any suitable scale (e.g., small-scale, large-scale). A suitable fermentation volume may be between about 1 L and about 10,000,000 L. Any process (e.g., solid culture, submerged culture, batch, fed-batch, or continuous-flow) may be utilized. In some embodiments, aerobic or microaerobic fermentation methods are applied to 3-MA production and volatilization.

[0065] In some embodiments, volatilized 3-MA is captured from the off-gases of the fermentation by methods well-known in the art and listed above. In other embodiments, the volatilized 3-MA is fed into and captured in a chemical reactor for further chemical reactions that are described in detail below. In some embodiments, the off-gases were passed directly through appropriately sized columns of 4-A molecular sieves to remove water prior to capture of the 3-MA by condensation in a chilled copper tubing-based collection system. In these embodiments, the off-gasses are passed through the molecular sieves. In some of these embodiments, the 3-MA passes through the columns of the molecular sieves, while the water is caught in the molecular sieves. In some embodiments, the off-gases were passed directly through appropriately sized columns of 4-A molecular sieves (Thermo Scientific) to remove water prior to capture of the 3-MA by condensation in a chilled copper tubing-based collection system. In some embodiment, 5-A and 10-A molecular sieves were used to capture volatilized 3-MA. In some embodiments, combinations of sieve columns in series were used to both dry and capture the off-gassed 3-MA.

[0066] In some embodiments, 3-MA is used as the starting material in a first reaction with various catalysts, hydrogen, hydrogen equivalents and co-reactants, as described in more detail below, to give essentially a single product or a mixture of products. Such products may be isolated and, if required, purified by distillation or by other purification methods known in the art. Alternatively, the single product or mixed products from the first reaction is used as the starting material for a second reaction that may be performed in one reactor vessel with a second series of catalysts to give further predominantly single products or further mixtures of products.

[0067] In some embodiments, the single products or mixtures of products are further reacted, or used as the starting material, to produce other products. In some of these embodiments, the other products comprise more than one aromatic ring.

[0068] In some embodiments, 3 -methylanisole at a temperature between about 25° C and about 500° C and a pressure between about 1 bar and about 100 bar is reacted with a solid catalyst to provide a first product comprising a cyclic hydrocarbon compound. In some embodiments, the cyclic hydrocarbon compounds are cyclic alkanes or cyclic alkenes. In some embodiments, the first product is one of methylanisoles, cresols, xylenes, xylenols, benzene, toluene, xylene mixtures and cis, trans- methylcyclohexane. In other embodiments, the mixture is at least one C7 aromatic or cycloalkane product. In still other embodiments, the mixture is at least one Cs aromatic or cycloalkane product. In still other embodiments, the mixture is a bicyclic cycloalkane or an alkylated C8-C22 cycloalkane derivative. In still other embodiments, the mixture is branched isoalkanes.

[0069] In other embodiments, 3 -methylanisole, at a temperature between about 25° C and about 500° C and a pressure between about 1 bar and about 100 bar is reacted with hydrogen or a hydrogen equivalent and a solid catalyst to provide a first product comprising methylcyclohexane. In still other embodiments, 3 -methylanisole, at a temperature between about 25° C and about 500° C and a pressure between about 1 bar and about 100 bar is reacted with a solid catalyst to provide a first product comprising p-xylene. In still other embodiments, 3-methylanisole, at a temperature between about 25° C and about 500° C and apressure between about 1 bar and about 100 bar is reacted with a solid catalyst to provide a first product mixture comprising methylcyclohexane and bicyclic methyl cycloalkanes. In still other embodiments, 3- methylanisole, at a temperature between about 25° C and about 500° C and a pressure between about 1 bar and about 100 bar is reacted with a solid catalyst to provide a first product mixture comprising branched isoalkanes. In still other embodiments, 3 -methylanisole, at a temperature between about 25° C and about 500° C and a pressure between about 1 bar and about 100 bar is reacted with a solid catalyst to provide a first product comprising toluene. In still other embodiments, 3-methylanisole, at a temperature between about 25° C and about 500° C and a pressure between about 1 bar and about 100 bar is reacted with a solid catalyst to provide a first product comprising 3-methylmethoxycyclohexane. In still other embodiments, 3-methylanisole, at a temperature between about 25° C and about 500° C and a pressure between about 1 bar and about 100 bar is reacted with a solid catalyst to provide a first product mixture comprising xylenols. In still other embodiments, 3-methylanisole, at a temperature between about 25° C and about 500° C and a pressure between about 1 bar and about 100 bar is reacted with a solid catalyst to provide a first product mixture comprising C7-C16 cycloalkanes and branched isoalkanes.

[0070] In some of the above embodiments, the temperature is about 25° C. In other of the above embodiments, the temperature is about 50° C. In still other of the above embodiments, the temperature is between about 50° C and 400° C. In still other of the above embodiments, the temperature is between about 50° C and 300° C. In still other of the above embodiments, the temperature is between about 50° C and 200° C. In still other of the above embodiments, the temperature is between about 50° C and 100° C. In still other of the above embodiments, the temperature is between about 100° C and 450° C. In still other of the above embodiments, the temperature is between about 150° C and 350° C. In still other of the above embodiments, the temperature is between about 200° C and 300° C. In still other of the above embodiments, the temperature is between about 225° C and 275° C. In some embodiments the temperature is about 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, or 700°C.

[0071] In some of the above embodiments, the pressure is between about 1 bar and about 50 bar. In other of the above embodiments, the pressure is between about 1 bar and about 30 bar. In still other of the above embodiments, the pressure is between about 1 bar and about 20 bar. In still other of the above embodiments, the pressure is between about 1 bar and about 10 bar. In still other of the above embodiments, the pressure is between about 1 bar and about 1 bar. In still other of the above embodiments, the pressure is between about 40 bar and about 50 bar. In still other of the above embodiments, the pressure is between about 30 bar and about 50 bar. In still other of the above embodiments, the pressure is between about 20 bar and about 50 bar. In still other of the above embodiments, the pressure is between about 10 bar and about 50 bar. In still other of the above embodiments, the pressure is between about 10 bar and about 40 bar. In still other of the above embodiments, the pressure is between about 20 bar and about 30 bar. In some embodiments, the pressure is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 bar.

[0072] In some embodiments, the reaction takes place for between 1 hour and 30 hours. In embodiments, the reaction takes place for between 10 hours and 25 hours. In embodiments, the reaction takes place for about 20 hours. In embodiments, the reaction takes place for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hours.

[0073] In some embodiments, the first product is produced with a yield of from about 65 to about 99.9%. In some embodiments, the first product is produced with a yield of from about 85 to about 99%. In some embodiments, the first product is produced with a yield of from about 94 to about 98%. In embodiments, the first product is produced with a yield of about 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%. In embodiments, the first product is produced with a yield of about 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, or 99.9%.

[0074] In some embodiments, the first product is produced with a yield of from about 65 to about 99.9%. In some embodiments, the first product is produced with a yield of from about 85 to about 99%. In some embodiments, the second product is produced with a yield of from about 94 to about 98%. In embodiments, the second product is produced with a yield of about 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%. In embodiments, the second product is produced with a yield of about 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, or 99.9%.

[0075] In embodiments, the first product is methylcyclohexane. In embodiments, the methylcyclohexane is produced with a yield of from about 65 to about 99%. In embodiments, the methylcyclohexane is produced with a yield of from about 93 to about 99%. In embodiments, the methylcyclohexane is produced with a yield of about 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%. In embodiments, the first product is produced with a yield of about 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, or 99.9%.

[0076] In embodiments, the second product is methylcyclohexane. In embodiments, the methylcyclohexane is produced with a yield of from about 65 to about 99%. In embodiments, the methylcyclohexane is produced with a yield of from about 93 to about 99%. In embodiments, the methylcyclohexane is produced with a yield of about 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%. In embodiments, the first product is produced with a yield of about 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, or 99.9%.

[0077] In embodiments, the second product is dimethylcyclohexane. In embodiments, the dimethylcyclohexane is produced with a yield of from about 65 to about 99%. In embodiments, the dimethylcyclohexane is produced with a yield of from about 93 to about 99%. In embodiments, the dimethylcyclohexane is produced with a yield of about 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%. In embodiments, the first product is produced with a yield of about 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, or 99.9%. In embodiments, the dimethylcyclohexane is 1,4-dimethylcyclohexane. In some embodiments, the 1,4-dimethylcyclohexane is cis- or trans- 1 ,4-dimethylcyclohexane. In some embodiments, the cis- or trans- 1 ,4-dimethylcyclohexane are produced in equal amounts.

