CG-dinucleotide depleted self-amplifying RNA molecule
CpG-modified saRNA vectors with reduced CpG content address the limitations of saRNA in humans by enhancing expression and resistance to interferon-mediated suppression, offering a potent vaccine and therapeutic solution.
Patent Information
- Application Number
- PCT/GB2025/050400
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-28
- Filing Date
- 2025-02-28
- Publication Date
- 2025-09-04
AI Technical Summary
Self-amplifying RNA (saRNA) vaccines and therapeutics face challenges in humans due to significant differences in innate activation and downstream effector functions compared to small animal models, primarily due to higher CpG dinucleotide frequencies and interferon responses, leading to reduced expression and efficacy.
Development of CpG-modified saRNA vectors with reduced or depleted CpG dinucleotides, optimized to minimize CpG content to levels below 0.15% or ideally 0.06%, mimicking the frequency of type I interferon transcripts, enhancing expression and resistance to interferon-mediated suppression.
The CpG-modified saRNA vectors exhibit enhanced gene expression and increased resistance to interferon-mediated repression, providing a potent vaccine and therapeutic platform with improved utility in humans.
Smart Images

Figure GB2025050400_04092025_PF_FP_ABST
Abstract
Description
[0001] CG-DINUCLEOTIDE DEPLETED SELF-AMPLIFYING RNA MOLECULE
[0002] The present invention relates to self-amplifying RNA (saRNA) molecules, and particularly, although not exclusively, to saRNA molecules comprising a reduced or depleted CpG nucleic acid sequence. The invention extends to saRNA replicons and to nucleic acids and expression vectors encoding such saRNA constructs, and to methods for improving saRNA-mediated gene expression. The invention also extends to the use of such saRNA constructs in therapy, for example in treating diseases and / or in vaccine delivery. The invention extends to pharmaceutical compositions comprising such saRNA constructs, and methods and uses thereof.
[0003] Self-amplifying RNA (saRNA) represents a novel platform for vaccine and therapeutic indications. The majority of saRNA vectors are derived from single stranded positive sense (ssRNA+) viruses, and particularly those from three main phylum: Alsuviricetes, the alphavirus supergroup; Flasuviricetes, which contains flaviviruses; and the Magsaviricetes, which contains nodaviruses. Many of these viruses exclusively replicate in invertebrates, but those that can replicate in animals upon insect transmission are generally favoured as saRNA vectors [1], Self-amplifying RNA vectors retain the core sequence of the virus including the non-structural proteins (NSPs) but replace the viral structural genes with a gene of interest (GDI) appropriate to vaccine or therapeutic indications. Thus, saRNA vectors retain the ability for self-amplification within transduced cells, but do not produce infectious virus. The amplification process provides the potential for saRNA vaccines and therapeutics to be used at a much lower dose than conventional mRNA vectors. While saRNA vaccines have been shown to be far superior to mRNA vaccine candidates in mice models [2], this has not yet been realised in human studies [3], Indeed, mRNA vaccines have been shown to be far more potent after a single vaccination than saRNA in humans [4], while saRNA vaccines can provide comparable boosting [3,4],
[0004] There are two important differences in these different technologies. Firstly, mRNA typically encodes sequences that have been codon optimised for the host species, therefore also representing a CpG dinucleotide frequency representative of the host. Secondly, mRNA is typically modified with N-l-pseudouridine (in place of uridine) to ablate or reduce the innate interferon response to exogenous RNA when delivered into the cytoplasm of transduced cells [5], By contrast, the backbone sequence of saRNA vectors is derived from viral sequences with CpG frequencies that are very different to those of humans. Furthermore, the use of N-l pseudouridine is not compatible with saRNA amplification. It is widely recognised that the induction of innate responses to naked RNA can impact on transgene expression, both by suppressing RNA translation and increasing the activity RNA degradation pathways. The relatively poor performance of saRNA vaccines in humans relative to mice likely reflects significant differences in innate activation and downstream effector functions between rodent species and larger animals and in particular humans and non-human primates [6], Furthermore, for many mosquito-transmitted ssRNA viruses, selective pressures driven by the endemic transmission cycle between mosquitos and rodent species have influenced genomic sequence evolution. Indeed, many sequence elements retained in the wild-type sequence of ssRNA positive viral genomes, such as high CpG and UpA frequency, codon bias and repeat sequence elements while optimal for the dual mosquito-rodent life-cycle, are likely suboptimal for replication in humans and non- human primates
[0032] , This reflects the vastly different adaptive pressures between dual host life cycles (mosquito-rodent) compared with single host (human adapted viruses due to hundreds of millions of years of separate evolution
[0041] ,
[0005] There is, therefore, a need to overcome the problems in the art, and provide novel RNA molecules which overcome the current limitations of saRNA in humans and larger animals.
[0006] The inventors generated and tested CpG-modified self-amplifying saRNA vectors having an expression cassette, which have reduced or depleted concentrations of CpG dinucleotides relative compared to their corresponding wild type RNA sequence. They found that there was a surprisingly enhanced expression by an saRNA vector in human skin and in the presence of an innate interferon response in mice. In addition, the inventors have generated data using non-human primates (NHP) in which the CpG- modified saRNA constructs showed surprisingly improved immunogenicity compared to the corresponding wild-type parenteral saRNA with normal (i.e. elevated) CpG levels. Furthermore, rather than matching the average genomic CpG dinucleotide composition of humans, the inventors minimised the CpG content in saRNA such that expression may be favoured during the innate response to the vector itself.
[0007] The inventors discovered that maximizing CpG depletion to an O / E of below 0.15, and ideally <0.06, levels present in fewer than 0.25% of human mRNA transcripts (and even lower than those found in all known human viruses) surprisingly results in both enhanced gene expression and increased resistance to interferon-mediated suppression
[0031] , By significantly reducing the CpG content in saRNA (typically longer RNA molecules, and much longer than mRNA), the inventors have exceeded the naturally suppressed CpG composition of human interferon-stimulated genes (ISGs), which encode antiviral proteins. This suppression is believed to enable ISGs to evade self-targeting mechanisms during an interferon response, unlike interferon-repressed genes (IRGs), which are selectively silenced
[0031] , However, surprisingly, optimal replication of VEEV was achieved by extreme reductions in CpG frequency that matches or is lower than many type I interferon mRNA, that have the most suppressed CpG frequencies of all human transcripts. The innovation to achieve (low) CpG levels that are only seen in type 1 Interferon mRNA transcripts enables saRNA to avoid non-self recognition and interferon resistance, thereby highlighting the uniqueness of this approach.
[0008] Moreover, as described in the Examples, the uniqueness of the invention is the achieved level of CpG reduction observed with CpG-R and CpG-F saRNA, because no human mRNA transcript exists that has such a low frequency for such a long RNA sequence. Indeed, the longest human mRNA transcript with an O / E <0.133 is only 7.175 Kb long (analogous to CpG-low), <0.06 is only 3.840 kb longer (analogous to CpG-R) and 0.046 is only 2.712 Kb long (analogous to CpG-F), whereas saRNA molecules can be much longer than 7.1 Kb. Therefore, the inventors have developed saRNA sequences with CpG frequencies that are so differentiated that they have no equivalence in either any human viral pathogen or human mRNA transcript.
[0009] Through these surprising observations, the inventors have designed novel saRNA constructs that share the unique sequence properties of type I interferon transcripts, allowing them to occupy a less-targeted sequence space. As a result, these constructs exhibit enhanced expression and increased resistance to interferon-mediated repression in transduced cells, representing a significant advancement in gene expression optimization under antiviral conditions. This inventive approach, therefore, endows the saRNA molecule with enhanced expression such that it has improved utility in humans as a potent vaccine and therapeutic platform.
[0010] Therefore, in a first aspect of the invention, there is provided a modified self- amplifying RNA (saRNA) molecule comprising a CpG-reduced or CpG-depleted RNA sequence compared to an unmodified, wild-type RNA sequence.
[0011] As discussed above, saRNA is a novel platform that has potential as a highly potent approach for the delivery of vaccines and therapeutics at much lower doses than conventional mRNA, and provides prolonged protein expression for weeks. However, although showing superiority to mRNA vaccines in small animal models, early clinical trials with saRNA failed to demonstrate this benefit. There are significant differences between saRNA and human RNA with respect to the use frequency of the four-base nucleic acid code: A, C, G and U. Human RNA suppresses the frequency of a C followed by a G (a cytosine followed by a guanine), known as the CpG content
[0031] , By contrast, saRNA has a higher CpG content than that observed in humans, and this renders the saRNA sequence prone to degradation in human cells. The inventors have surprisingly found that significant reduction of the CpG content to a O / E of <0.133 in saRNA promotes enhanced expression in human cells, this is further enhanced when reduced to O / E values <0.6. Furthermore, minimising the CpG content below an O / E of 0.06 in saRNA maximises its expression and surprisingly increases its interferon resistance. Intrig ui ng ly, however, minimising CpG content to less than a O / E of 0.06 in mRNA did not have the same beneficial effect as it did for saRNA. In this respect, although not wishing to be bound by hypothesis, this unexpected improvement in expression of saRNA at levels below a O / E of 0.133 and ideally below 0.06 may (compared to mRNA) be a result of saRNA's known ability to trigger interferon responses. Here, reduction of CpG frequency to levels associated with saRNAs induction of interferon stimulated genes would increase its resistance to interferon driven repression. In other words, since saRNA is strong driver of interferon response (and most, likely more than mRNA), saRNA gains more benefit from CpG reduction making it more resistance to its self-induced interferon suppression. This inventive approach, therefore, is thought to endow saRNA with improved utility as a potent vaccine and therapeutic platform for human health.
[0012] As shown in Figure 1, the inventors observed surprisingly robust expression from the CpG-low saRNA construct according to the invention relative to the control in human skin. In addition, Figure 2 illustrates the unexpected finding that CpG saRNA is significantly resistant to suppression by innate priming with interferon inducer polyinosinic acid-polycytidylic acid (poly-I:C) in small animal studies
[0042] . Furthermore, Figure 3 illustrates the unexpected ability of the saRNA-induced antibodies to neutralise SARS-CoV-2 in non-human primates (NHPs), particularly after the boost administration of the saRNA molecule. The other data collectively show that extreme CpG reduction (to levels less than a O / E of 0.15% and ideally <0.06%) is highly advantageous for saRNA expression, but not mRNA. Furthermore, the extent of the reduction and its innovation is illustrated by comparison to CpG levels seen in interferon stimulated genes and type I interferon transcripts (see Figure 15). Here, the inventors have met or exceeded reduced CpG frequency seen in interferon stimulated genes and matched the frequency see in type I interferon transcripts that have the most suppressed CpG frequency of all human mRNA transcripts. These data remarkably contrast with previous reports in the literature to improve saRNA expression which included the use modified nucleotides [7,8], amino acid substitution mutations in the non -structural proteins [9-14], and encoding modulators of the innate immune response [15, 16], The CpG-modified self-amplifying saRNA vectors also differ to approaches that have focused on modifying the genome to make the transcribed subgenomic RNA additionally amplifiable by viral replication enzymes
[0017] or use trans-amplification configurations
[0018] , While the discovered CpG modified vector improves expression of saRNA in its own right, it could be used in combination with any of these previous strategies to improve expression.
[0013] To date, there has been no demonstration of the use of CpG reduced / depleted saRNA or for any single-stranded positive RNA virus. The invention is based on the inventors' appreciation that small animal models are not predictive of the shortcomings of saRNA and therefore the need for improvement of the backbone by CpG modification would not have been an obvious step, providing little benefit in small animal preclinical models. Previous work has shown that increasing the CpG content can attenuate infectious virus, demonstrated for Zika virus and Echovirus 7. The use of reduced CpG content has previously been tried to increase the expression of DNA plasmids
[0043] and recombinant adeno-associated virus (AAV)
[0044] , which is a DNA viral vector. However, CpG motifs in DNA can be silenced by methylation and are potent activators of TLR9, and so the mechanisms disfavouring CpG content in DNA vectors are likely to be different than for RNA vectors
[0043] , A further non-obvious feature of the saRNA molecule of the invention is rather than to match CpG frequency to the average seen in the human RNA transcriptome, is to minimise and ideally eliminate CpG dinucleotides altogether. Minimising the CpG content in saRNA favours expression during innate response to the vector itself
[0031] , A non-obvious aspect of the invention is minimizing the GpG content to such a great extent (i.e. a O / E of <0.15, or ideally <0.06) that it exceeds the naturally suppressed CpG composition of human interferon- stimulated genes (ISGs) and matches the CpG composition of type I interferon transcripts, represented by <0.25% mRNA transcripts. Through maximal reduction of CpG content, particularly in saRNA molecules longer that 2kb or more, the inventors have designed novel saRNA constructs that share the unique sequence properties of type I interferon transcripts, allowing them to occupy a less targeted sequence space. Surprisingly, the inventors did not observe the same effects in mRNA. As a result, the saRNA constructs of the invention exhibit enhanced expression and increased resistance to interferon-mediated repression in transduced cells, representing a significant advancement in gene expression optimization under antiviral conditions. In addition, yet a further non-obvious aspect of the invention relates to the fact that CpG deletion from saRNA requires specific knowledge and expertise in sequence design. Alteration of CpG frequencies in saRNA inevitably involves extensive sequence modification, and such changes may have the secondary effect of introducing normally unfavoured codons or codon pairs into the saRNA vector, thereby reducing translation rates that may impair saRNA amplification and transgene expression. Furthermore, inevitable changes in RNA secondary structure may directly impact on the functionality of saRNA with respect to RNA amplification and establishment of membranous structures (or spherules) generated during the amplification process. Thus, reduction and / or depletion of CpG content requires specific design innovation to both maintain important RNA secondary structure and maintain or enhance amplification and / or translation leading enhanced transgene(s) expression. Thus, the approach described herein which minimises and ideally deletes CpG dinucleotides from saRNA vectors is very specific and highly unique.
[0014] Existing technologies rely on the use of modified nucleotides to enhance expression in the face of an innate interferon response. However, these modifications are lost with the first round of RNA amplification. In contrast, the sequence modifications described herein are integral to the RNA and therefore would be present throughout the amplification process to thereby ensure the improved properties endowed by reduced CpG content are functional throughout the amplification process leading to enhanced gene expression.
[0015] As used herein, a cytosine monophosphate (C) followed by a guanine monophosphate (G) in a nucleotide sequence is referred to as a CpG dinucleotide.
[0016] The saRNA molecule may comprise or be derived from a single-stranded positive RNA virus (ss+ RNA). The saRNA molecule may comprise or be derived from a single- stranded positive genome from one of the following three phyla: Kitrinoviricota, Lenarviricota, and Pisuviricota.
[0017] The phylum Kitrinoviricota includes four phylum, i.e. Alsuviricetes, the alphavirus supergroup; Flasuviricetes, which contains flaviviruses, Magsaviricetes, which contains nodaviruses and sinhaliviruses; and Tolucaviricetes, which primarily contains plant viruses. The phylum Lenarviricota contains the class Leviviricetes and their relative, Amabiliviricetes, which contains narnaviruses and their relatives, Howeltoviricetes, which contains mitoviruses and their relatives, and Miaviricetes, which contains botourmiaviruses and their relatives. The phylum Pisuviricota includes Pisoniviricetes, which contains nidoviruses, picornaviruses, and sobeliviruses, and Stelpaviricetes, which contains potyviruses and astroviruses.
[0034] , In addition to alphavirus-based saRNA vectors, a number of expression vectors based on flaviviruses such as Kunjin virus, West Nile virus, yellow fever virus, dengue virus, and tick-borne encephalitis virus [1] have been generated. In addition, nodavirus replicon vectors have also been generated
[0036] ,
[0018] Accordingly, the saRNA molecule may comprise or be derived from a single-stranded positive RNA virus selected from the group of genus consisting of: alphavirus; picornavirus; flavivirus; rubivirus; pestivirus; hepacivirus; nodavirus; calicivirus and coronavirus.
[0019] The saRNA molecule may comprise or be derived from a flavivirus. Thus, in one embodiment, the saRNA molecule comprises or is derived from Kunjin virus.
[0020] The saRNA molecule may also comprise or be derived from a Nodavirus. Thus, in a further embodiment, the saRNA may also compromise or be derived from a Nodamura virus.
[0021] In another embodiment, however, the saRNA molecule comprises or is derived from an alphavirus. Suitable wild-type alphavirus sequences are well-known.
[0022] Representative examples of suitable alphaviruses may include Aura, Bebaru virus, Cabassou, Chikungunya virus, Eastern equine encephalomyelitis virus, Fort Morgan, Getah virus, Kyzylagach, Mayaro, Mayaro virus, Middleburg, Mucambo virus, Ndumu, Pixuna virus, Ross River virus, Semliki Forest virus, Si nd bis virus, Tonate, Triniti, Una, Venezuelan equine encephalomyelitis virus (VEEV), Western equine encephalomyelitis, Whataroa, and Y-62-33. Therefore, the saRNA molecule may comprise or be derived from any of these alphaviruses.
[0023] In one embodiment, the saRNA molecule comprises or is based on an alphavirus backbone, for example Venezuelan Equine Encephalitis virus, Semliki Forest Virus, or Chikungunya virus. Thus, typically the saRNA molecule comprises or is derived from VEEV.
[0024] The term "parenteral", "reference" or "wild type sequence" refers to the parental viral sequence(s) from which the original saRNA vector is derived by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank®, PubMed®, or the like. Examples of parental alphavirus sequences for saRNA vectors derived from Venezuelan Equine Encephalitis (VEEV) virus can be found using the following accession numbers:
[0025] J04332.1, NC_075022.1, L01443.1, KR260736.1, KC344516.1, MZ399798.1,
[0026] MZ399799.1, KC344485.2, AY741139.1, KC344505.2, AF069903.1, KC344483.2,
[0027] KC344517.1, KC344430.1, KC344502.1, KC344486.1, KC344524.1, KC344484.1,
[0028] KC344525.1, KC344509.1, KC344519.1, KC344508.1, KC344520.1, KC344487.1,
[0029] KC344477.1, NC_001449.1, L04653.1, KC344514.1, U55342.2, KF985959.1,
[0030] KC344429.1, KC344528.1, U55345.2, AF375051.1, U55350.2, U55362.2,
[0031] KC344512.1, U55347.2, KC344462.1, KC344460.1, AY986475.1, AY973944.1,
[0032] KP282671.1, KC344459.1, KC344523.1, KC344521.1, KC344522.1, KC344461.2,
[0033] KC344506.1, KC344518.1, KC344471.1, KC344474.1, OR644811.1, OR644810.1,
[0034] KC344490.1, OR644807.1, OR644806.1, OR644782.1, KC344526.1, OR644809.1,
[0035] OR644795.1, KC344511.1, KC344475.1, KC344488.2, OR644784.1, OR644812.1,
[0036] OR644802.1, OR644808.1, OR644801.1, OR644783.1, DQ390224.2, OR644785.1,
[0037] KC344510.1, OR644804.1, OR644803.1, OR644796.1, OR644793.1, OR644794.1,
[0038] OR644792.1, OR644797.1, KC344472.1, OR644799.1, OR644798.1, OR644790.1,
[0039] OR644789.1, OR644800.1, KC344473.2, MF590066.1, OR644791.1, KC344503.2,
[0040] KC344504.2, KC344507.2.
[0041] Examples of parental alphavirus sequences for saRNA vectors derived from Semliki Forest Virus (SFV) can be found using the following accession numbers: NC_003215. 1, X04129.1, MH426977.1, KT009012.1, KP271965.1, AY112987.1, EU350586.1, MK280688.1, MH880789.1, X74424.1, X74425.1, V01399.1, X74423.1, KP699763.1.
[0042] Examples of parental alphavirus sequences for saRNA vectors derived from Chikungunya virus (CHIKV) can be found using the following accession numbers: MH229986.1, KX702402.1, KX702401.1, MT526807.1, MT526806.1, MT526805.1, MT526804.1, MT526803.1, MT526802.1, MT526801.1, MT526800.1, MT526799.1, MT526798.1, MT526797.1, MT526796.1, MK028840.1, MK028839.1, MK028838.1, MK028837.1, MK028836.1, FN295483.3, FN295485.3, FN295487.2, FN295484.2, JF274082.1, OR715104.1, OQ567725.1, OQ567724.1, OQ567723.1, OQ567722.1, OQ775507. 1-OQ775567.1.
[0043] Examples of parental flavivirus sequences for saRNA vectors derived from Kunjin virus can be found using the following accession numbers: KT934796.1, KT934797.1, KT934798.1, KT934799.1, KT934800.1, KT934801.1, KT934802.1, KT934803.1,
[0044] KT934804.1, KX394389.1.
[0045] Similar sequences for a number of additional expression vectors based on flaviviruses, such as West Nile virus, yellow fever virus, dengue virus, and tick-borne encephalitis virus can also be found through GenBank or the like.
[0046] Examples of parental nodavirus sequences for saRNA vectors can be found using the following accession numbers: Flock house virus (accession X77156), black beetle virus (accession X02396 & K02560), striped jack nervous necrosis virus (AB025018), pariacoto virus (AF171942), nodamura virus (AF174533), black beetle virus (NC- 001411), and halibut nervous necrosis virus (AJ401165).
[0047] In one embodiment, the saRNA molecule of the invention may comprise a sequence of an alphavirus self-amplifying RNA (saRNA) vector and a transgene, which encodes a therapeutic biomolecule.
[0048] The transgene may be a nucleic acid sequence, exogenous to the saRNA sequences flanking the transgene. In one embodiment, the transgene comprises a nucleic acid sequence, e.g., an RNA. Desirable RNA molecules include an RNA sequence coding for a specific protein, a non-coding RNA sequence, RNAi, ribosomal RNA, catalytic RNAs, siRNA, small hairpin RNA, trans-splicing RNA, and antisense RNAs. One example of a useful RNA sequence is a sequence encoding a functional protein designed to elicit an immune response. Typically, suitable target sequences include oncologic targets and pathogenic organisms which result in bacterial or viral diseases. This may be useful, e.g., for cancer therapies and vaccines. In another example, the transgene RNA sequence may encode a therapeutic protein e.g. for protein replacement / supplementation.
[0049] Thus, the therapeutic biomolecule may comprise a therapeutic protein. The skilled person would understand that "therapeutic protein" relates to any protein that has therapeutic application, preferably in human. Exemplary therapeutic biomolecules that can be encoded by the saRNA molecule of the first aspect include proteins or peptides derived from pathogens, such as bacteria, viruses, fungi, protozoa / or parasites. The protein or peptide may be an antigen, and therefore one which may stimulate or trigger an immune response in a host organism. Hence, in the embodiment in which the at least one therapeutic biomolecule is an antigen, the saRNA construct of the first aspect may be regarded as a vaccine. The protein or peptide derived from a virus may be a viral antigen. The viral antigen may be derived from a virus selected from the group consisting of: Orthomyxoviruses; Paramyxoviridae viruses; Metapneumovirus and Morbilliviruses; Pneumoviruses;
[0050] Paramyxoviruses; Poxviridae; Metapneumoviruses; Morbilliviruses; Picornaviruses;
[0051] Enteroviruseses; Bunyaviruses; Phlebovirus; Nairovirus; Heparnaviruses; Togaviruses; Alphavirus; Arterivirus; Flaviviruses; Pestiviruses; Hepadnaviruses; Rhabdoviruses;
[0052] Caliciviridae; Coronaviruses; Retroviruses; Reoviruses; Parvoviruses; Delta hepatitis virus (HDV); Hepatitis E virus (HEV); Human Herpesviruses and Papovaviruses.
[0053] The Orthomyxoviruses may be Influenza A, B and C. The Paramyxoviridae virus may be Pneumoviruses (RSV), Paramyxoviruses (PIV). The Metapneumovirus may be Morbilliviruses (e.g., measles). The Pneumovirus may be Respiratory syncytial virus (RSV), Bovine respiratory syncytial virus, Pneumonia virus of mice, or Turkey rhinotracheitis virus. The Paramyxovirus may be Parainfluenza virus types 1 - 4 (PIV), Mumps, Sendai viruses, Simian virus 5, Bovine parainfluenza virus, Nipahvirus, Henipavirus or Newcastle disease virus. The Poxviridae may be Variola vera, for example Variola major and Variola minor. The Metapneumovirus may be human metapneumovirus (hMPV) or avian metapneumoviruses (aMPV). The Morbillivirus may be measles. The Picornaviruses may be Enteroviruses, Rhinoviruses, Heparnavirus, Parechovirus, Cardioviruses and Aphthovi ruses. The Enteroviruses may be Poliovirus types 1, 2 or 3, Coxsackie A virus types 1 to 22 and 24, Coxsackie B virus types 1 to 6, Echovirus (ECHO) virus) types 1 to 9, 11 to 27 and 29 to 34 or Enterovirus 68 to 71. The Bunyavirus may be California encephalitis virus. The Phlebovirus may be Rift Valley Fever virus. The Nairovirus may be Crimean-Congo hemorrhagic fever virus. The Heparnaviruses may be Hepatitis A virus (HAV). The Togaviruses may be Rubivirus. The Flavivirus may be Tick-borne encephalitis (TBE) virus, Dengue (types 1, 2, 3 or 4) virus, Yellow Fever virus, Japanese encephalitis virus, Kyasanur Forest Virus, West Nile encephalitis virus, St. Louis encephalitis virus, Russian spring-summer encephalitis virus or Powassan encephalitis virus. The Pestivirus may be Bovine viral diarrhea (BVDV), Classical swine fever (CSFV) or Border disease (BDV). The Hepadnavirus may be Hepatitis B virus or Hepatitis C virus. The Rhabdovirus may be Lyssavirus (Rabies virus) or Vesiculovirus (VSV). The Caliciviridae may be Norwalk virus, or Norwalk-like Viruses, such as Hawaii Virus and Snow Mountain Virus. The Coronavirus may be SARS CoV-1, SARS-CoV-2, MERS, Human respiratory coronavirus, Avian infectious bronchitis (IBV), Mouse hepatitis virus (MHV), or Porcine transmissible gastroenteritis virus (TGEV). The Retrovirus may be Oncovirus, a Lentivirus or a Spumavirus. The Reovirus may be an Orthoreo virus, a Rotavirus, an Orbivirus, or a Coltivirus. The Parvovirus may be Parvovirus B 19. The Human Herpesvirus may be Herpes Simplex Viruses (HSV), Varicella-zoster virus (VZV), Epstein-Barr virus (EBV), Cytomegalovirus (CMV), Human Herpesvirus 6 (HHV6), Human Herpesvirus 7 (HHV7), or Human Herpesvirus 8 (HHV8). The Papovavirus may be Papilloma viruses, Polyomaviruses, Adenoviruess or Arenaviruses.
[0054] The protein or peptide derived from bacteria may be a bacterial antigen. The bacterial antigen may derived from a bacterium selected from the group consisting of: Neisseria meningitides, Streptococcus pneumoniae, Streptococcus pyogenes, Moraxella catarrhalis, Bordetella pertussis, Burkholderia sp. (e.g., Burkholderia mallei, Burkholderia pseudomallei and Burkholderia cepacia), Staphylococcus aureus, Haemophilus influenzae, Clostridium tetani (Tetanus), Clostridium perfringens, Clostridium botulinums, Cornynebacterium diphtheriae (Diphtheria), Pseudomonas aeruginosa, Legionella pneumophila, Coxiella burnetii, Brucella sp. (e.g., B. abortus, B. canis, B. melitensis, B. neotomae, B. ovis, B. suis and B. pinnipediae, Francisella sp. (e.g., F. novicida, F. philomiragia and F. tularensis), Streptococcus agalactiae, Neiserria gonorrhoeae, Chlamydia trachomatis, Treponema pallidum (Syphilis), Haemophilus ducreyi, Enterococcus faecalis, Enterococcus faecium, Helicobacter pylori, Staphylococcus saprophyticus, Yersinia enter ocolitica, E. coli, Bacillus anthracis (anthrax), Yersinia pestis (plague), Mycobacterium tuberculosis, Rickettsia, Listeria, Chlamydia pneumoniae, Vibrio cholerae, Salmonella typhi (typhoid fever), Borrelia burgdorfer, Porphyromonas s and Klebsiella sp.
[0055] The protein or peptide derived from a fungus may be a fungal antigen. The fungal antigen may be derived from a fungus selected from the group consisting of Dermatophytres, including: Epidermophyton koccusum, Microsporum audouini, Microsporum canis, Microsporum distortum, Microsporum equinum, Microsporum gypsum, Microsporum nanum, Trichophyton concentricum, Trichophyton equinum, Trichophyton gallinae, Trichophyton gypseum, Trichophyton megnini, Trichophyton mentagrophytes, Trichophyton quinckeanum, Trichophyton rubrum, Trichophyton schoenleini, Trichophyton tonsurans, Trichophyton verrucosum, T verrucosum var. album, var. discoides, var. ochraceum, Trichophyton violaceum, and / or Trichophyton faviforme; or from Aspergillus fumigatus, Aspergillus kavus, Aspergillus niger, Aspergillus nidulans, Aspergillus terreus, Aspergillus sydowi, Aspergillus kavatus, Aspergillus glaucus, Blastoschizomyces capitatus, Candida albicans, Candida enolase, Candida tropicalis, Candida glabrata, Candida krusei, Candida parapsilosis, Candida stellatoidea, Candida kusei, Candida parakwsei, Candida lusitaniae, Candida pseudotropicalis, Candida guilliermondi, Cladosporium carrionii, Coccidioides immitis, Blastomyces dermatidis, Cryptococcus neoformans, Geotrichum clavatum, Histoplasma capsulatum, Klebsiella pneumoniae, Microsporidia, Encephalitozoon spp., Septata intestinalis and Enterocytozoon bieneusi; Brachiola spp, Microsporidium spp., Nosema spp., Pleistophora spp.,Trachipleistophora spp., Vitta forma spp Paracoccidioides brasiliensis, Pneumocystis carinii, Pythiumn insidiosum, Pityrosporum ovale, Sacharomyces cerevisiae, Saccharomyces boulardii, Saccharomyces pombe, Scedosporium apiosperum, Sporothrix schenckii, Trichosporon beigelii, Toxoplasma gondii, Penicillium marneffei, Malassezia spp., Fonsecaea spp., Wangiella spp., Sporothrix spp., Basidiobolus spp., Conidiobolus spp., Rhizopus spp, Mucor spp, Absidia spp, Mortierella spp, Cunninghamella spp, Saksenaea spp., Alternaria spp, Curvularia spp, Helminthosporium spp, Fusarium spp, Aspergillus spp, Penicillium spp, Monolinia spp, Rhizoctonia spp, Paecilomyces spp, Pithomyces spp, and Cladosporium spp.
[0056] The protein or peptide derived from a protozoan may be a protozoan antigen. The protozoan antigen may be derived from a protozoan selected from the group consisting of: Entamoeba histolytica, Giardia lambli, Cryptosporidium parvum, Cyclospora cayatanensis and Toxoplasma.
[0057] The therapeutic biomolecule may be a protein or peptide derived from a plant. In some embodiments, the protein or peptide is a plant antigen. For example, the plant antigen may be derived from Ricinus communis.
[0058] In another embodiment, the therapeutic biomolecule may be an immunogen or an antigen. In some embodiments, the immunogen or an antigen is a tumour immunogen or antigen, or cancer immunogen or antigen. The tumour immunogens and antigens may be peptide-containing tumour antigens, such as a polypeptide tumour antigen or glycoprotein tumour antigens.
[0059] The tumour antigens may be (a) full length molecules associated with cancer cells, (b) homologs and modified forms of the same, including molecules with deleted, added and / or substituted portions, and (c) fragments of the same.
[0060] Suitable tumour immunogens include: class I-restricted antigens recognized by CD8+ lymphocytes or class Il-restricted antigens recognized by CD4+ lymphocytes.
[0061] The tumour antigen may be an antigen that is associated with a cancer selected from the group consisting of: a testis cancer, melanoma, lung cancer, head and neck cancer, NSCLC, breast cancer, gastrointestinal cancer, bladder cancer, colorectal cancer, pancreatic cancer, lymphoma, leukaemia, renal cancer, hepatoma, ovarian cancer, gastric cancer and prostate cancer.
[0062] The tumour antigen may be selected from:
[0063] (a) cancer-testis antigens, such as NY-ESO-I, SSX2, SCP-1, as well as RAGE, BAGE, GAGE and MAGE family polypeptides, for example, GAGE-I, GAGE-2, MAGE-I, MAGE-2, MAGE-3, MAGE-4, MAGE-5, MAGE-6, and MAGE-12 (which can be used, for example, to address melanoma, lung, head and neck, NSCLC, breast, gastrointestinal, and bladder tumours);
[0064] (b) mutated antigens, for example, p53 (associated with various solid tumours, e.g., colorectal, lung, head and neck cancer), p21 / Ras (associated with, e.g., melanoma, pancreatic cancer and colorectal cancer), CDK4 (associated with, e.g., melanoma), MUM- 1 (associated with, e.g., melanoma), caspase-8 (associated with, e.g., head and neck cancer), CIA 0205 (associated with, e.g., bladder cancer), HLA-A2-R1701, beta catenin (associated with, e.g., melanoma), TCR (associated with, e.g., T- cell non-Hodgkins lymphoma), BCR-abl (associated with, e.g., chronic myelogenous leukaemia), triosephosphate isomerase, KIA 0205, CDC-27, and LDLR-FUT;
[0065] (c) over-expressed antigens, for example, Galectin 4 (associated with, e.g., colorectal cancer), Galectin 9 (associated with, e.g., Hodgkin's disease), proteinase 3 (associated with, e.g., chronic myelogenous leukemia), WT 1 (associated with, e.g., various leukaemias), carbonic anhydrase (associated with, e.g., renal cancer), aldolase A (associated with, e.g., lung cancer), FRAME (associated with, e.g., melanoma), HER- 2 / neu (associated with, e.g., breast, colon, lung and ovarian cancer), alpha-fetoprotein (associated with, e.g., hepatoma), KSA (associated with, e.g., colorectal cancer), gastrin (associated with, e.g., pancreatic and gastric cancer), telomerase catalytic protein, MUC- I (associated with, e.g., breast and ovarian cancer), G-250 (associated with, e.g., renal cell carcinoma), p53 (associated with, e.g., breast, colon cancer), and carcinoembryonic antigen (associated with, e.g., breast cancer, lung cancer, and cancers of the gastrointestinal tract such as colorectal cancer);
[0066] (d) shared antigens, for example, melanoma-melanocyte differentiation antigens, such as MART-l / Melan A, gplOO, MCIR, melanocyte-stimulating hormone receptor, tyrosinase, tyrosinase related protein- 1 / TRPI and tyrosinase related protein-2 / TRP2 (associated with, e.g., melanoma); (e) prostate-associated antigens, such as PAP, PSA, PSMA, PSH-PI, PSM-PI, PSM-P2, associated with e.g., prostate cancer; and / or
[0067] (f) immunoglobulin idiotypes (associated with myeloma and B cell lymphomas, for example).
[0068] The therapeutic biomolecule may be a eukaryotic protein or peptide. In one embodiment, the eukaryotic protein or peptide is a mammalian protein or peptide. The mammalian protein or peptide may be selected from the group consisting of: an enzyme; an enzyme inhibitor; a hormone; an immune system protein; a receptor; a binding protein; a transcription factor; translation factor; tumour growth suppressing protein; a structural protein; and a blood protein.
[0069] The immune system protein may be an antibody or antigen binding fragment thereof. Accordingly, the therapeutic biomolecule may be an antibody or antigen binding fragment thereof, e.g. IgG, IgA or IgM etc. The antigen binding fragment may comprise an individual heavy or light chain, or a fragment thereof, such as VL, VH and Fd; a monovalent fragment, such as Fv, Fab, and Fab'; a bivalent fragment, such as F(ab')2; a single chain Fv (scFv); one or more complementarity determining region (CDR); or a Fc fragment.
[0070] The enzyme may be selected from the group consisting of: chymosin; gastric lipase; tissue plasminogen activator; streptokinase; a cholesterol biosynthetic or degradative steriodogenic enzyme; kinases; phosphodiesterases; methylases; de-methylases; dehydrogenases; cellulases; proteases; lipases; phospholipases; aromatases; cytochromes; adenylate or guanylate cyclases and neuramidases.
[0071] The enzyme inhibitor may be tissue inhibitor of metalloproteinase (TIMP). The hormone may be growth hormone.
[0072] The immune system protein may be selected from the group consisting of: a cytokine; a chemokine; a lymphokine; erythropoietin; an integrin; addressin; selectin; homing receptors; T cell receptors and immunoglobulins.
[0073] The cytokine may be an interleukin, for example IL-2, IL-4 and / or IL-6, colony stimulating factor (CSF), granulocyte colony stimulating factor (G- CSF), granulocyte- macrophage colony stimulating factor (GM-CSF) or tumour necrosis factor (TNF). The chemokine may be a macrophage inflammatory protein-2 and / or a plasminogen activator.
[0074] The lymphokine may be an interferon.
[0075] The immunoglobulin may be a natural, modified or chimeric immunoglobulin or a fragment thereof. Preferably, the immunoglobulin is a chimeric immunoglobulin having dual activity such as antibody enzyme or antibody-toxin chimera.
[0076] The hormone may be selected from the group consisting of: insulin, thyroid hormone, catecholamines, gonadotrophines, trophic hormones, prolactin, oxytocin, dopamine, bovine somatotropin, leptins; growth hormones (e.g., human grown hormone), growth factors (e.g., epidermal growth factor, nerve growth factor, insulin-like growth factor and the like).
[0077] The receptor may be a steroid hormone receptor or a peptide receptor. Preferably, the receptor is a growth factor receptor.
[0078] The binding protein may be a growth factor binding protein.
[0079] The tumour growth suppressing protein may be a protein that inhibits angiogenesis.
[0080] The structural protein may be selected from the group consisting of: collagen; fibroin; fibrinogen; elastin; tubulin; actin; and myosin.
[0081] The blood protein may be selected from the group consisting of thrombin; serum albumin; Factor VII; Factor VIII; insulin; Factor IX; Factor X; tissue plasminogen activator; protein C; von Willebrand factor; antithrombin III; glucocerebrosidase; erythropoietin granulocyte colony stimulating factor (GCSF) or modified Factor VIII; and anticoagulants.
[0082] In one embodiment, the therapeutic biomolecule is a cytokine which is capable of regulating lymphoid homeostasis, for example a cytokine which is involved in and may induce or enhance development, priming, expansion, differentiation and / or survival of T cells. Thus, the cytokine may be an interleukin, such as IL-2, IL-7, IL-12, IL-15, or IL-21.
[0083] The therapeutic biomolecule may be protein that is capable of enhancing reprogramming of somatic cells to cells having stem cell characteristics. The protein that is capable of enhancing reprogramming of somatic cells to cells having stem cell characteristics may be selected from the group consisting of: OCT4, SOX2, NANOG, LIN28, p53, ART-4, BAGE, ss- catenin / m, Bcr-abL CAMEL, CAP-1, CASP-8, CDC27 / m, CD 4 / m, CEA, CLAUDIN-12, c- MYC, CT, Cyp-B, DAM, ELF2M, ETV6-AML1, G250, GAGE, GnT-V, GaplOO, HAGE, HER-2 / neu, HPV-E7, HPV-E6, HAST-2, hTERT (or hTRT), LAGE, LDLR / FUT, MAGE-A, MAGE-B, MAGE- C, MART- 1 / Melan- A, MC1R, Myosin / m, MUC1, MUM-1, -2, -3, NA88-A, NF1, NY-ESO- 1, NY-BR-1, pl90 minor BCR- abL, Plac-1, Pml / RARa, FRAME, proteinase 3, PSA, PSM, RAGE, RU1 or RU2, SAGE, SART-1 or SART-3, SCGB3A2, SCP1, SCP2, SCP3, SSX, SURVIVIN, TEL / AML1, TPI / m, TRP-1, TRP-2, TRP-2 / INT2, TPTE and WT, preferably WT-1.
[0084] MAGE-A may be selected from the group consisting of: MAGE-A 1, MAGE-A2, MAGE- A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE- A7, MAGE-A8, MAGE-A9, MAGE-A 10, MAGE-A 11, or MAGE-A 12.
[0085] The protein that is capable of enhancing reprogramming of somatic cells to cells having stem cell characteristics may be OCT4, SOX2, LF4; c-MYC; NANOG; or LIN28.
[0086] The therapeutic biomolecule may be a biomolecule that is utilised for the modification of cells ex vivo for cell-therapy indications. Thus, the therapeutic biomolecule may be selected from the group consisting of an immunoglobulin, a T-cell receptor and NK receptor.
[0087] The therapeutic biomolecule may be an RNA molecule that is capable of regulating expression of endogenous host genes, for example an interfering RNA, such as small RNA, siRNA or microRNA.
[0088] The transgene coding sequence is suitably CpG-depleted as described herein and operatively linked to regulatory components in a manner which permits transgene amplification, translation, and / or expression in a host cell. The saRNA molecule may comprise an individual CpG reduced or deleted transgene or multiple transgenes (i.e. polycistronic) using strategies known by those skilled in the art, such as the use of multiple subgenomic promotor sequences (two or more), IRES sequences, or ribosomal skip sites (e.g. T2A, F2A, E2A, P2A, also known as self-cleaving peptides). These may be used in homologous or heterologous combinations and placed downstream or upstream of the native subgenomic promotor. The sequence of the alphavirus saRNA vector may comprise one or more of: a 5'UTR, non-structural proteins (NSP 1-4), a subgenomic promotor, a subgenomic 5'UTR and / or a 3' UTR. However, in an embodiment, the sequence of the alphavirus saRNA vector comprises each of: a 5'UTR, non-structural proteins (NSP 1-4), a subgenomic promotor, a subgenomic 5'UTR and a 3' UTR. The exogenous gene sequence may be placed under the control of the subgenomic promotor which controls expression of the encoded gene product.
[0089] In another embodiment, however, a non-replicating mRNA encoding a GpG depleted sequence of the alphaviral replicase is combined with a CpG depleted transreplicon (TR) RNA coding for the antigen
[0018] ,
[0090] To the extent any portion of the coding sequences for the non-structural proteins are retained (whether native, mutated, or chimeric) in the saRNA vector, they are CpG- depleted and, typically, CpG-free. However, it is not merely sufficient to reduce CpG content across the ss+ RNA (e.g. alphavirus) genome, because maintenance of the secondary structure in specific regions is important for replication of self-amplifying RNA
[0019] including four conserved sequence elements (CSEs)
[0020] , Indeed, the 5'- UTR contains core promoter elements for both minus- and plus-strand synthesis with significant secondary structure essential for its function (CSE-1) [21-24], NSP1 contains a 51 nt long conserved sequence element (CSE-2) with critical stem-loop structures important for RNA amplification [19, 20, 24, 25], CSE-3 comprises the basal promoter for the subgenomic RNA, located at the junction of the two coding regions of the alphavirus genome [18, 20, 26] and includes 19 nt upstream and 2-5 nt downstream of the transcription start site. The complement of this CSE in the negative strand is required for transcription of the subgenomic RNA
[0026] encoding the viral structural proteins. It is also important to maintain the secondary structure of the subgenomic 5'UTR. Similarly, structurally important are the 3'UTR-CSE sequences (CSE4) that act as a promoter in negative-strand RNA synthesis and thereby RNA amplification [20, 24],
[0091] Thus, presence of authentic secondary structural element for the four CSEs is believed to be important to ensure specific RNA amplification by the alphavirus replicase
[0024] , Additional stem-loop secondary conformation within the nsPl or nsP2 coding sequences may influence saRNA amplification and the establishment of membranous structures (or spherules) essential to occlude the double stranded intermediate generated during the amplification process from cytoplasmic antiviral binding proteins [27, 28], Furthermore, RNA secondary structure for alphaviruses that contain a stop- readthrough (opal sequence) between NSP3 and NSP4 (such as VEEV) is also considered to be important for saRNA function
[0029] , Alteration of CpG frequencies in saRNA inevitably involves extensive sequence modification. Such changes may have the secondary effect of introducing normally unfavoured codons or codon pairs in the saRNA vector, reducing translation rates that may impair saRNA amplification and transgene expression. Furthermore, inevitable changes in secondary structure may directly impact on the functionality of saRNA with respect to RNA amplification [20, 24] and establishment of membranous structures (or spherules) generated during the amplification process [16, 28], Thus, reduction and / or depletion of CpG content requires specific design innovation to both maintain important RNA secondary structure and maintain or enhance amplification and / or translation leading enhanced transgene(s) expression.
[0092] While increased CpG content has been previously used to attenuate pathogenic viruses [30, 31], CpG depletion has, to date, never been applied to enhance the functionality of self-amplifying RNA (saRNA) vectors derived from positive-stranded RNA viruses. Furthermore, rather than matching the average genomic CpG dinucleotide composition to that of humans, the saRNA molecules of the invention comprise a reduced or depleted CpG content, such that their expression may be favoured during innate response to the saRNA vector itself and / or the delivery formulation
[0031] ,
[0093] Accordingly, in an embodiment, the saRNA molecule maintains its secondary structure to allow replication of the saRNA, optionally by conserving stem loop structures.
[0094] In some embodiments, the secondary structure of the saRNA molecule is maintained at: (i) one or more conserved sequence element (CSE) selected from CSE1, CSE2, CSE3 and / or CSE4, (II) the 5'-UTR; (ill) the NSP1; (iv) one or more non-structural protein (nsP) selected from nsPl, nsP2, nsP3 and / or nsP4; and / or (v) the 3'-UTR.
[0095] Accordingly, the nucleic acid sequences of one or more, and typically all, of these elements are modified to reduce or eliminate CpG dinucleotides such that the expression of the vector and / or transgene is enhanced as compared to the unmodified (aka wild type) saRNA vector and in particular in the presence of innate interferon responses. In one embodiment, therefore, the transgene sequence comprises a reduced or depleted number of CpG di-nucleotides as compared to the native coding sequence for the gene product.
[0096] In another embodiment, the non-structural protein sequences (NSP1-4) comprise a reduced or depleted number of CpG di-nucleotides as compared to the unmodified, wild-type RNA sequence.
[0097] In still another embodiment, the 5' and / or 3' untranslated sequences comprise a reduced or depleted number of CpG di-nucleotides as compared to the unmodified, wild-type RNA sequence.
[0098] In additional embodiment, the subgenomic promotor comprises a reduced or depleted number of CpG di-nucleotides as compared to the unmodified, wild-type RNA sequence.
[0099] In additional embodiment, the subgenomic 5'UTR comprises a reduced or depleted number of CpG di-nucleotides as compared to the unmodified, wild-type RNA sequence.
[0100] In a further embodiment, the 5' conserved sequence element (CSE-2) comprises a reduced or depleted number of CpG di-nucleotides as compared to the unmodified, wild-type RNA sequence, while maintaining important stem loop structures required for replication.
[0101] In another embodiment one or more, and preferably all, of these elements are modified to maximally reduce or eliminate CpG di-nucleotides.
[0102] One way to evaluate the CpG dinucleotide content of the saRNA molecules of the invention is to use the dinucleotide observed / expected (O / E) odds ratio. The CG dinucleotide O / E ratio can be deduced from the observed number of CpG dinucleotides divided by the product of the frequencies of Cs and Gs present in a given sequence, where an O / E ratio of 1.0 is the expected frequency of occurrence if the RNA's mononucleotides were randomly distributed. Dinucleotides with O / E ratios below 0.72 are considered to be statistically underrepresented. Many positive single stranded RNA (ssRNA+) viruses transmitted by insects (invertebrates) [32, 33, 35], including alphaviruses, have O / E ratios above 0.72. However, the mean CpG O / E odds ratio for human coding sequences is only 0.438, i.e. significantly reduced from a random distribution and significantly lower than that of insect transmitted viruses
[0031] , Importantly, some human interferon genes, which need to be rapidly induced and expressed at high levels during viral infection, are particularly depleted in CpG dinucleotides
[0031] suggesting that expression of genes with a very low CpG content may be favoured during innate response to viral infection.
[0103] As used herein, the phrase "CpG-reduced" or "CpG-depleted" refers to a nucleic acid sequence which is generated, either synthetically or by mutation of a nucleic acid sequence, such that a majority, and ideally all, of the CpG di-nucleotides are removed from the nucleic acid sequence. In some instances, all CpG motifs are removed to provide what is termed herein as "modified CpG-free" sequences. In this respect, the CpG motifs are suitably reduced or eliminated not just in a coding sequence (e.g., non-structural protein (NSP1-4) and the transgene (s)), but also in the non-coding sequences, including, e.g., 5' and 3' untranslated regions (UTRs), the subgenomic promotor, the subgenomic 5'UTR, the polyA, and any other sequences present in the saRNA molecules of the invention . The CpG di-nucleotides may be located within a codon triplet for a selected amino acid. In one embodiment, the CpG di-nucleotides allocated within a codon triplet for a selected amino acid is changed to a codon triplet for the same amino acid lacking a CpG dinucleotide (a synonymous mutation). Table 1 shows the amino acids with their corresponding codons.
[0104] Table 1 - Amino acids and their corresponding codons
[0105] In addition, within the coding region of the alphavirus non-structural proteins, the interface between triplets may also be taken into consideration. For example, if an amino acid triplet ends in a C-nucleotide which is then followed by an amino acid triplet which can start only with a G-nucleotide (e.g., Valine, Glycine, Glutamic Acid, Alanine, Aspartic Acid), then the triplet for the first amino acid triplet may be changed to one which does not end in a C-nucleotide. CpG modification can be performed based on sequence analysis on a codon-by-codon basis. Alternatively, the skilled person may design and / or utilize algorithms or computer programs that modify the parenteral wild-type sequence to reduce or eliminate CpG dinucleotides, to create the saRNA molecules of the invention. Illustrative CpG-depletion of the coding sequences for alphavirus non-structural proteins (NSP1-4) are provided in SEQ ID NO's 3, 4, 39, 40 (VEEV), SEQ ID NO's 61-64 (SFV), SEQ ID NO's 71-72 (CHIKV) and SEQ ID NO's 73-74 (Nodamura).
[0106] In some embodiments, elimination of a CpG dinucleotide may only be achieved by the introduction of an alternative codon that encodes for an alternative (i.e. a non- synonymous mutation) with a conservative amino acid substitution that changes a given amino acid to a different amino acid with similar biochemical properties (e.g. charge, hydrophobicity and size).
[0107] Similarly, non-coding sequences carried within the saRNA molecule, including the 5'- UTR (CSE-1), the 51 nt long conserved sequence element (CSE-2), the subgenomic promoter (SGP), the subgenomic 5' UTR (CSE-3), and 3'UTRs (CSE-4) may be CpG- depleted. However, these sequences should be modified in such a manner that critical elements of the RNA secondary structure are retained. Illustrative CpG-depleted non- coding alphavirus sequences are provided in SEQ ID NO's 53, 54, 55, and 56. Furthermore, the coding region of any exogenous gene sequence (i.e. the transgene), which may be under the control of the subgenomic promotor(s), which controls expression of the gene product of interest, may be modified to significantly reduce or eliminate CpG dinucleotides. Illustrative CpG-depleted exogenous (transgene) coding sequences are provided in SEQ ID NO's: 41-50.
[0108] In some embodiments, the saRNA molecule may be codon optimised. Accordingly, alternative saRNA molecule sequences may be obtained through synthetic or other suitable means, such as codon optimisation by reference to published sequences, such as are available in the literature or in databases such as, e.g., GenBank®, PubMed®, or the like. These parental sequences are the saRNA nucleic acid sequences prior to CpG-depletion via synthetic methods or by site directed mutagenesis.
[0109] Accordingly, in some embodiments, the modified saRNA molecule of the invention may comprise an RNA sequence, which is both: (i) CpG-reduced or CpG-depleted, compared to an unmodified, wild-type RNA sequence; and (ii) codon optimised.
[0110] The wild-type saRNA backbone sequences from known alphaviruses are CpG rich structures from which CpG dinucleotides are reduced according to the invention without significantly impairing their ability for self-amplification and enhanced expression of any gene(s) of interest encoded within the saRNA vector.
[0111] For example, the Venezuelan Equine Encephalitis virus (VEEV) saRNA backbone has a total of 352 CpG dinucleotides with an O / E ratio of 0.76, which is considerably higher than the mean for human mRNA of 0.45. 330 of these CpG dinucleotides are within the NSP coding region, whereas 22 CpG dinucleotides are within the untranslated regions (see SEQ ID NO: 1 (RNA), and SEQ ID NO:2 (DNA)).
[0112] As a second example, the Semliki Forest virus (SFV) saRNA backbone has a total of 473 CpG nucleotides. 450 of these CpG dinucleotides are within the NSP coding region, while 23 CpG nucleotides are within the untranslated regions with an O / E ratio of 0.89 (see SEQ ID NO: 59 (RNA), and SEQ ID NO: 60 (DNA).
[0113] As a third example, the Chikungunya virus (CHKV) saRNA backbone has a total of 404 CpG nucleotides. 384 of these CpG dinucleotides are within the NSP coding region, while 20 CpG nucleotides are within the untranslated regions with an O / E ratio of 0.83 (see SEQ ID NO: 65 (RNA), and SEQ ID NO: 66 (DNA)). In addition, other regulatory sequences are desirably CpG-depleted or rendered CpG- free according to the present invention. Such other regulatory sequences include a variety of elements including, e.g., without limitation, untranslated regions, subgenomic promoter, Conserved sequence elements, conserved stemloop structures etc., within the alphavirus backbone.
[0114] For example, the alphaviral NSPs are under control of the 5' UTR and CSE1, while the product encoded by the exogenous nucleic acid sequence is typically under the control of the subgenomic promoter and / or promoter / enhancer sequence. Furthermore, other non-coding elements are essential to self-amplification of the RNA vector. Desirably, the CpG modifications to the promoters are made in a manner which does not affect the functional characteristics of the promoter and / or enhancer, e.g., without affecting tissue preference.
[0115] In an embodiment, where it may not be possible to remove all CpGs from a given nucleic molecule without negatively affecting a desired function, it may be desirable to concentrate on reducing clusters or concentrations of CpG dinucleotides in the NSP while retaining authentic sequences within the noncoding regions and conserved sequence elements in the NSPs. Indeed, minimal depletion of dinucleotides spaced between 14 and 32 nucleotides can be deleted to improve expression. Here 117 of 356 CpG dinucleotides are deleted, i.e. a 32.9% percent reduction in the total dinucleotide frequency, providing an O / E ratio of 0.54. Illustrative sequences with minimal CpG- depletion in the NSPs are provided in (see SEQ ID NO's 57 and 58).
[0116] However, an O / E ratio of 0.54 is still above the mean for human mRNA, i.e. 0.45. Therefore, in a further embodiment, all CpG dinucleotides within the NSP that can be eliminated while retaining conserved RNA secondary structure within these regions thought to be essential for self-amplification may be deleted. Illustrative coding sequences with maximal CpG-depletion in the coding sequence for the NSPs are provided in SEQ ID NO: 3 (RNA), and SEQ ID NO: 4 (DNA). For example, for VEEV, 330 of 356 CpG dinucleotides are deleted, i.e. 92.7% percent reduction in the total dinucleotide frequency, providing an O / E ratio of 0.12. This ratio is more reflective of human interferon alpha genes, which are rapidly induced and expressed at high levels during viral infection (4) indicating that this very low CpG content may be favoured during innate response to exogenous saRNA itself. Illustrative sequences with maximal CpG-depletion in the NSPs are provided in SEQ ID NO's 3, 4, 39, 40, 51, and 52. In another embodiment, the CpG-depleted NSP coding sequences are further optimised to enhance RNA manufacture by in vitro transcription (removal of polymerase termination motifs), further reduce potential of recognition of UpA binding proteins (UpA reduction), and / or optimisation of codon usage frequency to increase protein production
[0039] , This may include optimisation of codon usage for a specific species (host codon usage bias), for examples human, livestock, or pets, optimisation to increase RNA stability
[0040] , optimisation to enhance RNA manufacturing yield, optimisation to increase ribosomal loading, ribosomal travel, prevent ribosomal stalling and / or reduce RNA decay. Multiple online tools are available for codon optimisation
[0035] , e.g. COOL, OPTIMIZER, GALAXY, EUGENE, CODONWIZARD, CHARMING, SANDSTORM, CAD4BIO, LinearDesign, Ribotree, CDSFold, GeneWiz, DNA2.0 Gene Designer, GeneArt GeneOptimizer Thermofisher and are also provided by gene synthesis companies. Additional computational methods based on deep learning approaches are also being developed. Codon optimisation can also be performed manually. Importantly, any codon optimisation should consider maintenance of any RNA secondary structure critical to the self-amplification process and should therefore reinsert CpG dinucleotides in locations which are required to maintain the RNA secondary structure. Illustrative VEEV sequences of codon optimised, CpG-low in the NSPs are provided in SEQ ID NO: 51 (RNA), and SEQ ID NO: 52 (DNA), also in SEQ ID NO: 87 (RNA), and SEQ ID NO: 88 (DNA).
[0117] In addition to sequences encoding for the NSPs, CpG dinucleotides may be reduced or eliminated in the untranslated and CSE elements either individually, or in combination.
[0118] In one embodiment, therefore, the WT 5' UTR sequence (CSE-1) and 51nt sequence (CSE-2) (see SEQ NO: 5, and 6) may be modified to reduce or eliminate the CpG dinucleotide content. This may be in addition to the NSPs while ensuring RNA secondary structural elements are retained. For example, for VEEV, when combined with SEQ NO: 3 (RNA) or SEQ ID NO: 4 (DNA). 343 of 356 CpG dinucleotides are deleted, i.e. 93.2% percent reduction in the total dinucleotide frequency. Illustrative sequences with maximal CpG-depletion in the 5'UTR are provided in (SEQ No 7-12) and representative modelling of preserved secondary RNA structure.
[0119] In one embodiment where a stop codon (UGA) is present as an NSP3 / NSP4 read- through element
[0029] (SEQ NO: 13 (RNA), 14 (DNA)), this may be replaced with an arginine or alternative appropriate amino acid to facilitate CpG depletion without the requirement for maintenance of the immediate critical downstream secondary structure. In another embodiment, the stop codon may be maintained and the CpG content may be reduced or depleted. Illustrative sequences with maximal CpG- depletion at the NSP3 / 4 interface are provided in SEQ NO: 15 (RNA), 16 (DNA) and representative modelling of preserved secondary RNA structure.
[0120] In a further embodiment, the WT subgenomic promotor and / or subgenomic 5'UTR (CSE-3) (SEQ NO 17 (RNA), 18 (DNA) may be mutated to reduce or eliminate the native CpG dinucleotides content. This can be in addition to the NSPs while ensuring RNA secondary structural elements are retained. For example, for VEEV when combined with SEQ No 3 (RNA) or 4 (DNA), 333 of 356 CpG dinucleotides are deleted, i.e. 93.5% percent reduction in the total dinucleotide frequency. Illustrative sequences with maximal CpG-depletion in the subgenomic promotor and / or subgenomic 5'UTR (CSE-3) are provided in (SEQ No 20-24) and representative modelling of preserved secondary RNA structure.
[0121] In another embodiment, the WT 3' UTR (CSE-4) (SEQ ID No: 25 (RNA) or SEQ ID No: 26 (DNA)) may be mutated to reduce or eliminate native CpG di-nucleotides. This may be in addition to the NSPs while ensuring RNA secondary structural elements are retained. For example, for VEEV when combined with SEQ ID NO: 3 (RNA) and SEQ ID No: 4 (DNA), 336 of 356 CpG dinucleotides are deleted, i.e. 94.4% percent reduction in the total dinucleotide frequency. Illustrative sequences with maximal CpG-depletion in 3'UTR (CSE-4) are provided in (SEQ ID No 27-38) and representative modelling of preserved secondary RNA structure.
[0122] In a further embodiment, two or more elements taken from the untranslated elements, the 51 nt (CSE-2) element and the NSP3 / NSP4 read-through element may be combined with a CpG-depleted NSP sequence. Typically, all of the untranslated elements above and the NSPs are CpG depleted, providing a 100% reduction in total CpG dinucleotide frequency and an O / E ratio of zero. Illustrative sequences with maximal CpG-depletion across the entire saRNA vector are provided in in SEQ ID NO: 53 (RNA), and SEQ ID NO: 54 (DNA).
[0123] In another embodiment, all of the untranslated elements above and the NSPs are CpG depleted, and codon optimised combined with reduction in UpA dinucleotides. Illustrative codon optimised sequences with maximal CpG-depletion across the entire saRNA vector are provided in SEQ ID No: 55 (RNA) and SEQ ID No: 56 (DNA).
[0124] In a further embodiment, the majority of the CpG and UpA dinucleotides in the coding regions of the saRNA backbone represented by the codon optimised CpG-R VEEV saRNA sequence illustrated herein as SEQ ID No: 89 (RNA) and 90 (DNA). The codon optimised CpG-Low, UpA-Low VEEV saRNA sequence comprises 27 CpGs (O / E: 0.059) i.e. a 92.6% reduction in CpGs and 127 UpAs (O / E: 0.25).
[0125] In another embodiment, the majority of the CpG dinucleotides are eliminated and UpA dinucleotides reduced in the coding regions of the saRNA backbone represented by the codon optimised CpG-F saRNA sequence illustrated herein as SEQ ID No: 91, below. The codon optimised CpG-Low, UpA-Low VEEV saRNA sequence comprises 21 CpGs (O / E: 0.046), i.e. a 94% reduction in CpGs and 127 UpAs (O / E: 0.25).
[0126] In another embodiment, alternative SFV or CHIKV saRNA backbones can be modified to generate CpG-low variants: SEQ ID NO: 61, and 62 (SFV), and SEQ ID NO: 67, and 68 (CHIKV) with O / E ratios of 0.04, and 0.005, respectively. In a further embodiment, SFV or CHIKV saRNA backbones can be modified to generate maximally reduced CpG variants: SEQ NO 63, 64 (SFV), 69, 70 (CHIKV) with O / E ratios of 0.005 and 0.0045 respectively.
[0127] In further embodiments, CpG-low SFV saRNA (SEQ ID No 61 / 62 can also include elements of modified 5' UTRs, 3' UTRs and subgenomic regions as illustrated by SEQ Nos 103 / 104, 105 / 106, 107 / 108, 109 / 110, 111 / 112, 113 / 114, 115 / 116, 117 / 118, 121 / 122, 123 / 124, 125 / 126, and 127 / 128 (RNA / DNA sequence).
[0128] In a further embodiment, alternative saRNA backbones representative of flaviviruses e.g. Kunjin saRNA with a O / E ratio of 0.58 or Nodaviruses e.g. Nodamura saRNA (e.g. a Nodavirus) with a CpG O / E ratio of 1.1 can be modified to generate CpG-low variants: SEQ ID NO: 71, and 72 (Kunjin), or SEQ ID NO: 73, and 74 (Nodamura) with O / E ratios of 0.06 and 0.06, respectively.
[0129] Thus, in one embodiment, the saRNA molecule of the invention comprises a minimal reduced number of CpG di-nucleotides as compared to the corresponding sequences for the native elements. In one embodiment, the number of CpG di-nucleotides in the saRNA molecule of the invention is reduced by at least about 25%, at least about 30% (or an O / E ratio of 0.55), at least about 45%, at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or about 90% to 100% CpG-depleted, as compared to a nucleic acid molecule having the corresponding native sequences. In some embodiments, the number of CpG di-nucleotides in the saRNA molecule is reduced by at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% CpG- depleted, as compared to a nucleic acid molecule having the corresponding native sequences. One or more of the elements of the nucleic acid molecule carried by the saRNA vector, e.g., without limitation, the gene coding sequence and untranslated sequences, may be CpG-free, i.e., lacking any CpG di-nucleotides.
[0130] In some embodiments, the saRNA molecule of the invention has a CpG O / E odds ratio of less than about 0.65, or less than about 0.60, or less than about 0.55, or less than about 0.50. In some embodiments, the saRNA molecule has a CpG O / E odds ratio of less than about 0.45, or less than about 0.43, or less than about 0.40, or less than about 0.35, or less than about 0.30. In some embodiments, the saRNA molecule has a CpG O / E odds ratio of less than about 0.25, or less than about 0.20, or less than about 0.15. This is evidenced as being beneficial as CpG-low shows benefits over wild type.
[0131] In an embodiment, the saRNA molecule has a CpG O / E odds ratio of less than about 0.14. In an embodiment, the saRNA molecule has a CpG O / E odds ratio of less than about 0.133. This is evidenced by the inventors' observation that expression was improved when going from an O / E of 0.133 (for CpG-low) to 0.06 for GpG-R. In an embodiment, the saRNA molecule has a CpG O / E odds ratio of less than about 0.13.
[0132] In another embodiment, the saRNA molecule has a CpG O / E odds ratio of less than about 0.12. In an embodiment, the saRNA molecule has a CpG O / E odds ratio of less than about 0.11. Typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.10. More typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.09. More typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.08.
[0133] Typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.07. Typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.06. Typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.05. Typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.04. Typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.03. Typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.02.
[0134] Typically, the saRNA molecule has a CpG O / E odds ratio of less than about 0.01. In some embodiments, the CpG O / E is zero. The saRNA molecule may be at least at least 55 bases in length, at least 60 bases in length, at least 75 bases in length, at least 100 bases in length, at least 200 bases in length, at least 300 bases in length, at least 400 bases in length, at least 500 bases in length, at least 600 bases in length, at least 700 bases in length, at least 800 bases in length, or at least 900 bases in length.
[0135] The saRNA molecule may be at least 1000 bases in length, at least 2000 bases in length, at least 3000 bases in length, at least 4000 bases in length, at least 5000 bases in length, at least 6000 bases in length, at least 7000 bases in length, at least 8000 bases in length, at least 9000 bases in length, at least 10,000 bases in length, at least 11,000 bases in length or at least 12,000 bases in length.
[0136] The saRNA molecule may be at least 13,000 bases in length, at least 14,000 bases in length, at least 15,000 bases in length, at least 16,000 bases in length, at least 18,000 bases in length or at least 20,000 bases in length.
[0137] In a typical embodiment, the saRNA is at least 7,100 bases in length, at least 7,200 bases in length, at least 7,300 bases in length, or at least 7,400 bases in length.
[0138] The saRNA molecule may be between 5000 and 20,000 bases in length, between 6000 and 15,000 bases in length, between 7000 and 14,000 bases in length, between 7500 and 13,000 bases in length, between 8000 and 12,000 bases in length, between 8500 and 11,000 bases in length, between 9000 and 10,000 bases in length.
[0139] It will be appreciated that any of the saRNA lengths disclosed herein may be combined with any of the O / E odds ratios, or any of the percentage reductions in the number of CpG di-nucleotides in the saRNA molecule. Thus, by way of example only, the saRNA molecule may be at least at least 55 bases in length (or any of the other saRNA lengths described herein), and (I) has a CpG O / E odds ratio of less than about 0.65 (or any of the other CpG O / E odds ratios described herein); and / or (ill) the number of CpG di- nucleotides is reduced by at least about 25% (or any of the other percentage reductions of CpG described herein), and so on.
[0140] In another example, the saRNA molecule may be at least at least 1000 bases in length (or any of the other lengths described herein), and (I) has a CpG O / E odds ratio of less than about 0.15 (or any of the other CpG O / E odds ratios described herein). In another example, the saRNA molecule may be at least at least 3000 bases in length (or any of the other lengths described herein), and (I) has a CpG O / E odds ratio of less than about 0.13 (or any of the other CpG O / E odds ratios described herein). In another example, the saRNA molecule may be at least at least 7200 bases in length (or any of the other lengths described herein), and (i) has a CpG O / E odds ratio of less than about 0.06 (or any of the other CpG O / E odds ratios described herein). In another example, the saRNA molecule may be at least at least 8000 bases in length (or any of the other lengths described herein), and (i) has a CpG O / E odds ratio of less than about 0.02 (or any of the other CpG O / E odds ratios described herein).
[0141] The term "functional" refers to a product (e.g., a protein or peptide) which performs its native function, although not necessarily at the same level as the native product. The term "functional" may also refer to a gene or sequence which encodes a product and from which a desired product can be expressed. The term "functional" may also refer to a sequence or part of a sequence where the secondary RNA structure is critical to the function of RNA self-amplification, such as the four alphavirus CSEs. A "functional deletion" refers to a deletion which destroys the ability of the product to perform its native function.
[0142] The term "percent (%) identity" may be readily determined for RNA or DNA sequences, over the full-length of an saRNA vector and / or transgene, or a fragment thereof. Suitably, a fragment is at least about 10 nt in length, and may be up to about 30,000 nt. Generally, when referring to "identity", "homology", or "similarity" between two different saRNA sequences, "identity", "homology" or "similarity" is determined in reference to "aligned" sequences. "Aligned" sequences or "alignments" refer to multiple nucleic acid sequences, often containing corrections for missing or additional bases as compared to a reference sequence.
[0143] The saRNA molecule may comprise a CpG reduced or deleted sequence that is further modified to additionally reduce or delete UpA-dinucleotides that may be recognised by antiviral proteins in RNA sequences compared to an unmodified, wild-type RNA sequence or more prominently on CpG reduced / depleted RNA sequence
[0045] ,
[0144] Thus, in one embodiment, the saRNA molecule of the invention comprises a minimal reduced number of UpA di-nucleotides as compared to the corresponding sequences for the native elements. In one embodiment, the number of UpA di-nucleotides in the saRNA molecule of the invention is reduced by at least about 25%, at least about 30% (or an O / E ratio of 0.55), at least about 45%, at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or about 90% to 100% UpA -depleted, as compared to a nucleic acid molecule having the corresponding native sequences. In some embodiments, the number of UpA di-nucleotides in the saRNA molecule is reduced by at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% UpA-depleted, as compared to a nucleic acid molecule having the corresponding native sequences. One or more of the elements of the nucleic acid molecule carried by the saRNA vector, e.g., without limitation, the gene coding sequence and untranslated sequences, may be UpA-free, i.e., lacking any UpA di-nucleotides.
[0145] One way to evaluate the UpA dinucleotide content of the saRNA molecules of the invention is to use the dinucleotide observed / expected (O / E) odds ratio. The UA dinucleotide O / E ratio can be deduced from the observed number of UpA dinucleotides divided by the product of the frequencies of Us and As present in a given sequence, where an O / E ratio of 1.0 is the expected frequency of occurrence if the RNA's mononucleotides were randomly distributed.
[0146] In some embodiments, therefore, the saRNA molecule of the invention has a UpA O / E odds ratio of less than about 0.65, or less than about 0.60, or less than about 0.55, or less than about 0.50. In some embodiments, the saRNA molecule has a UpA O / E odds ratio of less than about 0.45, or less than about 0.43, or less than about 0.40, or less than about 0.35, or less than about 0.30. In some embodiments, the saRNA molecule has a UpA O / E odds ratio of less than about 0.25, or less than about 0.20, or less than about 0.15, or less than about 0.10. In some embodiments, the UpA O / E is zero.
[0147] As used herein, a uracil monophosphate (U) followed by an adenine monophosphate (A) in a nucleotide sequence is referred to as a UpA dinucleotide.
[0148] It will be appreciated that the saRNA molecule of the first aspect may comprise both a reduced / depleted CpG content and additionally a reduced / depleted UpA content.
[0149] Accordingly, in some embodiments, the modified saRNA molecule of the invention may comprise an RNA sequence, which is both: (I) CpG-reduced or CpG-depleted compared to an unmodified, wild-type RNA sequence, and (II) UpA-reduced or UpA-depleted, compared to an unmodified, wild-type RNA sequence.
[0150] In other embodiments, the saRNA molecule of the invention may comprise a reduced / depleted CpG content, a reduced / depleted UpA content, and also be codon optimised. Thus, in some embodiments, the modified saRNA molecule of the invention may comprise an RNA sequence, which is: (i) CpG-reduced or CpG-depleted compared to an unmodified, wild-type RNA sequence, (ii) UpA-reduced or UpA-depleted compared to an unmodified, wild-type RNA sequence, and (ill) codon optimised.
[0151] In one embodiment, the CpG-depleted saRNA molecule improves expression of the encoded transgene in a human cell by at least about two-fold, at least three-fold or at least about four-fold, etc of the protein expression levels, as compared to a nucleic acid molecule having the corresponding wild-type sequences, e.g., native exogenous gene sequence.
[0152] In an embodiment, the wild type VEEV RNA sequence (accession number J04332.1) is represented herein as SEQ ID No: 1, below. The wild type VEEV RNA sequence comprises 352 CpGs (O / E: 0.771) and 365 UpAs (O / E: 0.73).