[0078] In some of the above embodiments, 3 -methylanisole is bio-based 3 -methylanisole. In other of the above embodiments, the bio-based 3 -methylanisole is added directly to the catalyst from a fermentation device.

[0079] In some of the above embodiments, a co-reactant is added where the co-reactant is hydrogen, an alternate hydrogen donor, methanol, alkyl alcohols, ethers, aromatic compounds, organic or inorganic acids, aldehydes, esters, Diels-Alder reactive compounds or combinations thereof. In other of the above embodiments, the co-reactants are derived from bio-based processes and include, but are not limited to, biomethanol, bioethanol, bioisobutanol, bioisobutene and bioisoprene.

[0080] In some embodiments, a methyl migration reaction and HDO reaction proceed in a one- or two- pot reaction to give predominantly individual xylenes, or otherwise mixed xylenes. In other embodiments, additional bio-based methanol is added to increase fully bio-based xylene yields. In still other embodiments, catalysts provide predominantly p-xylene, wherein the p-xylene is produced with >80%, or >90% or >95% purity. In still other embodiments, p-xylene is purified by distillation or cryogenic technologies well-known in the art or is used “as is” in further reactions. In some of the above embodiments, the co-reactant is methanol in a molar ratio of between 0.01 and 0.1 or 0.1 and 1.1 and the mixture comprises xylenes, wherein the xylenes are predominantly p-xylene.

[0081] In some embodiments, p-xylene is oxidized in situ to terephthalic acid. In still other embodiments, bio-based p-xylene is converted to terephthalic acid, optionally with a co-reactant. In preferred embodiments, the first product is a methyl migration reaction product such as 2,5-xylenol or mixed xylenols and the second product is a hydrodeoxygenation product such as p-xylene or mixed xylenes.

[0082] In some of the above embodiments, the first product is reacted with a second solid catalyst, optionally with a co-reactant. In preferred embodiments, the first product is a methyl migration reaction product such as 2,5-xylenol or mixed xylenols and the second product is a hydrodeoxygenation product such as p-xylene or mixed xylenes.

[0083] In some embodiments, 3 -MA is converted by hydrodeoxygenation in one step into the C7 cycloalkane methylcyclohexane (MCH). MCH is a well-known surrogate jet fuel and a major component of JP-9 missile fuel (Chevron Corporation; Aviation Fuels Technical Review, 2007). The biobased MCH of this disclosure is a second major starting compound for additional chemicals and, in particular, the sustainable jet fuel component families exemplified by cycloalkanes and isoalkanes. It should be understood that in a two-step reaction to specific, or mixtures of higher molecular weight cycloalkanes and / or isoalkanes, intermediate molecules such as methylcyclohexenes and methylcyclohexadienes are likely involved as part of the process (see, for example, FIGS. 6, 7 and 8). In other embodiments, such intermediates can be isolated by methods well-known in the art.

[0084] In some embodiments, co-products of certain reactions, such as, but not limited to methanol and methane, are captured for industrial use as bio-based molecules. The products of certain reactions maylead to additional lower and / or higher molecular weight hydrocarbons than those that are the primary targets for sustainable aviation fuel. Such hydrocarbon molecules may be isolated by, for example distillation, as individual molecules or as mixtures of molecules that can be used as sustainable gasoline, diesel, certain aviation fuels, or components thereof.

[0085] The catalyst can be a currently known catalyst, or a catalyst developed in the future. In some embodiments, the catalyst is a solid catalyst. A solid catalyst may comprise one or more solid materials without limitation, whether now known or developed in the future. In some embodiments, the catalyst is a solid acid, carbon, metal oxide, mixed metal oxide, a supported transition metal, a supported noble metal, functionalized tetrafluoroethylene-fluoropolymer copolymer, calcium apatite, silica-alumina, silica, titania, zeolite, sulfated zirconia, tungstated zirconia, alumina, or mixtures thereof.

[0086] Exemplary solid acid catalysts used to catalyze one- or two-step reactions of 3-MA and its first- step reaction product or products, such as those illustrated in FIGS. 3 through 9 include, but are not limited to, heteropoly-acids, acid resin-type catalysts, meso-porous silicas, acid clays, sulfated zirconia, molecular sieve materials that include HY, HZSM and alkali metal or transition metal and Lewis acidtype acidic materials on thermo-stable supports, including microporous materials. Where an acidic material is provided on a thermo-stable support, the thermo-stable support can include for example, one or more of aluminum, carbon, niobium, silica, tin, titanium, zirconia, and their oxides. The oxides themselves (e.g., ZrCL. SnCL. TiCL. NbOx, etc.), may optionally be doped with additional acid groups such as sulfates, phosphates, etc., and may also be used as solid acid catalysts.

[0087] In some embodiments, a solid catalyst is a supported transition metal or supported noble metal. An illustrative, non-limiting list of transition or noble metals includes chromium, cobalt, copper, gold, iridium, iron, lanthanum, magnesium, manganese, molybdenum, nickel, niobium, palladium, platinum, rhodium, ruthenium, silver, tantalum, tin, tungsten, vanadium, zinc, zirconium, and mixtures thereof. In some embodiments, the catalyst is silica-supported rhodium or other metal nanoparticles.

[0088] In some embodiments, derivatized palladium catalysts are used to catalyze reactions of bio-based 3-MA and its first-step reaction product or products. In other embodiments, the catalyst used herein is derived from the family of Pd catalysts exemplified by dichloro(l,5-cyclooctadiene)palladium, abbreviated PdCh(cod). In still other embodiments, such catalysts facilitate cross-coupling processes that are known in the art. In still other embodiments, the selected catalyst comprises a phosphine ligand. In still other embodiments, the phosphine ligand is selected from triethyl phosphine, triphenyl phosphine and tritolyl phosphine.

[0089] Catalysts described herein are characterized by a wide range of surface areas. In some embodiments, a solid catalyst is used that has a surface area equal to or greater than 1 m2 / g, 5 m2 / g, 10 m2 / g, 20 m2 / g, 50 m2 / g, 100 m2 / g, or 200 m2 / g. In other embodiments, a solid catalyst is used that has a surface area equal to or less than 50 m2 / g, 100 m2 / g, 200 m2 / g, 600 m2 / g, 1000 m2 / g, or 2000 m2 / g. In still other embodiments, the solid catalyst has a surface area between 20 m2 / g and 600 m2 / g.

[0090] Zeolites may also be used as solid acid catalysts. In some embodiments, the zeolite is a H-type zeolites such as, for example, zeolites in the mordenite group or fine-pored zeolites, such as zeolites X, Y,and L (i.e., mordenite, erionite, chabazite). In other embodiments, the zeolite is based on the ultra-stable zeolites in the faujasite group that have been dealuminated. In still other embodiments, solid acid catalysts are selected from the group consisting of functionalized styrene-divinylbenzene copolymers, functionalized tetrafluoroethylene-fluoropolymer copolymers, calcium apatite and silica-alumina.

[0091] In some embodiments, catalytic hydrogenation, hydrodeoxygenation (HDO), or hydrocracking / reforming is performed, with hydrogen or hydrogen equivalents in a one-step or two-step reaction. In a two-step reaction, a first product is subsequently reacted in situ to produce C« to C22 hydrocarbon compositions. In some embodiments, the hydrogenation reaction is carried out in the presence of hydrogen with a catalyst such as Pd, Pd / C, Pt, PtC>2, KufPPh ihCP. KhfPPh ;);. Ru / C, Raney nickel, nickel, or combinations thereof. The procedures reported in U.S. Patent No. 7,399,322 may be used to perform the hydrogenation reactions.

[0092] In some embodiments, hydrodeoxygenation (HDO) is used specifically to improve the energy density, thermal stabilities and melting points of final fuel molecules, and can be carried out by transferring Diels-Alder adducts to provide saturated Cs to C22 cycloalkanes and substituted cycloalkane molecules. Exemplary catalysts include, but are not limited to, physically mixed acidic zeolite and Pd / C and other metal catalyst combinations. Dehydration and removal of oxygen is followed by metal- catalyzed hydrogenation in the presence of hydrogen or hydrogen equivalents.