[0153] AugggcggcgcaugagagaagcccagaccaauuaccuacccaaaAUGgagaaaguucacguugacaucgaggaagacagcccauuccucag agcuuugcagcggacguucccgcaguuugagguagaagccaagcaggucacugauaaugaccaugcuaaugccagagcguuuucgcaucug gcuucaaaacugaucgaaacggagguggacccauccgacacgauccuugacauuggaagugcgcccgcccgcagaauguauucuaagcaca aguaucauuguaucuguccgaugagaugugcggaagauccggacagauuguauaaguaugcaacuaagcugaagaaaaacuguaaggaaau aacugauaaggaauuggacaagaaaaugaaggagcucgccgccgucaugagcgacccugaccuggaaacugagacuaugugccuccacgac gacgagucgugucgcuacgaagggcaagucgcuguuuaccaggauguauacgcgguugacggaccgacaagucucuaucaccaagccaaua agggaguuagagucgccuacuggauaggcuuugacaccaccccuuuuauguuuaagaacuuggcuggagcauauccaucauacucuaccaa cugggccgacgaaaccguguuaacggcucguaacauaggccuaugcagcucugacguuauggagcggucacguagagggauguccauucuu agaaagaaguauuugaaaccauccaacaauguucuauucucuguuggcucgaccaucuaccacgagaagagggacuuacugaggagcuggc accugccgucuguauuucacuuacguggcaagcaaaauuacacaugucggugugagacuauaguuaguugcgacggguacgucguuaaaag aauagcuaucaguccaggccuguaugggaagccuucaggcuaugcugcuacgaugcaccgcgagggauucuugugcugcaaagugacagac acauugaacggggagagggucucuuuucccgugugcacguaugugccagcuacauugugugaccaaaugacuggcauacuggcaacagaug ucagugcggacgacgcgcaaaaacugcugguugggcucaaccagcguauagucgucaacggucgcacccagagaaacaccaauaccaugaa aaauuaccuuuugcccguaguggcccaggcauuugcuaggugggcaaaggaauauaaggaagaucaagaagaugaaaggccacuaggacua cgagauagacaguuagucaugggguguuguugggcuuuuagaaggcacaagauaacaucuauuuauaagcgcccggauacccaaaccauca ucaaagugaacagcgauuuccacucauucgugcugcccaggauaggcaguaacacauuggagaucgggcugagaacaagaaucaggaaaau guuagaggagcacaaggagccgucaccucucauuaccgccgaggacguacaagaagcuaagugcgcagccgaugagcguaaggaggugcgu gaagccgaggaguugcgcgcagcucuaccaccuuuggcagcugauguugaggagcccacucuggaagccgaugucgacuugauguuacaag aggcuggggccggcucaguggagacaccucguggcuugauaaagguuaccagcuacgauggcgaggacaagaucggcucuuacgcugugcu uucuccgcaggcuguacucaagagugaaaaauuaucuugcauccacccucucgcugaacaagucauagugauaacacacucuggccgaaaa gggcguuaugccguggaaccauaccaugguaaaguaguggugccagagggacaugcaauacccguccaggacuuucaagcucugagugaaa gugccaccauuguguacaacgaacgugaguucguaaacagguaccugcaccauauugccacacauggaggagcgcugaacacugaugaaga auauuacaaaacugucaagcccagcgagcacgacggcgaauaccuguacgacaucgacaggaaacagugcgucaagaaagaacuagucacu gggcuagggcucacaggcgagcugguggauccucccuuccaugaauucgccuacgagagucugagaacacgaccagccgcuccuuaccaag uaccaaccauagggguguauggcgugccaggaucaggcaagucuggcaucauuaaaagcgcagucaccaaaaaagaucuaguggugagcgc caagaaagaaaacugugcagaaauuauaagggacgucaagaaaaugaaagggcuggacgucaaugccagaacuguggacucagugcucuug aauggaugcaaacaccccguagagacccuguauauugacgaagcuuuugcuugucaugcagguacucucagagcgcucauagccauuauaa gaccuaaaaaggcagugcucugcggggaucccaaacagugcgguuuuuuuaacaugaugugccugaaagugcauuuuaaccacgagauuug cacacaa.gucuuccacaa.aagcaucucucgccguugcacua.aaucugugacuucggucgucuca.accuuguuuua.cgacaaaa.aaaugaga. acgacgaauccgaaagagacuaagauugugauugacacuaccggcaguaccaaaccuaagcaggacgaucucauucucacuuguuucagag ggugggugaagcaguugcaaauagauuacaaaggcaacgaaauaaugacggcagcugccucucaagggcugacccguaaagguguguaugc cguucgguacaaggugaaugaaaauccucuguacgcacccaccucagaacaugugaacguccuacugacccgcacggaggaccgcaucgug uggaaaacacuagccggcgacccauggauaaaaacacugacugccaaguacccugggaauuucacugccacgauagaggaguggcaagcag agcaugaugccaucaugaggcacaucuuggagagaccggacccuaccgacgucuuccagaauaaggcaaacguguguugggccaaggcuuu agugccggugcugaagaccgcuggcauagacaugaccacugaacaauggaacacuguggauuauuuugaaacggacaaagcucacucagca gagauaguauugaaccaacuaugcgugagguucuuuggacucgaucuggacuccggucuauuuucugcacccacuguuccguuauccauua ggaauaaucacugggauaacuccccgucgccuaacauguacgggcugaauaaagaagugguccgucagcucucucgcagguacccacaacu gccucgggcaguugccacuggaagagucuaugacaugaacacugguacacugcgcaauuaugauccgcgcauaaaccuaguaccuguaaac agaagacugccucaugcuuuaguccuccaccauaaugaacacccacagagugacuuuucuucauucgucagcaaauugaagggcagaacug uccugguggucggggaaaaguuguccgucccaggcaaaaugguugacugguugucagaccggccugaggcuaccuucagagcucggcugga uuuaggcaucccaggugaugugcccaaauaugacauaauauuuguuaaugugaggaccccauauaaauaccaucacuaucagcagugugaa gaccaugccauuaagcuuagcauguugaccaagaaagcuugucugcaucugaaucccggcggaaccugugucagcauagguuaugguuacg cugacagggccagcgaaagcaucauuggugcuauagcgcggcaguucaaguuuucccggguaugcaaaccgaaauccucacuugaagagac ggaaguucuguuuguauucauuggguacgaucgcaaggcccguacgcacaauccuuacaagcuuucaucaaccuugaccaacauuuauaca gguuccagacuccacgaagccggaugugcacccucauaucauguggugcgaggggauauugccacggccaccgaaggagugauuauaaaug cugcuaacagcaaaggacaaccuggcggaggggugugcggagcgcuguauaagaaauucccggaaagcuucgauuuacagccgaucgaagu aggaaaagcgcgacuggucaaaggugcagcuaaacauaucauucaugccguaggaccaaacuucaacaaaguuucggagguugaaggugac aaacaguuggcagaggcuuaugaguccaucgcuaagauugucaacgauaacaauuacaagucaguagcgauuccacuguuguccaccggca ucuuuuccgggaacaaagaucgacuaacccaaucauugaaccauuugcugacagcuuuagacaccacugaugcagauguagccauauacug cagggacaagaaaugggaaaugacucucaaggaagcaguggcuaggagagaagcaguggaggagauaugcauauccgacgacucuucagug acagaaccugaugcagagcuggugagggugcauccgaagaguucuuuggcuggaaggaagggcuacagcacaagcgauggcaaaacuuucu cauauuuggaagggaccaaguuucaccaggcggccaaggauauagcagaaauuaaugccauguggcccguugcaacggaggccaaugagca gguaugcauguauauccucggagaaagcaugagcaguauuaggucgaaaugccccgucgaagagucggaagccuccucaccaccuagcacg cugccuugcuugugcauccaugcca.ugacucca.gaaa.gaguacagcgccuaa.aagccuca.cguccaga.acaaauua.cugugugcuca.uccu uuccauugccgaaguauagaaucacuggugugcagaagauccaaugcucccagccuauauuguucucaccgaaagugccugcguauauuca uccaaggaaguaucucguggaaacaccaccgguagacgagacuccggagccaucggcagagaaccaauccacagaggggacaccugaacaa ccaccacuuauaaccgaggaugagaccaggacuagaacgccugagccgaucaucaucgaagaggaagaagaggauagcauaaguuugcugu cagauggcccgacccaccaggugcugcaagucgaggcagacauucacgggccgcccucuguaucuagcucauccugguccauuccucaugc auccgacuuugauguggacaguuuauccauacuugacacccuggagggagcuagcgugaccagcggggcaacgucagccgagacuaacucu uacuucgcaaagaguauggaguuucuggcgcgaccggugccugcgccucgaacaguauucaggaacccuccacaucccgcuccgcgcacaa gaacaccgucacuugcacccagcagggccugcucgagaaccagccuaguuuccaccccgccaggcgugaauagggugaucacuagagagga gcucgaggcgcuuaccccgucacgcacuccuagcaggucggucucgagaaccagccuggucuccaacccgccaggcguaaauagggugauu acaagagaggaguuugaggcguucguagcacaacaacaaugacgguuugaugcgggugcauacaucuuuuccuccgacaccggucaagggc auuuacaacaaaaaucaguaaggcaaacggugcuauccgaagugguguuggagaggaccgaauuggagauuucguaugccccgcgccucga ccaagaaaaagaagaauuacuacgcaagaaauuacaguuaaaucccacaccugcuaacagaagcagauaccaguccaggaagguggagaac augaaagccauaacagcuagacguauucugcaaggccuagggcauuauuugaaggcagaaggaaaaguggagugcuaccgaacccugcauc cuguuccuuuguauucaucuagugugaaccgugccuuuucaagccccaaggucgcaguggaagccuguaacgccauguugaaagagaacuu uccgacuguggcuucuuacuguauuauuccagaguacgaugccuauuuggacaugguugacggagcuucaugcugcuuagacacugccagu uuuugcccugcaaagcugcgcagcuuuccaaagaaacacuccuauuuggaacccacaauacgaucggcagugccuucagcgauccagaaca cgcuccagaacguccuggcagcugccacaaaaagaaauugcaaugucacgcaaaugagagaauugcccguauuggauucggcggccuuuaa uguggaaugcuucaagaaauaugcguguaauaaugaauauugggaaacguuuaaagaaaaccccaucaggcuuacugaagaaaacguggua aauuacauuaccaaauuaaaaggaccaaaagcugcugcucuuuuugcgaagacacauaauuugaauauguugcaggacauaccaauggaca gguuuguaauggacuuaaagagagacgugaaagugacuccaggaacaaaacauacugaagaacggcccaagguacaggugauccaggcugc cgauccgcuagcaacagcguaucugugcggaauccaccgagagcugguuaggagauuaaaugcgguccugcuuccgaacauucauacacug uuugauaugucggcugaagacuuugacgcuauuauagccgagcacuuccagccuggggauuguguucuggaaacugacaucgcgucguuug auaaaagugaggacgacgccauggcucugaccgcguuaaugauucuggaagacuuagguguggacgcagagcuguugacgcugauugaggc ggcuuucggcgaaauuucaucaauacauuugcccacuaaaacuaaauuuaaauucggagccaugaugaaaucuggaauguuccucacacug uuugugaacacagucauuaacauuguaaucgcaagcagaguguugagagaacggcuaaccggaucaccaugugcagcauucauuggagaug acaauaucgugaaaggagucaaaucggacaaauuaauggcagacaggugcgccaccugguugaauauggaagucaagauuauagaugcugu ggugggcgagaaagcgccuuauuucuguggaggguuuauuuugugugacuccgugaccggcacagcgugccguguggcagacccccuaaaa aggcuguuuaagcuuggcaaaccucuggcagcagacgaugaacaugaugaugacaggagaagggcauugcaugaagagucaacacgcugga accgaguggguauucuuucagagcugugcaaggcaguagaaucaagguaugaaaccguaggaacuuccaucauaguuauggccaugacuac ucuagcuagcaguguuaaaucauucagcuaccugagaggggccccuauaacucucuacggcuaaccugaauggacuacgacauagucuagu ccgccaag
[0154] - gene of interest- aauuggcaagcugcuuacauagaacucgcggcgauuggcaugccgccuuaaaauuuuuauuuuauuuuucuuuucuuuuccgaaucggauu uuguuuuuaauauuucaaaaaaaaaaaaaaaaaaaaaaaaa
[0155] [SEQ ID No: 1]
[0156] In an embodiment, the wild type VEEV RNA sequence is encoded by the DNA nucleotide sequence of SEQ ID No: 2, below. The wild type VEEV DNA nucleotide sequence comprises 352 CpGs (O / E ratio of 0.77) and 365 TpAs (O / E: 0.73).
[0157] AtgggcggcgcatgagagaagcccagaccaattacctacccaaaATGgagaaagttcacgttgacatcgaggaagacagcccattcctcag agctttgcagcggacgttcccgcagtttgaggtagaagccaagcaggtcactgataatgaccatgctaatgccagagcgttttcgcatctg gcttcaaaactgatcgaaacggaggtggacccatccgacacgatccttgacattggaagtgcgcccgcccgcagaatgtattctaagcaca agtatcattgtatctgtccgatgagatgtgcggaagatccggacagattgtataagtatgcaactaagctgaagaaaaactgtaaggaaat aactgataaggaattggacaagaaaatgaaggagctcgccgccgtcatgagcgaccctgacctggaaactgagactatgtgcctccacgac gacgagtcgtgtcgctacgaagggcaagtcgctgtttaccaggatgtatacgcggttgacggaccgacaagtctctatcaccaagccaata agggagttagagtcgcctactggataggctttgacaccaccccttttatgtttaagaacttggctggagcatatcoatcatactctaccaa ctgggccgacgaaaccgtgttaacggctcgtaacataggcctatgcagctctgacgttatggagcggtcacgtagagggatgtccattctt agaaagaagtatttgaaaccatccaacaatgttctattctctgttggctcgaccatctaccacgagaagagggacttactgaggagctggc acctgccgtctgtatttcacttacgtggcaagcaaaattacacatgtcggtgtgagactatagttagttgcgacgggtacgtcgttaaaag aatagctatcagtccaggcctgtatgggaagccttcaggctatgctgctacgatgcaccgcgagggattcttgtgctgcaaagtgacagac acattgaacggggagagggtctcttttcccgtgtgcacgtatgtgccagctacattgtgtgaccaaatgactggcatactggcaacagatg tcagtgcggacgacgcgcaaaaactgctggttgggctcaaccagcgtatagtcgtcaacggtcgcacccagagaaacaccaataccatgaa aaattaccttttgcccgtagtggcccaggcatttgctaggtgggcaaaggaatataaggaagatcaagaagatgaaaggccactaggacta cgagatagacagttagtcatggggtgttgttgggcttttagaaggcacaagataacatctatttataagcgcccggatacccaaaccatca tcaaagtgaacagcgatttccactcattcgtgctgcccaggataggcagtaacacattggagatcgggctgagaacaagaatcaggaaaat gttagaggagcacaaggagccgtcacctctcattaccgccgaggacgtacaagaagctaagtgcgcagccgatgagcgtaaggaggtgcgt gaagccgaggagttgcgcgcagctctaccacctttggcagctgatgttgaggagcccactctggaagccgatgtcgacttgatgttacaag aggctggggccggctcagtggagacacctcgtggcttgataaaggttaccagctacgatggcgaggacaagatcggctcttacgctgtgct ttctccgcaggctgtactcaagagtgaaaaattatcttgcatccaccctctcgctgaacaagtcatagtgataacacactctggccgaaaa gggcgttatgccgtggaaccataccatggtaaagtagtggtgccagagggacatgcaatacccgtccaggactttcaagctctgagtgaaa gtgccaccattgtgtacaacgaacgtgagttcgtaaacaggtacctgcaccatattgccacacatggaggagcgctgaacactgatgaaga atattacaaaactgtcaagcccagcgagcacgacggcgaatacctgtacgacatcgacaggaaacagtgcgtcaagaaagaactagtcact gggctagggctcacaggcgagctggtggatcctcccttccatgaattcgcctacgagagtctgagaacacgaccagccgctccttaccaag taccaaccataggggtgtatggcgtgccaggatcaggcaagtctggcatcattaaaagcgcagtcaccaaaaaagatctagtggtgagcgc caagaaagaaaactgtgcagaaattataagggacgtcaagaaaatgaaagggctggacgtcaatgccagaactgtggactcagtgctcttg aatggatgcaaacaccccgtagagaccctgtatattgacgaagcttttgcttgtcatgcaggtactctcagagcgctcatagccattataa gacctaaaaaggcagtgctctgcggggatcccaaacagtgcggtttttttaacatgatgtgcctgaaagtgcattttaaccacgagatttg cacacaagtcttccacaaaagcatctctcgccgttgcactaaatctgtgacttcggtcgtctcaaccttgttttacgacaaaaaaatgaga acgacgaatccgaaagagactaagattgtgattgacactaccggcagtaccaaacctaagcaggacgatctcattctcacttgtttcagag ggtgggtgaagcagttgcaaatagattacaaaggcaacgaaataatgacggcagctgcctctcaagggctgacccgtaaaggtgtgtatgc cgttcggtacaaggtgaatgaaaatcctctgtacgcacccacctcagaacatgtgaacgtcctactgacccgcacggaggaccgcatcgtg tggaaaacactagccggcgacccatggataaaaacactgactgccaagtaccctgggaatttcactgccacgatagaggagtggcaagcag agcatgatgccatcatgaggcacatcttggagagaccggaccctaccgacgtcttccagaataaggcaaacgtgtgttgggccaaggcttt agtgccggtgctgaagaccgctggcatagacatgaccactgaacaatggaacactgtggattattttgaaacggacaaagctcactcagca gagatagtattgaaccaactatgcgtgaggttctttggactcgatctggactccggtctattttctgcacccactgttccgttatccatta ggaataatcactgggataactccccgtcgcctaacatgtacgggctgaataaagaagtggtccgtcagctctctcgcaggtacccacaact gcctcgggcagttgccactggaagagtctatgacatgaacactggtacactgcgcaattatgatccgcgcataaacctagtacctgtaaac agaagactgcctcatgctttagtcctccaccataatgaacacccacagagtgacttttcttcattcgtcagcaaattgaagggcagaactg tcctggtggtcggggaaaagttgtccgtcccaggcaaaatggttgactggttgtcagaccggcctgaggctaccttcagagctcggctgga tttaggcatcccaggtgatgtgcccaaatatgacataatatttgttaatgtgaggaccccatataaataccatcactatcagcagtgtgaa gaccatgccattaagcttagcatgttgaccaagaaagcttgtctgcatctgaatcccggcggaacctgtgtcagcataggttatggttacg ctgacagggccagcgaaagcatcattggtgctatagcgcggcagttcaagttttcccgggtatgcaaaccgaaatcctcacttgaagagac ggaagttctgtttgtattcattgggtacgatcgcaaggcccgtacgcacaatccttacaagctttcatcaaccttgaccaacatttataca ggttccagactccacgaagccggatgtgcaccctcatatcatgtggtgcgaggggatattgccacggccaccgaaggagtgattataaatg ctgctaacagcaaaggacaacctggcggaggggtgtgcggagcgctgtataagaaattcccggaaagcttcgatttacagccgatcgaagt aggaaaagcgcgactggtcaaaggtgcagctaaacatatcattcatgccgtaggaccaaacttcaacaaagtttcggaggttgaaggtgac aaacagttggcagaggcttatgagtccatcgctaagattgtcaacgataacaattacaagtcagtagcgattccactgttgtccaccggca tcttttccgggaacaaagatcgactaacccaatcattgaaccatttgctgacagctttagacaccactgatgcagatgtagccatatactg cagggacaagaaatgggaaatgactctcaaggaagcagtggctaggagagaagcagtggaggagatatgcatatccgacgactcttcagtg acagaacctgatgcagagctggtgagggtgcatccgaagagttctttggctggaaggaagggctacagcacaagcgatggcaaaactttct catatttggaagggaccaagtttcaccaggcggccaaggatatagcagaaattaatgccatgtggcccgttgcaacggaggccaatgagca ggtatgcatgtatatcctcggagaaagcatgagcagtattaggtcgaaatgccccgtcgaagagtcggaagcctcctcaccacctagcacg ctgccttgcttgtgcatccatgccatgactccagaaagagtacagcgcctaaaagcctcacgtccagaacaaattactgtgtgctcatcct ttccattgccgaagtatagaatcactggtgtgcagaagatccaatgctcccagcctatattgttctcaccgaaagtgcctgcgtatattca tccaaggaagtatctcgtggaaacaccaccggtagacgagactccggagccatcggcagagaaccaatccacagaggggacacctgaacaa ccaccacttataaccgaggatgagaccaggactagaacgcctgagccgatcatcatcgaagaggaagaagaggatagcataagtttgctgt cagatggcccgacccaccaggtgctgcaagtcgaggcagacattcacgggccgccctctgtatctagctcatcctggtccattcctcatgc atccgactttgatgtggacagtttatccatacttgacaccctggagggagctagcgtgaccagcggggcaacgtcagccgagactaactct tacttcgcaaagagtatggagtttctggcgcgaccggtgcctgcgcctcgaacagtattcaggaaccctccacatcccgctccgcgcacaa gaacaccgtcacttgcacccagcagggcctgctcgagaaccagcctagtttccaccccgccaggcgtgaatagggtgatcactagagagga gctcgaggcgcttaccccgtcacgcactcctagcaggtcggtctcgagaaccagcctggtctccaacccgccaggcgtaaatagggtgatt acaagagaggagtttgaggcgttcgtagcacaacaacaatgacggtttgatgcgggtgcatacatcttttcctccgacaccggtcaagggc atttacaacaaaaatcagtaaggcaaacggtgctatccgaagtggtgttggagaggaccgaattggagatttcgtatgccccgcgcctcga ccaagaaaaagaagaattactacgcaagaaattacagttaaatcccacacctgctaacagaagcagataccagtccaggaaggtggagaac atgaaagccataacagctagacgtattctgcaaggcctagggcattatttgaaggcagaaggaaaagtggagtgctaccgaaccctgcatc ctgttcctttgtattcatctagtgtgaaccgtgccttttcaagccccaaggtcgcagtggaagcctgtaacgccatgttgaaagagaactt tccgactgtggcttcttactgtattattccagagtacgatgcctatttggacatggttgacggagcttcatgctgcttagacactgccagt ttttgccctgcaaagctgcgcagctttccaaagaaacactcctatttggaacccacaatacgatcggcagtgccttcagcgatccagaaca cgctccagaacgtcctggcagctgccacaaaaagaaattgcaatgtcacgcaaatgagagaattgcccgtattggattcggcggcctttaa tgtggaatgcttcaagaaatatgcgtgtaataatgaatattgggaaacgtttaaagaaaaccccatcaggcttactgaagaaaacgtggta aattacattaccaaattaaaaggaccaaaagctgctgctctttttgcgaagacacataatttgaatatgttgcaggacataccaatggaca ggtttgtaatggacttaaagagagacgtgaaagtgactccaggaacaaaacatactgaagaacggcccaaggtacaggtgatccaggctgc cgatccgctagcaacagcgtatctgtgcggaatccaccgagagctggttaggagattaaatgcggtcctgcttccgaacattcatacactg tttgatatgtcggctgaagactttgacgctattatagccgagcacttccagcctggggattgtgttctggaaactgacatcgcgtcgtttg ataaaagtgaggacgacgccatggctctgaccgcgttaatgattctggaagacttaggtgtggacgcagagctgttgacgctgattgaggc ggctttcggcgaaatttcatcaatacatttgcccactaaaactaaatttaaattcggagccatgatgaaatctggaatgttcctcacactg tttgtgaacacagtcattaacattgtaatcgcaagcagagtgttgagagaacggctaaccggatcaccatgtgcagcattcattggagatg acaatatcgtgaaaggagtcaaatcggacaaattaatggcagacaggtgcgccacctggttgaatatggaagtcaagattatagatgctgt ggtgggcgagaaagcgccttatttctgtggagggtttattttgtgtgactccgtgaccggcacagcgtgccgtgtggcagaccccctaaaa aggctgtttaagcttggcaaacctctggcagcagacgatgaacatgatgatgacaggagaagggcattgcatgaagagtcaacacgctgga accgagtgggtattctttcagagctgtgcaaggcagtagaatcaaggtatgaaaccgtaggaacttccatcatagttatggccatgactac tctagctagcagtgttaaatcattcagctacctgagaggggcccctataactctctacggctaacctgaatggactacgacatagtctagt ccgccaag
[0158] -Gene of Interest- aattggcaagctgcttacatagaactcgcggcgattggcatgccgccttaaaatttttattttatttttcttttcttttccgaatcggatt ttgtttttaatatttcaaaaaaaaaaaaaaaaaaaaaaaaa
[0159] [SEQ ID No: 2]
[0160] In an embodiment, the CpG-depleted VEEV RNA sequence (excluding the 5'UTR, 51
[0161] CSE, and 3'UTR, nucleotides 224-7499) is represented herein as SEQ ID No:3, below.
[0162] It will be appreciated that SEQ ID No: 3 corresponds to SEQ ID No: 1 wherein the
[0163] CpGs have been fully depleted (O / E: 0). auccuugacauuggaagugcaccagccaggagaauguauucuaagcacaaguaucauuguaucugcccaaugagaugugcagaagauccag acagauuguauaaguaugcaacuaagcugaagaaaaacuguaaggaaauaacugauaaggaauuggacaagaaaaugaaggagcuggcagc agucaugucagacccugaccuggaaacugagacuaugugccuccaugaugaugagucauguagguaugaagggcaaguggcuguuuaccag gauguauaugcaguugauggaccaacaagucucuaucaccaagccaauaagggaguuagaguggccuacuggauaggcuuugacaccaccc cuuuuauguuuaagaacuuggcugga.gca.uauccaucauacucua.cca.a.cugggca.gaugaaa.caguguuaacagcuagaaacauaggccu augcagcucugauguuauggagaggucaagaagagggauguccauucuuagaaagaaguauuugaaaccauccaacaauguucuguucucu guuggcucaaccaucuaccaugagaagagggacuuccugaggagcuggcaccugccaucuguguuucaccugagaggcaagcaaaauuaca caugcaggugugagaccauugugaguugugauggguauguggucaaaagaauugccaucaguccaggccuguaugggaagccuucaggcua ugcugccacaaugcacagggagggauucuugugcugcaaagugacagacacauugaauggggagagggucucuuuuccagugugcacauau gugccagccacauugugugaccaaaugacuggcauccuggcaacagaugucagugcagaugaugcacaaaaacugcugguugggcucaacc agagaauuguggucaauggcaggacccagagaaacaccaauaccaugaaaaauuaccuuuugccaguaguggcccaggcauuugcuaggug ggcaaaggaauauaaggaagaucaagaagaugaaaggccacuaggacuaagagauagacaguuagucaugggguguuguugggcuuuuaga aggcacaagauaacaucuauuuauaagaggccagauacccaaaccaucaucaaagugaacucagauuuccacucauuugugcugcccagga uaggcaguaacacauuggagauugggcugagaacaagaaucaggaaaauguuagaggagcacaaggagccaucaccucucauuacagcaga ggauguacaagaagcuaagugugcagcagaugagagaaaggaggugagagaagcagaggaguugagggcagcucuaccaccuuuggcagcu gauguugaggagcccacucuggaagcagauguggacuugauguuacaagaggcuggggcaggcucaguggagacaccuagaggcuugauaa agguuaccagcuaugauggagaggacaagauuggcucuuaugcugugcuuucuccacaggcuguacucaagagugaaaaauuaucuugcau ccacccucuggcugaacaagucauagugauaacacacucuggcagaaaagggagauaugcaguggaaccauaccaugguaaaguaguggug ccagagggacaugcaauaccaguccaggacuuucaagcucugagugaaagugccaccauuguguacaaugaaagagaguuuguaaacaggu accugcaccauauugccacacauggaggagcacugaacacugaugaagaauauuacaaaacugucaagcccucagagcaugauggagaaua ccuguaugacauugacaggaaacagugugucaagaaagaacuagucacugggcuagggcucacaggagagcugguggauccucccuuccau gaauuugccuaugagagucugagaacaagaccagcagcuccuuaccaaguaccaaccauagggguguauggagugccaggaucaggcaagu cuggcaucauuaaaucagcagucaccaaaaaagaucuaguggugucagccaagaaagaaaacugugcagaaauuauaagggaugucaagaa aaugaaagggcuggaugucaaugccagaacuguggacucagugcucuugaauggaugcaaacacccaguagagacccuguauauugaugaa gcuuuugcuugucaugcagguacucucagagcacucauagccauuauaagaccuaaaaaggcagugcucuguggggaucccaaacagugug guuuuuuuaacaugaugugccugaaagugcauuuuaaccaugagauuugcacacaagucuuccacaaaagcaucucuaggagaugcacuaa aucugugacuucaguggucucaaccuuguuuuaugacaaaaaaaugagaacaacaaauccaaaagagacuaagauugugauugacacuaca ggcaguaccaaaccuaagcaggaugaucucauucucacuuguuucagagggugggugaagcaguugcaaauagauuacaaaggcaaugaaa uaaugacagcagcugccucucaagggcugaccagaaaagguguguaugcaguuagguacaaggugaaugaaaauccucuguaugcacccac cucagaacaugugaauguccuacugaccaggacagaggacaggauuguguggaaaacacuagcaggagacccauggauaaaaacacugacu gccaaguacccugggaauuucacugccacaauagaggaguggcaagcagagcaugaugccaucaugaggcacaucuuggagagaccagacc cuacagaugucuuccagaauaaggcaaauguguguugggccaaggcuuuagugccagugcugaagacagcuggcauagacaugaccacuga acaauggaacacuguggauuauuuugaaacagacaaagcucacucagcagagauaguauugaaccaacuaugugugagguucuuuggacug gaucuggacucaggucuauuuucugcacccacuguuccauuauccauuaggaauaaucacugggauaacuccccaucaccuaacauguaug ggcugaauaaagaaguggucagacagcucucuaggagguacccacaacugccuagggcaguugccacuggaagagucuaugacaugaacac ugguacacugaggaauuaugauccaaggauaaaccuaguaccuguaaacagaagacugccucaugcuuuaguccuccaccauaaugaacac ccacagagugacuuuucuucauuugucagcaaauugaagggcagaacuguccugguggugggggaaaaguugucagucccaggcaaaaugg uugacugguugucagacaggccugaggcuaccuucagagcuaggcuggauuuaggcaucccaggugaugugcccaaauaugacauaauauu uguuaaugugaggaccccauauaaauaccaucacuaucagcagugugaagaccaugccauuaagcuuagcauguugaccaagaaagcuugu cugcaucugaauccaggaggaaccugugucagcauagguuaugguuaugcugacagggccucagaaagcaucauuggugcuauagcaaggc uguucaaguuuuccaggguaugcaaaccaaaauccucacuugaagagacagaaguucuguuuguauucauuggguaugauaggaaggccag aacacacaauccuuacaagcuuucaucaaccuugaccaacauuuauacagguuccagacuccaugaagcaggaugugcacccucauaucau guggugagaggggauauugccacagccacagaaggagugauuauaaaugcugcuaacagcaaaggacaaccuggaggagggguguguggag cacuguauaagaaauucccagaaagcuuugauuuacagccaauugaaguaggaaaagcaagacuggucaaaggugcagcuaaacauaucau ucaugcaguaggaccaaacuucaacaaaguuucagagguugaaggugacaaacaguuggcagaggcuuaugaguccauugcuaagauuguc aaugauaacaauuacaagucaguagcaauuccacuguuguccacaggcaucuuuucagggaacaaagauagacuaacccaaucauugaacc auuugcugacagcuuuagacaccacugaugcagauguagccauauacugcagggacaagaaaugggaaaugacucucaaggaagcaguggc uaggagagaagcaguggaggagauaugcauaucagaugacucuucagugacagaaccugaugcagagcuggugagggugcauccaaagagu ucuuuggcuggaaggaagggcuacagcacaucagauggcaaaacuuucucauauuuggaagggaccaaguuucaccaggcagccaaggaua uagcagaaauuaaugccauguggccaguugcaacagaggccaaugagcagguaugcauguauauccugggagaaagcaugagcaguauuag gucaaaaugcccaguggaagagucagaagccuccucaccaccuagcacacugccuugcuugugcauccaugccaugacuccagaaagagua cagaggcuaaaagccucaagaccagaacaaauuacugugugcucauccuuuccauugccaaaguauagaaucacuggugugcagaagaucc aaugcucccagccuauauuguucucaccaaaagugccugcauauauucauccaaggaaguaucugguggaaacaccaccaguagaugagac uccagagccaucagcagagaaccaauccacagaggggacaccugaacaaccaccacuuauaacagaggaugagaccaggacuagaacaccu gagccaaucaucauugaagaggaagaagaggauagcauaaguuugcugucagauggcccaacccaccaggugcugcaaguggaggcagaca uucaugggccacccucuguaucuagcucauccugguccauuccucaugcaucagacuuugauguggacaguuuauccauacuugacacccu ggagggagcuucagugaccucaggggcaacaucagcagagacuaacucuuacuuugcaaagaguauggaguuucuggcaagaccagugccu gcaccuagaacaguauucaggaacccuccacauccagcuccaaggacaagaacaccaucacuugcacccagcagggccugcucaagaacca gccuaguuuccaccccaccaggagugaauagggugaucacuagagaggagcuggaggcacuuaccccaucaaggacuccuagcaggucagu cucaagaaccagccuggucuccaacccaccaggaguaaauagggugauuacaagagaggaguuugaggcauuuguagcacaacaacaaaga agguuugaugcaggagcauacaucuuuuccucagacacaggccaagggcaucugcaacaaaaaucagugaggcaaacagugcugucagaag ugguguuggagaggacagaguuggagauuucauaugccccaaggcuggaccaagagaaagaagaggugcugaggaagaaacugcagcugaa ucccacaccugcuaacagaagcagauaccaguccaggaagguggagaacaugaaagccaucacagccagaagaauucugcaaggccugggg cauuauuugaaggcagaaggaaaaguggagugcuacagaacccugcauccuguuccuuuguauucaucuagugugaacagagccuuuucaa gccccaagguggcaguggaagccuguaaugccauguugaaagagaacuuuccaacuguggcuucuuacuguauuauuccagaguaugaugc cuauuuggacaugguugauggagcuucaugcugcuuagacacugccaguuuuugcccugcaaagcugaggagcuuuccaaagaaacacucc uauuuggaacccacaauaagaucagcagugccuucagcaauccagaacacacuccagaauguccuggcagcugccacaaaaagaaauugca augucacacaaaugagagaauugccaguauuggauucagcagccuuuaauguggaaugcuucaagaaauaugcauguaauaaugaauauug ggaaacauuuaaagaaaaccccaucaggcuuacugaagaaaaugugguaaauuacauuaccaaauuaaaaggaccaaaagcugcugcucuu uuugcaaagacacauaauuugaauauguugcaggacauaccaauggacagguuuguaauggacuuaaagagagaugugaaagugacuccag gaacaaaacauacugaagaaaggcccaagguacaggugauccaggcugcagauccacuagcaacagcauaucuguguggaauccacagaga gcugguuaggagauuaaaugcaguccugcuuccaaacauucauacacuguuugauaugucagcugaagacuuugaugcuauuauagcagag cacuuccagccuggggauuguguucuggaaacugacauugcaucauuugauaaaagugaggaugaugccauggcucugacagcauuaauga uucuggaagacuuagguguggaugcagagcuguugacacugauugaggcagcuuuuggagaaauuucaucaauacauuugcccacuaaaac uaaauuuaaauuuggagccaugaugaaaucuggaauguuccucacacuguuugugaacacagucauuaacauuguaauugcaagcagagug uugagagaaaggcuaacaggaucaccaugugcagcauucauuggagaugacaauauugugaaaggagucaaaucagacaaauuaauggcag acaggugugccaccugguugaauauggaagucaagauuauagaugcuguggugggagagaaagcaccuuauuucuguggaggguuuauuuu gugugacucagugacaggcacagcaugcagaguggcagacccccuaaaaaggcuguuuaagcuuggcaaaccucuggcagcagaugaugaa caugaugaugacaggagaagggcauugcaugaagagucaacaagguggaacagaguggguauucuuucagagcugugcaaggcaguagaau caagguaugaaacaguaggaacuuccaucauaguuauggccaugacuacucuagcuagcaguguuaaaucauucagcuaccugaga [SEQ ID No: 3]
[0164] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 3, or a variant or fragment thereof.
[0165] In an embodiment, the CpG-depleted VEEV RNA sequence is encoded by the DNA nucleotide sequence of SEQ ID No: 4, below. It will be appreciated that SEQ ID No: 4 corresponds to SEQ ID No: 2 wherein the CpGs have been fully depleted (O / E: 0). atccttgacattggaagtgcaccagccaggagaatgtattctaagcacaagtatcattgtatctgcccaatgagatgtgcagaagatccag acagattgtataagtatgcaactaagctgaagaaaaactgtaaggaaataactgataaggaattggacaagaaaatgaaggagctggcagc agtcatgtcagaccctgacctggaaactgagactatgtgcctccatgatgatgagtcatgtaggtatgaagggcaagtggctgtttaccag gatgtatatgcagttgatggaccaacaagtctctatcaccaagccaataagggagttagagtggcctactggataggctttgacaccaccc cttttatgtttaagaacttggctggagcatatccatcatactctaccaactgggcagatgaaacagtgttaacagctagaaacataggcct atgcagctctgatgttatggagaggtcaagaagagggatgtccattcttagaaagaagtatttgaaaccatccaacaatgttctgttctct gttggctcaaccatctaccatgagaagagggacttcctgaggagctggcacctgccatctgtgtttcacctgagaggcaagcaaaattaca catgcaggtgtgagaccattgtgagttgtgatgggtatgtggtcaaaagaattgccatcagtccaggcctgtatgggaagccttcaggcta tgctgccacaatgcacagggagggattcttgtgctgcaaagtgacagacacattgaatggggagagggtctcttttccagtgtgcacatat gtgccagccacattgtgtgaccaaatgactggcatcctggcaacagatgtcagtgcagatgatgcacaaaaactgctggttgggctcaacc agagaattgtggtcaatggcaggacccagagaaacaccaataccatgaaaaattaccttttgccagtagtggcccaggcatttgctaggtg ggcaaaggaatataaggaagatcaagaagatgaaaggccactaggactaagagatagacagttagtcatggggtgttgttgggcttttaga aggcacaagataacatctatttataagaggccagatacccaaaccatcatcaaagtgaactcagatttccactcatttgtgctgcccagga taggcagtaacacattggagattgggctgagaacaagaatcaggaaaatgttagaggagcacaaggagccatcacctctcattacagcaga ggatgtacaagaagctaagtgtgcagcagatgagagaaaggaggtgagagaagcagaggagttgagggcagctctaccacctttggcagct gatgttgaggagcccactctggaagcagatgtggacttgatgttacaagaggctggggcaggctcagtggagacacctagaggcttgataa aggttaccagctatgatggagaggacaagattggctcttatgctgtgctttctccacaggctgtactcaagagtgaaaaattatcttgcat ccaccctctggctgaacaagtcatagtgataacacactctggcagaaaagggagatatgcagtggaaccataccatggtaaagtagtggtg ccagagggacatgcaataccagtccaggactttcaagctctgagtgaaagtgccaccattgtgtacaatgaaagagagtttgtaaacaggt acctgcaccatattgccacacatggaggagcactgaacactgatgaagaatattacaaaactgtcaagccctcagagcatgatggagaata cctgtatgacattgacaggaaacagtgtgtcaagaaagaactagtcactgggctagggctcacaggagagctggtggatcctcccttccat gaatttgcctatgagagtctgagaacaagaccagcagctccttaccaagtaccaaccataggggtgtatggagtgccaggatcaggcaagt ctggcatcattaaatcagcagtcaccaaaaaagatctagtggtgtcagccaagaaagaaaactgtgcagaaattataagggatgtcaagaa aatgaaagggctggatgtcaatgccagaactgtggactcagtgctcttgaatggatgcaaacacccagtagagaccctgtatattgatgaa gcttttgcttgtcatgcaggtactctcagagcactcatagccattataagacctaaaaaggcagtgctctgtggggatcccaaacagtgtg gtttttttaacatgatgtgcctgaaagtgcattttaaccatgagatttgcacacaagtcttccacaaaagcatctctaggagatgcactaa atctgtgacttcagtggtctcaaccttgttttatgacaaaaaaatgagaacaacaaatccaaaagagactaagattgtgattgacactaca ggcagtaccaaacctaagcaggatgatctcattctcacttgtttcagagggtgggtgaagcagttgcaaatagattacaaaggcaatgaaa taatgacagcagctgcctctcaagggctgaccagaaaaggtgtgtatgcagttaggtacaaggtgaatgaaaatcctctgtatgcacccac ctcagaacatgtgaatgtcctactgaccaggacagaggacaggattgtgtggaaaacactagcaggagacccatggataaaaacactgact gccaagtaccctgggaatttcactgccacaatagaggagtggcaagcagagcatgatgccatcatgaggcacatcttggagagaccagacc ctacagatgtcttccagaataaggcaaatgtgtgttgggccaaggctttagtgccagtgctgaagacagctggcatagacatgaccactga acaatggaacactgtggattattttgaaacagacaaagctcactcagcagagatagtattgaaccaactatgtgtgaggttctttggactg gatctggactcaggtctattttctgcacccactgttccattatccattaggaataatcactgggataactccccatcacctaacatgtatg ggctgaataaagaagtggtcagacagctctctaggaggtacccacaactgcctagggcagttgccactggaagagtctatgacatgaacac tggtacactgaggaattatgatccaaggataaacctagtacctgtaaacagaagactgcctcatgctttagtcctccaccataatgaacac ccacagagtgacttttcttcatttgtcagcaaattgaagggcagaactgtcctggtggtgggggaaaagttgtcagtcccaggcaaaatgg ttgactggttgtcagacaggcctgaggctaccttcagagctaggctggatttaggcatcccaggtgatgtgcccaaatatgacataatatt tgttaatgtgaggaccccatataaataccatcactatcagcagtgtgaagaccatgccattaagcttagcatgttgaccaagaaagcttgt ctgcatctgaatccaggaggaacctgtgtcagcataggttatggttatgctgacagggcctcagaaagcatcattggtgctatagcaaggc tgttcaagttttccagggtatgcaaaccaaaatcctcacttgaagagacagaagttctgtttgtattcattgggtatgataggaaggccag aacacacaatccttacaagctttcatcaaccttgaccaacatttatacaggttccagactccatgaagcaggatgtgcaccctcatatcat gtggtgagaggggatattgccacagccacagaaggagtgattataaatgctgctaacagcaaaggacaacctggaggaggggtgtgtggag cactgtataagaaattcccagaaagctttgatttacagccaattgaagtaggaaaagcaagactggtcaaaggtgcagctaaacatatcat tcatgcagtaggaccaaacttcaacaaagtttcagaggttgaaggtgacaaacagttggcagaggcttatgagtccattgctaagattgtc aatgataacaattacaagtcagtagcaattccactgttgtccacaggcatcttttcagggaacaaagatagactaacccaatcattgaacc atttgctgacagctttagacaccactgatgcagatgtagccatatactgcagggacaagaaatgggaaatgactctcaaggaagcagtggc taggagagaagcagtggaggagatatgcatatcagatgactcttcagtgacagaacctgatgcagagctggtgagggtgcatccaaagagt tctttggctggaaggaagggctacagcacatcagatggcaaaactttctcatatttggaagggaccaagtttcaccaggcagccaaggata tagcagaaattaatgccatgtggccagttgcaacagaggccaatgagcaggtatgcatgtatatcctgggagaaagcatgagcagtattag gtcaaaatgcccagtggaagagtcagaagcctcctcaccacctagcacactgccttgcttgtgcatccatgccatgactccagaaagagta cagaggctaaaagcctcaagaccagaacaaattactgtgtgctcatcctttccattgccaaagtatagaatcactggtgtgcagaagatcc aatgctcccagcctatattgttctcaccaaaagtgcctgcatatattcatccaaggaagtatctggtggaaacaccaccagtagatgagac tccagagccatcagcagagaaccaatccacagaggggacacctgaacaaccaccacttataacagaggatgagaccaggactagaacacct gagccaatcatcattgaagaggaagaagaggatagcataagtttgctgtcagatggcccaacccaccaggtgctgcaagtggaggcagaca ttcatgggccaccctctgtatctagctcatcctggtccattcctcatgcatcagactttgatgtggacagtttatccatacttgacaccct ggagggagcttcagtgacctcaggggcaacatcagcagagactaactcttactttgcaaagagtatggagtttctggcaagaccagtgcct gcacctagaacagtattcaggaaccctccacatccagctccaaggacaagaacaccatcacttgcacccagcagggcctgctcaagaacca gcctagtttccaccccaccaggagtgaatagggtgatcactagagaggagctggaggcacttaccccatcaaggactcctagcaggtcagt ctcaagaaccagcctggtctccaacccaccaggagtaaatagggtgattacaagagaggagtttgaggcatttgtagcacaacaacaaaga aggtttgatgcaggagcatacatcttttcctcagacacaggccaagggcatctgcaacaaaaatcagtgaggcaaacagtgctgtcagaag tggtgttggagaggacagagttggagatttcatatgccccaaggctggaccaagagaaagaagaggtgctgaggaagaaactgcagctgaa tcccacacctgctaacagaagcagataccagtccaggaaggtggagaacatgaaagccatcacagccagaagaattctgcaaggcctgggg cattatttgaaggcagaaggaaaagtggagtgctacagaaccctgcatcctgttcctttgtattcatctagtgtgaacagagccttttcaa gccccaaggtggcagtggaagcctgtaatgccatgttgaaagagaactttccaactgtggcttcttactgtattattccagagtatgatgc ctatttggacatggttgatggagcttcatgctgcttagacactgccagtttttgccctgcaaagctgaggagctttccaaagaaacactcc tatttggaacccacaataagatcagcagtgccttcagcaatccagaacacactccagaatgtcctggcagctgccacaaaaagaaattgca atgtcacacaaatgagagaattgccagtattggattcagcagcctttaatgtggaatgcttcaagaaatatgcatgtaataatgaatattg ggaaacatttaaagaaaaccccatcaggcttactgaagaaaatgtggtaaattacattaccaaattaaaaggaccaaaagctgctgctctt tttgcaaagacacataatttgaatatgttgcaggacataccaatggacaggtttgtaatggacttaaagagagatgtgaaagtgactccag gaacaaaacatactgaagaaaggcccaaggtacaggtgatccaggctgcagatccactagcaacagcatatctgtgtggaatccacagaga gctggttaggagattaaatgcagtcctgcttccaaacattcatacactgtttgatatgtcagctgaagactttgatgctattatagcagag cacttccagcctggggattgtgttctggaaactgacattgcatcatttgataaaagtgaggatgatgccatggctctgacagcattaatga ttctggaagacttaggtgtggatgcagagctgttgacactgattgaggcagcttttggagaaatttcatcaatacatttgcccactaaaac taaatttaaatttggagccatgatgaaatctggaatgttcctcacactgtttgtgaacacagtcattaacattgtaattgcaagcagagtg ttgagagaaaggctaacaggatcaccatgtgcagcattcattggagatgacaatattgtgaaaggagtcaaatcagacaaattaatggcag acaggtgtgccacctggttgaatatggaagtcaagattatagatgctgtggtgggagagaaagcaccttatttctgtggagggtttatttt gtgtgactcagtgacaggcacagcatgcagagtggcagaccccctaaaaaggctgtttaagcttggcaaacctctggcagcagatgatgaa catgatgatgacaggagaagggcattgcatgaagagtcaacaaggtggaacagagtgggtattctttcagagctgtgcaaggcagtagaat caaggtatgaaacagtaggaacttccatcatagttatggccatgactactctagctagcagtgttaaatcattcagctacctgaga
[0166] [SEQ ID No: 4]
[0167] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 4, or a variant or fragment thereof.
[0168] In an embodiment, the wild type VEEV 5'UTR and 51 CSE RNA sequence is represented herein as SEQ ID No: 5, below. The wild type VEEV 5'UTR and 51 CSE
[0169] RNA sequence comprises 13 CpGs (O / E: 0.69). augggcggcgcaugagagaagcccagaccaauuaccuacccaaaAUGgagaaaguucacguugacaucgaggaagacagcccauuccucag agcuuugcagcggacguucccgcaguuugagguagaagccaagcaggucacugauaaugaccaugcuaaugccagagcguuuucgcaucug gcuucaaaacugaucgaaacggagguggacccauccgacacgauccuugacauuggaagugcaccagccaggagaauguauucuaagcaca aguaucauuguaucuguccaaugagaugugcagaa
[0170] [SEQ ID No: 5]
[0171] In an embodiment, the wild type VEEV 5'UTR and 51 CSE RNA sequence is encoded by the DNA nucleotide sequence of SEQ ID No: 6, below. The wild type VEEV 5'UTR and
[0172] 51 CSE DNA nucleotide sequence comprises 13 CpGs (O / E: 0.69). atgggcggcgcatgagagaagcccagaccaattacctacccaaaATGgagaaagttcacgttgacatcgaggaagacagcccattcctcag agctttgcagcggacgttcccgcagtttgaggtagaagccaagcaggtcactgataatgaccatgctaatgccagagcgttttcgcatctg gcttcaaaactgatcgaaacggaggtggacccatccgacacgatccttgacattggaagtgcaccagccaggagaatgtattctaagcaca agtatcattgtatctgtccaatgagatgtgcagaa
[0173] [SEQ ID No: 6]
[0174] In an embodiment, the CpG depleted VEEV 5'UTR and 51 CSE RNA sequence (with
[0175] A42V mutation to maintain secondary structure) is represented herein as SEQ ID No:
[0176] 7, below. It will be appreciated that SEQ ID No: 7 corresponds to SEQ ID No: 5 wherein the CpGs have been fully depleted (O / E: 0).
[0177] augggcagcccaugagagaagcccagaccaauuaccuacccaaaAUGgagaaaguucauguugacauugaggaagacagcccauuccucag agcuuugcagaggacauucccacaguuugagguagaagccaagcaggucacugauaaugaccaugcuaaugccagaguguuuucacaucug gcuucaaaacugauagaaacagagguggacccaucugacacuauccuugacauuggaagugcaccagccaggagaauguauucuaagcaca aguaucauuguaucugcccaaugagaugugcagaa
[0178] [SEQ ID No: 7]
[0179] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 7, or a variant or fragment thereof.
[0180] In an embodiment, CpG depleted VEEV 5'UTR and 51 CSE RNA sequence (with A42V mutation to maintain secondary structure) is encoded by the DNA nucleotide sequence of SEQ ID No: 8, below. It will be appreciated that SEQ ID No: 8 corresponds to SEQ ID No: 6 wherein the CpGs have been fully depleted (O / E: 0). atgggcagcccatgagagaagcccagaccaattacctacccaaaATGgagaaagttcatgttgacattgaggaagacagcccattcctcag agctttgcagaggacattcccacagtttgaggtagaagccaagcaggtcactgataatgaccatgctaatgccagagtgttttcacatctg gcttcaaaactgatagaaacagaggtggacccatctgacactatccttgacattggaagtgcaccagccaggagaatgtattctaagcaca agtatcattgtatctgcccaatgagatgtgcagaa
[0181] [SEQ ID No: 8]
[0182] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 8, or a variant or fragment thereof.
[0183] In an embodiment, the CpG reduced VEEV 5'UTR and 51 CSE RNA sequence (retaining two CpG dinucleotides for structure) is represented herein as SEQ ID No: 9, below. It will be appreciated that SEQ ID No: 9 corresponds to SEQ ID No: 5 wherein the CpGs have been reduced to 2 CpGs (O / E: 0.12).
[0184] augggcagcccaugagagaagcccagaccaauuaccuacccaaaAUGgagaaaguucauguugacauugaggaagacagcccauuccucag agcuuugcagaggacauucccacaguuugagguagaagccaagcaggucacugauaaugaccaugcuaaugccagagcguuuucgcaucug gcuucaaaacugauagaaacagagguggacccaucugacacuauccuugacauuggaagugcaccagccaggagaauguauucuaagcaca aguaucauuguaucugcccaaugagaugugcagaa
[0185] [SEQ ID No: 9]
[0186] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 9, or a variant or fragment thereof.
[0187] In an embodiment, the CpG reduced VEEV 5'UTR and 51 CSE RNA sequence (retaining two CpG dinucleotides for structure) is encoded by the DNA nucleotide sequence of SEQ ID No: 10, below. It will be appreciated that SEQ ID No: 10 corresponds to SEQ ID No: 6 wherein the CpGs have been reduced to 2 CpGs (O / E: 0.12). atgggcagcccatgagagaagcccagaccaattacctacccaaaATGgagaaagttcatgttgacattgaggaagacagcccattcctcag agctttgcagaggacattcccacagtttgaggtagaagccaagcaggtcactgataatgaccatgctaatgccagagcgttttcgcatctg gcttcaaaactgatagaaacagaggtggacccatctgacactatccttgacattggaagtgcaccagccaggagaatgtattctaagcaca agtatcattgtatctgcccaatgagatgtgcagaa
[0188] [SEQ ID No: 10]
[0189] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 10, or a variant or fragment thereof.
[0190] In an embodiment, the CpG reduced VEEV 5'UTR and 51 CSE RNA sequence (retaining four CpG dinucleotides for structure) is represented herein as SEQ ID No: 11, below. It will be appreciated that SEQ ID No: 11 corresponds to SEQ ID No: 5 wherein the CpGs have been reduced to 4 CpGs (O / E: 0.24).
[0191]
[0192] AugggcggcgcaugagagaagcccagaccaauuaccuacccaaaAUGgagaaaguucauguugacauugaggaagacagcccauuccucag agcuuugcagaggacauucccacaguuugagguagaagccaagcaggucacugauaaugaccaugcuaaugccagagcguuuucgcaucug gcuucaaaacugauagaaacagagguggacccaucugacacuauccuugacauuggaagugcaccagccaggagaauguauucuaagcaca aguaucauuguaucugcccaaugagaugugcagaa
[0193] [SEQ ID No: 11]
[0194] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 11, or a variant or fragment thereof.
[0195] In an embodiment, the CpG reduced VEEV 5'UTR and 51 CSE RNA sequence (retaining four CpG dinucleotides for structure) is encoded by the DNA nucleotide sequence of SEQ ID No: 12, below. It will be appreciated that SEQ ID No: 12 corresponds to SEQ ID No: 6 wherein the CpGs have been reduced to 4 CpGs (O / E: 0.24).
[0196] AtgggcggcgcatgagagaagcccagaccaattacctacccaaaATGgagaaagttcatgttgacattgaggaagacagcccattcctcag agctttgcagaggacattcccacagtttgaggtagaagccaagcaggtcactgataatgaccatgctaatgccagagcgttttcgcatctg gcttcaaaactgatagaaacagaggtggacccatctgacactatccttgacattggaagtgcaccagccaggagaatgtattctaagcaca agtatcattgtatctgcccaatgagatgtgcagaa
[0197] [SEQ ID No: 12]
[0198] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 12, or a variant or fragment thereof.
[0199] In an embodiment, the VEEV NSP3 / 4 readthrough loop RNA sequence (nucleotides 5682-5999) is represented herein as SEQ ID No: 13, below. The NSP3 / 4 readthrough loop RNA sequence comprises 14 CpGs (O / E: 0.80).
[0200] Ugacgguuugaug cgggugcauacaucuuuuccuccgacaccggucaagggcauuuacaacaaaaaucaguaaggcaaacggugcuauccg aagugguguuggagaggaccgaauuggagauuucguaugccccgcgccucgaccaagaaaaagaagaauuacuacgcaagaaauuacaguu aaaucccacaccugcuaacagaagcagauaccaguccaggaagguggagaacaugaaagccauaacagcuagacguauucugcaaggccua gggcauuauuugaaggcagaaggaaaaguggagugcuaccgaacc
[0201] [SEQ ID No: 13]
[0202] In an embodiment, the VEEV NSP3 / 4 readthrough loop RNA sequence (nucleotides 5682-5999) is encoded by the DNA nucleotide sequence of SEQ ID No: 14, below. The NSP3 / 4 readthrough loop DNA nucleotide sequence comprises 14 CpGs (O / E: 0.80). tgacggtttgatgcgggtgcatacatcttttcctccgacaccggtcaagggcatttacaacaaaaatcagtaaggcaaacggtgctatccg aagtggtgttggagaggaccgaattggagatttcgtatgccccgcgcctcgaccaagaaaaagaagaattactacgcaagaaattacagtt aaatcccacacctgctaacagaagcagataccagtccaggaaggtggagaacatgaaagccataacagctagacgtattctgcaaggccta gggcattatttgaaggcagaaggaaaagtggagtgctaccgaacc
[0203] [SEQ ID No: 14]
[0204] In an embodiment, the CpG deleted VEEV NSP4 readthrough loop (with mutated NSP3 opal stop codon - UGA to AGA (or AGG), i.e. arginine) RNA sequence (nucleotides 5682-5999) is represented herein as SEQ ID No: 15, below. It will be appreciated that SEQ ID No: 15 corresponds to SEQ ID No: 13 with mutated NSP3 opal stop codon and wherein the CpGs have been fully depleted (O / E: 0).
[0205] Agaagguuugaugcaggagcauacaucuuuuccucagacacaggccaagggcaucugcaacaaaaaucagugaggcaaacagugcugucag aagugguguuggagaggacagaguuggagauuucauaugccccaaggcuggaccaagagaaagaagaggugcugaggaagaaacugcagcu gaaucccacaccugcuaacagaagcagauaccaguccaggaagguggagaacaugaaagccaucacagccagaagaauucugcaaggccug gggcauuauuugaaggcagaaggaaaaguggagugcuacagaacc
[0206] [SEQ ID No: 15]
[0207] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 15, or a variant or fragment thereof. In an embodiment, the CpG deleted VEEV NSP4 readthrough loop (with mutated NSP3 opal stop codon - UGA to AGA (or AGG), i.e. arginine) RNA sequence (nucleotides 5682-5999) is encoded by the DNA nucleotide sequence of SEQ ID No: 16, below. It will be appreciated that SEQ ID No: 16 corresponds to SEQ ID No: 14 with mutated NSP3 opal stop codon and wherein the CpGs have been fully depleted (O / E: 0).
[0208] Agaaggtttgatgcaggagcatacatcttttcctcagacacaggccaagggcatctgcaacaaaaatcagtgaggcaaacagtgctgtcag aagtggtgttggagaggacagagttggagatttcatatgccccaaggctggaccaagagaaagaagaggtgctgaggaagaaactgcagct gaatcccacacctgctaacagaagcagataccagtccaggaaggtggagaacatgaaagccatcacagccagaagaattctgcaaggcctg gggcattatttgaaggcagaaggaaaagtggagtgctacagaacc
[0209] [SEQ ID No: 16]
[0210] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 16, or a variant or fragment thereof.
[0211] In an embodiment, the wild type VEEV subgenomic promotor and 5'UTR RNA sequence (nucleotides 7500-7561) is represented herein as SEQ ID No: 17, below. The wild type VEEV subgenomic promotor and 5'UTR RNA sequence comprises 3 CpGs (O / E: 0.75). ggggccccuauaacucucuacggcuaaccugaAUGgacuacgacauagucuaguccgccaag
[0212] [SEQ ID No: 17]
[0213] In an embodiment, the wild type VEEV subgenomic promotor and 5'UTR RNA sequence (nucleotides 7500-7561) is encoded by the DNA nucleotide sequence of SEQ ID No: 18, below. The wild type VEEV subgenomic promotor and 5'UTR DNA nucleotide sequence comprises 3 CpGs (O / E: 0.75). ggggcccctataactctctacggctaacctgaATGgactacgacatagtctagtccgccaag
[0214] [SEQ ID No: 18]
[0215] In an embodiment, the CpG reduced VEEV subgenomic promotor and 5'UTR RNA sequence (retaining a single CpG to maintain secondary structure) (nucleotides 7500- 7561) is represented herein as SEQ ID NO. 19, below. It will be appreciated that SEQ ID No: 19 corresponds to SEQ ID No: 17 wherein the CpGs have been reduced to 1 CpG (O / E: 0.25). ggggccccuauaacucucuacggcuaaccugaAUGgacuaugacauagucuagucccccaag
[0216] [SEQ ID No: 19]
[0217] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 19, or a variant or fragment thereof.
[0218] In an embodiment, the CpG reduced VEEV subgenomic promotor and 5'UTR RNA sequence (retaining a single CpG to maintain secondary structure) (nucleotides 7500- 7561) is encoded by the DNA nucleotide sequence of SEQ ID NO: 20, below. It will be appreciated that SEQ ID No: 20 corresponds to SEQ ID No: 18 wherein the CpGs have been reduced to 1 CpG (O / E: 0.25). ggggcccctataactctctacggctaacctgaATGgactatgacatagtctagtcccccaag
[0219] [SEQ ID No: 20]
[0220] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 20, or a variant or fragment thereof.
[0221] In an embodiment, the CpG depleted VEEV subgenomic promotor and 5'UTR RNA sequence (nucleotides 7500-7561) is represented herein as SEQ ID No: 21, below. It will be appreciated that SEQ ID No: 21 corresponds to SEQ ID No: 17 wherein the CpGs have been fully depleted (O / E: 0).
[0222] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 21, or a variant or fragment thereof. In an embodiment, the CpG depleted VEEV subgenomic promotor and 5'UTR RNA sequence (nucleotides 7500-7561) is encoded by the DNA nucleotide sequence of SEQ ID No: 22, below. It will be appreciated that SEQ ID No: 22 corresponds to SEQ ID No: 18 wherein the CpGs have been fully depleted (O / E: 0). ggggcccctataactctctaaggctaacctgaATGgactatgacatagtctagtcccccaag
[0223] [SEQ ID No: 22]
[0224] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 22, or a variant or fragment thereof.
[0225] In an embodiment, the CpG depleted VEEV subgenomic promotor and 5'UTR RNA sequence (removing u at position 7541) (nucleotides 7500-7560) is represented herein as SEQ ID No: 23, below. It will be appreciated that SEQ ID No: 23 corresponds to SEQ ID No: 17 with u at position 7541 removed and wherein the CpGs have been fully depleted (O / E: 0). g
[0226] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 23, or a variant or fragment thereof.
[0227] In an embodiment, the CpG depleted VEEV subgenomic promotor and 5'UTR RNA sequence (removing u at position 7541) (nucleotides 7500-7560) is encoded by the DNA nucleic acid sequence of SEQ ID No: 24, below. It will be appreciated that SEQ ID No: 24 corresponds to SEQ ID No: 18 with t at position 7541 removed and wherein the CpGs have been fully depleted (O / E: 0). ggggcccctataactctctaaggctaacctgaATGgactagacatagtctagtcccccaag
[0228] [SEQ ID No: 24] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 24, or a variant or fragment thereof.
[0229] In an embodiment, the wild type VEEV 3'UTR RNA sequence is represented herein as SEQ ID No: 25, below. The wild type VEEV 3'UTR RNA sequence comprises 6 CpGs (O / E: 1.99).
[0230] In an embodiment, the wild type VEEV 3'UTR RNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 26, below. The wild type VEEV 3'UTR DNA nucleic acid sequence comprises 6 CpGs (O / E: 1.99).
[0231] Aattggcaagctgcttacatagaactcgcggcgattggcatgccgccttaaaatttttattttatttttcttttcttttccgaatcggatt ttgtttttaatatttc
[0232] [SEQ ID No: 26]
[0233] In an embodiment, the CpG reduced VEEV 3'UTR RNA sequence (retaining 3 CpGs to maintain secondary structure) is represented herein as SEQ ID No: 27, below. It will be appreciated that SEQ ID No: 27 corresponds to SEQ ID No: 25 wherein the CpGs have been reduced to 3 CpGs (O / E: 1.0).
[0234]
[0235] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 27, or a variant or fragment thereof.
[0236] In an embodiment, the CpG reduced VEEV 3'UTR RNA sequence (retaining 3 CpGs to maintain secondary structure) is encoded by the DNA nucleic acid sequence of SEQ ID No: 28. It will be appreciated that SEQ ID No: 28 corresponds to SEQ ID No: 26 wherein the CpGs have been reduced to 3 CpGs (O / E: 1.0).
[0237] Aattggcaacctggttacatagaactcccaggcattggcatgccgccttaaaatttttattttatttttcttttcttttccgaatcggatt ttgtttttaatatttc
[0238] [SEQ ID No: 28]
[0239] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 28, or a variant or fragment thereof.
[0240] In an embodiment, the CpG reduced VEEV 3'UTR RNA sequence (retaining 3 CpGs to maintain secondary structure) is represented herein as SEQ ID No: 29, below. It will be appreciated that SEQ ID No: 29 corresponds to SEQ ID No: 25 wherein the CpGs have been reduced to 3 CpGs (O / E: 1.0).
[0241] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 29, or a variant or fragment thereof.
[0242] In an embodiment, the CpG reduced VEEV 3'UTR RNA sequence (retaining 3 CpGs to maintain secondary structure) is encoded by the DNA nucleic acid sequence of SEQ ID No: 30. It will be appreciated that SEQ ID No: 30 corresponds to SEQ ID No: 26 wherein the CpGs have been reduced to 3 CpGs (O / E: 1.0).
[0243] Aattggcaagctgcttacatagaactcgcggcgattggcatgcagccttaaaatttttattttatttttcttttcttttcccaatgggatt ttgtttttaatatttc
[0244] [SEQ ID No: 30] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 30, or a variant or fragment thereof.
[0245] In an embodiment, the CpG depleted VEEV 3'UTR version 1 RNA sequence is represented herein as SEQ ID No: 31, below. It will be appreciated that SEQ ID No: 31 corresponds to SEQ ID No: 25 wherein the CpGs have been fully depleted (O / E: 0).
[0246] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 31, or a variant or fragment thereof.
[0247] In an embodiment, the CpG depleted VEEV 3'UTR version 1 RNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 32, below. It will be appreciated that SEQ ID No: 32 corresponds to SEQ ID No: 26 wherein the CpGs have been fully depleted (O / E: 0).
[0248] Aattggcaacctggttacatagaactcccaggcattggcatgcagccttaaaatttttattttatttttcttttcttttcccaatgggatt ttgtttttaatattt [SEQ ID No: 32]
[0249] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 32, or a variant or fragment thereof.
[0250] In an embodiment, the CpG depleted VEEV 3'UTR version 2 RNA sequence is represented herein as SEQ ID No: 33, below. It will be appreciated that SEQ ID No: 33 corresponds to SEQ ID No: 25 wherein the CpGs have been fully depleted (O / E: 0). Furthermore, the repeat sequence element auuuuuauuuua (SEQ ID No: 75) has been modified to cuuuuucuuuuc (SEQ ID No: 76) to reduce additional potential binding of antiviral proteins.
[0251] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 33, or a variant or fragment thereof. In an embodiment, the CpG depleted VEEV 3'UTR version 2 RNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 34, below. It will be appreciated that SEQ ID No: 34 corresponds to SEQ ID No: 26 wherein the CpGs have been fully depleted (O / E: 0). Furthermore, the repeat sequence element atttttatttta (SEQ ID No: 77) has been modified to ctttttcttttc (SEQ ID No: 78) to reduce additional potential binding of antiviral proteins.
[0252] Aattggcaacctggttacatagaactcccaggcattggcatgcagccttaaactttttcttttctttttcttttcttttcccaatgggatt ttgtttttaatatttc
[0253] [SEQ ID No: 34]
[0254] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 34, or a variant or fragment thereof.
[0255] In an embodiment, the CpG depleted VEEV 3'UTR version 3 RNA sequence is represented herein as SEQ ID No: 35, below. It will be appreciated that SEQ ID No: 35 corresponds to SEQ ID No: 25 wherein the CpGs have been fully depleted (O / E: 0). Furthermore, the repeat sequence element auuuuuauuuuauuuuu (SEQ ID No: 79) has been modified to uucuuuauucuauucuu (SEQ ID No: 80) to reduce additional potential binding of antiviral proteins.
[0256] Aa.uuggcaaccugguuacaua.gaacucccaggcauuggcaugca.gccuuaaa.uucuuua.uucuauucuucuuuucuuuuccca.augggauu uuguuuuuaauauuuc [SEQ ID No: 35]
[0257] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 35, or a variant or fragment thereof.
[0258] In an embodiment, the CpG depleted VEEV 3'UTR version 3 RNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 36, below. It will be appreciated that SEQ ID No: 36 corresponds to SEQ ID No: 26 wherein the CpGs have been fully depleted (O / E: 0). Furthermore, the repeat sequence element atttttattttattttt (SEQ ID No: 81) has been modified to ttctttattctattctt (SEQ ID No: 82) to reduce additional potential binding of antiviral proteins.
[0259] Aattggcaacctggttacatagaactcccaggcattggcatgcagccttaaattctttattctattcttcttttcttttcccaatgggatt ttgtttttaatatttc
[0260] [SEQ ID No: 36]
[0261] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 36, or a variant or fragment thereof.
[0262] In an embodiment, the CpG depleted VEEV 3'UTR version 4 RNA sequence is represented herein as SEQ ID No: 37, below. It will be appreciated that SEQ ID No: 37 corresponds to SEQ ID No: 25 wherein the CpGs have been fully depleted (O / E: 0). Furthermore, the entire repeat sequence element uuaaaauuuuuauuuuauuuuucuuuucuuuuccg (SEQ ID No: 83) has been modified to uauucuauucuucuuccc (SEQ ID No: 84) to reduce additional potential binding of antiviral proteins.
[0263]
[0264] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 37, or a variant or fragment thereof.
[0265] In an embodiment, the CpG depleted VEEV 3'UTR version 4 RNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 38, below. It will be appreciated that SEQ ID No: 38 corresponds to SEQ ID No: 26 wherein the CpGs have been fully depleted (O / E: 0). Furthermore, the entire repeat sequence element ttaaaatttttattttatttttcttttcttttccg (SEQ ID No: 85) has been modified to tattctattcttcttccc (SEQ ID No: 86) to reduce additional potential binding of antiviral proteins.