[0093] In some embodiments, the catalysts are selected from the group consisting of silicon oxide, aluminum oxide, titanium oxide, magnesium oxide, zirconium oxide, cobalt oxide, iron oxide, nickel oxide, manganese oxide, zinc oxide, molybdenum oxide, niobium oxide, tungsten oxide, calcium oxide, cerium oxide, tin oxide, and chromium oxide, and mixtures thereof. In other embodiments, the solid catalyst is a mixed metal oxide catalyst, i.e., a catalyst comprising two or more distinct metals or metal oxides. In still other embodiments, the catalyst is a heterogeneous catalyst.

[0094] In some embodiments reactions are performed on a neat basis or diluted in hydrocarbon solvents such as dodecanes or MCH at 10-0.0 IM. By slowing the reaction down, variable amounts of intermolecular dimerization occur.

[0095] In some embodiments, the first product or first product mixture comprises compounds independently selected from the group consisting of one or more mixed methylanisoles, cresols, xylenes, xylenols, benzene, toluene, xylene mixtures and cis, trans- 1,4-dimethylcyclohexane. In other embodiments, the second product or second product mixture comprises mixed compounds derived from reaction of the first product or first product mixture, in the first reactor, in a one-pot chemical procedure, or in a second reactor in a two-pot chemical procedure. In still other embodiments, the first or second product or product mixture may be reacted in a solvent, with a catalyst, and may be reacted with a coreactant. In still other embodiments, the first or second product or product mixture may be reacted under pressure and at elevated temperatures or at 1 bar and ambient temperature.

[0096] In some embodiments, the first or second reactions are a hydrogenation reaction, a methyl migration reaction, a hydrodeoxygenation reaction, a hydroalkylation reaction, or a hydrocrackingreaction. In other embodiments, 3-MA is converted to methylated decalin compounds, in a one- or two- pot reaction (FIG. 7), using isoprene under Diels-Alder reaction conditions.

[0097] In some embodiments, the first or second reaction products from 3-MA and or MCH are 1,4- dimethylcyclohexane, 3-methylcyclohexanol, 3 -methylmethoxy cyclohexane, terephthalic acid or mixtures thereof, as shown in FIG. 3.

[0098] In some embodiments, a continuous flow strategy for the generation of target first and second reaction products from 3-MA and / or MCH are employed. The neat or dissolved 3-MA or MCH and chosen catalyst(s) are pumped and mixed in continuous flow using a static mixer. The homogeneous mixture obtained is fully converted to the target product(s) in a residence time unit downstream of the mixer. Real-time reaction monitoring via in-line GC / MS analysis at the reactor outlet, is implemented, enabling fast optimization of the reaction conditions, and providing sensitive and reliable feedback to control target product quality. The process is intensified in-flow by stepwise increase of the temperature of the residence time unit.

[0099] In some embodiments, 3-MA, obtained by fermentation, is demethylated in a one-pot reaction to give meta-cresol. The meta-cresol may be distilled to >99% purity. In other embodiments, a second one- or two-pot reaction provides mixed ortho-, meta- and para-cresols. In still other embodiments, 3-MA is converted to meta-cresol in a first reaction and then converted to a second cresol, with greater than 95% purity, in the same reactor. In still other embodiments, the second cresol is para-cresol.

[0100] In some embodiments, electrochemical methods convert 3-MA to further commercially important molecules. In other embodiments, an electrochemical process wherein ions are combined and / or reacted with compounds in a compartment between two membranes, to yield a desired compound, such as a desired organic compound, in particular a product obtained from 3-MA by reduction, by hydrodeoxygenation, by demethylation, or by demethoxylation, wherein the compartment may contain ionic liquid-conductive material is provided.

[0101] In some embodiments, the cathode electrode hydrodeoxygenates 3-MA and, if desired, hydrogenates a second product generated from 3-MA in a catholyte, with a hydride or hydride equivalent. The cathode electrode of the present embodiment includes a catalyst layer and a diffusion layer. The catalyst layer contains, for example, copper, iron, nickel, palladium, platinum, tungsten, titanium, or ruthenium (reviewed by, for example, Kim S. et al., Green Chem 2019, 21:3715) as a cathode catalyst for hydrodeoxygenating or hydrogenating the substance to be hydrodeoxygenated or hydrogenated. In some embodiments, the catalyst layer contains a porous catalyst support that holds a cathode catalyst. In other embodiments, the catalyst support is an electron conductive material such as porous carbon, a porous metal, or a porous metal oxide. In still other embodiments, cathode catalyst is coated or partially coated with an ionomer. As a result, all three elements (the target molecule, for example 3-MA or MCH, and protons and electrons) that are necessary for an electrochemical reaction in the catalyst layer can be efficiently supplied to the reaction field.

[0102] In some embodiments, p-xylene is further reduced to 1 ,4-dimethylcyclohexane. In some embodiments, p-xylene is further oxidized to terephthalic acid. In some embodiments, xylenols are HDOreduced to produce mixed isomers of dimethylcyclohexanes including 1,1 -dimethylcyclohexane, 1,2- dimethylcyclohexane, 1,3-dimethylcyclohexane, 1 ,4-dimethylcyclohexane or other dimethylcyclohexanes. In some embodiments, a coproduct such as ethanol, isobutanol, or bio-isoprene, are added to produce an alkylated C8-C22 cycloalkane derivative.

[0103] A first embodiment is a process for providing a first product comprising cyclic hydrocarbon compounds, the process comprises reacting 3 -methylanisole with hydrogen at a temperature between about 25° C and about 500° C and a hydrogen pressure between about 1 bar and about 100 bar in the presence of a first catalyst to provide a first product comprising cyclic hydrocarbon compounds.

[0104] In a second embodiment, the cyclic hydrocarbon compounds are cyclic alkanes or cyclic alkenes.

[0105] In a third embodiment, the cyclic alkene is aromatic.

[0106] In a fourth embodiment, the cyclic hydrocarbon compounds of embodiment 1 comprise one or more compounds of the group consisting of; methyl anisoles, cresols, xylenes, xylenols, benzene, toluene, xylene mixtures, 3-methylmethoxycyclohexane, cyclic alkanes, and methylcyclohexane.

[0107] In a fifth embodiment, the first product comprises cis or trans-methylcyclohexane.

[0108] In a sixth embodiment, the first product comprises 3-methylmethoxycyclohexane.

[0109] In a seventh embodiment, the first product comprises C8-C22 cyclic alkanes.

[0110] In a eighth embodiment, the first product comprises xylenols.

[0111] In a ninth embodiment, the first product comprises p-xylene.

[0112] In a tenth embodiment, the first product comprises m-cresol.

[0113] In an eleventh embodiment, the first product comprises toluene.

[0114] In a twelfth embodiment, the first product comprises C7-C16 cycloalkanes and branched isoalkanes.

[0115] In a thirteenth embodiment, the 3 -methylanisole is obtained from yeast fermentation.

[0116] In a fourteenth embodiment, the process further comprises capturing the obtained 3- methylanisole in a molecular sieve prior to the reaction hydrogen.

[0117] In a fifteenth embodiment, capturing the 3 -methylanisole in the molecular sieves at least partially removes water from the obtained 3 -methylanisole.

[0118] In a sixteenth embodiment, a pore size of the molecular sieves is between about 2A and about 12A.

[0119] In a seventeenth embodiment, the pore size of the molecular sieves is about 5 A or about 10A.

[0120] A eighteenth embodiment is a process for providing a second product comprising cyclic hydrocarbon compounds, the process comprises reacting any of the first product of any of the preceding embodiments with hydrogen at a temperature between about 25° C and about 500° C and a hydrogen pressure between about 1 bar and about 100 bar in the presence of a second catalyst to provide a second product comprising cyclic hydrocarbon compounds.

[0121] In a nineteenth embodiment, the second product comprises dimethylcyclohexane.

[0122] In a twentieth embodiment, the second product comprises terephthalic acid.

[0123] In a twenty-first embodiment, the second product comprises 3-methylcyclohexanol.

[0124] In a twenty-second embodiment, the second product comprises methylcyclohexanol and bicyclic aromatic compounds.

[0125] In a twenty-third embodiment, the second product comprises at least one C7 aromatic or cycloalkane product.