[0266] Aattggcaacctggttacatagaactcccaggcattggcatgcagcctattctattcttcttcccaatgggattttgtttttaatatttc
[0267] [SEQ ID No: 38]
[0268] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 38, or a variant or fragment thereof. In an embodiment, the CpG-Low VEEV saRNA RNA backbone is represented herein as
[0269] SEQ ID No : 39, below. The CpG-Low VEEV saRNA RNA backbone comprises 22 CpGs
[0270] (O / E: 0.056). gccuagggcaguugccacuggaagagucuaugacaugaacacugguacacugaggaauuaugauccaaggauaaaccuaguaccuguaaac agaagacugccuca.ugcuuuaguccucca.ccauaaugaaca.ccca.caga.gugacuuuucuuca.uuugucagcaaa.uuga.agggcaga.acug uccugguggugggggaaaaguugucagucccaggcaaaaugguugacugguugucagacaggccugaggcuaccuucagagcuaggcugga uuuaggcaucccaggugaugugcccaaauaugacauaauauuuguuaaugugaggaccccauauaaauaccaucacuaucagcagugugaa gaccaugccauuaagcuuagcauguugaccaagaaagcuugucugcaucugaauccaggaggaaccugugucagcauagguuaugguuaug cugacagggccucagaaagcaucauuggugcuauagcaaggcuguucaaguuuuccaggguaugcaaaccaaaauccucacuugaagagac agaaguucuguuuguauucauuggguaugauaggaaggccagaacacacaauccuuacaagcuuucaucaaccuugaccaacauuuauaca gguuccagacuccaugaagcaggaugugcacccucauaucauguggugagaggggauauugccacagccacagaaggagugauuauaaaug cugcuaacagcaaaggacaaccuggaggagggguguguggagcacuguauaagaaauucccagaaagcuuugauuuacagccaauugaagu aggaaaagcaagacuggucaaaggugcagcuaaacauaucauucaugcaguaggaccaaacuucaacaaaguuucagagguugaaggugac aaacaguuggcagaggcuuaugaguccauugcuaagauugucaaugauaacaauuacaagucaguagcaauuccacuguuguccacaggca ucuuuucagggaacaaagauagacuaacccaaucauugaaccauuugcugacagcuuuagacaccacugaugcagauguagccauauacug cagggacaagaaaugggaaaugacucucaaggaagcaguggcuaggagagaagcaguggaggagauaugcauaucagaugacucuucagug acagaaccugaugcagagcuggugagggugcauccaaagaguucuuuggcuggaaggaagggcuacagcacaucagauggcaaaacuuucu cauauuuggaagggaccaaguuucaccaggcagccaaggauauagcagaaauuaaugccauguggccaguugcaacagaggccaaugagca gguaugcauguauauccugggagaaagcaugagcaguauuaggucaaaaugcccaguggaagagucagaagccuccucaccaccuagcaca cugccuugcuugugcauccaugccaugacuccagaaagaguacagaggcuaaaagccucaagaccagaacaaauuacugugugcucauccu uuccauugccaaaguauagaaucacuggugugcagaagauccaaugcucccagccuauauuguucucaccaaaagugccugcauauauuca uccaaggaaguaucugguggaaacaccaccaguagaugagacuccagagccaucagcagagaaccaauccacagaggggacaccugaacaa ccaccacuuauaacagaggaugagaccaggacuagaacaccugagccaaucaucauugaagaggaagaagaggauagcauaaguuugcugu cagauggcccaacccaccaggugcugcaaguggaggcagacauucaugggccacccucuguaucuagcucauccugguccauuccucaugc aucagacuuugauguggacaguuuauccauacuugacacccuggagggagcuucagugaccucaggggcaacaucagcagagacuaacucu uacuuugcaaagaguauggaguuucuggcaagaccagugccugcaccuagaacaguauucaggaacccuccacauccagcuccaaggacaa gaacaccaucacuugcacccagcagggccugcucaagaaccagccuaguuuccaccccaccaggagugaauagggugaucacuagagagga gcuggaggcacuuaccccaucaaggacuccuagcaggucagucucaagaaccagccuggucuccaacccaccaggaguaaauagggugauu acaagagaggaguuugaggcauuuguagcacaacaacaaagaagguuugaugcaggagcauacaucuuuuccucagacacaggccaagggc aucugcaacaaaaaucagugaggcaaacagugcugucagaagugguguuggagaggacagaguuggagauuucauaugccccaaggcugga ccaagagaaagaagaggugcugaggaagaaacugcagcugaaucccacaccugcuaacagaagcagauaccaguccaggaagguggagaac augaaagccaucacagccagaagaauucugcaaggccuggggcauuauuugaaggcagaaggaaaaguggagugcuacagaacccugcauc cuguuccuuuguauucaucuagugugaacagagccuuuucaagccccaagguggcaguggaagccuguaaugccauguugaaagagaacuu uccaacuguggcuucuuacuguauuauuccagaguaugaugccuauuuggacaugguugauggagcuucaugcugcuuagacacugccagu uuuugcccugcaaagcugaggagcuuuccaaagaaacacuccuauuuggaacccacaauaagaucagcagugccuucagcaauccagaaca cacuccagaauguccuggcagcugccacaaaaagaaauugcaaugucacacaaaugagagaauugccaguauuggauucagcagccuuuaa uguggaaugcuucaagaaauaugcauguaauaaugaauauugggaaacauuuaaagaaaaccccaucaggcuuacugaagaaaauguggua aauuacauuaccaaauuaaaaggaccaaaagcugcugcucuuuuugcaaagacacauaauuugaauauguugcaggacauaccaauggaca gguuuguaauggacuuaaagagagaugugaaagugacuccaggaacaaaacauacugaagaaaggcccaagguacaggugauccaggcugc agauccacuagcaacagcauaucuguguggaauccacagagagcugguuaggagauuaaaugcaguccugcuuccaaacauucauacacug uuugauaugucagcugaagacuuugaugcuauuauagcagagcacuuccagccuggggauuguguucuggaaacugacauugcaucauuug auaaaagugaggaugaugccauggcucugacagcauuaaugauucuggaagacuuagguguggaugcagagcuguugacacugauugaggc agcuuuuggagaaauuucaucaauacauuugcccacuaaaacuaaauuuaaauuuggagccaugaugaaaucuggaauguuccucacacug uuugugaacacagucauuaacauuguaauugcaagcagaguguugagagaaaggcuaacaggaucaccaugugcagcauucauuggagaug acaauauugugaaaggagucaaaucagacaaauuaauggcagacaggugugccaccugguugaauauggaagucaagauuauagaugcugu ggugggagagaaagcaccuuauuucuguggaggguuuauuuugugugacucagugacaggcacagcaugcagaguggcagacccccuaaaa aggcuguuuaagcuuggcaaaccucuggcagcagaugaugaacaugaugaugacaggagaagggcauugcaugaagagucaacaaggugga acagaguggguauucuuucagagcugugcaaggcaguagaaucaagguaugaaacaguaggaacuuccaucauaguuauggccaugacuac ucuagcuagcaguguuaaaucauucagcuaccugagaggggccccuauaacucucuacggcuaaccugaauggacuacgacauagucuagu ccgccaag - Gene of interest- aauuggcaagcugcuuacauagaacucgcggcgauuggcaugccgccuuaaaauuuuuauuuuauuuuucuuuucuuuuccgaaucggauu uuguuuuuaauauuucaaaaaaaaaaaaaaaaaaaaaaaaa
[0271] [SEQ ID No: 39]
[0272] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 39, or a variant or fragment thereof.
[0273] In an embodiment, the CpG-Low VEEV saRNA RNA backbone is encoded by the DNA nucleic acid sequence of SEQ ID No: 40. The CpG-Low VEEV saRNA DNA nucleic acid sequence comprises 22 CpGs (O / E: 0.056). atgggcggcgcatgagagaagcccagaccaattacctacccaaaATGgagaaagttcacgttgacatcgaggaagacagcccattcctcag agctttgcagcggacgttcccgcagtttgaggtagaagccaagcaggtcactgataatgaccatgctaatgccagagcgttttcgcatctg gcttcaaaactgatcgaaacggaggtggacccatccgacacgatccttgacattggaagtgcaccagccaggagaatgtattctaagcaca agtatcattgtatctgcccaatgagatgtgcagaagatccagacagattgtataagtatgcaactaagctgaagaaaaactgtaaggaaat aactgataaggaattggacaagaaaatgaaggagctggcagcagtcatgtcagaccctgacctggaaactgagactatgtgcctccatgat gatgagtcatgtaggtatgaagggcaagtggctgtttaccaggatgtatatgcagttgatggaccaacaagtctctatcaccaagccaata agggagttagagtggcctactggataggctttgacaccaccccttttatgtttaagaacttggctggagca tat coat catactctaccaa ctgggcagatgaaacagtgttaacagctagaaacataggcctatgcagctctgatgttatggagaggtcaagaagagggatgtccattctt agaaagaagtatttgaaaccatccaacaatgttctgttctctgttggctcaaccatctaccatgagaagagggacttcctgaggagctggc acctgccatctgtgtttcacctgagaggcaagcaaaattacacatgcaggtgtgagaccattgtgagttgtgatgggtatgtggtcaaaag [SEQ ID No: 40]
[0274] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 40, or a variant or fragment thereof.
[0275] In an embodiment, the RNA sequence for CpG depleted SARS-CoV-2 spike glycoprotein is represented herein as SEQ ID No: 41, below.
[0276] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO:41, or a variant or fragment thereof.
[0277] In an embodiment, the RNA sequence for CpG depleted SARS-CoV-2 spike glycoprotein is encoded by the DNA nucleic acid sequence of SEQ ID No: 42, below.
[0278]
[0279] [SEQ ID No: 42]
[0280] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 42, or a variant or fragment thereof.
[0281] In an embodiment, the RNA sequence for CpG depleted firefly luciferase-mGreen lantern fusion protein is represented herein as SEQ ID No: 43, below.
[0282] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO:43, or a variant or fragment thereof.
[0283] In an embodiment, the RNA sequence for CpG depleted firefly luciferase-mGreen lantern fusion protein is encoded by the DNA nucleic acid sequence of SEQ ID No: 44, below.
[0284] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 44, or a variant or fragment thereof.
[0285] In an embodiment, the RNA sequence for CpG depleted Ebola virus spike glycoprotein is represented herein as SEQ ID No: 45, below.
[0286]
[0287] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO:45, or a variant or fragment thereof.
[0288] In an embodiment, the RNA sequence for CpG depleted Ebola virus spike glycoprotein is encoded by the DNA nucleic acid sequence of SEQ ID No: 46, below.
[0289] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 46, or a variant or fragment thereof.
[0290] In an embodiment, the RNA sequence for CpG depleted Lassa virus spike glycoprotein is represented herein as SEQ ID No: 47, below.
[0291] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 47, or a variant or fragment thereof.
[0292] In an embodiment, the RNA sequence for CpG depleted Lassa virus spike glycoprotein is encoded by the DNA nucleic acid sequence of SEQ ID No: 48, below.
[0293] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 48, or a variant or fragment thereof.
[0294] In an embodiment, the RNA sequence for CpG depleted human erythropoietin is represented herein as SEQ ID No: 49, below.
[0295] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 49, or a variant or fragment thereof.
[0296] In an embodiment, the RNA sequence for CpG depleted human erythropoietin is encoded by the DNA nucleic acid sequence of SEQ ID No: 50, below.
[0297] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 50, or a variant or fragment thereof.
[0298] In an embodiment, the codon optimised CpG-Low, UpA-Low VEEV saRNA sequence is represented herein as SEQ ID No: 51, below. The codon optimised CpG-Low, UpA-Low
[0299] VEEV saRNA sequence comprises 22 CpGs (O / E: 0.05) and 128 UpAs (O / E: 0.26).
[0300]
[0301] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 51, or a variant or fragment thereof.
[0302] In an embodiment, the codon optimised CpG-Low, UpA-Low VEEV saRNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 52, below. The codon optimised CpG-Low, UpA-Low VEEV DNA template sequence comprises 22 CpGs (O / E:
[0303] 0.05) and 128 TpAs (O / E: 0.26).
[0304] ]
[0305] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 52, or a variant or fragment thereof.
[0306] In an embodiment, the CpG-depleted VEEV saRNA sequence (comprising sequence
[0307] SEQ ID No: 3, SEQ ID No: 7, SEQ ID No: 15, SEQ ID No: 21, & SEQ ID No: 31) is represented herein as SEQ ID No: 53, below. The CpG-depleted VEEV saRNA sequence does not comprise any CpGs (O / E: 0).
[0308]
[0309] [SEQ ID No: 53]
[0310] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 53, or a variant or fragment thereof.
[0311] In an embodiment, the CpG-depleted VEEV DNA template sequence (comprising sequence SEQ ID No: 4, SEQ ID No: 8, SEQ ID No: 16, SEQ ID No: 22, & SEQ ID No:
[0312] 32) is represented herein as SEQ ID No: 54, below. The CpG-depleted VEEV DNA template sequence does not comprise any CpGs (O / E: 0).
[0313]
[0314] [SEQ ID No: 54]
[0315] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 54, or a variant or fragment thereof.
[0316] In an embodiment, the codon optimised CpG-depleted, UpA-Low VEEV saRNA sequence is represented herein as SEQ ID No: 55, below. The codon optimised CpG- depleted, UpA-Low VEEV saRNA sequence does not comprise any CpGs (O / E: 0) and comprises 129 UpAs (O / E: 0.26).
[0317]
[0318] [SEQ ID No: 55] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 55, or a variant or fragment thereof.
[0319] In an embodiment, the codon optimised CpG-depleted, UpA-Low VEEV saRNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 56, below. The codon optimised CpG-depleted, UpA-Low VEEV DNA template does not comprise any
[0320] CpGs (O / E: 0) and comprises 129 TpAs (O / E: 0.26).
[0321]
[0322] [SEQ ID No: 56]
[0323] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 56, or a variant or fragment thereof.
[0324] In an embodiment, the CpG-minimal reduction VEEV saRNA sequence is represented herein as SEQ ID No: 57, below. The CpG-minimal reduction VEEV saRNA sequence comprises 239 CpGs (O / E: 0.76) and 367 UpAs (O / E: 0.70).
[0325]
[0326] [SEQ ID No: 57]
[0327] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 57, or a variant or fragment thereof.
[0328] In an embodiment, the CpG-minimal reduction VEEV saRNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 58, below. The CpG-minimal reduction
[0329] VEEV DNA template sequence comprises 239 CpGs (O / E: 0.76) and 367 UpAs (O / E:
[0330] 0.70).
[0331] [SEQ ID No: 58]
[0332] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 58, or a variant or fragment thereof.
[0333] In an embodiment, the Wild type (WT) SFV RNA sequence (Parenteral strain, isolate
[0334] LIO, complete genome ID: KP271965.1) is represented herein as SEQ ID NO: 59, below. The Wild type (WT) SFV RNA sequence comprises 474 CpGs (O / E: 0.89) and
[0335] 337 UpAs (O / E: 0.80).
[0336]
[0337] [SEQ ID No: 59]
[0338] In an embodiment, the wild type (WT) SFV RNA sequence (Parenteral strain, isolate
[0339] LIO, complete genome ID: KP271965.1) is encoded by the DNA nucleic acid of SEQ ID
[0340] NO: 60, below. The wild type (WT) SFV DNA template sequence comprises 474 CpGs
[0341] (O / E: 0.89) and 337 TpAs (O / E: 0.80).
[0342]
[0343] [SEQ ID No: 60]
[0344] In an embodiment, the CpG-Low SFV saRNA sequence is represented herein as SEQ
[0345] ID NO: 61, below. It will be appreciated that SEQ ID No: 61 corresponds to SEQ ID
[0346] No: 59 wherein the CpGs have been reduced to 25 CpGs (O / E: 0.04).
[0347] [SEQ ID No: 61]
[0348] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 61, or a variant or fragment thereof.
[0349] In an embodiment, the CpG-Low SFV saRNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID NO: 62, below. It will be appreciated that SEQ ID No: 62 corresponds to SEQ ID No: 60 wherein the CpGs have been reduced to 25 CpGs (O / E:
[0350] 0.04).
[0351]
[0352] [SEQ ID No: 62]
[0353] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 62, or a variant or fragment thereof.
[0354] In an embodiment, the CpG-maximally reduced SFV saRNA sequence is represented herein as SEQ ID No: 63, below. It will be appreciated that SEQ ID No: 63 corresponds to SEQ ID No: 59 wherein the CpGs have been reduced to 3 CpGs (O / E:
[0355] 0.005) and the UpAs reduced to 118 (Q / E:0.32).
[0356]
[0357] [SEQ ID No: 63]
[0358] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 63, or a variant or fragment thereof.
[0359] In an embodiment, the CpG-maximally reduced SFV saRNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 64, below. It will be appreciated that SEQ ID No: 64 corresponds to SEQ ID No: 60 wherein the CpGs have been reduced to
[0360] 3 CpGs (O / E: 0.005) and the TpAs reduced to 118 (O / E:0.32).
[0361]
[0362] [SEQ ID No: 64]
[0363] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 64, or a variant or fragment thereof.
[0364] In an embodiment, the wild type (WT) CHIKV RNA sequence (parental strain) is represented herein as SEQ ID No: 65, below. The wild type (WT) CHIKV RNA sequence comprises 404 CpGs (O / E: 0.83) and 445 UpAs (O / E: 0.89).
[0365]
[0366] [SEQ ID No: 65]
[0367] In an embodiment, the wild type (WT) CHIKV RNA sequence (parental strain) is encoded by the DNA nucleic acid sequence of SEQ ID No: 66, below. The wild type
[0368] (WT) CHIKV DNA template sequence comprises 404 CpGs (O / E: 0.83) and 445 TpAs
[0369] (O / E: 0.89). [SEQ ID No: 66]
[0370] In an embodiment, the CpG-Low CHIKV saRNA sequence is represented herein as SEQ
[0371] ID No: 67, below. It will be appreciated that SEQ ID No: 67 corresponds to SEQ ID
[0372] No: 65 wherein the CpGs have been reduced to 25 CpGs (O / E: 0.056) and 279 UpAs
[0373] (O / E: 0.51).
[0374]
[0375] [SEQ ID No: 67]
[0376] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 67, or a variant or fragment thereof.
[0377] In an embodiment, the CpG-Low CHIKV saRNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 68, below. It will be appreciated that SEQ ID No:
[0378] 68 corresponds to SEQ ID No: 66 wherein the CpGs have been reduced to 25 CpGs
[0379] (O / E: 0.056) and 279 TpAs (O / E: 0.51).
[0380]
[0381] [SEQ ID No: 68]
[0382] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 68, or a variant or fragment thereof. In an embodiment, the CpG-maximally reduced CHIKV saRNA sequence is represented herein as SEQ ID No: 69, below. It will be appreciated that SEQ ID No: 69 corresponds to SEQ ID No: 65 wherein the CpGs have been reduced to 2 CpGs (O / E:
[0383] 0.0045) and 278 UpAs (O / E: 0.50). auggcugcgugaga.caca.cgua.gccuacca.guuucuuacugcucuacucugcaaagcaagaga.uuaa.uaacccaucAuggauccugugua.u guggacauagaugcugacagugccuuuuugaaggcccugcaaagggcaauaccccauguuugagguggaaccaaggcaggucacacccaau gaccaugcuaaugcugagcuuucucucaucuagcuauaaaacugauugagcaggaaauugauccagacucaaccauccuggauauuggcag ugcaccagcaaggaggaugaugucagacaggaaguaccacugugucugcccaaugaggagugcagaagauccagagagacuggcuaauuau gcaagaaagcuggcaucugcagcaggaaaaguccuggacagaaacaucucuggaaagauuggagaccugcaagcagugauggcagugccag acaaggagacaccaacauucugccugcacacagaugucucauguagacagagagcagauguggcuaucuaccaagaugucuaugcugugca ugcacccacaucacuguaccaccaggcaauuaaaggagucagaguggcauacuggguuggguuugacacaacaccauucauguacaaugcc auggcaggagccuacccaucauacucaacaaacugggcagaugagcaggugcugaaggcuaagaacauuggacuguguucaacagaccuga cagaaggcagaagaggcaaguugucuauuaugagaaggaaaaagcugaaaccaugugacagagugcuguucucagugggcucaacacucua cccagaaagcaggaagcugcugaagagcuggcaccugccaucaguguuccaucugaagggcaaacucagcuucacaugcaggugugauaca gugguuucaugugagggcuaugugguuaagagaaucacaaugagcccaggccuguauggaaaaaccacaggguaugcagugacccaccaug cagauggauuccugaugugcaagacuacagacacaguugauggagaaagaaugucauucucagugugcacauaugugccagcaaccauuug ugaucaaaugacaggcauccuggcuacagaagucacaccagaggaugcacagaagcuguuggugggccugaaccagagaauugugguuaau ggcagaacacaaaggaauaugaacaccaugaaaaauuaucugcugccagugguggcccaagccuucaguaagugggcaaaggagugcagga aagacauggaagaugaaaaacuccugggagucagagaaagaacacugaccugcugcugucugugggcauucaagaagcagaaaacacacac agucuacaagaggccugauacccagucaauucagaagguucaggcagaguuugacagcuuuguggugccaagucuguggucaucaggguug ucaaucccuuugaggacuagaaucaaaugguugcugagcaaggugccaaaaacagaccugaucccauacucaggagaugccagagaagcca gggaugcagaaaaagaagcagaggaagaaagagaagcagaacugacuagggaagcccugccaccucugcaggcagcacaggaagauguuca gguggaaauugauguggaacagcuggaggacagagcaggagcaggaaucauugagacuccaagaggagcuaucaaaguuacugcccaacca acagaccauguggugggagaguaccuggugcucagcccacagacagugcugagaagccagaagcucagucugauucaugcuuuggcagagc aagugaagacaugcacacacaauggaagagcagggagguaugcaguggaagcauaugauggcagaguccuggugcccucaggcuaugcaau cucaccugaagacuuccagagucugucagaaucagcaacaaugguguauaaugaaagagaguuugugaacagaaagcugcaccauauugca augcauggaccagcccugaacacagaugaagagucauaugagcuggugagggcagagaggacagaacaugaguaugucuaugauguggauc agagaagaugcuguaagaaggaagaagcagcaggacuggugcuggugggagacuugacuaauccacccuaccaugaauuugcauaugaagg gcugaaaaucaggccugccugcccauacaaaauugcagucauuggagucuuuggagugccaggaucuggcaagucagcuauuaucaagaac cugguuaccaggcaggaccuggugacuucaggaaagaaagaaaacugccaagaaaucaccacagaugugaugagacagagaggccuggaga ucucugcaagaacaguugacucacugcucuugaauggaugcaacagaccaguggauguguuguauguggaugaggcauuugcaugccacuc uggaacacugcuggcuuugauugccuuggugagaccaaggcagaaaguugugcuguguggagacccaaagcaguguggcuucuucaauaug augcagaugaaagucaacuauaaucacaacaucugcacccaaguguaccacaaaaguaucuccaggagguguacacugccugugacagcca uugugucaucauugcauuaugaaggcaaaaugaggacuacaaaugaguacaacaagccaauugugguggacacuacaggcucaacaaaacc ugacccuggagaccuggugcugacaugcuucagaggguggguuaaacaacugcaaauugacuauagaggauaugaggucaugacagcagca gcaucccaagggcugaccagaaaaggaguuuaugcaguuagacaaaaaguuaaugaaaacccacucuaugcaucaacaucagagcauguca augugcuccugacaagaacagaaggcaaacugguguggaagacacugucaggagacccauggaucaagacacugcagaacccaccaaaagg aaacuucaaagcaacuauuaaggagugggagguggagcaugcaucaaucauggcaggcaucugcagucaccaaaugaccuuugauacauuc caaaauaaagccaauguuuguugggcuaagagcuuggucccuauccuggaaacagcagggaucaaacugaaugauaggcaguggucucaga ucauucaagccuucaaagaagacaaagcauacucaccugaaguggcccugaaugaaaucuguacaaggauguauggaguggaucuggacuc agggcuguucucuaaaccauuggugucuguguauuaugcagauaaccacugggauaauaggccuggagggaaaauguuuggauuuaaccca gaggcagcauccauucuggaaagaaaguauccauucacaaaagggaaguggaacaucaacaagcagaucugugugacuaccaggaggauug aagacuuuaacccuaccaccaacaucaucccagccaacaggagacugccacacucacugguggcagaacacaggccagugaaaggagaaag aauggaauggcugguuaacaagaucaauggccaccaugugcuccuggucaguggcuauaaccuggcacugccuacuaagagagucacuugg guggcaccacugggagucagaggagcagacuacacauacaaccuggaguugggccugccagcaacacugggcagguaugaccuggugguca ucaacauccacacacccuuuaggauccaccauuaccaacaguguguggaccaugcaaugaaacugcaaaugcugggaggagacucauugag acugcucaaaccaggaggcucucuguugaucagagcauauggcuaugcagauagaaccagugaaagagucaucuguguguugggaaggaag uuuagaucaucuagagcauugaaaccaccaugugucaccagcaacacugagauguucuuccuguucagcaacuuugacaauggcagaagga auuucacaacucaugucaugaacaaucaacugaaugcagccuuugugggacaggucaccagagcaggaugugcaccaucauacagggugaa aaggauggacauugcaaagaaugaugaagaguguguggucaaugcagcuaacccuagaggccugccaggagauggaguuugcaaggcagug uacaaaaaauggccagaguccuuuaagaacagugcaacaccagugggaacagcaaaaacaguuauguguggcacauauccagugauccaug cuguuggaccaaacuucucuaauuauucagagucugaaggagacagggaauuggcagcugccuauagagaaguggcaaaggaagugacuag gcugggagugaauaguguggcuaucccucuccucuccacaggaguguacucaggagggaaagacaggcugacccagucacugaaccaccuc uuuacagccauggacucaacagaugcagauguggucaucuacugcagggacaaagaaugggagaagaaaaucucugaggccauccagauga ggacccaaguggagcugcuggaugagcacaucuccauugacugugauauuguuagggugcacccugacagcagcuuggcaggcagaaaagg auacagcaccacagaaggagcacuguacucauaucuggaagggaccagauuucaucagacagcuguggauauggcagagauccauacuaug uggccaaagcaaacagaggccaaugagcaagucugccuguaugcccugggagaaaguauugaaucaaucaggcagaaaugcccaguggaug augcagaugcaucaucuccucccaaaacugucccaugccugugcagauaugcuaugacuccagaaagggucaccaggcugaggaugaacca ugucacaagcaucauuguguguucuucauuuccucucccaaaguacaaaauugaaggagugcaaaaagucaaaugcucuaaggugaugcug uuugaccacaaugugccaucaagggugaguccaagggaauauagaucuucccaggagucugcacaggaggcaaguacaaucacaucacuga cacauagucaauuugaccugucaguugauggagagauccugccagucccaucagaccuggaugcugaugcuccagcccuggaaccagcacu ggaugauggagcaacacacacacugccauccacaacaggaaaccuggcagcagugucugacugggugaugagcacagugccugugg caeca cccagaagaaggagagggagaaaccugacugugacaugugaugagagagaagggaauaucacacccauggcuucagucagauucuuuaggg cagagcuguguccaguggugcaagaaacagcagagacaagagacacagcaaugucucugcaggcaccaccaaguacagccacagaaccaaa ucauccaccaaucuccuuuggagcaucaucagagacauucccuauuacauuuggagacuucaaugaaggagaaauugaaagcuugucuucu gagcugcugacuuuuggagacuuccugccaggagaaguggaugacuugacagacucagacugguccacaugcucagacacagaugaugagc ugagacuggacagggcaggaggguauaucuucuccucugacacaggcccaggccaucugcaacagaagucagugagacagucagugcugcc agugaacacccuggaggaaguccaugaggagaaguguuacccaccuaagcuggaugaagcaaaggagcaacugcugcugaagaaacuccag gagagugcauccauggccaacagaagcagguaucagucaaggaaaguggaaaacaugaaagcagcaaucauccagagacugaagagaggcu guagacuguaccugaugucagagacaccaaaagucccuacuuacaggacuacauauccagcaccuguguacucaccuccaaucaaugucag auuguccaauccagagucagcaguggcagcaugcaaugaguuccuggcuagaaacuauccaacugucucaucauaccaaauuacagaugag
[0384]
[0385] [SEQ ID No: 69]
[0386] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 69, or a variant or fragment thereof.
[0387] In an embodiment, the CpG-maximally reduced CHIKV saRNA sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 70, below. It will be appreciated that
[0388] SEQ ID No: 70 corresponds to SEQ ID No: 66 wherein the CpGs have been reduced to
[0389] 2 CpGs (O / E: 0.0045) and 278 TpAs (O / E: 0.50). atgtgctcctgacaagaacagaaggcaaactggtgtggaagacactgtcaggagacccatggatcaagacactgcagaacccaccaaaagg aaacttcaaagcaactattaaggagtgggaggtggagcatgcatcaatcatggcaggcatctgcagtcaccaaatgacctttgatacattc caaaataaagccaatgtttgttgggctaagagcttggtccctatcctggaaacagcagggatcaaactgaatgataggcagtggtctcaga tcattcaagccttcaaagaagacaaagcatactcacctgaagtggccctgaatgaaatctgtacaaggatgtatggagtggatctggactc agggctgttctctaaaccattggtgtctgtgtattatgcagataaccactgggataataggcctggagggaaaatgtttggatttaaccca gaggcagcatccattctggaaagaaagtatccattcacaaaagggaagtggaacatcaacaagcagatctgtgtgactaccaggaggattg aagactttaaccctaccaccaacatcatcccagccaacaggagactgccacactcactggtggcagaacacaggccagtgaaaggagaaag aatggaatggctggttaacaagatcaatggccaccatgtgctcctggtcagtggctataacctggcactgcctactaagagagtcacttgg gtggcaccactgggagtcagaggagcagactacacatacaacctggagttgggcctgccagcaacactgggcaggtatgacctggtggtca tcaacatccacacaccctttaggatccaccattaccaacagtgtgtggaccatgcaatgaaactgcaaatgctgggaggagactcattgag actgctcaaaccaggaggctctctgttgatcagagcatatggctatgcagatagaaccagtgaaagagtcatctgtgtgttgggaaggaag tttagatcatctagagcattgaaaccaccatgtgtcaccagcaacactgagatgttcttcctgttcagcaactttgacaatggcagaagga atttcacaactcatgtcatgaacaatcaactgaatgcagcctttgtgggacaggtcaccagagcaggatgtgcaccatcatacagggtgaa aaggatggacattgcaaagaatgatgaagagtgtgtggtcaatgcagctaaccctagaggcctgccaggagatggagtttgcaaggcagtg tacaaaaaatggccagagtcctttaagaacagtgcaacaccagtgggaacagcaaaaacagttatgtgtggcacatatccagtgatccatg ctgttggaccaaacttctctaattattcagagtctgaaggagacagggaattggcagctgcctatagagaagtggcaaaggaagtgactag gctgggagtgaatagtgtggctatccctctcctctccacaggagtgtactcaggagggaaagacaggctgacccagtcactgaaccacctc tttacagccatggactcaacagatgcagatgtggtcatctactgcagggacaaagaatgggagaagaaaatctctgaggccatccagatga ggacccaagtggagctgctggatgagcacatctccattgactgtgatattgttagggtgcaccctgacagcagcttggcaggcagaaaagg atacagcaccacagaaggagcactgtactcatatctggaagggaccagatttcatcagacagctgtggatatggcagagatccatactatg tggccaaagcaaacagaggccaatgagcaagtctgcctgtatgccctgggagaaagtattgaatcaatcaggcagaaatgcccagtggatg atgcagatgcatcatctcctcccaaaactgtcccatgcctgtgcagatatgctatgactccagaaagggtcaccaggctgaggatgaacca tgtcacaagcatcattgtgtgttcttcattt octet cccaaagtacaaaattgaaggagtgcaaaaagtcaaatgctctaaggtgatgctg tttgaccacaatgtgccatcaagggtgagtccaagggaatatagatcttcccaggagtctgcacaggaggcaagtacaatcacatcactga cacatagtcaatttgacctgtcagttgatggagagatcctgccagtcccatcagacctggatgctgatgctccagccctggaaccagcact ggatgatggagcaacacacacactgccatccacaacaggaaacctggcagcagtgtctgactgggtgatgagcacagtgcctgtggcacca cccagaagaaggagagggagaaacctgactgtgacatgtgatgagagagaagggaatatcacacccatggcttcagtcagattctttaggg cagagctgtgtccagtggtgcaagaaacagcagagacaagagacacagcaatgtctctgcaggcaccaccaagtacagccacagaaccaaa tcatccaccaatctcctttggagcatcatcagagacattccctattacatttggagacttcaatgaaggagaaattgaaagcttgtcttct gagctgctgacttttggagacttcctgccaggagaagtggatgacttgacagactcagactggtccacatgctcagacacagatgatgagc tgagactggacagggcaggagggtatatcttctcctctgacacaggcccaggccatctgcaacagaagtcagtgagacagtcagtgctgcc agtgaacaccctggaggaagtccatgaggagaagtgttacccacctaagctggatgaagcaaaggagcaactgctgctgaagaaactccag gagagtgcatccatggccaacagaagcaggtatcagtcaaggaaagtggaaaacatgaaagcagcaatcatccagagactgaagagaggct gtagactgtacctgatgtcagagacaccaaaagtccctacttacaggactacatatccagcacctgtgtactcacctccaatcaatgtcag attgtccaatccagagtcagcagtggcagcatgcaatgagttcctggctagaaactatccaactgtctcatcataccaaattacagatgag tatgatgcatatctggacatggtggatgggtcagagagttgcctggacagagcaacattcaatccatcaaaactcaggagctacccaaaac agcatgcttaccatgcaccctccatcagatcagctgtgccatccccattccagaacacactgcagaatgtgctggcagcagccacaaaaag aaactgcaatgtcacacagatgagggaactgcccactttggactcagcagtgttcaatgtggagtgtttcaaaaaatttgcatgcaaccaa gaatactgggaagaatttgctgccagccctattaggatcacaactgagaatctggcaacctatgttactaaactgaaagggccaaaagcag cagcactgtttgcaaaaacccataatctgctgccactgcaggaagtgccaatggataggttcacagtggatatgaaaagggatgtgaaggt gactcctggcacaaagcatacagaggaaagacctaaggtgcaggttatccaggcagctgaacccttggcaacagcatacctgtgtgggatt cacagagagctggttaggaggctgaatgcagtcctcctgcccaatgtgcatacactgtttgacatgtctgcagaggattttgatgccatca ttgcagcacactttaagccaggagacactgtgttggaaacagacattgcctcctttgataagagccaagatgattcactggcactcactgc tttgatgctgctggaggatctgggagtggatcactccctgctggacttgattgaggctgcctttggagagatttccagctgtcacctgcca acaggcacaaggttcaagtttggagccatgatgaaatcaggcatgttcctgactctgtttgtcaacacattgctgaacatcaccattgcca gcagagtgctggaagatagactgacaaaatcagcatgtgcagccttcattggagatgacaacatcattcatggagtggtctcagatgaatt gatggcagccagatgtgccacttggatgaacatggaagtgaagatcattgatgcagttgtgtccttgaaagctccttacttctgtggaggg tttatcctgcatgatactgtgacaggaacagcttgcagagtggcagacccactgaaaaggctgtttaaactgggcaaaccactggcagcag gagatgaacaagatgaagatagaagaagagcactggctgatgaagtgatcagatggcaaagaacagggctgattgatgagctggagaaagc agtgtactctaggtatgaagtgcagggcatctcagttgtggtgatgtccatggccacctttgcaagctccagatccaactttgagaagctc agaggaccagtcataactttgtatggtggtcctaaataggtaagcactacagctacctattttgcagaagcccacagcaagtatctaaaca ctaatcagctaca-gene of interest cttgacaattaagtatgaaggtatatgtgtcccctaagagacacactgtacatagcaaataatctatagatcaaagggctaagcaacccct gaatagtaacaaaatacaaaatcactaaaaattataaaaacagaaaaatacataaataggtatacatgtcccctaagagacacattgtatg taggtgataagtatagatcaaagggcccaataacccctgaatagtaacaaaatatgaaaatcaataaaaatcataaaatagaaaaaccata aacagaagtagttcaaagggctataaaacccctgaatagtaacaaaacataaaattaataaaaatcaaatgaataccataattggcaaaag gaagagatgtaggtacttaagcttcctaaaagcagccaaactcactttgagaagtaggcatagcataccaaactcttccatgattctccaa acccacagggaagtaggagatgttattttgtttttaatatttcc
[0390] [SEQ ID No: 70]
[0391] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 70, or a variant or fragment thereof.
[0392] In an embodiment, the CpG-reduced Kinjun (Flavivirus) replicon saRNA sequence derived from the parenteral strain (GenBank: JX276662.1) is represented herein as SEQ ID No: 71, below. The CpG-reduced Kinjun (Flavivirus) replicon saRNA sequence comprises 33 CpGs (0 / E: 0.065) and 123 UpAs (O / E: 0.24).
[0393]
[0394] [SEQ ID No: 71]
[0395] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 71, or a variant or fragment thereof.
[0396] In an embodiment, the CpG-reduced Kinjun (Flavivirus) replicon saRNA sequence derived from the parenteral strain (GenBank: JX276662.1) is encoded by the DNA nucleic acid sequence of SEQ ID No: 72, below. The CpG-reduced Kinjun (Flavivirus) replicon DNA sequence comprises 33 CpGs (O / E: 0.065) and 123 TpAs (O / E: 0.24).
[0397]
[0398] [SEQ ID No: 72]
[0399] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 72, or a variant or fragment thereof. In an embodiment, the CpG-reduced Nodamura (Nodavirus) replicon saRNA sequence derived from the parenteral strain (GenBank: NC_002690.1) is represented herein as
[0400] SEQ ID No: 73, below. The CpG-reduced Nodamura (Nodavirus) replicon saRNA sequence comprises 12 CpGs (O / E: 0.06) and 59 UpAs (O / E: 0.3).
[0401] [SEQ ID No: 73]
[0402] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 73, or a variant or fragment thereof.
[0403] In an embodiment, the CpG-reduced Nodamura (Nodavirus) replicon saRNA sequence derived from the parenteral strain (GenBank: NC_002690.1) is encoded by the DNA nucleic acid sequence of SEQ ID No: 74, below. The CpG-reduced Nodamura
[0404] (Nodavirus) replicon DNA sequence comprises 12 CpGs (O / E: 0.06) and 59 TpAs (O / E:
[0405] 0.3).
[0406]
[0407] [SEQ ID No: 74]
[0408] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 74, or a variant or fragment thereof.
[0409] In a further embodiment, the codon optimised CpG-Low VEEV saRNA sequence is represented herein as SEQ ID No: 87, below. The codon optimised CpG-Low VEEV saRNA sequence comprises 51 CpGs (O / E: 0.133) and 372 UpAs (O / E: 0.638).