[0126] In a twenty-fourth embodiment, the second product comprises at least one C« aromatic or cycloalkane product.

[0127] In a twenty-fifth embodiment, the second product comprises a bicyclic cycloalkane or an alkylated C8-C22 cycloalkane derivative.

[0128] In a twenty-sixth embodiment, the first catalyst and / or the second catalyst of the process of any of embodiments 1-23 comprises a mixed metal oxide, a supported transition metal, a supported noble metal, functionalized tetrafluoroethylene-fluoropolymer copolymer, calcium apatite, silica-alumina, silica, titania, zeolite, sulfated zirconia, tungstated zirconia, alumina, or mixtures thereof.

[0129] In a twenty-seventh embodiment, the transition metal or noble metal of the process of embodiment 24 is lanthanum, magnesium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, zirconium, molybdenum, niobium, ruthenium, rhodium, silver, tin, tungsten, tantalum, iridium, platinum, gold or mixtures thereof.

[0130] In a twenty-eighth embodiment, the process of any of the preceding embodiments further comprises addition of a co-reactant wherein the co-reactant is an alternate hydrogen donor, methanol, alkyl alcohols, ethers, aromatic compounds, organic or inorganic acids, aldehydes, esters or combinations thereof.

[0131] In a twenty-ninth embodiment the co-reactant of embodiment 26 is methanol in a molar ratio of between about 0.1 and about 1.1.

[0132] In a thirtieth embodiment, p-xylene is oxidized in situ to terephthalic acid.

[0133] In a thirty-first embodiment, the temperature of the process of any of the preceding embodiments is between about 25° C and 500° C.

[0134] In a thirty-second embodiment, the temperature of the process of any of the preceding embodiments is between about 50° C and 400° C.

[0135] In a thirty-third embodiment, the temperature of the process of any of the preceding embodiments is between about 50° C and 300° C.

[0136] In a thirty-fourth embodiment, the temperature of the process of any of the preceding embodiments is between about 50° C and 200° C.

[0137] In a thirty-fifth embodiment, the temperature of the process of any of the preceding embodiments is between about 50° C and 100° C.

[0138] In a thirty-sixth embodiment, the temperature of the process of any of the preceding embodiments is between about 100° C and 450° C.

[0139] In a thirty-seventh embodiment, the temperature of the process of any of the preceding embodiments is between about 150° C and 350° C.

[0140] In a thirty-eighth embodiment, the temperature of the process of any of the preceding embodiments is between about 200° C and 300° C.

[0141] In a thirty-ninth embodiment, the temperature of the process of any of the preceding embodiments is between about 225° C and 275° C.

[0142] In a fortieth embodiment, the pressure of the process of any of the preceding embodiments is between about 1 bar and about 50 bar.

[0143] In a forty-first embodiment, the pressure of the process of any of the preceding embodiments is between about 1 bar and about 40 bar.

[0144] In a forty-second embodiment, the pressure of the process of any of the preceding embodiments is between about 1 bar and about 30 bar.

[0145] In a forty-third embodiment, the pressure of the process of any of the preceding embodiments is between about 1 bar and about 20 bar.

[0146] In a forty-fourth embodiment, the pressure of the process of any of the preceding embodiments is between about 1 bar and about 10 bar.

[0147] In a forty-fifth embodiment, the bio-based 3 -methyl anisole of any of the preceding embodiments is directly added to the catalyst from a fermentation device.

[0148] In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art. All patents, patent applications, and literature references cited in the present specification are hereby incorporated by reference in their entirety.

[0149] The following Examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.EXAMPLES

[0150] The following examples set forth preferred methods in accordance with the invention. In addition, all examples conducted with purified 3-MA and / or MCH may also be conducted with unpurified materials, such as 3-MA volatilized directly from production fermenters, with or without further processing such as drying or even condensation. First reactions that are followed by second reactions may or may not necessarily be of the “one -pot” type of reaction.

[0151] Gas chromatography (GC) was performed using a customized 908Devices instrument with autosampling for fermentation monitoring and chemistry reaction analytics. For fermentation analytics, a two liter working volume fed-batch fermenter was configured using a splitter to send 10% of the fermenter off-gases (2L / minute) to the GC apparatus, and 90% to columns of 3-, 4-, 5-, and 10-A molecular sievesarranged in various chosen series. The polyethylene columns were loaded with the appropriate sieves 25 grams dry weight, (Thermo Scientific) and airflow was continued through each configuration of sieve tubes for the duration of the fermentation. Capture of 3-MA was monitored by taking sieve samples (2 grams each) and placing in vials containing 5mL of isopropanol. Vials were shaken gently overnight, or heated at 50°C for 20 minutes prior to analysis by HPLC. (Figure 11)EXAMPLE 1: Expression / production of 3-MA in Saccharomyces cerevisiae

[0152] The .S', cerevisiae ADH2 promoter was chemically synthesized and fused to a synthetic gene encoding 6-MSAS from P. griseofulvum. This gene was linked to a synthetic gene for B. subtilis sfp with a synthetic sequence for the .S', cerevisiae pl 50 internal ribosome entry site (IRES) sequence. A .S'. cerevisiae terminator sequence is also fused to the gene sequence, immediately subsequent to the stop codon(s) of the sfp gene. The expression cassette is cloned into a yeast expression vector containing the URA3 selectable marker. Similarly, a gene encoding the R. chinensis 00MT2 enzyme and a P. griseofulvum PatG decarboxylase gene, also linked by the .S', cerevisiae pl 50 internal ribosome entry site (IRES), is cloned into a yeast expression vector containing the selectable marker (LEU2) for growth in leucine-deficient media. A .S', cerevisiae terminator sequence is also fused to this dicistronic sequence, immediately subsequent to the stop codon(s) of the synthetic PatG gene.

[0153] Competent Saccharomyces cerevisiae BJ2168 (MATa his3Dl leu2 trpl-289 ura3-52) cells, or commercial ethanol-producing haploid strains engineered for uracil- or leucine- selection were transformed sequentially with the Ura3 or Leu2 gene-containing expression vectors and then plated on minimal agar plates (1.7 g / L yeast nitrogen base without amino acids or ammonium sulfate (DIFCO), 5 g / L (NH4)2SO4, 20 g / L glucose, 20 g / L agar that contained amino acids for selection based on uracil and leucine prototrophy. Transformants were picked and grown for 24 hours in uracil- and leucine-deficient minimal media in 8% glucose.

[0154] A successful transformant was used to inoculate 2 mL of uracil-deficient minimal medium with 8% glucose and was grown overnight, with shaking at 30°C. A 500 pL aliquot of this culture was used to inoculate 50 mL of YEPD medium (Wobbe, in Current Protocols in Molecular Biology, Supplement 34:13.0.1-13.13.9 (Wiley, 1996)) (10 g / L yeast extract, 20 g / L peptone, 2% glucose).

[0155] Cells and culture media were collected by centrifugation of 500 pL aliquots of the culture taken after 24 and, 48 and 72 hours of growth and the cells lysed by boiling in 50 pL of 2 x SDS gel loading buffer for about 2 minutes. The cell lysates were analyzed by loading onto 12% SDS-PAGE gels. Bands corresponding to the expected size of the encoded enzymes were observed. Culture media was analyzed by direct injection onto C18 reverse phase HPLC columns using a 5-minute, 20% - 100% methanol / water gradient with 0.1% formic acid, and 230nm UV detection.

[0156] 3-MA, 6-MSA / HMBA and m-cresol isolated, where applicable, from the yeast head space, media and any associated with the spun yeast cells, such as for monitoring progression of an individual fermentation, were identified and quantified by comparison with known standards, by HPLC analysis, as above.EXAMPLE 2: Production and Capture of 3-MA Directly from S. cerevisiae.

[0157] The transformed yeast cells described above were grown in 200mL uracil-deficient minimal media in an Erlenmeyer flask with 8% glucose for 24 hours. This culture was added to 2 Liters of YEPD 1% glucose in an aerated 5 -liter working volume fermenter. Following glucose depletion at around 16 - 20 hours, the fermenter was fed with a logarithmically increasing supply of glucose in YEPD for a total of 72 hours. Volatilized 3-MA was captured in condensation traps, following flow through a column of molecular sieves to remove water vapor, and analyzed by gas chromatography and HPLC. Verification that the fermentation was essentially complete was accomplished by HPLC analysis of the fermentation media, or total extracts, and observation that the amounts of 6-MSA / HMBA and m-cresol were either barely detectable or below the limit of detection, by HPLC.