[0410]
[0411] [SEQ ID No: 87]
[0412] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 87, or a variant or fragment thereof. In an embodiment, the CpG-low VEEV DNA template sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 88, below. The codon optimised CpG-Low VEEV
[0413] DNA template sequence comprises 51 CpGs (O / E: 0.133) and 372 TpAs (O / E: 0.638). atgggcggcgcatgagagaagcccagaccaattacctacccaaaatggagaaagttcacgttgacatcgaggaagacagcccattcctcag agctttgcagcggacgttcccgcagtttgaggtagaagccaagcaggtcactgataatgaccatgctaatgccagagcgttttcgcatctg gcttcaaaactgatcgaaacggaggtggacccatccgacacgatccttgacattggaagtgcaccagccaggagaatgtattctaagcaca agtatcattgtatctgtccaatgagatgtgcagaagatccagacagattgtataagtatgcaactaagctgaagaaaaactgtaaggaaat aactgataaggaattggacaagaaaatgaaggagctggcagcagtcatgtcagaccctgacctggaaactgagactatgtgcctccatgat gatgagtcatgtaggtatgaagggcaagtggctgtttaccaggatgtatatgcagttgatggaccaacaagtctctatcaccaagccaata agggagttagagtggcctactggataggctttgacaccaccccttttatgtttaagaacttggctggagcatatccatcatactctaccaa ctgggcagatgaaacagtgttaacagctagaaacataggcctatgcagctctgatgttatggagaggtcaagaagagggatgtccattctt agaaagaagtatttgaaaccatccaacaatgttctattctctgttggctcaaccatctaccatgagaagagggacttactgaggagctggc acctgccatctgtatttcacttaagaggcaagcaaaattacacatgtaggtgtgagactatagttagttgcgacgggtacgtcgttaaaag aatagctatcagtccaggcctgtatgggaagccttcaggctatgctgctacaatgcaccgcgagggattcttgtgctgcaaagtgacagac acattgaatggggagagggtctcttttcccgtgtgcacatatgtgccagctacattgtgtgaccaaatgactggcatactggcaacagatg tcagtgcggacgacgcgcaaaaactgctggttgggctcaaccagcgtatagtcgtcaacggtcgcacccagagaaacaccaataccatgaa aaattaccttttgccagtagtggcccaggcatttgctaggtgggcaaaggaatataaggaagatcaagaagatgaaaggccactaggacta agagatagacagttagtcatggggtgttgttgggcttttagaaggcacaagataacatctatttataagaggccagatacccaaaccatca tcaaagtgaactcagatttccactcatttgtgctgcccaggataggcagtaacacattggagattgggctgagaacaagaatcaggaaaat gttagaggagcacaaggagccatcacctctcattacagcagaggatgtacaagaagctaagtgtgcagcagatgagagaaaggaggtgaga gaagcagaggagttgagggcagctctaccacctttggcagctgatgttgaggagcccactctggaagcagatgtggacttgatgttacaag aggctggggcaggctcagtggagacacctagaggcttgataaaggttaccagctatgatggagaggacaagattggctcttatgctgtgct ttctccacaggctgtactcaagagtgaaaaattatcttgcatccaccctctggctgaacaagtcatagtgataacacactctggcagaaaa gggagatatgcagtggaaccataccatggtaaagtagtggtgccagagggacatgcaataccagtccaggactttcaagctctgagtgaaa gtgccaccattgtgtacaatgaaagagagtttgtaaacaggtacctgcaccatattgccacacatggaggagcactgaacactgatgaaga atattacaaaactgtcaagccctcagagcatgatggagaatacctgtatgacattgacaggaaacagtgtgtcaagaaagaactagtcact gggctagggctcacaggagagctggtggatcctcccttccatgaatttgcctatgagagtctgagaacaagaccagcagctccttaccaag taccaaccataggggtgtatggagtgccaggatcaggcaagtctggcatcattaaatcagcagtcaccaaaaaagatctagtggtgtcagc caagaaagaaaactgtgcagaaattataagggatgtcaagaaaatgaaagggctggatgtcaatgccagaactgtggactcagtgctcttg aatggatgcaaacacccagtagagaccctgtatattgatgaagcttttgcttgtcatgcaggtactctcagagcactcatagccattataa gacctaaaaaggcagtgctctgtggggatcccaaacagtgtggtttttttaacatgatgtgcctgaaagtgcattttaaccatgagatttg cacacaagtcttccacaaaagcatctctaggagatgcactaaatctgtgacttcagtggtctcaaccttgttttatgacaaaaaaatgaga acaacaaatccaaaagagactaagattgtgattgacactacaggcagtaccaaacctaagcaggatgatctcattctcacttgtttcagag ggtgggtgaagcagttgcaaatagattacaaaggcaatgaaataatgacagcagctgcctctcaagggctgaccagaaaaggtgtgtatgc agttaggtacaaggtgaatgaaaatcctctgtatgcacccacctcagaacatgtgaatgtcctactgaccaggacagaggacaggattgtg tggaaaacactagcaggagacccatggataaaaacactgactgccaagtaccctgggaatttcactgccacaatagaggagtggcaagcag agcatgatgccatcatgaggcacatcttggagagaccagaccctacagatgtcttccagaataaggcaaatgtgtgttgggccaaggcttt agtgccagtgctgaagacagctggcatagacatgaccactgaacaatggaacactgtggattattttgaaacagacaaagctcactcagca gagatagtattgaaccaactatgtgtgaggttctttggactggatctggactcaggtctattttctgcacccactgttccattatccatta ggaataatcactgggataactccccatcacctaacatgtatgggctgaataaagaagtggtcagacagctctctaggaggtacccacaact gcctagggcagttgccactggaagagtctatgacatgaacactggtacactgaggaattatgatccaaggataaacctagtacctgtaaac agaagactgcctcatgctttagtcctccaccataatgaacacccacagagtgacttttcttcatttgtcagcaaattgaagggcagaactg tcctggtggtgggggaaaagttgtcagtcccaggcaaaatggttgactggttgtcagacaggcctgaggctaccttcagagctaggctgga tttaggcatcccaggtgatgtgcccaaatatgacataatatttgttaatgtgaggaccccatataaataccatcactatcagcagtgtgaa gaccatgccattaagcttagcatgttgaccaagaaagcttgtctgcatctgaatccaggaggaacctgtgtcagcataggttatggttatg ctgacagggcctcagaaagcatcattggtgctatagcaaggctgttcaagttttccagggtatgcaaaccaaaatcctcacttgaagagac agaagttctgtttgtattcattgggtatgataggaaggccagaacacacaatccttacaagctttcatcaaccttgaccaacatttataca ggttccagactccatgaagcaggatgtgcaccctcatatcatgtggtgagaggggatattgccacagccacagaaggagtgattataaatg ctgctaacagcaaaggacaacctggaggaggggtgtgtggagcactgtataagaaattcccagaaagctttgatttacagcccattgaagt aggaaaagcaagactggtcaaaggtgcagctaaacatatcattcatgcagtaggaccaaacttcaacaaagtttcagaggttgaaggtgac aaacagttggcagaggcttatgagtccattgctaagattgtcaatgataacaattacaagtcagtagcaattccactgttgtccacaggca tcttttcagggaacaaagatagactaacccaatcattgaaccatttgctgacagctttagacaccactgatgcagatgtagccatatactg cagggacaagaaatgggaaatgactctcaaggaagcagtggctaggagagaagcagtggaggagatatgcatatcagatgactcttcagtg acagaacctgatgcagagctggtgagggtgcatccaaagagttctttggctggaaggaagggctacagcacatcagatggcaaaactttct catatttggaagggaccaagtttcaccaggcagccaaggatatagcagaaattaatgccatgtggccagttgcaacagaggccaatgagca ggtatgcatgtatatcctgggagaaagcatgagcagtattaggtcaaaatgcccagtggaagagtcagaagcctcctcaccacctagcaca ctgccttgcttgtgcatccatgccatgactccagaaagagtacagaggctaaaagcctcaagaccagaacaaattactgtgtgctcatcct ttccattgccaaagtatagaatcactggtgtgcagaagatccaatgctcccagcctatattgttctcaccaaaagtgcctgcatatattca tccaaggaagtatctggtggaaacaccaccagtagatgagactccagagccatcagcagagaaccaatccacagaggggacacctgaacaa ccaccacttataacagaggatgagaccaggactagaacacctgagccaatcatcattgaagaggaagaagaggatagcataagtttgctgt cagatggcccaacccaccaggtgctgcaagtggaggcagacattcatgggccaccctctgtatctagctcatcctggtccattcctcatgc atcagactttgatgtggacagtttatccatacttgacaccctggagggagcttcagtgacctcaggggcaacatcagcagagactaactct tactttgcaaagagtatggagtttctggcaagaccagtgcctgcacctagaacagtattcaggaaccctccacatccagctccaaggacaa gaacaccatcacttgcacccagcagggcctgctcaagaaccagcctagtttccaccccaccaggagtgaatagggtgatcactagagagga gctggaggcacttaccccatcaaggactcctagcaggtcagtctcaagaaccagcctggtctccaacccaccaggagtaaatagggtgatt acaagagaggagtttgaggcatttgtagcacaacaacaatgacggtttgatgcgggtgcatacatcttttcctccgacaccggtcaagggc atttacaacaaaaatcagtaaggcaaacggtgctatccgaagtggtgttggagaggaccgaattggagatttcgtatgccccgcgcctcga ccaagaaaaagaagaattactacgcaagaaattacagttaaatcccacacctgctaacagaagcagataccagtccaggaaggtggagaac atgaaagccataacagctagacgtattctgcaaggcctagggcattatttgaaggcagaaggaaaagtggagtgctaccgaaccctgcatc ctgttcctttgtattcatctagtgtgaacagagccttttcaagccccaaggtggcagtggaagcctgtaatgccatgttgaaagagaactt tccaactgtggcttcttactgtattattccagagtatgatgcctatttggacatggttgatggagcttcatgctgcttagacactgccagt ttttgccctgcaaagctgaggagctttccaaagaaacactcctatttggaacccacaataagatcagcagtgccttcagcaatccagaaca
[0414]
[0415] [SEQ ID No: 88]
[0416] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 88, or a variant or fragment thereof.
[0417] In another embodiment, the codon optimised CpG-R VEEV saRNA sequence is represented herein as SEQ ID No: 89, below. The codon optimised CpG-Low, UpA-Low
[0418] VEEV saRNA sequence comprises 27 CpGs (O / E: 0.059) and 127 UpAs (O / E: 0.25).
[0419]
[0420] [SEQ ID No: 89]
[0421] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 89, or a variant or fragment thereof.
[0422] In an embodiment,, the CpG-R VEEV DNA template sequence is encoded by tine DNA nucleic acid sequence of SEQ ID No: 90, below. The codon optimised CpG-Low, TpA-
[0423] Low VEEV saRNA sequence comprises 27 CpGs (O / E: 0.059) and 127 UpAs (O / E:
[0424] 0.25).
[0425] [SEQ ID No: 90]
[0426] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 90, or a variant or fragment thereof.
[0427] In a further embodiment, the codon optimised CpG-F saRNA sequence is represented herein as SEQ ID No: 91, below. The codon optimised CpG-Low, UpA-Low VEEV saRNA sequence comprises 21 CpGs (O / E: 0.046) and 127 UpAs (O / E: 0.25).
[0428]
[0429] [SEQ ID No: 91]
[0430] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 91, or a variant or fragment thereof.
[0431] In an embodiment, the CpG-F VEEV DNA template sequence is encoded by the DNA nucleic acid sequence of SEQ ID No: 92, below. The codon optimised CpG-Low, UpA-
[0432] Low VEEV DNA template sequence comprises 21 CpGs (O / E: 0.046) and 127 TpAs
[0433] (O / E: 0.25).
[0434]
[0435] [SEQ ID No: 92]
[0436] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 92, or a variant or fragment thereof. In a further embodiment, the CpG depleted fLuc mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail, is represented herein as SEQ ID
[0437] No: 93, below.
[0438] [SEQ ID No: 93]
[0439] Accordingly, the CpG depleted fLuc mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail may comprise an RNA sequence substantially as set out in SEQ ID NO: 93, or a variant or fragment thereof.
[0440] In another embodiment, the CpG depleted fLuc DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail is encoded by the DNA nucleic acid sequence of SEQ ID No: 94, below.
[0441] [SEQ ID No: 94] Accordingly, the CpG depleted fLuc DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 94, or a variant or fragment thereof.
[0442] In one embodiment, the CpG depleted murine EPO mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail is represented herein as SEQ ID No: 95, below.
[0443] [SEQ ID No: 95]
[0444] Accordingly, the CpG depleted murine EPO mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail may comprise an RNA sequence substantially as set out in SEQ ID NO: 95, or a variant or fragment thereof.
[0445] In one embodiment, the CpG depleted murine EPO DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail is represented herein as SEQ ID No: 96, below.
[0446] [SEQ ID No: 96]
[0447] Accordingly, the CpG depleted murine EPO DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 96, or a variant or fragment thereof. In one embodiment, the UpA reduced murine EPO mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail is represented herein as SEQ ID No: 97, below.
[0448] [SEQ ID No: 97]
[0449] Accordingly, the UpA reduced murine EPO mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail may comprise an RNA sequence substantially as set out in SEQ ID NO: 97, or a variant or fragment thereof.
[0450] In one embodiment, the TpA murine EPO reduced DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail is represented herein as SEQ ID No: 98, below.
[0451] [SEQ ID No: 98]
[0452] Accordingly, the TpA murine EPO reduced DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 98, or a variant or fragment thereof.
[0453] In one embodiment, the GpG depleted and UpA reduced murine EPO mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail is represented herein as SEQ ID No: 99, below.
[0454]
[0455] [SEQ ID No: 99]
[0456] Accordingly, the GpG depleted and UpA reduced murine EPO mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail may comprise an RNA sequence substantially as set out in SEQ ID NO: 99, or a variant or fragment thereof.
[0457] In one embodiment, the GpG depleted and TpA reduced murine EPO DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail is represented herein as SEQ ID No: 100, below.
[0458] [SEQ ID No: 100]
[0459] Accordingly, the GpG depleted and TpA reduced murine EPO DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ
[0460] ID NO: 100, or a variant or fragment thereof.
[0461] In one embodiment, the RNA sequence for CpG depleted pig erythropoietin is represented herein as SEQ ID No: 101, below.
[0462] [SEQ ID No: 101] Accordingly, the CpG depleted pig erythropoietin may comprise an RNA sequence substantially as set out in SEQ ID NO: 101, or a variant or fragment thereof.
[0463] In one embodiment, the DNA sequence for CpG depleted pig erythropoietin is represented herein as SEQ ID No: 102, below.
[0464] [SEQ ID No: 102]
[0465] Accordingly, the CpG depleted pig erythropoietin may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 102, or a variant or fragment thereof.
[0466] In some embodiments, conserved structural regions of SFV may be further modified to remove additional CpG di-nucleotides; these include the following sequences.
[0467] In one embodiment, the CpG-optimized SFV 5 UTR VI saRNA sequence, for which part of SEQ ID No: 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 103, below.
[0468] [SEQ ID No: 103]
[0469] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 103, or a variant or fragment thereof.
[0470] In one embodiment, the CpG-optimized SFV 5 UTR VI DNA sequence, for which part of SEQ ID No: 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 104, below.
[0471] [SEQ ID No: 104]
[0472] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 104, or a variant or fragment thereof.
[0473] In one embodiment, the CpG-optimized SFV 5 UTR V2 saRNA sequence, for which part of SEQ ID No: 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 105, below.
[0474] [SEQ ID No: 105]
[0475] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 105, or a variant or fragment thereof.
[0476] In one embodiment, the CpG-optimized SFV 5 UTR V2 DNA sequence, for which part of SEQ ID No: 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 106, below.
[0477] [SEQ ID No: 106]
[0478] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 106, or a variant or fragment thereof.
[0479] In one embodiment, the CpG-optimized SFV 5 UTR V3 saRNA sequence, for which part of SEQ ID No: 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 107, below. [SEQ ID No: 107]
[0480] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 107, or a variant or fragment thereof.
[0481] In one embodiment, the CpG-optimized SFV 5 UTR V3 DNA sequence, for which part of SEQ ID No: 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 108, below.
[0482] [SEQ ID No: 108]
[0483] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 108, or a variant or fragment thereof.
[0484] In one embodiment, the CpG-optimized SFV 5 UTR V4 saRNA sequence, for which part of SEQ ID No: 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 109, below.
[0485] [SEQ ID No: 109]
[0486] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 109, or a variant or fragment thereof.
[0487] In one embodiment, the CpG-optimized SFV 5 UTR V4 DNA sequence, for which part of SEQ ID No: 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 110, below.
[0488] [SEQ ID No: 110] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 110, or a variant or fragment thereof.
[0489] In one embodiment, the CpG-optimized SFV 3 UTR VI saRNA sequence, for which part of SEQ ID No: 61 encompassing 3'UTR (last 261 nucleotides) was further CpG- reduced, is represented herein as SEQ ID No: 111, below.
[0490] [SEQ ID No: 111]
[0491] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 111, or a variant or fragment thereof.
[0492] In one embodiment, the CpG-optimized SFV 3 UTR VI DNA sequence, for which part of SEQ ID No: 62 encompassing 3'UTR (last 261 nucleotides) was further CpG- reduced, is represented herein as SEQ ID No: 112, below.
[0493] [SEQ ID No: 112]
[0494] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 112, or a variant or fragment thereof.
[0495] In one embodiment, the CpG-optimized SFV 3 UTR V2 saRNA sequence, for which part of SEQ ID No: 61 encompassing 3'UTR (last 261 nucleotides) was further CpG- reduced, is represented herein as SEQ ID No: 113, below.
[0496] [SEQ ID No: 113]
[0497] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 113, or a variant or fragment thereof. In one embodiment, the CpG-optimized SFV 3 UTR V2 DNA sequence, for which part of SEQ ID No: 62 encompassing 3'UTR (last 261 nucleotides) was further CpG- reduced, is represented herein as SEQ ID No: 114, below.
[0498] [SEQ ID No: 114]
[0499] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 114, or a variant or fragment thereof.
[0500] In one embodiment, the CpG-optimized SFV SG saRNA sequence, for which part of SEQ ID No: 61 encompassing the subgenomic promoter (nucleotides 7378-7422) was further CpG-reduced, is represented herein as SEQ ID No: 115, below.
[0501] [SEQ ID No: 115]
[0502] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 115, or a variant or fragment thereof.
[0503] In one embodiment, the CpG-optimized SFV SG DNA sequence, for which part of SEQ ID No: 62 encompassing the subgenomic promoter (nucleotides 7378-7422) was further CpG-reduced, is represented herein as SEQ ID No: 116, below.
[0504] [SEQ ID No: 116]
[0505] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 116, or a variant or fragment thereof.
[0506] In one embodiment, the CpG-optimized SFV AU saRNA sequence, for which part of SEQ ID No: 61 encompassing 3'UTR (last 261 nucleotides) was replaced with the sequence below, is represented herein as SEQ ID No: 117, below.
[0507] [SEQ ID No: 117]
[0508] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 117, or a variant or fragment thereof.
[0509] In one embodiment, the CpG-optimized SFV AU DNA sequence, for which part of SEQ
[0510] ID No: 62 encompassing 3'UTR (last 261 nucleotides) was replaced with the sequence below, is represented herein as SEQ ID No: 118, below.
[0511] [SEQ ID No: 118]
[0512] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 118, or a variant or fragment thereof.
[0513] In one embodiment, YYLUC; CpG optimized to contain no CpGs, modified firefly luciferase fused to mGreenLantern fluorescent protein, RNA sequence is represented herein as SEQ ID No: 119, below.
[0514] [SEQ ID No: 119]
[0515] Accordingly, YYLUC, CpG optimized to contain no CpGs, modified firefly luciferase fused to mGreenLantern fluorescent protein may comprise an RNA sequence substantially as set out in SEQ ID No: 119, or a variant or fragment thereof. In one embodiment, YYLUC; CpG optimized to contain no CpGs, modified firefly luciferase fused to mGreenLantern fluorescent protein, DNA sequence is represented herein as SEQ ID No: 120, below.
[0516] [SEQ ID No: 120]
[0517] Accordingly, YYLUC; CpG optimized to contain no CpGs, modified firefly luciferase fused to mGreenLantern fluorescent protein may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 120, or a variant or fragment thereof.
[0518] In one embodiment, the CpG-optimized SFV 5 UTR Vl-2 saRNA sequence, for which part of SEQ ID No: 61 encompassing 5'UTR and CSE was further CpG-reduced
[0519] (nucleotides 1-308), is represented herein as SEQ ID No: 121, below.
[0520] [SEQ ID No: 121]
[0521] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 121, or a variant or fragment thereof.
[0522] In one embodiment, the CpG-optimized SFV 5 UTR Vl-2 DNA sequence, for which part of SEQ ID No: 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides
[0523] 1-308), is represented herein as SEQ ID No: 122, below.
[0524] [SEQ ID No: 122]
[0525] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 122, or a variant or fragment thereof.
[0526] In one embodiment, the CpG-optimized SFV 5 UTR V2-2 saRNA sequence, for which part of SEQ ID No: 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 123, below.
[0527] [SEQ ID No: 123]
[0528] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 123, or a variant or fragment thereof.
[0529] In one embodiment, the CpG-optimized SFV 5 UTR V2-2 DNA sequence, for which part of SEQ ID No: 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 124, below.
[0530] [SEQ ID No: 124]
[0531] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 124, or a variant or fragment thereof.
[0532] In one embodiment, the CpG-optimized SFV 5 UTR V3-2 saRNA sequence, for which part of SEQ ID No: 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 125, below. [SEQ ID No: 125]
[0533] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 125, or a variant or fragment thereof.
[0534] In one embodiment, the CpG-optimized SFV 5 UTR V3-2 DNA sequence, for which part of SEQ ID No: 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 126, below.
[0535] [SEQ ID No: 126]
[0536] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 126, or a variant or fragment thereof.
[0537] In one embodiment, the CpG-optimized SFV 5 UTR V4-2 saRNA sequence, for which part of SEQ ID No: 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 127, below.
[0538] [SEQ ID No: 127]
[0539] Accordingly, the saRNA molecule may comprise an RNA sequence substantially as set out in SEQ ID NO: 127, or a variant or fragment thereof.
[0540] In one embodiment, the CpG-optimized SFV 5 UTR V4-2 DNA sequence, for which part of SEQ ID No: 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308), is represented herein as SEQ ID No: 128, below.
[0541] [SEQ ID No: 128] Accordingly, the saRNA molecule may comprise an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 128, or a variant or fragment thereof.
[0542] In some embodiments, therefore, the VEEV saRNA molecule comprises an RNA sequence substantially as set out in SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 27, 29, 31, 33, 35, 37, 39, 51, 53, 55, 57, 67, 69, 71, 73, 87, 89, and 91 or a variant or fragment thereof.
[0543] In further embodiments, the VEEV saRNA molecule comprises an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 4, 8, 10, 12, 16, 20, 22, 24, 28, 30, 32, 34, 36, 38, 40, 52, 54, 56, 58, 68, 70, 72, 74, 88, 90 and 92 or a variant or fragment thereof.
[0544] In some embodiments, therefore, the SFV saRNA molecule comprises an RNA sequence substantially as set out in SEQ ID NO: 61, 63, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, and 127 or a variant or fragment thereof.
[0545] In further embodiments, the SFV saRNA molecule comprises an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 62, 64, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128 or a variant or fragment thereof.
[0546] The inventors believe that GpG reduction or depletion in the saRNA molecule reduces innate activation and binding of RNA binding proteins that trigger or enhance RNA degradation. These degradative pathways can be amplified by a type I interferon response. Accordingly, CpG depletion reduces RNA recognition and subsequent degradation by cytoplasmic proteins and, furthermore, the benefit of CpG reduction will be more profound in the setting of a type I interferon response. Here, the inventors have mimicked the highly supressed CpG dinucleotide content of human interferon-stimulated genes (ISGs), which enable ISGs to evade self-targeting mechanisms during an interferon response. The highly CpG depleted saRNA constructs share the unique sequence properties of ISG transcripts, allowing them to occupy a less targeted sequence space. This is particularly important given saRNA itself is a potent trigger in type I interferons. As herein described, the inventors have exceeded the highly suppressed CpG dinucleotide content of human interferon-stimulated genes (ISGs) and achieved by extreme reductions in CpG frequency that matches or is lower than many type I interferon mRNA, that have the most suppressed CpG frequencies of all human transcripts (figure 15). This enables saRNA, line interferon transcripts, to evade self-targeting mechanisms during an interferon response. The highly CpG depleted saRNA constructs with O / Es of < 1.5 exceed the mean depletion of ISG transcripts, improving saRNA performance, while O / Es of <0.06 share the unique sequence properties of interferon transcripts, allowing them to occupy a less targeted sequence space. This may be particularly advantageous to offset their known potential to trigger potent interferon responses. As a result, these constructs exhibit enhanced expression and increased resistance to interferon-mediated repression in transduced cells, avoiding non-self RNA recognition. The overall result of this is that the transgene encoded by the saRNA molecule is expressed and translated to greater levels when compared to expression / translation levels when the saRNA molecule does not have a CpG-reduced or CpG-depleted RNA sequence compared to an unmodified, wild-type RNA sequence, and even more so in the context of an innate immune response.
[0547] Therefore, in a second aspect of the invention, there is provided use of the saRNA molecule according to the first aspect, for:
[0548] (i) reducing the activation of innate sensing, reducing RNA recognition, reducing binding by RNA binding proteins, reducing interferon generation and / or reducing degradation of the saRNA molecule; and / or
[0549] (ii) enhancing the expression and / or translation of a transgene harboured on the saRNA molecule.
[0550] The inventors have appreciated that CpG frequency is especially low in interferon response genes that need to be expressed in the context of interferon signalling. Furthermore, saRNA triggers a type I interferon pathway in many cells, and this is exemplified in the mouse study (Figure 2) where pre-treating the mice with poly I:C which is a known trigger of interferons has a far bigger impact on the suppression of WT saRNA than GpG low saRNA.
[0551] Thus, in some embodiments, the expression and / or translation of a transgene harboured on the saRNA molecule is enhanced in the context of an innate response.
[0552] In a third aspect, there is provided a method for enhancing the expression and / or translation of a transgene harboured on the saRNA molecule according to the first aspect, the method comprising delivering the saRNA molecule into a cell, and allowing it to carry out saRNA-mediated gene expression of the transgene. In a fourth aspect of the invention, there is provided a nucleic acid sequence encoding the saRNA molecule of the first aspect.
[0553] The nucleic acid sequence may be a DNA sequence, for example any of those which are described herein.
[0554] In a fifth aspect, there is provided an expression cassette comprising a nucleic acid sequence according to the second aspect.
[0555] The nucleic acid sequences of the invention may be harboured in a recombinant vector, for example a recombinant vector for delivery into a host cell of interest to enable production of the saRNA molecule.
[0556] Accordingly, in a sixth aspect, there is provided a recombinant vector comprising the expression cassette according to the fifth aspect.
[0557] In one embodiment, the vector may comprise a DNA sequence which encodes or comprises an saRNA molecule.
[0558] The saRNA constructs of the invention may be made using a DNA plasmid, as a template. RNA copies may then be made by in vitro transcription using a polymerase, such as T7 polymerase, and the T7 promoter may be upstream of the saRNA. Hence, the saRNA constructs of the invention may be made using the DNA plasmid having a nucleic acid sequence substantially as set out above, comprising or consisting of SEQ ID Nos: 40, 52, 54, 56, 62, 64, 68, 70, 72 or 74 and a GDI, such as SEQ ID No: 42, 46, 48, or 50, or a variant or fragment thereof, as the template. Of course, it will be appreciated that other RNA polymerases could be used instead of T7 polymerase, for example the SP6 or the T3 polymerase, in which case the saRNA construct may comprise the SP6 or T3 promoter instead.
[0559] The vector of the sixth aspect encoding the saRNA molecule of the first aspect may for example be a plasmid, cosmid or phage and / or be a viral vector. Such recombinant vectors are highly useful in the delivery systems of the invention for transforming cells with the nucleotide sequences. The nucleotide sequences may preferably be a DNA sequence, and it is this DNA sequence which encodes the RNA sequence forming the saRNA molecule of the first aspect. Recombinant vectors encoding the saRNA molecule of the first aspect may also include other functional elements. For example, they may further comprise a variety of other functional elements including a suitable promoter for initiating transgene expression upon introduction of the vector in a host cell. For instance, the vector is preferably capable of autonomously replicating in the nucleus of the host cell, such as a bacterial cell. In this case, elements which induce or regulate DNA replication may be required in the recombinant vector. Alternatively, the recombinant vector may be designed such that it integrates into the genome of a host cell. In this case, DNA sequences which favour targeted integration (e.g. by homologous recombination) are envisaged. Suitable promoters may include the SV40 promoter, CMV, EFla, PGK, viral long terminal repeats, as well as inducible promoters, such as the Tetracycline inducible system, as examples. The cassette or vector may also comprise a terminator, such as the Beta globin, SV40 polyadenylation sequences or synthetic polyadenylation sequences. The recombinant vector may also comprise a promoter or regulator or enhancer to control expression of the nucleic acid as required.
[0560] The vector encoding the saRNA molecule may also comprise DNA coding for a gene that may be used as a selectable marker in the cloning process, i.e. to enable selection of cells that have been transfected or transformed, and to enable the selection of cells harbouring vectors incorporating heterologous DNA. For example, ampicillin, neomycin, puromycin or chloramphenicol resistance is envisaged. Alternatively, the selectable marker gene may be in a different vector to be used simultaneously with the vector containing the transgene(s). The cassette or vector may also comprise DNA involved with regulating expression of the nucleotide sequence, or for targeting the expressed polypeptide to a certain part of the host cell.
[0561] Purified vector may be inserted directly into a host cell by suitable means, e.g. direct endocytotic uptake. The vector may be introduced directly into a host cell (e.g. a eukaryotic or prokaryotic cell) by transfection, infection, electroporation, microinjection, cell fusion, protoplast fusion or ballistic bombardment. Alternatively, vectors of the invention may be introduced directly into a host cell using a particle gun.
[0562] The nucleic acid molecule may (but not necessarily) be one, which becomes incorporated in the DNA of the host cell. Undifferentiated cells may be stably transformed leading to the production of genetically modified daughter cells (in which case regulation of expression in the subject may be required e.g. with specific transcription factors or gene activators). Alternatively, the delivery system may be designed to favour unstable or transient transformation of differentiated cells. When this is the case, regulation of expression may be less important because expression of the DNA molecule will stop when the transformed cells die or stop expressing the protein.
[0563] Alternatively, the delivery system may provide the nucleic acid molecule to the host cell without it being incorporated in a vector. For instance, the nucleic acid molecule may be incorporated within a liposome or virus particle. Alternatively, a "naked" nucleic acid molecule may be inserted into a host cell by a suitable means e.g. direct endocytotic uptake.
[0564] In a seventh aspect, there is provided a pharmaceutical composition comprising the saRNA molecule of the first aspect, the nucleic acid sequence of the fourth aspect, the expression cassette of the fifth aspect, or the vector of the sixth aspect, and a pharmaceutically acceptable vehicle.
[0565] In an eighth aspect, there is provided a process for making the pharmaceutical composition according to the seventh aspect, the method comprising contacting the saRNA molecule of the first aspect, the nucleic acid sequence of the fourth aspect, the expression cassette of the fifth aspect or the vector of the sixth aspect, with a pharmaceutically acceptable vehicle.
[0566] In a ninth aspect, there is provided a method of preparing the saRNA molecule of the first aspect, the method comprising: a) I) introducing, into a host cell, the vector of the sixth aspect; and ii) culturing the host cell under conditions to result in the production of the RNA construct of the first aspect; or b) transcribing the RNA construct from the vector according to the sixth aspect.
[0567] The host cell of step a) may be a eukaryotic or prokaryotic host cell. Typically, the host cell is a eukaryotic host cell. Typically, the host cell is a mammalian host cell such as Human embryonic kidney 293 cells or Chinese hamster ovary (CHO) cells. Step (b) may be performed in vitro or in vivo, preferably in vitro, i.e. in vitro transcription (IVT). Suitable methods of in vitro transcription are well known in the art and would be known to those skilled in the art. For example, as described in Molecular Cloning, A Laboratory Manual, 2nd edition. (1989) editor C Nolan, Cold Spring Harbor Laboratory Press.
[0568] The saRNA replicon of the first aspect is particularly suitable for therapy. While the inventors envisaged that the RNA construct of the first aspect would be generated by in vitro transcription for in vivo use in therapy, those experienced in the art will recognise that the saRNA molecule can be generated in vivo in a subject for therapy, by in vivo delivery of the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, or the vector according to the sixth aspect to a subject.
[0569] Hence, according to a tenth aspect, there is provided a saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect, for use as a medicament or in therapy.
[0570] In an eleventh aspect of the invention, there is provided a saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect, for use in the prevention, amelioration or treatment of a protozoan, fungal, bacterial or viral infection.
[0571] The protozoan, fungal, bacterial or viral infection may be an infection of a protozoa, fungus, bacterium or virus as defined in the first aspect.
[0572] In a twelfth aspect of the invention, there is provided an saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect, for use in the prevention, amelioration or treatment of cancer.
[0573] The cancer may be as defined in the first aspect.
[0574] In an thirteenth aspect of the invention, there is provided a method for treating a protozoan, fungal, bacterial or viral infection, the method comprising administering, to a subject in need thereof, a therapeutically effective amount of the saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect. The protozoan, fungal, bacterial or viral infection to be treated may be an infection of a protozoa, fungus, bacterium or virus as defined in the first aspect.
[0575] In a fourteenth aspect of the invention, there is provided a method for treating cancer, the method comprising administering, to a subject in need thereof, a therapeutically effective amount of the saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect.
[0576] The cancer to be treated may be as defined in the first aspect.
[0577] The saRNA molecule described herein provides an effective means of vaccinating a subject (e.g. against a viral, bacterial or fungal infection) and cancer. Thus, the saRNA molecule can be used as an infectious disease vaccine or a cancer vaccine.
[0578] Accordingly, in a fifteenth aspect of the invention, there is provided a vaccine comprising the saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect, and optionally an adjuvant
[0579] The adjuvant incorporated into a delivery formulation may be selected form the group consisting of a bacterial lipopeptide, lipoprotein and lipoteichoic acid; mycobacterial lipoglycan; yeast zymosan, porin, Lipopolysaccharide, Lipid A, monophosphoryl lipid A (MPL), Flagellin, CpG DNA, hemozoin, Tomatine, ISCOM, ISCOMATRIXTM, squalene based emulsions, polymers, such as PEI, Carbopol, lipid nanoparticles (LNPs) and bacterial toxins (CT, LT). Other examples of adjuvants incorporated into the delivery formulation may include an aluminium salt, a synthetic form of DNA, a carbohydrate, a tablet binder, an ion exchange resin, preservative, a polymer, an emulsion and / or a lipid. Examples of adjuvants may include monosodium glutamate, sucrose, dextrose, aluminum bovine, human serum albumin, cytosine phosphoguanine, potassium phosphate, plasdone C, anhydrous lactose, cellulose, polacrilin potassium, glycerine, asparagine, citric acid, potassium phosphate magnesium sulfate, iron ammonium citrate, 2-phenoxyethanol, aluminium, beta-propiolactone, bovine extract, DOPC, EDTA, formaldehyde, thimerosal, phenol, potassium aluminum sulfate, potassium glutamate, sodium borate, sodium metabisulphite, urea, PLGA, PVA, PLA, PVP, cyclodextrin-based stabilisers, oil in water emulsion adjuvants and / or lipid-based adjuvants.
[0580] In an embodiment, the CpG-modified saRNA molecule is formulated with a suitable carrier (e.g. LNP, polyplex etc).
[0581] In a sixteenth aspect of the invention, there is provided an saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect, for use in stimulating an immune response in a subject.
[0582] The immune response may be stimulated against a protozoa, bacterium, virus, fungus or cancer as per the antigens defined in the first aspect.
[0583] In a seventeenth aspect, there is provided a method of vaccinating a subject, the method comprising administering, or having administered, to a subject in need thereof, a therapeutically effective amount of the saRNA molecule of the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect.
[0584] According to an eighteenth aspect, there is provided an saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect, for use in stem cell therapy.