[0158] HPLC analysis of head space above the transformed yeast cell culture was monitored throughout the fermentation and was carried out by direct injection of the head-space vapors, dissolved thoroughly in isopropanol, onto a reverse-phase HPLC column with UV detection, as above (FIG. 2).

[0159] Off-gases were passed directly through appropriately sized columns of 4-A molecular sieves to remove water prior to capture of the 3-MA by condensation in a chilled copper tubing-based collection system. Off-gases were passed directly through appropriately sized columns of 4-A molecular sieves (Thermo Scientific) to remove water prior to capture of the 3-MA by condensation in a chilled copper tubing-based collection system. Alternatively, 5-A and 10-A molecular sieves were used to capture volatilized 3-MA, combinations of sieve columns in series were used to both dry and capture the offgassed 3-MA.

[0160] The following example reactions are performed on a neat basis or diluted in hydrocarbon solvents such as dodecanes or MCH at 10-0.0 IM.EXAMPLE 3: Hydrodeoxygenation of 3-MA to Toluene

[0161] Dried bio-based 3-MA (1.22 g) is captured from engineered .S', cerevisiae fermentation and is charged into a Parr shaker hydrogenation apparatus, either neat or dissolved in dodecane, along with 100 mg of the catalyst Iron phosphide (Fe2P). The vessel is purged twice with hydrogen, and pressure is then set to 1.03 bar (15 psi). The vessel is heated to 200°C for 19 hours until the reaction is complete as measured by gas chromatography.EXAMPLE 4a: One-pot Conversion of 3-MA to MCH by Further Hydrogenation of Toluene

[0162] Dried bio-based 3-MA that is captured from engineered 5. cerevisiae fermentation as described above, (1.22g), is treated as in EXAMPLE 3. Reactions providing essentially the pure toluene intermediate at greater than 98% yield are further reacted as follows. The hydrogenation apparatus is recharged by purging twice with hydrogen and a suitable hydrogenation catalyst added, such as 10% Pd / C, Pd black, Pt / C, Rh(acac)3 / AgBF4. Typical conditions are temperatures of 100°C -240°C, hydrogen pressures of 100-870psi and reaction times of 4-20h. Following further heating at the desired temperature and pressure, essentially pure MCH (95-98%) yield % is collected and identified by gas chromatography.EXAMPLE 4b: Direct Catalytic Conversion of 3-MA to MCH via Cycloalkene and Methylcyclohexanol Intermediates

[0163] 3-MA (1.22g) was converted to MCH directly via methylcyclohexane and methylcyclohexanol intermediates, using wet or dry 10% Pd on charcoal (75 mg) in the presence of zeolites B38, ZSM-5, and Y-RE2. In one example, 10% Pd on charcoal combined with B38 zeolite was subjected to hydrogen pressure of 20.68 bar (300 psi), at a temperature of 200°C, for 20 hours. Intermediates were identified using GC with known standards. 3-MA was fully consumed and approximately 50% yield of MCH was observed by GC, along with the intermediates.EXAMPLE 4c: Direct Conversion of 3-MA to MCH using Nickel on silica gel

[0164] 3-MA (38mg) in 1.3g n-dodecane was reacted with hydrogen 48.26 bar (700 psi) at 200°C over NiSiO2 catalyst (50mg) for 20 hours. MCH was produced at 72% yield, as measured by GC. (Figure 11D).EXAMPLE 5: Conversion of 3-MA to p-Xylene by Methyl Migration / Hydrodeoxygenation

[0165] 3-MA (1.22g), was reacted with hydrogen (100 psi), using NiSiO2 catalyst with methyl group retention and ring migration capabilities and the products are analyzed for conversion to p-xylene by gas chromatography, with a yield of 0.5 %.EXAMPLE 6: Conversion of 3-MA to Predominantly p-Xylene Using Added Sustainably- Produced Methanol

[0166] The experiment described above in Example 5 is repeated except that 0.01 - 1.1 molar equivalents of bio-based methanol (MilliporeSigma) were added prior to initiating the reaction. As above, products are analyzed for conversion yields and specificity for the production of p-xylene.EXAMPLE 7: Demethylation of 3-MA to m-Cresol

[0167] Dried bio-based 3-MA that is captured from engineered 5. cerevisiae fermentation as described above, (1.22g), either 5.51g (2eq) of MgE or (leq) of Nal was placed in a sealed vessel along with the ionic liquid l-butyl-2,3-dimethylimidazolium tetrafluoroborate (BMMImBF4) (10% v / v) with water as the solvent. The solution was stirred at 130° C for 2 hours. m-Cresol was obtained in greater than 98% or 94% yield, respectively.EXAMPLE 8: Further “One-pot” Rearrangement of m-Cresol to Mixed Cresols

[0168] Reactions providing essentially pure m-cresol, as in Example 7. at greater than 98% yield are further reacted as follows. The vessel is recharged with a second specific cresol isomerization catalyst and resealed. Following further heating at the desired temperature and pressure, mixed cresols are identified by GC and HPLC. Conditions favoring the production of p-cresol are repeated at scale, and the cresols are separated by distillation.EXAMPLE 9: Electrochemical Conversions of 3-MA to MCH

[0169] Dried or partially dried 3-MA that is obtained by direct collection from fermentations as described above, is introduced into the cathode chamber of an electrolytic bath with an anode made from iridium oxide. A cathode electrode made of platinum ruthenium-supported carbon (Pt RuIC), and a cathode chamber with a membrane made of Nation (DuPont), and a reference electrode inserted into the cathode chamber are prepared. Using this electrolytic bath, constant current electrolysis is performed at a current density of 0.2 A / cm2 for 10 minutes at 60° C. IM aqueous sulfuric acid solution flows throughthe anode chamber at a flow rate of 20 mL / min. Conversion of 3-MA directly to MCH is measured by gas chromatography.EXAMPLE 10: Conversion of p-Xylene to cis- and Zrans-1,4-Dimethylcyclohexane (DMCH)

[0170] p-Xylene (50mg) in 3.5mL THF was reduced using hydrogen at 500psi and a temperature of 100° C over a Rhodium acetylacetonate catalyst (5mg) and AgBF4 (5mg). The reaction was followed by GC for 19 hours. The final yield of DMCH was 91%. When the reaction was performed using platinum oxide (5mg) and using n-dodecane as the solvent, the yield was 74%. The two isomers, as identified by GC using known standards, were produced in equal quantities, with either of the above catalysts, or with platinum on carbon catalysts. In a similar set of conditions, p-xylene was treated with 5% platinum on carbon catalyst in n-dodecane to afford a 98% yield with a 1.5:1 cis to trans ratio. In still another similar set of conditions, p-xylene neat (3.5mL) and 50mg of 10%Pd / C was hydrogenated with hydrogen at 500psi and 100°C for 19h to afford a 99.7% yield of an equal molar mixture of cis- and trans- 1 ,4-DMCH.ILLUSTRATIVE DNA SEQUENCES

[0171] SEQ ID NO:1 Illustrative yeast-preferred codon-based synthetic gene for P. griseofulvum 6- MSAS under control of the 5. cerevisiae ADH2 promoter. The Bacillus subtilis sfp gene is attached within a dicistronic construct using the .S', cerevisiae pl50 internal ribosome entry site (IRES).

[0172] 5’ -GGATCCGACGCTAGATGAAGAGACTAATCAAAGAATCGTTTTCTCAAAAAAATTAATATCTT AACTGATAGTTTGATCAAAGGGGCAAAACGTAGGGGCAAACAAACGGAAAAATCGTTTCTC AAATTTTCTGATGCCAAGAACTCTAACCAGTCTTATCTAAAAATTGCCTTATGATCCGTCTCT CCGGTTACAGCCTGTGTAACTGATTAATCCTGCCTTTCTAATCACCATTCTAATGTTTTAATT AAGGGATTTTGTCTTCATTAACGGCTTTCGCTCATAAAAATGTTATGACGTTTTGCCCGCAGG CGGGAAACCATCCACTTCACGAGACTGATCTCCTCTGCCGGAACACCGGGCATCTCCAACTT ATAAGTTGGAGAAATAAGAGAATTTCAGATTGAGAGAATGAAAAAAAAAAAAAAAAAAAA GGCAGAGGAGAGCATAGAAATGGGGTTCACTTTTTGGTAAAGCTATAGCATGCCTATCACAT ATAAATAGAGTGCCAGTAGCGACTTTTTTCACACTCGAAATACTCTTACTACTGCTCTCTTGT TGTTTTTATCACTTCTTGTTTCTTCTTGGTAAATAGAATATCAAGCTACAAAAAGCATACAAT CAACTATCAACTATTAACTATATCGTAATCTAGACCATGCACTCCGCTGCTACCTCTACTTAC CCTTCAGGTAAGACCTCTCCTGCCCCAGTGGGGACACCAGGAACAGAATACTCAGAATACG AGTTTTCTAATGATGTAGCTGTAGTTGGTATGGCATGCAGAGTGGCCGGTGGAAATCATAAT CCTGAACTTCTATGGCAGTCCCTTTTGTCACAAAAGTCCGCTATGGGTGAAATCCCACCTATG AGATGGGAACCATACTATAGAAGAGATGCAAGGAATGAAAAGTTCCTGAAAAACACTACAT CTAGGGGGTACTTCCTAGACAGACTGGAGGACTTCGACTGCCAGTTTTTCGGTATCTCACCA AAGGAAGCAGAACAGATGGACCCACAACAAAGAGTTTCCCTTGAAGTAGCTTCTGAGGCTC TTGAAGATGCAGGTATCCCAGCAAAATCTTTATCAGGTTCTGACACCGCCGTCTTTTGGGGC GTCAATTCCGATGACTACTCTAAGCTGGTATTGGAGGATTTGCCAAACGTCGAAGCCTGGAT GGGTATAGGTACTGCCTACTGTGGAGTCCCTAATAGAATCTCATACCACCTTAACCTTATGGGACCATCTACCGCAGTAGACGCTGCATGTGCCTCCTCATTGGTAGCTATTCACCATGGCGTCCAAGCAATTAGGCTGGGCGAATCAAAAGTGGCTATTGTAGGTGGCGTTAATGCTTTATGTGGTCCAGGTTTGACAAGAGTGCTAGACAAAGCTGGAGCAATCTCTTCAGATGGCTCATGTAAGTCTTTTGATGATGACGCCCATGGTTACGCAAGAGGTGAAGGCGCAGGGGCACTAGTCTTGAAATCTTTGCATAGAGCCCTATTGGACCATGATAATGTACTAGCAGTCATTAAGGGTTCTGCTGTTTGTCAAGATGGAAAAACTAATGGAATCATGGCTCCTAATTCTGTGGCACAACAGTTAGCTGCTAACAATGCACTATCTGCTGCAAACATCGATCCTCATACAGTTAGGTACGTTGAAGCTCATGCTACAAGTACACCTTTGGGAGATCCAACTGAGATATCTGCAATTGCTTCTGTTTATGGGGCTGATAGACCAGCCGATGACCCATGTTACATCGGCTCAATCAAGCCAAACATTGGTCATTTGGAAGCTGGAGCAGGTGTTATGGGTTTCATTAAGGCAGTATTAGCAATTCAAAAGGGCGTACTTCCTCCACAAGCAAACTTAACCAAATTGAATAGTAGAATTGATTGGAAAACAGCTGGCGTAAAAGTTGTACAGGAAGCAACTCCTTGGCCTGAAAGTGATCCTATTAGACGTGCCGGTGTTTGCTCTTATGGGTACGGTGGCACAGTGTCTCACGCTGTTATAGAGGAATTCTCTCCTATACTGCAACCAGATCCACTTGGTAATGGAGCCGTATCCGGACCTGGTTTACTGTTGTTGTCAGGGCCTCAGGAGAAAAGATTGGCTCTGCAAGCCAAAACCCTGAGAGATTGGATGACTGCCGAGGGTAAAGATCATAACTTAAGTGATATTCTAACTACACTTGCCACTAGAAGGGATCATCATGATTACAGAGCTGCTCTAGTTGTTGACGATTACAGAGATGCCGAACAAGTTTTGCAATCATTGGCAAACGGAGTCGATCATACTTTTACAACACAATCAAGAGTTCTAGGGTCCGATATCTCTAAAGACGTCGTTTGGGTCTTTTCTGGCCATGGAGCTCAGTGGCCAGACATGGGTAAACAACTTATACACAATCCTGTCTTTTTCGCTGCAATTCAACCATTAGATGAGTTAATCCAAGCAGAAATTGGATTATCTCCAATTGAACTATTACGTACCGGCGATTTCGAATCTTCAGATAGAGTACAAATTCTGACTTATGTGATGCAAATAGGCCTAAGTGCATTACTTCAAAGTAATGGAATAACACCACAGGCCGTCATCGGCCATTCTGTTGGCGAGATAGCTGCCTCTGTCGTTGCTGGTGCCTTGTCACCTGCTGAAGGTGCTTTGATAGTGACAAGACGTGCTCTATTGTACAGACAAGTTATGGGCAAAGGTGGTATGATACTTGTAAACTTACCATCCGCAGAGACAGAGGAAATTCTGGGGTCAAGATCAGATCTTGTGGTAGCCATTGATTCCTCACCATCATCTTGCGTAGTTGCCGGTGATAAGGAACTAGTTGCCGAAACTGCTGAAGCTCTAAAAGCAAGAGGCGTTAAGACATTCACAGTCAAGAGTGACATAGCATTTCATTCCCCTACATTGAATGGTTTGGTTGACCCACTAAGGGATGTCTTGGCTGAAACCTTGAGTCCAGTTAGTCCAAACGTTAAGTTGTATTCAACTGCACTAGCTGACCCAAGAGGGCAAGATTTGAGAGATGTAGAATACTGGGCTGGCAATATGGTCAATAGAGTTCGTTTGACTTCTGCTGTCAAGGCAGCCGTGGAGGATGGCTATAGACTGTTTTTGGAAGTTTCTACACATCCTGTAGTTTCTCACTCAATCAATGAAACTTTGATGGACGCTGGGATGGAGGACTTTGCTGTTATCCCTACTTTACTTAGGAAAAAGCCAACTGAAAAACACATTTTGCATTCTATCGCTCAACTACATTGTAGAGGTGCTGAAGTTAACTGGGCAGCTCAAATGCCAGGTAGATGGGCTACAGGTGTTCCTACAACTACTTGGATGCATAAGCCTATCTGGAGAAAGATCGAAACAGCTCCATTGCACACCGGCTTGACCCATGACGTGGAAAAGCACACATTACTTGGGCAGAGAATTCCAGTGCCTGGTACTGATACTTACGTATACACCACTAGACTTGATAATGATACTAAACCATTTCCAGGCTCTCATCCACTACACGGTACAGAAATTGTTCCTGCAGCAGGACTGATCAATACTTTTCTAAAAGGAACAGGAGGTCAAATGCTTCAAAATGTCGTCCTACGTGTTCCAGTTGCCATAAACGCCCCTAGATCAGTTCAAGTCGTGGTTCAACAAGACCAGGTTAAAGTCGTTTCCAGACTGATCCCATCAGAACCTTCACAATTGGACGATGACGCATCATGGGTTACTCATACAACTGCTTACTGGGACAGAAAAGTCGCAGGTAGTGAAGATAGGATTGACTTTGCAGCCGTCAAATCCAGATTAGTTACAAAGTTGGCTGATAACTTTTCTATTGACTATCTTGATAAAGTTGGTGTTAGTGCCATGGGCTTTCCATGGGCAGTTACTGAACACTACAGAAACGATAAGGAAATGTTGGCAAGAGTGGATGTTAATCCAGCTATTTCTGGCGATGCACCACTGCCTTGGGATTCCTCTTCATGGGCACCAGTCCTGGATGCAGCAACTTCAGTAGGATCTACCATCTTTCCAACACCAGCATTACGTATGCCTGCTCAAATCGAAAGAGTAGAGGTCTTTACTTCTCAGGACCCACCAAAGATCTCTTGGTTGTACGTGCAAGAGGCTTCAGATTCCGTACCAACATCTCACGTTTCTGTTGTGTCCGAAGCAGGCGAAGTATTGGCCAAATTCACAGCTATGAGGTTTTCCGAAATAGAAGGTACACCTGGTGTGAGTGGTTCAATGGAATCCTTAGTGCATCAAATCGCCTGGCCACCAGCTACTCCTGCTGAGGAACCACTGTCTATTGAAACAGTTATCTTAGTGAGTCCAGATGCCACCACAAGAGCTCTATATGCAGCCTCATTGCCTACCAGAGTTAACTCTTTTCAGTTTTCATCTACTCAGGAGTTTTTCTCTAATGCCTCTTCTCTTCCATTGGAAAAGGGTACAGTTGTAACTTACATTCCAGGAGAAGTGGCATCATTAGCCGAAGTCCCAGCAGCTTCCGAATCTTTCACATGGAACTTACTAGAGTTAATCAAGTTTACCGTAAACGGTAGTTTGCCTATCAAAGTATTCACTTTAACTGCCAATATCGGAGAAGGACAGACCCCAACAGCATTGGCTCAATCTCCACTATATGGTTTAGCTAGAGTCATCGCCAGTGAACATCCTGACTTAGGTACACTAATCGACGTTGAAGAGCCAGTTATCCCATTAAGTACAATGAGATACATCCAAGGCGCTGACATCATTAGAATCAATGATGGTATAGCTAGAACTTCACGTTTTAGATCCTTACCTAGGAATAAGCTGTTACCTGCTTCAGAAGGGCCACGTCTGTTGCCAAGACCAGAAGGTACCTATTTGATCACTGGTGGCCTAGGAGTGCTTGGCTTAGAGGTTGCCGATTTCCTGGTAGAGAAAGGTGCAAGACGTTTGCTGTTGATTTCTAGGAGAGCTTTGCCACCTAGAAGGACTTGGGATCAAGTTTCTGAGGATCTTCAACCTACTATCGCAAAGATACGTCTGCTTGAATCACGTGGTGCCTCTGTGCACGTATTGCCATTGGACATAACCAAGCCAGATGCCGTTGAACAACTGACAACAGCTTTAGACAGATTGTCATTGCCATCCGTTCAAGGTGTTGTACATGCAGCTGGAGTGCTGGACAACGAGTTGGTGATGCAGACTACAAGAGATGCCTTCAATAGGGTGCTGGCCCCAAAGATTGCTGGGGCTCTAGCATTGCATGAAGTCTTTCCACCAAAATCTGTGGACTTTTTCGTCATGTTTAGTTCATGCGGCAACTTAGTTGGATTCACAGGACAAGCATCTTATGGCTCCGGTAACGCCTTTTTGGATACTTTGGCTACACATAGAGCAAGATTGGGAGATGCAGCTGTATCTTTTCAGTGGACATCATGGAGAGGGCTTGGTATGGGAGCATCTACAGATTTCATTAACGCTGAACTTGAATCTAAGGGCATTACAGATGTCACAAGGGACGAAGCTTTCGCCGCATGGCAACACTTAGCTAAGTACGATATGGATCATGGTGTTGTTCTAAGATCACGTGCCTTTGAAGATGGAGAACCAATCCCTGTGTCAATCTTAAACGATATTGCTGTCAGAAGAGTCGGTACAGTGTCAAACACATCACCAGCTGCCGCTGGTTCCTCTGATGCTGTGCCAACAAGTGGACCTGAGCTAAAGGCATACCTTGATGAGAAAATCAGAGGTTGTGTCGCTAAAGTTTTACAAATGACAGCTGAAGATGTGGATTCAAAAGCTGCTTTAGCCGACTTAGGTGTTGATAGTGTAATGACAGTTACATTGCGTAGACAATTGCAACTGACTCTTAAGATTGCCGTACCTCCAACTTTGACTTGGTCCCACCCAACTGTATCACACTTAGCCGTGTGGTTTGCAGAAAAACTTGCTAAGTAATAGCTCGAGAATCATTTTTTTGAAAATTACATTAATAAGGCTTTTTTCAATATCTCTGGAACAACAGTTTGTTTCTACTTACTAATAGCTTTAAGGACCCTCTTGGACATCATGATGGCAGACTTCCATCGTAGTGGGATGATCATATGATGGGCGCTATCCTCATCGCGACTCGATAACGACGTGAGAAACGATTTTTTTTTTTCTTTTTCACCGTATTTTTGTGCGTCCTTTTTCAATTATAGCTTTTTTTTATTTTTTTTTTTTCTCGTACTGTTTCACTGACAAAAGTTTTTTTTCAAGAAAAATTTTCGATGCCGCGTTCTCTGTGTGCAACGGATGGATGGTAGATGGAATTTCAATATGTTGCTTGAAATTTTACCAATCTTGATATTGTGATAATTTACTTAATTATGATTCTTCCTCTTCCCTTCAATTTCTTAAAGCTTCTTACTTTACTCCTTCTTGCTCATAAATAAGCAAGGTAAGAGGACAACTGTAATTACCTATTACAATAATGAAGATCTACGGCATATACATGGATCGTCCATTATCTCAGGAGGAAAATGAAAGATTCATGTCCTTTATCTCCCCAGAAAAGCGTGAAAAGTGTAGAAGATTCTACCATAAAGAGGATGCTCATAGAACCTTACTTGGTGACGTCCTAGTTAGATCTGTCATATCAAGACAGTATCAATTAGATAAGTCTGACATCAGATTCAGTACACAGGAATACGGAAAACCATGCATTCCTGATTTGCCTGATGCACACTTTAACATTTCTCATTCAGGGAGATGGGTGATTTGTGCTTTTGACTCCCAACCTATAGGCATTGACATTGAAAAGACCAAGCCAATAAGTTTAGAGATTGCCAAGAGGTTTTTCTCTAAAACTGAATACTCCGACTTGTTAGCCAAGGATAAAGATGAACAAACTGATTACTTCTATCATCTTTGGTCTATGAAGGAATCTTTCATAAAGCAGGAAGGGAAAGGGTTATCTTTGCCTTTAGACTCATTTTCAGTAAGATTACATCAAGATGGTCAAGTTTCCATCGAATTGCCAGACTCTCACAGTCCTTGCTACATCAAAACTTATGAGGTTGATCCAGGATACAAAATGGCAGTCTGTGCTGCACACCCTGATTTTCCTGAGGATATCACAATGGTTAGTTATGAAGAGCTTTTGTAA - 3’