[0585] Stem cell therapy may relate to the reprogramming somatic cells to cells having stem cell characteristics.
[0586] Somatic cells may be reprogrammed by delivering one or more proteins that are capable of enhancing reprogramming of somatic cells to cells having stem cell characteristics as defined in the first aspect.
[0587] According to a nineteenth aspect, there is provided a method of modifying a cell ex vivo or in vitro, comprising delivering, to the cell, the saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect.
[0588] Ideally, the method is performed ex vivo.
[0589] The cell may be a eukaryotic or prokaryotic cell. Typically, the cell is a eukaryotic cell.
[0590] Typically, the cell is a mammalian host cell. In embodiments, the cell is a human cell.
[0591] Ideally, the modified cell is suitable for cell-therapy indications.
[0592] In a twentieth aspect, there is provided a modified cell obtained from, or obtainable by, the method of the sixteenth aspect.
[0593] In a twenty first aspect, there is provided the modified cell of the seventeenth aspect, for use in therapy, optionally cell therapy.
[0594] The CpG-depleted saRNA molecules and vectors of the invention may be prepared into a pharmaceutical composition, typically in the form of a suspension with a pharmaceutically acceptable carrier. The CpG-depleted saRNA molecule may be delivered to host cells according to published methods. The saRNA molecule may be administered to a human or non-human mammalian patient. Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the transfer virus is directed.
[0595] It will be appreciated that the saRNA molecule according to the first aspect, the nucleic acid according to the fourth aspect, the expression cassette according to the fifth aspect, the vector according to the sixth aspect or the pharmaceutical composition according to the seventh aspect (herein known as the active agents) may be used in a medicament, which may be used as a monotherapy (i.e. use of the active agent), for treating, ameliorating, or preventing disease or in vaccination.
[0596] Alternatively, the active agents according to the invention may be used as an adjunct to, or in combination with, known therapies for treating, ameliorating, or preventing disease or in vaccination.
[0597] The saRNA molecule may be administered in sufficient amounts to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to a desired organ (e.g., the lung, liver, skeletal muscle, eye, heart), oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.
[0598] The saRNA molecule, nucleic acid sequence, expression cassette, vector or pharmaceutical composition of the invention may be combined in compositions having a number of different forms depending, in particular, on the manner in which the composition is to be used. Thus, for example, the composition may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micellar solution, transdermal patch, liposome suspension, polyplex, emulsion, liposome, lipid nanoparticles (with RNA on the surface or encapsulated), functionalised liposomes or lipid nanoparticles (e.g. with peptide, antibody, antibody fragment, glycan, glyco-conjugate, DNA or RNA on the surface or encapsulated), solid lipid nanoparticles, or any other suitable form that may be administered to a person or animal in need of treatment or vaccination. The lipid nanoparticle may comprise one or more components selected from a group consisting of: a cationic lipid (which is preferably ionisable); phosphatidylcholine; cholesterol; and polyethylene glycol (PEG)- lipid. The saRNA molecule may be administered as just naked RNA, or on solid inorganic nanoparticles, gold nanoparticles, silica particles, PLGA particles, solid lipid particles, carnauba wax particles, micro-alum, protein nanoparticles, polymer nanoparticles, polymer-lipid nanoparticles, exosomes, microbubbies, virus like particles - or any nano particulate able to complex saRNA and deliver the saRNA into cells. It will be appreciated that the vehicle of medicaments according to the invention should be one which is well-tolerated by the subject to whom it is given.
[0599] The saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition of the invention may also be incorporated within a slow- er delayed-release device. Such devices may, for example, be inserted on or under the skin, and the medicament may be released over weeks or even months. The device may be located at least adjacent to the treatment site. Such devices may be particularly advantageous when long-term treatment with the saRNA construct or the recombinant vector is required and which would normally require frequent administration (e.g. at least daily injection).
[0600] In a preferred embodiment, however, medicaments according to the invention may be administered to a subject by injection into the blood stream, muscle, skin, tumour, brain, CNS, or directly into a site requiring treatment. In a further embodiment, medicaments according to the invention may be administered to the subject when applied mucosally via oral, respiratory, ocular, genital or rectal surfaces, or topically / transcutaneously to the skin. Typically, the medicaments, including the saRNA molecule, construct, are injected into muscle. Injections may be intravenous (bolus or infusion) or subcutaneous (bolus or infusion), or intradermal (bolus or infusion), or intramuscular (bolus or infusion).
[0601] It will be appreciated that the amount of saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition that is required is determined by its biological activity and bioavailability, which in turn depends on the mode of administration, the physiochemical properties of the saRNA construct, nucleic acid sequence, expression cassette, vector, or pharmaceutical composition and whether it is being used as a monotherapy or in a combined therapy. The frequency of administration will also be influenced by the half-life of the active agent within the subject being treated. Optimal dosages to be administered may be determined by those skilled in the art, and will vary with the particular the saRNA construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition in use, the strength of the pharmaceutical composition, the mode of administration, and the type and advancement of the viral infection. Additional factors depending on the particular subject being treated will result in a need to adjust dosages, including subject age, weight, gender, diet, and time of administration.
[0602] Generally, a daily dose of between O.OOlpg / kg of body weight and lOmg / kg of body weight, or between O.Olptg / kg of body weight and Img / kg of body weight, of the saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition of the invention may be used for treating, ameliorating, or preventing a disease, depending upon the active agent used.
[0603] Daily doses may be given as a single administration (e.g. a single daily injection or inhalation of a nasal spray). Alternatively, the saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition may require administration twice or more times during a day. As an example, the RNA construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition may be administered as two (or more depending upon the severity of the disease being treated) daily doses of between 0.07 pig and 700 mg (i.e. assuming a body weight of 70 kg). A patient receiving treatment may take a first dose upon waking and then a second dose in the evening (if on a two dose regime) or at 3- or 4-hourly intervals thereafter. Alternatively, a slow release device may be used to provide optimal doses of the saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition according to the invention to a patient without the need to administer repeated doses.
[0604] Hence, doses can be given once or repeatedly, such as daily, every other day, weekly, biweekly, or monthly, or until adequate transgene expression is detected in the patient. In an embodiment, saRNA-containing compositions are given once weekly - every 2 weeks, every 3 weeks, every 4 weeks, every 6 weeks, every 8, every 9 weeks, or every 12 weeks etc. In one embodiment, however, the saRNA molecule, nucleic acid sequence, expression cassette, vector or pharmaceutical composition according to the invention may be given as a weekly dose, and in some embodiments, a fortnightly dose.
[0605] Known procedures, such as those conventionally employed by the pharmaceutical industry (e.g. in vivo experimentation, clinical trials, etc.), may be used to form specific formulations of the RNA construct, nucleic acid sequence, expression cassette or vector according to the invention and precise therapeutic regimes (such as daily doses of the agents and the frequency of administration).
[0606] A "subject" may be a vertebrate, mammal, or domestic animal. Hence, compositions and medicaments according to the invention may be used to treat any mammal, for example livestock (e.g. a horse), pets, or may be used in other veterinary applications. Most preferably, however, the subject is a human being.
[0607] A "therapeutically effective amount" of the saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition is any amount which, when administered to a subject, is the amount of the aforementioned that is needed to ameliorate, prevent or treat any given disease.
[0608] For example, the saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition of the invention may be used from about 0.0001 mg to about 800 mg, and preferably from about 0.001 mg to about 500 mg. It is preferred that the amount of the replicon, nucleic acid sequence, expression cassette, vector or pharmaceutical composition is an amount from about 0.01 mg to about 250 mg, and most preferably from about 0.01 mg to about 1 mg. Preferably, the saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition according to the invention is administered at a dose of 1- 200 pg. A "pharmaceutically acceptable vehicle" as referred to herein, is any known compound or combination of known compounds that are known to those skilled in the art to be useful in formulating pharmaceutical compositions.
[0609] In one embodiment, the pharmaceutically acceptable vehicle may be a solid, and the composition may be in the form of a powder or tablet. A solid pharmaceutically acceptable vehicle may include one or more substances which may also act as flavouring agents, lubricants, solubilisers, suspending agents, dyes, fillers, glidants, compression aids, inert binders, sweeteners, preservatives, dyes, coatings, or tablet- disintegrating agents. The vehicle may also be an encapsulating material. In powders, the vehicle is a finely divided solid that is in admixture with the finely divided active agents according to the invention. In tablets, the active agent (e.g. saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition according to the invention) may be mixed with a vehicle having the necessary compression properties in suitable proportions and compacted in the shape and size desired. The powders and tablets preferably contain up to 99% of the active agents. Suitable solid vehicles include, for example calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidine, low melting waxes and ion exchange resins. In another embodiment, the pharmaceutical vehicle may be a gel and the composition may be in the form of a cream or the like.
[0610] However, the pharmaceutical vehicle may be a liquid, and the pharmaceutical composition is in the form of a solution. Liquid vehicles are used in preparing solutions, suspensions, emulsions, syrups, elixirs and pressurized compositions. The saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition according to the invention may be dissolved or suspended in a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats. The liquid vehicle can contain other suitable pharmaceutical additives such as solubilisers, emulsifiers, buffers, preservatives, sweeteners, flavouring agents, suspending agents, thickening agents, colours, viscosity regulators, stabilizers or osmo-regulators. Suitable examples of liquid vehicles for oral and parenteral administration include water (partially containing additives as above, e.g. cellulose derivatives, preferably sodium carboxymethyl cellulose solution), alcohols (including monohydric alcohols and polyhydric alcohols, e.g. glycols) and their derivatives, and oils (e.g. fractionated coconut oil and arachis oil). For parenteral administration, the vehicle can also be an oily ester such as ethyl oleate and isopropyl myristate. Sterile liquid vehicles are useful in sterile liquid form compositions for parenteral administration. The liquid vehicle for pressurized compositions can be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.
[0611] Liquid pharmaceutical compositions, which are sterile solutions or suspensions, can be utilized by, for example, subcutaneous, intradermal, intrathecal, epidural, intraperitoneal, intravenous and particularly intramuscular injection. The nucleic acid sequence, or expression cassette of the invention may be prepared as a sterile solid composition that may be dissolved or suspended at the time of administration using sterile water, saline, or other appropriate sterile injectable medium.
[0612] The saRNA molecule, construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition of the invention may be administered orally in the form of a sterile solution or suspension containing other solutes or suspending agents (for example, enough saline or glucose to make the solution isotonic), bile salts, acacia, gelatin, sorbitan monoleate, polysorbate 80 (oleate esters of sorbitol and its anhydrides copolymerized with ethylene oxide) and the like. The saRNA construct, nucleic acid sequence, expression cassette, vector or pharmaceutical composition according to the invention can also be administered orally either in liquid or solid composition form. Compositions suitable for oral administration include solid forms, such as pills, capsules, granules, tablets, and powders, and liquid forms, such as solutions, syrups, elixirs, and suspensions. Forms useful for parenteral administration include sterile solutions, emulsions, and suspensions.
[0613] It will be appreciated that the invention extends to any nucleic acid or peptide or variant, derivative or analogue thereof, which comprises substantially the amino acid or nucleic acid sequences of any of the sequences referred to herein, including variants or fragments thereof. The terms "substantially the amino acid / nucleotide / peptide sequence", "variant" and "fragment", can be a sequence that has at least 40% sequence identity with the amino acid / nucleotide / peptide sequences of any one of the sequences referred to herein, for example 40% identity with any of the sequences identified herein.
[0614] Amino acid / polynucleotide / polypeptide sequences with a sequence identity which is greater than 65%, more preferably greater than 70%, even more preferably greater than 75%, and still more preferably greater than 80% sequence identity to any of the sequences referred to are also envisaged. Preferably, the amino acid / polynucleotide / polypeptide sequence has at least 85% identity with any of the sequences referred to, more preferably at least 90% identity, even more preferably at least 92% identity, even more preferably at least 95% identity, even more preferably at least 97% identity, even more preferably at least 98% identity and, most preferably at least 99% identity with any of the sequences referred to herein.
[0615] The skilled technician will appreciate how to calculate the percentage identity between two amino acid / polynucleotide / polypeptide sequences. In order to calculate the percentage identity between two amino acid / polynucleotide / polypeptide sequences, an alignment of the two sequences must first be prepared, followed by calculation of the sequence identity value. The percentage identity for two sequences may take different values depending on :- (i) the method used to align the sequences, for example, ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, for example, local vs global alignment, the pair-score matrix used (e.g. BLOSUM62, PAM250, Gonnet etc.), and gap-penalty, e.g. functional form and constants.
[0616] Having made the alignment, there are many different ways of calculating percentage identity between the two sequences. For example, one may divide the number of identities by: (i) the length of shortest sequence; (ii) the length of alignment; (iii) the mean length of sequence; (iv) the number of non-gap positions; or (v) the number of equivalenced positions excluding overhangs. Furthermore, it will be appreciated that percentage identity is also strongly length dependent. Therefore, the shorter a pair of sequences is, the higher the sequence identity one may expect to occur by chance.
[0617] Hence, it will be appreciated that the accurate alignment of protein, DNA or RNA sequences is a complex process. The popular multiple alignment program ClustalW (Thompson et al., 1994, Nucleic Acids Research, 22, 4673-4680; Thompson et al., 1997, Nucleic Acids Research, 24, 4876-4882) is a preferred way for generating multiple alignments of proteins or DNA in accordance with the invention. Suitable parameters for ClustalW may be as follows: For DNA alignments: Gap Open Penalty - 15.0, Gap Extension Penalty - 6.66, and Matrix - Identity. For protein alignments: Gap Open Penalty - 10.0, Gap Extension Penalty - 0.2, and Matrix - Gonnet. For DNA and Protein alignments: ENDGAP - -1, and GAPDIST - 4. Those skilled in the art will be aware that it may be necessary to vary these and other parameters for optimal sequence alignment. Preferably, calculation of percentage identities between two amino acid / polynucleotide / polypeptide sequences may then be calculated from such an alignment as (N / T)*100, where N is the number of positions at which the sequences share an identical residue, and T is the total number of positions compared including gaps and either including or excluding overhangs. Preferably, overhangs are included in the calculation. Hence, a most preferred method for calculating percentage identity between two sequences comprises (i) preparing a sequence alignment using the ClustalW program using a suitable set of parameters, for example, as set out above; and (II) inserting the values of N and T into the following formula :- Sequence Identity = (N / T)*100.
[0618] Alternative methods for identifying similar sequences will be known to those skilled in the art. For example, a substantially similar nucleotide sequence will be encoded by a sequence which hybridizes to DNA sequences or their complements under stringent conditions. By stringent conditions, the inventors mean the nucleotide hybridises to filter-bound DNA or RNA in 3x sodium chloride / sodium citrate (SSC) at approximately 45°C followed by at least one wash in 0.2x SSC / 0.1% SDS at approximately 20-65°C. Alternatively, a substantially similar polypeptide may differ by at least 1, but less than 5, 10, 20, 50 or 100 amino acids from any of the sequences described herein.
[0619] Due to the degeneracy of the genetic code, it is clear that any nucleic acid sequence described herein could be varied or changed without substantially affecting the sequence of the protein encoded thereby, to provide a functional variant thereof. Suitable nucleotide variants are those having a sequence altered by the substitution of different codons that encode the same amino acid within the sequence, thus producing a silent (synonymous) change. Other suitable variants are those having homologous nucleotide sequences but comprising all, or portions of, sequence, which are altered by the substitution of different codons that encode an amino acid with a side chain of similar biophysical properties to the amino acid it substitutes, to produce a conservative change. For example, small non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large non-polar, hydrophobic amino acids include phenylalanine, tryptophan and tyrosine. The polar neutral amino acids include serine, threonine, cysteine, asparagine and glutamine. The positively charged (basic) amino acids include lysine, arginine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It will therefore be appreciated which amino acids may be replaced with an amino acid having similar biophysical properties, and the skilled technician will know the nucleotide sequences encoding these amino acids. When alignments are referenced, or when the CpG-modified sequences are compared to the sequences from the parental sequence prior to modification, conventional alignment techniques may be utilized. There are a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. These can be aligned as DNA (template for in vitro transcription to generate RNA) or RNA sequence. Generally, these programs are used at default settings, although one skilled in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program that provides at least the level of identity or alignment as that provided by the referenced algorithms and programs.
[0620] Typically, when an alignment is prepared based upon a nucleic acid sequence (e.g., a saRNA vector sequence), the alignment may contain insertions and deletions which are so identified with respect to a reference saRNA sequence, and the numbering of the nucleic acid residues is based upon a reference scale provided for the alignment. However, any given saRNA sequence may have fewer nucleic acid residues than the reference scale. In the present invention, when discussing the parental sequence, the term "the same position" or the "corresponding position" refers to the nucleic acid located at the same residue number in each of the sequences, with respect to the reference scale for the aligned sequences. However, when taken out of the alignment, each of the sequences may have these nucleic acid nucleotides located at different residue numbers. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Sequence alignment programs are available for nucleic acid sequences, e.g., FASTA and BLAST programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs
[0035] ,
[0621] All features described herein (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined with any of the above aspects in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which :-
[0622] Figure 1 shows firefly luciferase (fLuc), as gene of interest, expression, in human skin explants, of wild type (WT) Venezuelan equine encephalitis (VEEV) saRNA construct or CpG reduced / depleted VEEV saRNA construct vs PBS or untreated controls. Direct visualisation was carried out with an AMI imager from Spectral Instruments Imaging (Figure 1A) Human skin explants were injected intradermally with either WT VEEV (Column 1, SEQ ID No: 1), CpG-Low VEEV (Column 2, SEQ ID No: 87) or PBS control (Column 3) encoding firefly luciferase (SEQ ID No: 43). At 24 hours the explants were incubated with luciferin substrate and the luminescent emission imaged. Direct visualisation was also quantified as relative light units (Figure IB) Graph of the total emission (photons / sec) from the triplicate skin samples for each construct. Figure 1C shows the fLuc emission (fold-change) from the skin explants when normalised to the emission from the PBS control. Robust expression was observed for the CpG-low saRNA construct (SEQ ID No: 75) relative to the PBS control (15-fold increase over background), while the WT construct (SEQ ID NO: 1) was only just detectable (4-fold background signal). Figure ID shows the fLuc emission (fold-change) from the CpG- Low VEEV skin explants when normalised to the emission from the WT VEEV construct backbone. Direct comparison of the two constructs indicated up to a five-fold improvement for the CpG-Low construct relative to the original wild-type (WT) sequence.
[0623] Figure 2 shows the impact of CpG reduction on saRNA firefly luciferase (fLuc) expression in vivo in murine quadricep muscles after injection with WT VEEV or CpG- Low backbone saRNAs. Capped saRNA encoding firefly luciferase was generated by IVT, using WT (SEQ NO ID 1) and CpG-Low (SEQ ID NO: 87) DNA templates. saRNA was formulated in a lipid nanoparticle composed of C12-200 ionizable lipid with DSPC, cholesterol and DMPE-PEG200. Groups of five female balb / c mice (n-5 per group) were pre-treated with 50 pg of Pol-IC complexed with in vivo-jetPEI®, administered by peritoneal injection 24 hours prior to being dosed with saRNA. Mice were then given an I.M. administration of 1 pg LNP formulated WT or CpG-low VEEV-fLuc saRNA in each hind leg. A) At 24 and 48 hr post injection luciferin substrate was administered intraperitoneally and 10 min later the luminescence emission from the mice were imaged and quantified using an AMI imager from Spectral Instruments. B) Graph of summary data gained from quantification of each luminescent region of interest demonstrating higher emission at both 24 hr and 48 hr of the fLuc gene expressed in the CpG-Low compared to the WT VEEV backbone. The luciferase expression was quantified as photons per second using an Aura Imaging Software. Points in graphs represent total emission from each mouse. Mean values and standard error of mean (SEM) were calculated and are shown for each group in graphs.
[0624] Figure 3 shows the elevated immunogenicity of the CpG-low saRNA construct (SEQ ID NO 87) over the wild-type (WT) parenteral (CpG-high) (SEQ ID NO 1) VEEV saRNA construct in non-human primates (NHPs). Animals received two injections of LNP- formulated vaccine at weeks 0, and 7, and serum samples were collected at 2 weeks post first immunization and 2 and 6 weeks post second immunization (see Figure 3). After the prime, low binding antibody responses (< 103AU / mL) could be measured by week 2 in 3 / 4 animals vaccinated with the CpG-low saRNA and 2 / 4 animals vaccinated with the WT saRNA (see Figure 3a). By week 9, two weeks after the boost, all animals showed high anti-spike IgG titres (>105AU / ml) that were significantly higher than those induced by WT saRNA, these differences were still apparent at week 17, 6 weeks after the boost. Statistical analysis was performed by unpaired t-test. * p <0.05).
[0625] Figure 4 shows the expression of Firefly luciferase (fLuc) gene of interest from VEEV WT (SEQ ID NO: 1), CpG-Low (SEQ NO ID 87) and various modified VEEV saRNA backbones in HEK293T17 cells. A number of sequence modifications to investigate the effect of various removals of CpG motifs while maintaining the RNA secondary structure. Each VEEV section was analysed and various CpG regions were altered when compared to the CpG-Low backbone, with the aim of further reducing the CpG motifs while increasing the expression of the gene of interest. HEK293T17 cells were transfected with 100 ng / well of the different saRNA constructs containing the fLuc gene of interest in quadruplicate in a 96 well plate. The total luminescence was measured using the BrightGlo luminescence assay. The specific effect of these alterations on the expression level of fLuc are compared to the level of expression from the wild-type VEEV backbone. These data suggested limited additional gains could be provided by reduction CpG content in these regions, therefore inventor looked to determine whether the level of depletion in the CpG-low sequence (O / E 0.133) was optimal, already being lower than the frequency in most human mRNA sequences (O / E 0.45).
[0626] Figure 5 shows the expression of Firefly luciferase (fLuc) gene of interest from VEEV WT, CpG-Low and CpG-R saRNA backbones in HeLa cells. Here Hela cells were transfected with 100 ng / well saRNA containing the fLuc gene of interest in quadruplicate in a 96 well plate. The total luminescence was measured using the BrightGlo luminescence assay, showing that CpG-low expressed fLuc at slightly higher levels than the wild-type VEEV but that fLuc expression from CpG-R was considerably higher. These data demonstrate the surprising observation that depleting CpG levels to an O / E of 0.059, lower than any known human virus sequence and a level only seen on 0.25% of human mRNA sequences further improved expression relative to WT saRNA and even that of the CpG-low construct.
[0627] Figures 6 8i 7 show that minimising CpG content provides additional benefit. While the VEEV CpG-R saRNA construct demonstrated enhanced activity over WT and CpG- low sequences, a few additional CpG dinucleotides were present within the NSP sequence. The inventors then derived a construct "CpG-F" (SEQ ID NO: 91) that removed these final 6 CpG dinucleotides form the NSP sequence (excluding the 51 CSE sequence and SG region of NSP1 and NSP4 respectively) resulting in an O / E ratio of 0.046. This construct was then evaluated for expression in HEK293T (Figure 6) and HeLa cells (Figure 7). Both GpG-R and CpG-R Full (CpG-F) demonstrated improved expression in both HEK293T cells and HeLa cells over WT (O / E 0.76) and more importantly GpG-low (O / E 0.133) constructs. However, the difference was minimal or not apparent between GpG-R and CpG-F constructs suggesting that optimal performance of saRNA can be achieved with O / E values of >0.133.
[0628] Figure 8 shows expression of Firefly luciferase (fLuc) gene of interest from VEEV WT, CpG-Low, CpG-Min, CpG-R and CpG-F saRNA backbones in A549 cells. A549 cells were transfected with 100 ng / well saRNA containing the fLuc gene of interest in quadruplicate in a 96 well plate. The total luminescence was measured using the BrightGlo luminescence assay, showing that CpG-low (sequence No 87) expressed fLuc at similar levels to the wild-type VEEV but that fLuc expression from CpG-R (sequence No 89) and CpG-F (sequence No 91) backbones was considerably higher. The data show that minimising CpG content also improves response in Human A549 cells known to produce strong interferon beta responses. Here the inventors determined the relative expression of these constructs in A549 human epithelial cells widely used to assess antiviral responses to RNA viruses. Studies using these cells that have strong antiviral responses clear demonstrate the novel finding that minimising the GpG content in the saRNA backbone maximises expression with the higher activity shown by CpG-F (O / E 0.046), followed by GpG-R (O / E 0.059) while expression of CpG-low (O / E 0.133) and WT VEEV (O / E 0.79) saRNA were comparatively low.
[0629] Figure 9 shows CpG-Low and CpG-R VEEV saRNA facilitates higher expression of a gene of interest in pigs. Weaned Large White x Duroc Cross Pigs (age 6 weeks) (n-5) were intramuscularly injected with a 100 ug / 0.5 mL dose of LNP formulated saRNA, where the VEEV backbone was either WT (SEQ ID No: 1), CpG-Low (SEQ ID No: 87) or CpG-R (sequence No 91) and encoded GpG depleted sequence for Pig erythropoietin (EPO) blood factor (SEQ ID No: 101). Peripheral blood was assessed for EPO expression using an EPO specific ELISA and graphed as fold expression, normalised to the VEEV WT backbone. Here WT, GpG-low (SEQ ID No: 87) and CpG-R (SEQ ID No: 89) VEEV constructs were enveloped where erythropoietin (EPO) was expressed downstream of the subgenomic promotor. Here EPO was used as an expression marker that could be detected by ELISA in the blood stream of animals following intramuscular administration of 100 pg of LNP formulated saRNA. Data from this experiment demonstrated 7- and 10-fold increase in expression of EPO relative to the WT construct and 12 hours post IM injection, and increased levels of expression for CpG-R (7-fold) were still evident at 24 hours post injection. These data confirm that the gains in expression seen with the extreme reduction of CpG frequency provided by the CpG-R construct observed in human cells vitro were also representative of responses in a relevant large animal model.
[0630] Figure 10 shows that maximising GpG reduction also improves the kinetics of saRNA based on the backbone of Semliki Forest virus. The inventors sort to determine whether high levels of CpG reduction might favour replication of saRNA constructs based on the backbone of Semliki Forest virus (SFV). (A) HEK293T, HeLa and THP-1 cells were transfected in 96-well culture plates with 100 ng of SFV saRNA complexed with Lipofectamine MessengerMAX (Invitrogen). Expression of a modified firefly luciferase (SEQ ID No: 119) was determined with a luciferase assay (Promega Bright- Glo) at the indicated time points to assess the effects of CpG optimization of SFV saRNA (SEQ ID No: 61), relative to the non-optimized SFV saRNA. Each point represents the mean ± SD (n-3). (B) The 6 h time point was plotted on a separate bar graph. Statistical analysis was performed by unpaired t-test. * p <0.05; ** p <0.01; **** p <0.0001. Here, CpG content was minimised in the sequences encoding the NSPs of SFV (CpG optimised / low SFV, SEQ ID No: 61)), while retaining CpGs required to maintain secondary structure required for replication (ie within the UTRs, Subgenomic promotor and conserved sequence elements - see SEQ ID No: 61). Transfection experiments demonstrated that CpG depletion across the NSPs generating a construct with an O / E value of 0.04, led to much more rapid expression of SFV saRNA than WT SFV saRNA. Here, enhanced levels of expression relative the WT sequence were determined by 6 h post-transfection in HEK293T, HeLa and THP-1 cells (Figure 10 A & B), however expression of WT SFV reached similar plateaux levels of expression by 24 h. Figure 11 shows that modification of CpG content in 5' and 3' UTRs of SFV saRNA have variable effects on expression. (A) HEK293T, HeLa and THP-1 cells were transfected, as in Figure 9, with SFV saRNAs of different optimizations based on SEQ ID No: 61 to assess their fitness in gene of interest expression during the time course indicated. Expression of a modified firefly luciferase (SEQ ID No: 119) was determined with a luciferase assay (Promega Bright-Glo) at the indicated time points to assess the effects of CpG optimization of SFV saRNA (SEQ ID No: 61), relative to the non- optimized SFV saRNA. Each point represents the mean ± SD (n-3). (B) The 6 h time point was plotted on a separate bar graph. Statistical analysis was performed by one- way ANOVA adjusted for multiple comparisons. * p <0.05; ** p <0.01; **** p <0.0001. As for VEEV based saRNA, the inventors explored whether deletion of CpG sequences within the 5' and 3' UTRs of SFV saRNA provided any benefit over the CpG optimised SFV construct (SEQ ID No: 61). All the variants tried either had no or negative impacts on expression relative to the CpG optimised saRNA construct (Figure lla&b). These data demonstrate that a generalised approach to CpG depletion cannot be applied to saRNA and that such critical CpG motifs within RNA structural regions essential for saRNA replication need to be preserved.
[0631] Figure 12 shows that all viral CpG ratios and most human mRNA sequences are higher than those represented by CpG-low, CpG-R and CpG-F saRNA sequences. It shows that CpG-R and CpG-F saRNA represent extremely low O / E values relative to human viruses and the vast majority of huma mRNA sequences. Having observed that maximal improvements in saRNA expression were gained by GpG-R and CpG-F variants of saRNA the inventors assessed how representative these were with respect to O / E CpG frequency (Figure 12). With respect to other viruses infecting humans, wild-type VEEV has one of the highest O / E values (0.76). Unsurprisingly most human viruses have an O / E values similar to the mean O / E value for human mRNA (0.45) (figure I la), reflecting adaptation to the human host where such frequencies avoid self-targeting of host mRNA
[0031] , It would be expected that a reduction in the O / E values of VEEV to match that of the majority of human mRNA would provide an advantage in terms of replication. However, surprisingly optimal replication of VEEV was achieved by extreme reductions in CpG frequency, where GpG-R (SEQ ID No: 87) and CpG-F (SEQ ID No: 91) had O / E values of 0.059 and 0.046, and these were seen to perform significantly better than CpG-Low with an O / E of 0.133. This is highly unexpected as these frequencies are lower than the observed in all human viruses, and far lower than those thought to engage antiviral proteins
[0046] , Such low levels of CpG O / E values are only observed in <0.5% of all human mRNA sequences highlighting the uniqueness of this approach.
[0632] Figure 13 shows that CpG reduction provides no advantage in the expression of mRNA sequences. Firefly luciferase expression of HEK, HeLa and THP1 cells transfected with wild type fLuc mRNA (WT) or CpG optimised fLuc mRNA (CpG Free, sequence No 93). Measurements taken at 6h, 24h and 48h post-transfection. Luminescent intensities are presented as mean relative light units (RLU) ± SEM. n-3. (ns - not significant. Two-way ANOVA). The inventors asked if the advantages of extreme CpG reduction provided to saRNA were applicable to RNA expression in general. To test this the inventors depleted CpG motifs from mRNA sequences encoding firefly luciferase (fLuc, SEQ ID No: 93) (Figure 13) and erythropoietin (EPO) (Figure 14). Comparison of the expression wildtype and CpG depleted sequences for both these mRNA constructs provided no apparent advantage. Indeed, for EPO mRNA expression of GpG-depleted (sequence No 95) or UpA reduced (SEQ ID No: 97) were worse that the wildtype sequence (figure 14d at 48h), while combined depletion of GpG and reduction of UpA (SEQ ID No: 99) was similar to WT sequence. This was unexpected given the surprising improvement that extreme CpG reduction provided alphavirus expression (as demonstrated for VEEV and SFV). These data highlight the uniqueness of the inventors' discovery that extreme CpG reduction is highly advantageous for saRNA expression.
[0633] Figure 14 shows CpG, UpA or CpG+UpA depletion provides no advantage for the expression of mRNA encoding Erythropoietin (EPO). Murine EPO expression in HEK (A&B) and HeLa (C8iD) cells transfected with wild type EPO mRNA (WT) or optimised EPO mRNA, CpG Free (sequence No 95), UpA Free (sequence No 97), or Both CpG and UpA free (sequence No 99). Measurements taken at 6h, 12h, 24h and 48h post- transfection. EPO expression is presented as mIU / ml ± SEM. n-3. (ns - not significant, *p > 0.05, ** p < 0.05. Two-way ANOVA).
[0634] Figure 15 shows CpG ratios for human interferon stimulated genes (ISG) and type I interferon mRNA sequences are higher than those represented by CpG-F saRNA sequences. CpG dinucleotide frequency (Observed / expected CpG ratio) across a) human mRNA and ISG mRNA in comparison to CpG-F saRNA (SEQ ID No: 91), b) human mRNA and type I interferon mRNA in comparison to CpG-F saRNA (sequence No 91). It illustrates that CpG-F saRNA exceeds the suppression of CpG frequency in interferon stimulated genes and matches and is often lower than that of type I interferon transcripts that have the most suppressed CpG frequencies of all human transcripts. It would be expected that a reduction in the O / E values of VEEV to match that of the majority of human mRNA would provide an advantage in terms of replication. However, surprisingly optimal replication of VEEV was achieved by extreme reductions in CpG frequency that matches or is lower than many type I interferon mRNA transcripts. The innovation to achieve CpG levels that are only seen in type 1 Interferon mRNA transcripts enables saRNA to avoid non-self recognition and interferon resistance highlighting the uniqueness of this approach.
[0635] Sequences
[0636] SEQ ID No 1 : Wild type (WT) VEEV RNA sequence (Parental strain);
[0637] SEQ ID No 2: Wild type (WT) VEEV DNA template sequence (Parental strain);
[0638] SEQ ID No 3: CpG-depleted VEEV RNA (excluding the 5'UTR, 51 CSE, subgenomic promotor, and 3'UTR);
[0639] SEQ ID No 4: CpG-depleted VEEV DNA template (excluding the 5'UTR, 51 CSE, subgenomic promotor, and 3'UTR);
[0640] SEQ ID No 5: WT VEEV 5'UTR and 51CSE RNA sequence;
[0641] SEQ ID No 6: WT VEEV 5'UTR and 51 CSE DNA template sequence;
[0642] SEQ ID No 7: CpG depleted VEEV 5'UTR and 51 CSE RNA sequence with A42V mutation to maintain secondary structure;
[0643] SEQ ID No 8: CpG depleted VEEV 5'UTR and 51 CSE DNA template sequence with A42V mutation to maintain secondary structure;
[0644] SEQ ID No 9: CpG reduced VEEV 5'UTR and 51 CSE RNA sequence retaining two CpG dinucleotides for structure;
[0645] SEQ ID No 10: CpG reduced VEEV 5'UTR and 51 CSE DNA template retaining two CpG dinucleotides for structure;
[0646] SEQ ID No 11 : CpG reduced VEEV 5'UTR and 51 CSE RNA sequence four retaining CpG dinucleotides for structure;
[0647] SEQ ID No 12: CpG reduced VEEV 5'UTR and 51 CSE RNA sequence four retaining CpG dinucleotides for structure;
[0648] SEQ ID No 13: WT VEEV NSP3 / 4 readthrough loop RNA sequence (nucleotides 5682- 5999);
[0649] SEQ ID No 14: WT VEEV NSP3 / 4 readthrough loop DNA template sequence (nucleotides 5682-5999);
[0650] SEQ ID No 15: CpG deleted VEEV NSP4 readthrough loop with mutated NSP3 opal stop codon (UGA to AGA (or AGG), ie arginine), RNA sequence (nucleotides 5682-5999); SEQ ID No 16: CpG deleted VEEV NSP4 readthrough loop with mutated NSP3 opal stop codon (UGA to AGA (or AGG), ie arginine), DNA template sequence (nucleotides 5682-5999);
[0651] SEQ ID No 17: WT VEEV subgenomic promotor and 5'UTR, RNA sequence (nucleotides 7500-7461);
[0652] SEQ ID No 18: WT VEEV subgenomic promotor and 5'UTR, DNA template sequence (nucleotides 7500-7461);
[0653] SEQ ID No 19: CpG reduced VEEV subgenomic promotor and 5'UTR, RNA sequence retaining a single CpG to maintain secondary structure (nucleotides 7500-7461);
[0654] SEQ ID No 20: CpG reduced VEEV subgenomic promotor and 5'UTR, DNA template sequence retaining a single CpG to maintain secondary structure (nucleotides 7500-7461);
[0655] SEQ ID No 21 : CpG depleted VEEV subgenomic promotor and 5'UTR, RNA sequence (nucleotides 7500-7461);
[0656] SEQ ID No 22: CpG depleted VEEV subgenomic promotor and 5'UTR, DNA template sequence (nucleotides 7500-7461);
[0657] SEQ ID No 23: CpG depleted VEEV subgenomic promotor and 5'UTR, RNA sequence removing u at position 7541 (nucleotides 7500-7460);
[0658] SEQ ID No 24: CpG depleted VEEV subgenomic promotor and 5'UTR, DNA template sequence removing t at position 7541 (nucleotides 7500-7460);
[0659] SEQ ID No 25: WT VEEV 3'UTR, RNA sequence;
[0660] SEQ ID No 26: WT VEEV 3'UTR, DNA template sequence;
[0661] SEQ ID No 27: CpG reduced VEEV 3'UTR, RNA sequence retaining 3 CpGs to maintain secondary structure;
[0662] SEQ ID No 28: CpG reduced VEEV 3'UTR, DNA template sequence retaining 3 CpGs to maintain secondary structure;
[0663] SEQ ID No 29: CpG reduced VEEV 3'UTR, RNA sequence retaining 3 CpGs to maintain secondary structure;
[0664] SEQ ID No 30: CpG reduced VEEV 3'UTR, DNA template sequence retaining 3 CpGs to maintain secondary structure;
[0665] SEQ ID No 31 : CpG depleted VEEV 3'UTR version 1, RNA sequence;
[0666] SEQ ID No 32: CpG depleted VEEV 3'UTR version 1, DNA template sequence ;
[0667] SEQ ID No 33: CpG depleted VEEV 3'UTR version 2, RNA sequence;
[0668] SEQ ID No 34: CpG depleted VEEV 3'UTR version 2, DNA template sequence;
[0669] SEQ ID No 35: CpG depleted VEEV 3'UTR version 3, RNA sequence;
[0670] SEQ ID No 36: CpG depleted VEEV 3'UTR version 3, DNA template sequence;
[0671] SEQ ID No 37: CpG depleted VEEV 3'UTR version 4, RNA sequence; SEQ ID No 38: CpG depleted VEEV 3'UTR version 4, DNA template sequence;
[0672] Note: RNA sequence SEQ ID No 3 can be combined with any 5'UTR and 51 CSE (sequences: 5, 7, 9 or 11), CpG deleted VEEV NSP4 readthrough loop (sequences 13 or 15), subgenomic promotor and 5'UTR (sequences: 17, 19, 21, or 23) and 3'UTR (SEQ ID oO: 25, 27, 29, 31, 33, 35, or 37).