[0173] SEQ ID NO:2 Illustrative yeast-preferred codon-based synthetic gene for Aspergillus clavatus PatG decarboxylase

[0174] 5’ -ATGGCCAAGATCGATGTTCACCATCACTTCTATCCTCAAGCAATGAGAGAGGCATTAGAAAGAGCTGGTGGAGATCCATCTGGATGGTACATTCCACCATGGACATTGGATCTGGACAAGGAAATCTCCAGAGTACTTAAAGTCCAAACTACTATCTTATCAGTGACGGCTCCAGGTCCAGGGATTGAAACTGACCCAGGTAAAGCTGCTGCCCTTGCTAGGCTGTGTAATGAGGAAGCAGCCGCTATAAGAGATGCTCATCCATTGCAATATGGTTTCTTTGCCTCTGTTCCTTCATTGTTTGATACAGCTGCAGTTCTAGCTGAAATAGAACATGCATTCACCAATCTCCACGCTGATGGCGTCACATTGTATACTAGATACGGTGCCGGACACTCTTACTTGGGTGATGAGAGATTCCGTCCAATATGGGCTGAGCTTTCTAAGAGAAGGGCAGTTGTGTTTATCCATCCTACTCATGCAGTTGATACACAATTAATCAATAGTTGGATGCCTCAGCCAATGTTTGATTACCCTCATGAAACAGGGAGAACTGCGATGGACTTGCTAACTAGAGGCGTCATTAGAGATTACCCTGGTTGTAAGATCATATTATCTCATGCAGGCGGCACACTGCCTTACTTAATTCATCGTGCCGCAACTATGCTACCATTCATGCCTAGAAACTTAGGCATGTCAAGAGAGGAAATTGTTGAAGCTGCTAGAACATTCTACTTTGACACCGCAATTTCAGCCAACCCAGTAACCTTGAAAGCGTTACTAGAATTTGCCAAACCAGGACACGTATTGTTTGGGAGTGACTTTCCAAACGCTCCTAGAGGTGCCATCACACATTTCACGTCCTTTCTG 1GAAGGATACGACAATATGAGCGAGGAAACACGAAGGCTCGTGGAACGTGAAGCGGCATTGGAACTCTTTCCAAGACTAAGAGGTCAATCCACAAGAGCTTGCCTTTAA - 3’

[0175] SEQ ID NOG Illustrative yeast-preferred codon-based synthetic gene for Rosa chinensis 00MT2 O-methyltransferase

[0176] 5’ -ATGGAAAGACTTAACAGTTTCAAACATCTTAACCAGAAATGGTCTAATGGCGAACACTCAAATGAATTGTTACATGCACAAGCTCACATATGGAACCATATATTCAGCTTTATCAATTCAATGTCTCTTAAGTCAGCTATCCAATTGGGTATTCCTGATATCATCAATAAGCATGGACCAATGACTTTATCTGAACTGACATCTGCATTACCAATACACCCAACTAAGTCTCATTCAGTTTACAGATTAATGCGAATTCTCGTTCACAGCGGTTTCTTTGCTAAGAAGAAACTAAGTAAGACAGACGAGGAAGGTTACACATTGACTGACGCCTCTCAACTTCTATTGAAAGATCATCCTTTGTCATTAACTCCATTTCTGACAGCTATGTTAGATCCTGTCCTAACAACTCCATGGAACTACTTGTCCACCTGGTTTCAGAATGAAGATCCAACTCCTTTCGATACAGCCCATGGTATGACGTTCTGGGATTATGGCAATCATCAACCTTCTATAGCCCACTTGTTTAATGATGCAATGGCTTCCGATGCTAGATTGGTGACTTCTGTTATTATCGATGACTGTAAAGGCGTATTTGAAGGATTGGAATCACTGGTTGACGTGGGTGGTGGGACCGGTACAGTAGCAAAGGCTATTGCGGATGCATTTCCACATATTGAATGCACAGTGCTCGACTTACCACACGTAGTTGCAGACCTTCAAGGAAGTAAGAATTTGAAATATACAGGTGGTGATATGTTTGAAGCGGTTCCTCCAGCCGATACCGTCCTACTCAAATGGATCTTGCATGACTGGAACGATGAAGAGTGTATTAAGATCTTGAAGAGATCCAGAGTCGCAATTACTTCAAAGGACAAGAAAGGGAAAGTCATCATCATTGATATGATGATGGAGAACCAGAAAGGCGACGAAGAGTCTATAGAAACACAATTATTCTTTGATATGTTAATGATGGCCCTCGTTAGAGGCCAAGAGAGGAATGAGAAGGAATGGGCTAAACTATTCACGGATGCTGGGTTCTCCGATTACAAGATCACTCCAATTCTAGGACTGCGTTCTCTTATCGAAGTATACCCTTAA - 3’

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A process for providing a first product comprising cyclic hydrocarbon compounds, the process comprising: reacting 3 -methylanisole with hydrogen at a temperature between about 25° C and about 500° C and a hydrogen pressure between about 1 bar and about 100 bar in the presence of a first catalyst to provide a first product comprising cyclic hydrocarbon compounds.

2. The process of claim 1 , wherein the cyclic hydrocarbon compounds are cyclic alkanes or cyclic alkenes.

3. The process of claim 2, wherein the cyclic alkene is aromatic.

4. The process of claim 1 , wherein the cyclic hydrocarbon compounds comprise one or more compounds of the group consisting of; methyl anisoles, cresols, xylenes, xylenols, benzene, toluene, xylene mixtures, 3-methylmethoxycyclohexane, cyclic alkanes, and methylcyclohexane.

5. The process of claim 1, wherein the first product comprises cis- or tran.v-dimcthylcyclohcxanc or methylcyclohexane .

6. The process of claim 1, wherein the first product comprises 3-methylmethoxycyclohexane.

7. The process of claim 1, wherein the first product comprises C8-C22 cyclic alkanes.

8. The process of claim 1, wherein the first product comprises xylenols.

9. The process of claim 1, wherein the first product comprises p-xylene.

10. The process of claim 1, wherein the first product comprises m-cresol.

11. The process of claim 1 , wherein the first product comprises toluene.

12. The process of claim 1, wherein the first product comprises C7-C16 cycloalkanes and branched isoalkanes.

13. The process of claim 1, wherein the 3 -methylanisole is obtained from yeast fermentation.

14. The process of claim 13, the process further comprising, capturing the obtained 3 -methylanisole in a molecular sieve prior to the reaction with hydrogen.

15. The process of claim 14, wherein capturing the 3 -methylanisole in the molecular sieves at least partially removes water from the obtained 3-methylanisole.

16. The process of claims 14-15, wherein a pore size of the molecular sieves is between about 2A and about 12A.

17. The process of claim 16, wherein the pore size of the molecular sieves is about 5A or about 10A.

18. A process for providing a second product comprising cyclic hydrocarbon compounds, the process comprising: reacting any of the first product of any of the preceding claims with hydrogen at a temperature between about 25° C and about 500° C and a hydrogen pressure between about 1 bar and about 100 bar in the presence of a second catalyst to provide a second product comprising cyclic hydrocarbon compounds.

19. The process of claim 18, wherein the second product comprises cis- or trans- dimethylcyclohexane or methylcyclohexane.

20. The process of claim 18, wherein the second product comprises terephthalic acid.

21. The process of claim 18, wherein the second product comprises 3-methylcyclohexanol.

22. The process of claim 18, wherein the second product comprises methylcyclohexanol and bicyclic aromatic compounds.

23. The process of claim 18, wherein the second product comprises at least one C7 aromatic or cycloalkane product.

24. The process of claim 18, wherein the second product comprises at least one Cs aromatic or cycloalkane product.

25. The process of claim 18, wherein the second product comprises a bicyclic cycloalkane or an alkylated C8-C22 cycloalkane derivative.

26. The process of any of claims 1-25, wherein the first catalyst and / or the second catalyst comprise a mixed metal oxide, a supported transition metal, a supported noble metal, functionalized tetrafluoroethylene-fluoropolymer copolymer, calcium apatite, silica-alumina, silica, titania, zeolite, sulfated zirconia, tungstated zirconia, alumina, or mixtures thereof.

27. The process of claim 26, wherein the transition metal or noble metal is lanthanum, magnesium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, zirconium, molybdenum, niobium, ruthenium, rhodium, silver, tin, tungsten, tantalum, iridium, platinum, gold or mixtures thereof.

28. The process of any of the preceding claims, the process further comprising addition of a coreactant wherein the co-reactant is an alternate hydrogen donor, methanol, alkyl alcohols, ethers, aromatic compounds, organic or inorganic acids, aldehydes, esters or combinations thereof.

29. The process of claim 28, wherein the co-reactant is methanol in a molar ratio of between about 0.1 and about 1.1.

30. The process of claim 29, wherein p-xylene is oxidized in situ to terephthalic acid.

31. The process of any of the preceding claims, wherein the temperature is between about 25° C and 500° C.

32. The process of any of the preceding claims, wherein the temperature is between about 50° C and 400° C.

33. The process of any of the preceding claims, wherein the temperature is between about 50° C and 300° C.

34. The process of any of the preceding claims, wherein the temperature is between about 50° C and 200° C.

35. The process of any of the preceding claims, wherein the temperature is between about 50° C and 100° C.

36. The process of any of the preceding claims, wherein the temperature is between about 100° C and 450° C.

37. The process of any of the preceding claims, wherein the temperature is between about 150° C and 350° C.

38. The process of any of the preceding claims, wherein the temperature is between about 200° C and 300° C.

39. The process of any of the preceding claims, wherein the temperature is between about 225° C and 275° C.

40. The process of any of the preceding claims, wherein the pressure is between about 1 bar and about 50 bar.

41. The process of any of the preceding claims, wherein the pressure is between about 1 bar and about 40 bar.

42. The process of any of the preceding claims, wherein the pressure is between about 1 bar and about 30 bar.

43. The process of any of the preceding claims, wherein the pressure is between about 1 bar and about 20 bar.

44. The process of any of the preceding claims, wherein the pressure is between about 1 bar and about 10 bar.

45. The process of any of the preceding claims, wherein the bio-based 3-methyl anisole is directly added to the catalyst from a fermentation device.

Images