[0673] To generate CpG-low saRNA molecules, these were used according to SEQ ID No 39. To generate CpG depleted saRNA molecules, these were used according to SEQ ID No: 51. However, other combinations may also be favourable.
[0674] SEQ ID No 39: CpG-Low VEEV saRNA sequence (comprising sequence SEQ ID NO 3, SEQ ID NO 5, SEQ ID NO 15, SEQ ID NO 17, & SEQ ID NO 25);
[0675] SEQ ID No 40: CpG-Low VEEV DNA template sequence (comprising sequence SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO 16, SEQ ID NO 18, & SEQ ID NO 26);
[0676] SEQ ID No 41 : RNA sequence for CpG depleted SARS-CoV-2 spike glycoprotein;
[0677] SEQ ID No 42: CpG depleted SARS-CoV-2 spike glycoprotein;
[0678] SEQ ID No 43: RNA sequence for CpG depleted firefly luciferase-mGreen lantern fusion protein;
[0679] SEQ ID No 44: DNA sequence for CpG depleted firefly luciferase-mGreen lantern fusion protein;
[0680] SEQ ID No 45: RNA sequence for CpG depleted Ebola virus spike glycoprotein;
[0681] SEQ ID No 46: DNA sequence for CpG depleted Ebola virus spike glycoprotein;
[0682] SEQ ID No 47: RNA sequence for CpG depleted Lassa virus spike glycoprotein;
[0683] SEQ ID No 48: DNA sequence for CpG depleted Lassa virus spike glycoprotein;
[0684] SEQ ID No 49: RNA sequence for CpG depleted human erythropoietin;
[0685] SEQ ID No 50: DNA sequence for CpG depleted human erythropoietin;
[0686] In a further iteration, SEQ ID No: 39 / 40 (CpG-Low) may be further modified to reduce UpA dinucleotide motifs and codon optimised as illustrated by SEQ ID No 49 / 50;
[0687] SEQ ID No 51 : Codon optimised CpG-Low, UpA-Low VEEV saRNA sequence;
[0688] SEQ ID No 52: Codon optimised CpG-Low, UpA-Low VEEV DNA template;
[0689] SEQ ID No 53: CpG-depleted VEEV saRNA sequence (comprising sequence SEQ ID No 3, SEQ ID No 7, SEQ ID No 15, SEQ ID No 21, & SEQ ID No 31);
[0690] SEQ ID No 54: CpG-depleted VEEV DNA template sequence (comprising sequence SEQ ID No 4, SEQ ID No 8, SEQ ID No 16, SEQ ID No 22, & SEQ ID No 32); In a further iteration, SEQ ID No 5 / 52 (CpG-depleted) may be further modified to reduce UpA dinucleotide motifs and codon optimised as illustrated by SEQ ID No 53 / 54;
[0691] SEQ ID No 55: Codon optimised CpG-depleted, UpA-Low VEEV saRNA sequence;
[0692] SEQ ID No 56: Codon optimised CpG-depleted, UpA-Low VEEV DNA template;
[0693] SEQ ID No 57: CpG-minimal reduction VEEV saRNA sequence;
[0694] SEQ ID No 58: CpG-minimal reduction VEEV DNA template sequence;
[0695] SEQ ID No 59: Wild type (WT) SFV RNA sequence (Parental strain);
[0696] SEQ ID No 60: Wild type (WT) SFV DNA template sequence (Parental strain);
[0697] SEQ ID No 61 : CpG-Low SFV saRNA sequence;
[0698] SEQ ID No 62: CpG-Low SFV DNA template sequence;
[0699] SEQ ID No 63: CpG-maximally reduced SFV saRNA sequence;
[0700] SEQ ID No 64: CpG- maximally reduced SFV DNA template sequence;
[0701] SEQ ID No 65: Wild type (WT) CHIKV RNA sequence (Parental strain);
[0702] SEQ ID No 66: Wild type (WT) CHIKV DNA template sequence (Parental strain);
[0703] SEQ ID No 67: CpG-Low CHIKV saRNA sequence;
[0704] SEQ ID No 68: CpG-Low CHIKV DNA template sequence;
[0705] SEQ ID No 69: CpG-maximally reduced CHIKV saRNA sequence;
[0706] SEQ ID No 70: CpG- maximally reduced CHIKV DNA template sequence;
[0707] SEQ ID No 71 : CpG-reduced Kinjun (Flavivirus) replicon saRNA sequence;
[0708] SEQ ID No 72: CpG-reduced Kinjun (Flavivirus) replicon DNA sequence;
[0709] SEQ ID No 73: CpG-reduced Nodamura (Nodavirus) saRNA sequence;
[0710] SEQ ID No 74: CpG-reduced Nodamura (Nodavirus) replicon DNA sequence; and
[0711] SEQ ID No: 75, 77, 79, 81, 83 and 85 and repeat sequences which are modified to corresponding sequences SEQ ID No: 76, 78, 80, 82, 84 and 86.
[0712] SEQ ID No 87: CpG-low reduction VEEV saRNA sequence;
[0713] SEQ ID No 88: CpG-low reduction VEEV DNA template sequence;
[0714] SEQ ID No 89: CpG-R reduction VEEV saRNA sequence;
[0715] SEQ ID No 90: CpG-R reduction VEEV DNA template sequence;
[0716] SEQ ID No 91 : CpG-F reduction VEEV saRNA sequence;
[0717] SEQ ID No 92: CpG-F reduction VEEV DNA template sequence;
[0718] SEQ ID No 93 CpG depleted fLuc mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail;
[0719] SEQ ID No 94: CpG fLuc depleted DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail;
[0720] SEQ ID No 95 CpG depleted murine EPO mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail; SEQ ID No 96: CpG depleted murine EPO DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail;
[0721] SEQ ID No 97 UpA reduced murine EPO mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail;
[0722] SEQ ID No 98: TpA murine EPO reduced DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail;
[0723] SEQ ID No 99 GpG depleted and UpA reduced murine EPO mRNA construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail;
[0724] SEQ ID No 100: GpG depleted and TpA reduced murine EPO DNA template construct containing a 5' alpha globin UTR, double 3' beta globin UTR and poly-A tail;
[0725] SEQ ID No 101 : RNA sequence for CpG depleted pig erythropoietin;
[0726] SEQ ID No 102: DNA sequence for CpG depleted pig erythropoietin;
[0727] SEQ ID No 103: CpG-optimized SFV 5 UTR VI saRNA sequence, for which part of SEQ ID No 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0728] SEQ ID No 104: CpG-optimized SFV 5 UTR VI DNA sequence, for which part of SEQ ID No 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0729] SEQ ID No 105: CpG-optimized SFV 5 UTR V2 saRNA sequence, for which part of SEQ ID No 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0730] SEQ ID No 106: CpG-optimized SFV 5 UTR V2 DNA sequence, for which part of SEQ ID No 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0731] SEQ ID No 107: CpG-optimized SFV 5 UTR V3 saRNA sequence, for which part of SEQ ID No 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0732] SEQ ID No 108: CpG-optimized SFV 5 UTR V3 DNA sequence, for which part of SEQ ID No 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0733] SEQ ID No 109: CpG-optimized SFV 5 UTR V4 saRNA sequence, for which part of SEQ ID No 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0734] SEQ ID No 110: CpG-optimized SFV 5 UTR V4 DNA sequence, for which part of SEQ ID No 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308); SEQ ID No 111 : CpG-optimized SFV 3 UTR VI saRNA sequence, for which part of SEQ ID No 61 encompassing 3'UTR (last 261 nucleotides) was further CpG-reduced;
[0735] SEQ ID No 112: CpG-optimized SFV 3 UTR VI DNA sequence, for which part of SEQ ID No 62 encompassing 3'UTR (last 261 nucleotides) was further CpG- reduced;
[0736] SEQ ID No 113: CpG-optimized SFV 3 UTR V2 saRNA sequence, for which part of SEQ ID No 61 encompassing 3'UTR (last 261 nucleotides) was further CpG-reduced;
[0737] SEQ ID No 114: CpG-optimized SFV 3 UTR V2 DNA sequence, for which part of SEQ ID No 62 encompassing 3'UTR (last 261 nucleotides) was further CpG- reduced;
[0738] SEQ ID No 115: CpG-optimized SFV SG saRNA sequence, for which part of SEQ ID No
[0739] 61 encompassing the subgenomic promoter (nucleotides 7378-7422) was further CpG-reduced;
[0740] SEQ ID No 116: CpG-optimized SFV SG DNA sequence, for which part of SEQ ID No
[0741] 62 encompassing the subgenomic promoter (nucleotides 7378-7422) was further CpG-reduced;
[0742] SEQ ID No 117: CpG-optimized SFV AU saRNA sequence, for which part of SEQ ID No:
[0743] 61 encompassing 3'UTR (last 261 nucleotides) was replaced;
[0744] SEQ ID No 118: CpG-optimized SFV AU DNA sequence, for which part of SEQ ID No:
[0745] 62 encompassing 3'UTR (last 261 nucleotides) was replaced;
[0746] SEQ ID No 119: YYLUC; CpG optimized to contain no CpGs, modified firefly luciferase fused to mGreenLantern fluorescent protein - RNA sequence;
[0747] SEQ ID No 120: YYLUC; CpG optimized to contain no CpGs, modified firefly luciferase fused to mGreenLantern fluorescent protein - DNA sequence;
[0748] SEQ ID No 121 : CpG-optimized SFV 5 UTR Vl-2 saRNA sequence, for which part of SEQ ID No 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0749] SEQ ID No 122: CpG-optimized SFV 5 UTR Vl-2 DNA sequence, for which part of SEQ ID No 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0750] SEQ ID No 123: CpG-optimized SFV 5 UTR V2-2 saRNA sequence, for which part of SEQ ID No 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0751] SEQ ID No 124: CpG-optimized SFV 5 UTR V2-2 DNA sequence, for which part of SEQ ID No 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308); SEQ ID No 125: CpG-optimized SFV 5 UTR V3-2 saRNA sequence, for which part of SEQ ID No 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0752] SEQ ID No 126: CpG-optimized SFV 5 UTR V3-2 DNA sequence, for which part of SEQ ID No 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0753] SEQ ID No 127: CpG-optimized SFV 5 UTR V4-2 saRNA sequence, for which part of SEQ ID No 61 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308);
[0754] SEQ ID No 128: CpG-optimized SFV 5 UTR V4-2 DNA sequence, for which part of SEQ ID No 62 encompassing 5'UTR and CSE was further CpG-reduced (nucleotides 1-308).
[0755] Examples
[0756] The inventors have generated and tested CpG-modified self-amplifying saRNA vectors, which have reduced or deleted concentrations of CpG compared to their corresponding wild type RNA sequence. The saRNA vectors carry a nucleic acid molecule comprising the sequence of an alphavirus self-amplifying RNA (saRNA) vector including: the 5'UTR; non-structural proteins (NSP 1-4); subgenomic promotor; 5' subgenomic UTR; 3' UTR; and an exogenous gene sequence under the control of the subgenomic promotor which controls expression of the gene product. The nucleic acid sequences of the vector and the exogenous gene of interest were modified to significantly reduce or eliminate CpG dinucleotides, such that the expression of the vector was enhanced compared to the unmodified saRNA vector. The inventors have also developed methods and regimens for delivering trans genes using these improved CpG-depleted saRNA vectors, in which the expression of the vector and / or transgene was significantly improved in human skin (Figure 1). Furthermore, the inventors have generated data using balb / c mice primed with the interferon inducer Poly-I:C, demonstrating the CpG-low saRNA constructs showed surprisingly improved expression compared to the corresponding wild-type parenteral saRNA with normal (i.e. elevated) CpG levels (Figure 2). In addition, the inventors have generated data using non-human primates (NHP) in which the CpG-low saRNA constructs showed surprisingly improved immunogenicity compared to the corresponding wild-type parenteral saRNA with normal (i.e. elevated) CpG levels (Figure 3).
[0757] The inventors have also reduced CpG content in 5' and 3' regions and sub genomic promoter regions of saRNA. In addition, they have produced novel constructs including CpG-R (SEQ ID No: 89), exhibiting depleted CpG levels to an O / E of 0.059, lower than any known human virus sequence and a level only seen on 0.25% of human mRNA sequences, and also CpG-F (SEQ ID No: 91) that removed the final 6 CpG dinucleotides from the NSP sequence (excluding the 51 CSE sequence and SG region of NSP1 and NSP4, respectively) resulting in an O / E ratio of 0.046. Performance between GpG-R and CpG-F constructs suggest that optimal performance of saRNA can be achieved with O / E values of >0.133. When taken together, the data demonstrate that a generalised approach to CpG depletion may not always be applied to saRNA and that some important CpG motifs within RNA structural regions essential for saRNA replication should be preserved. They also looked at the effects of reducing CpG in mRNA, and unexpectedly found that extreme CpG reduction is highly advantageous for saRNA expression, but not for mRNA.
[0758] The inventors have therefore developed an innovative approach to maximising the elimination of CpG in an saRNA context (as opposed to mRNA) to levels lower than human frequency, such that the saRNA behaves like type I interferon transcripts many of which also have minimal CpG content which allows them to operate in an interferon activated environment, and remain undetected by the innate immune system.
[0759] Materials & Methods
[0760] Cloning of saRNA and CpG variants
[0761] The self-amplifying RNA cassette (and CpG variants) comprising the 5'UTR, non- structural proteins 1-4, subgenomic promoter, subgenomic UTR and 3'UTR were derived from different alpha viruses (VEEV, SFV, CHIKV) and were cloned into a plasmid vector, as previously described (A. K. Blakney, P. F. McKay, R. J. Shattock, Structural Components for Amplification of Positive and Negative Strand VEEV Splitzicons. Frontiers in Molecular Biosciences 5, 71 (2018).). Encoded genes-of- interest, GDI, (e.g. firefly Luciferase, the spike protein of SARS-CoV-2, or the spike glycoprotein of Rabies virus) were cloned between the 5' subgenomic UTR and 3'UTR, essentially replacing the structural proteins of the alpha virus. The sequence of the gene of interest was identical in saRNAs with WT and CpG-low alpha virus sequences, so that only the CpG concentrations between the WT and CpG-low saRNA constructs differed.
[0762] In vitro transcription of saRNA
[0763] Self-amplifying RNA was produced using in vitro transcription (IVT). Plasmid DNA (pDNA) was transformed into Escherichia coli (E. coli) (NEB, Stable, C3040H) and cultured in 100 mL of Luria Broth (LB) with 100 pg / mL of carbenicillin or kanamycin (Sigma Aldrich, UK). The pDNA was subsequently isolated using a Plasmid Plus MaxiPrep kit (QIAGEN, UK, 12963) and the final concentration of pDNA was measured on a NanoDrop One (ThermoFisher, UK). pDNA was linearized using Mlul or Sapl for 2h at 37 °C followed by the addition of fresh enzyme and a second incubation for Ih at 37 °C. saRNA was generated by in vitro transcription (IVT) using HiScribe® T7 High Yield RNA Synthesis Kit (NEB, E2040S) according to the manufacturer's protocol with the addition of 0.8 pl of lOOmM CleanCap AU reagent (TriLink, N-7114) in a 20 pl reaction, pg of linearized pDNA was used per 20 pl IVT reaction. IVT reactions were incubated at 37°C for 2 hours. saRNA was purified with a Monarch RNA Cleanup Kit (NEB, T2050) and RNA size and integrity was confirmed by agarose gel electrophoresis. RNA was stored at -80 °C until further use.
[0764] Cell culture and in vitro transfection
[0765] HEK293T.17 (ATCC, UK), A549 (ATCC, UK) and HELA (ATCC) cells were cultured in complete Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, UK) containing 10% fetal bovine serum (FBS), 1% L-glutamine (L-glu) and 1% penicillin-streptomycin (Pen-strep) (Thermo Fisher Scientific, UK). THP1 cells (ATCC) were cultured in complete Roswell Park Memorial Institute (RPMI) 1640 medium with 10% FBS, 1% L- glu and 1% pen-strep. Cells were plated in a 96-well plate 24 h prior to transfection at a density of 7 x!04cells per well for HEK293T.17 and HeLa cells; and IxlO5cells per well THP-1 cells. Transfection of saRNA and mRNA encoding fLuc was performed using Lipofectamine MessengerMAX (Thermo Fisher, UK) according to the manufacturer's instructions.
[0766] In Vitro Firefly luciferase assay
[0767] At 24, 48 or 72 h post transfection, half of the cell supernatants were discarded from each well and an equal volume of the Bright-GloTM Luciferase (Promega, UK) added to each well then placed in the dark. Cells were incubated with the luciferase reagent for 5 min to ensure complete lysis of the cells. Cells were then pipetted up and down and transferred to a white 96-well Costar® plate (Thermo Fisher Scientific). The luminescence was then measured on the FLUOstar Omega microplate reader (BMG Labtech) using gain 2500, 3000, 3600 and 4095.
[0768] Lipid nanoparticle formulation saRNA was formulated in a lipid nanoparticle (LNP), utilizing C12-200 (Corden
[0769] Pharma, Switzerland) as the complexing ionizable lipid (N / P ratio of 8), 1,2-distearoyl- sn-glycero-3-phosphocholine (DSPC) (Avanti® Polar Lipids, US) as the helper lipid, cholesterol (plant-derived) (Avanti® Polar Lipids, US), and 1,2-dimyristoyl-sn-glycero- 3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt) (DMPE-PEG2000) (Avanti® Polar Lipids, US) as previously described (McKay et al., 2020). Z-average diameter and zeta potential were analyzed using a Zetasizer Nano ZS (Malvern Instruments, UK) and encapsulation using a Quant-iT RiboGreen assay (Thermo Fisher Scientific, UK). The Z-average diameter was 80-100 nm with a PDI of 0.2-0.3 and a Zeta potential of -4 to -6 mV. Encapsulation efficiency was >90%. The LNP-formulated saRNA vaccines were shipped on dry ice and stored at <-60°C before use.
[0770] Human Skin Explant Culture and Injection
[0771] For ex vivo studies, surgically resected specimens of human skin tissues were collected at Charing Cross Hospital, Imperial NHS Trust, London, UK. All tissues were collected after receiving signed informed consent from patients undergoing elective abdominoplasty or 10 mastectomy surgeries, under protocols approved by the Local Research Ethics Committee (MED_RS_ll_014) at Imperial College London. Skin tissue was refrigerated until use and was excised into 1 cm2section and cultured in 12-well plates with 1 mL of cDMEM at 37 °C with 5 % COZ. To analyse expression in the skin tissue, explants were transfected with 1 pg of fLuc-expressing saRNA, encapsulated within different LNP formulations. Micro-fine insulin needles (BD Biosciences, UK) containing 1 pg of saRNA-LNP in 50 pL were injected intradermally at a 15° angle in a controlled manner. On the day of imaging, media was replaced with 1 mL of DMEM and 100 pL of D-luciferin at 30 mg / mL (Perkin Elmer, UK) and explants were allowed to incubate for 10 minutes at 37 °C. Image acquisition was performed in an AMI imager from Spectral Instruments Imaging with 30 seconds exposure and pixel binning of 2 on the luminescence setting.
[0772] Murine studies
[0773] Female BALB / c mice (Charles River, UK) (n - 5 per group) were injected intraperitoneally with 50 pg of poly-IC (Sigma; P9582), complexed with in vivo- jetPEI® (Polyplus) according to manufacturer's instructions. 24 hours later mice were injected i.m. with 2x1 pg (1 pg per hind leg) of WT or CpG-Low LNP formulated fLuc saRNA and expression monitored at 24 and 48 hours post i.m injection with saRNA. For imaging, animals received a 100 pL I.P. dose of D-Luciferin at 30 mg / mL (Perkin Elmer, UK) and were imaged after 10 minutes. The acquisition was performed using the Ami-HT (Spectral Imaging Instruments, US) and image analysis was done with the Aura software version 4.0.8 (Spectral Imaging Instruments, US). Non-human-primate (NHP) studies
[0774] Cynomolgus macaques (Macaca fascicularis) aged 33-48 months and originally from Mauritian AAALAC-certified breeding centers were used for SARS-CoV-2 immunogenicity studies. All animals were housed in Infectious Disease Models and Innovative Therapies (IDMIT) facilities (CEA, Fontenay-aux-Roses), and in compliance with European Directive 2010 / 63 / EU, the French regulations, and the Standards for Human Care and Use of Laboratory Animals of the Office for Laboratory Animal Welfare (OLAW, assurance number #A5826-01, US). The protocols were approved by the institutional ethical committee Comite d'Ethique en Experimentation Animale du Commissariat a I'Energie Atomique et aux Energies Alternatives (CEtEA #44) under statement number A20-037. The study was authorized by the Research, Innovation and Education Ministry under registration number APAFIS#24434-2020030216532863 and APAFIS#28946- 2021011312169043. Cynomolgus macaques were randomly assigned to the experimental groups. Animals were immunised intramuscularly at weeks 0 and 7 with 5 pg of LNP formulated WT or CpG-Low saRNA encoding the spike glycoprotein of SARS-CoV-2 (Wuhan strain).
[0775] Quantification of antibodies by mesoscale
[0776] Cynomolgus macaque samples were screened for Spike specific IgG and their neutralizing capacity (analyzed by a pseudo- neutralizing Spike-ACE2 assay) against SARS-CoV-2 (Wuhan strain) (IgG and ACE2, MesoScale Discovery [MSD], Rockville, USA) according to the manufacturer's instructions. The plates were blocked with 50 mL of blocker A (1% BSA in MilliQ water) solution for at least 30 min at room temperature shaking at 700 rpm with a digital microplate shaker. During blocking, heat-inactivated serum samples were diluted 1 : 500 and 1 : 5,000 (IgG assay) or 1 : 10 and 1 : 100 (ACE2 assay) in diluent buffer. Each plate contained duplicates of a seven- point calibration curve with serial dilution of a reference standard, and a blank well. The plates were then washed three times with 150 mL of the MSD kit wash buffer, blotted dry, and 50 mL (IgG assay) or 25 mL (ACE2 assay) of the diluted samples were added to the plates and set to shake at 700 rpm at room temperature for at least 2 h. The plates were again washed three times and 50 mL of SULFO-Tagged anti-human IgG antibody or 25 mL of SULFO-Tagged human ACE2 protein, respectively, was added to each well and incubated shaking at 700 rpm at room temperature for at least 1 h. Plates were then washed three times and 150 mL of MSD GOLD Read Buffer B was added to each well. The plates were read immediately after on a MESO QuickPlex SQ 120 machine. Electro-chemiluminescence (ECL) signal was recorded and results expressed as AU / mL. Porcine studies
[0777] Weaned Large White x Duroc Cross Pigs (age 6 weeks) (n-5) were intramuscularly injected with a 100 ug / 0.5 mL dose of LNP formulated saRNA, where the VEEV backbone was either WT, CpG-Low or CpG-R and encoded the Pig erythropoietin (EPO) blood factor. Peripheral blood was assessed for EPO expression using an EPO specific ELISA (Abeam, UK) and graphed as fold expression, normalised to the VEEV WT backbone.
[0778] Example 1 - GpG-reduced saRNA leads to enhanced expression in ex vivo Human Skin Explants
[0779] As the inventors believed that CpG content could limit saRNA expression in humans, they first tested this concept using ex-vivo human skin tissue. This model contains skin resident primary cells including, epithelial, fibroblast, and adipocyte cells and a range of immune cells, including T cells, B cells, dendritic cells, and Langerhans cells etc., in their appropriate tissue environment. This ex-vivo model is a close surrogate to direct in vivo administration in humans and has much stronger translational relevance than cell culture of individual cell types (Blakney AK et al., 2019).
[0780] The inventors compared the expression of saRNA based on the VEEV backbone and encoding firefly luciferase as an indicator gene (acting as a surrogate GOI) cloned downstream of the subgenomic promotor, with and without CpG modification (SEQ ID NO: 1 and 87). In this model, expression of luciferase provides a direct indication of the level of protein expression from saRNA constructs with different levels of CpG density. The inventors compared luciferase expression saRNA based on the authentic parental sequence of the Trinidad Donkey strain with the original CpG density, to the same sequence modified to reduce CpG content by >90% (herein referred to as the "CpG-low" construct, SEQ ID No: 87). The inventors characterized the magnitude of luciferase expression (relative light units (RLUs) in resident human skin cells (see Figure 1).
[0781] Direct visualisation was carried out with an AMI imager from Spectral Instruments Imaging (Figure 1A) and quantified as relative light units (Figure IB). As shown in Figure 1C, the data indicate surprisingly robust expression from the CpG-low saRNA construct relative to the PBS control (15-fold increase over background), while the WT construct was only just detectable (4-fold background signal). Referring to Figure ID, direct comparison of the two constructs indicated close to a five-fold improvement for the CpG-Low construct relative to the original wild-type (WT) sequence. Example 2 - CpG-low saRNA shows improved immunogenicity over wide type (WT) parenteral VEEV saRNA in mice
[0782] The inventors then performed a comparative study to compare expression of the wide type (WT) parenteral VEEV saRNA (sequence Nol) to the CpG-low modified (sequence no 87) VEEV saRNA platform in Balb / c mice. Here, groups of five female balb / c mice (n-5 per group) were pre-treated with 50 pg of Pol-I:C administered by peritoneal injection. 24 hours later mice were then given an I.M. administration of 2 pg LNP formulated WT (sequence 1) or CpG-low (sequence 87) VEEV-fLuc saRNA. Mice were imaged at 24 and 48 hours using an AMI imager from Spectral Instruments, as shown in Figure 2. The expression fLuc a surrogate maker of protein expression was significantly higher for CpG-Low saRNA than WT saRNA. This data illustrate that CpG- Low RNA is expressed more efficiently in the context of the in vivo induction of interferon responses stimulated by Poly-I:C treatment.
[0783] Example 3 - CpG-low saRNA shows improved immunogenicity over wide type (WT) parenteral VEEV saRNA in non-human primates
[0784] Next, the inventors performed a comparative study to compare the immunogenicity of the wide type (WT, SEQ ID No: 1) parenteral VEEV saRNA to the CpG-low modified (sequence No 87) VEEV saRNA platform in cynomolgus macaques, a non-human primate (NHP) model relevant to pre-clinical evaluation of human vaccines. The inventors injected two groups of 4 cynomolgus macaques with a 5ug dose of WT or CpG-low saRNA encoding the surface glycoprotein of the Wuhan strain of SARS-CoV-2, the causative agent of COVID-19. The CpG content of the CpG-low VEEV saRNA backbone was reduced by 90% (see SEQ ID No: 87, and 88) and the CpG content of the SARS-CoV-2 glycoprotein was eliminated (see SEQ ID No: 41, and 42).
[0785] Animals received two injections of LNP-formulated vaccine at weeks 0, and 7, and serum samples were collected at 2 weeks post first immunization and 2 and 6 weeks post second immunization (see Figure 3). After the prime, low binding antibody responses (<103AU / mL) could be measured by week 2 in 3 / 4 animals vaccinated with the CpG-low saRNA and 2 / 4 animals vaccinated with the WT saRNA (see Figure 3a). By week 9, two weeks after the boost, all animals showed high anti-spike IgG titres (>105AU / ml) that were significantly higher than those induced by WT saRNA, these differences were still apparent at week 17, 6 weeks after the boost.
[0786] The ability of the saRNA-induced antibodies to neutralise SARS-CoV-2 was then measured as a marker of antibody functionality (see Figure 3b). There was no detectable neutralising response after the priming vaccination. However, at 6 weeks, two weeks after the boost, potent neutralising antibody responses were detected in the serum of animals vaccinated with the CpG-low saRNA (102AU / ml) and these were significantly higher than those seen with the WT saRNA (101AU / ml). These differences were still apparent at week 10, 6 weeks after the boost.
[0787] Example 4 - Modification of GpG content in 5' and 3' UTRs of VEEV have variable effects on expression
[0788] The inventors next looked to assess the potential impact of CpG content in the highly structured 5' and 3' UTRs and subgenomic promotor regions, where secondary structure of these regions is essential to self-amplification and expression of subgenomic RNA. Recoding of these regions was non-obvious and while a few designs led to a modest improvement in expression of CpG-Low (SEQ ID No: 87), the majority had a negative impact on expression (Figure 4). These data suggested limited additional gains could be provided by reduction CpG content in these regions, therefore, the inventors looked to determine whether the level of depletion in the CpG-low sequence (O / E 0.133) was optimal, already being lower than the frequency in most human mRNA sequences (O / E 0.45).
[0789] Example 5 - Further reduction in GpG content provides additional improvements in expression
[0790] While the VEEV CpG-low saRNA construct demonstrated enhanced activity in human skin tissue explants and non-human primate studies, the inventors then determined if further reduction in CpG content outside of the structurally conserved UTR and subgenomic promotor regions might provide additional gains in expression. They derived a construct "CpG-R" (SEQ ID No: 89) that was further reduced with respect to CpG and UpA motifs, with additional codon modifications. This construct was then evaluated for expression in HeLa cells (Figure 5). These data demonstrate the surprising observation that depleting CpG levels to an O / E of 0.059, lower than any known human virus sequence and a level only seen on 0.25% of human mRNA sequences further improved expression relative to WT saRNA and even that of the CpG-low construct.
[0791] Example 6 - Minimising CPG content provides additional benefit
[0792] While the VEEV CpG-R saRNA construct demonstrated enhanced activity over WT and CpG-low sequences, a few additional CpG dinucleotides were present within the NSP sequence. The inventors then derived a construct "CpG-F" (SEQ ID No: 91) that removed these final 6 CpG dinucleotides form the NSP sequence (excluding the 51 CSE sequence and SG region of NSP1 and NSP4, respectively) resulting in an O / E ratio of 0.046. This construct was then evaluated for expression in HEK293T (Figure 6) and HeLa cells (Figure 7). Both GpG-R and CpG-R Full (CpG-F) demonstrated improved expression in both HEK293T cells and HeLa cells over WT (O / E 0.76) and more importantly GpG-low (O / E 0.133) constructs. However, the difference was minimal or not apparent between GpG-R and CpG-F constructs suggesting that optimal performance of saRNA can be achieved with O / E values of >0. 133.
[0793] Example 7 - Minimising GpG content also improves response in Human A549 cells known to produce strong interferon beta responses
[0794] To further expand these findings, the inventors determined the relative expression of these constructs in A549 human epithelial cells widely used to assess antiviral responses to RNA viruses (Figure 8). Studies using these cells that have strong antiviral responses clear demonstrate the novel finding that minimising the GpG content in the saRNA backbone maximises expression with the higher activity shown by CpG-F (O / E 0.046), followed by GpG-R (O / E 0.059) while expression of CpG-low (O / E 1.33) and WT VEEV (O / EO.79) saRNA were comparatively low.
[0795] Example 8 - Minimising GpG content improves saRNA expression in porcine large animal model
[0796] Having determined that extreme reduction in the CpG content improved expression in human cells, the inventors then determined if this was representative of expression in a large animal study using pigs. WT, GpG-low (SEQ ID No: 87) and CpG-R (SEQ ID No: 89) VEEV constructs were enveloped where erythropoietin (EPO) was expressed downstream of the subgenomic promotor. Here EPO was used as an expression marker that could be detected by ELISA in the blood stream of animals following intramuscular administration of 100 pg of LNP formulated saRNA (Figure 9). Data from this experiment demonstrated 7- and 10-fold increase in expression of EPO relative to the WT construct and 12 hours post IM injection, and increased levels of expression for CpG-R (7-fold) were still evident at 24 hours post injection. These data confirm that the gains in expression seen with the extreme reduction of CpG frequency provided by the CpG-R construct observed in human cells vitro were also representative of responses in a relevant large animal model.
[0797] Example 9 Maximising GoG reduction also improves the kinetics of saRNA based on the backbone of Semliki Forest virus
[0798] The inventors also determined whether high levels of CpG reduction might favour replication of saRNA constructs based on the backbone of Semliki Forest virus (SFV). Here CpG content was minimised in the sequences encoding the NSPs of SFV (CpG optimised / low SFV, SEQ ID No: 61), while retaining CpGs required to maintain secondary structure required for replication (i.e. within the UTRs, Subgenomic promotor and conserved sequence elements - see SEQ ID No: 61). Transfection experiments demonstrated that CpG depletion across the NSPs generating a construct with an O / E value of 0.04, led to much more rapid expression of SFV saRNA than WT SFV saRNA. Here, enhanced levels of expression relative to the WT sequence were determined by 6 h post-transfection in HEK293T, HeLa and THP-1 cells (Figure 10 A 8i B), however, expression of WT SFV reached similar plateaux levels of expression by 24 h.
[0799] Example 10 - Modification of GpG content in 5' and 3' UTRs of SFV saRNA have variable effects on expression
[0800] As for VEEV based saRNA, the inventors explored whether deletion of CpG sequences within the 5' and 3' UTRs of SFV saRNA provided any benefit over the CpG optimised SFV construct (SEQ ID No: 61). All the variants tried either had no or negative impacts on expression relative to the CpG optimised saRNA construct (Figure lla&b). These data demonstrate that a generalised approach to CpG depletion may not always be applied to saRNA and that some important CpG motifs within RNA structural regions essential for saRNA replication should be preserved.
[0801] Example 11 - GpG-R and GpG-F saRNA represent extremely low O / E values relative to human viruses and the vast majority of human mRNA sequences
[0802] Having observed that maximal improvements in saRNA expression were gained by GpG-R and CpG-F variants of saRNA, the inventors assessed how representative these were with respect to O / E CpG frequency (Figure 12). With respect to other viruses infecting humans, wild-type VEEV has one of the highest O / E values (0.76).
[0803] Unsurprisingly, most human viruses have an O / E values similar to the mean O / E value for human mRNA (0.45) (Figure Ila), reflecting adaptation to the human host where such frequencies avoid self-targeting of host mRNA
[0031] , It would be expected that a reduction in the O / E values of VEEV to match that of the majority of human mRNA would provide an advantage in terms of replication. However, surprisingly optimal replication of VEEV was achieved by extreme reductions in CpG frequency, where GpG-R (SEQ ID No: 87) and CpG-F (SEQ ID No: 91) had O / E values of 0.059 and 0.046, and these were seen to perform significantly better than CpG-Low with an O / E of 0.133. This is highly unexpected as these frequencies are lower than the observed in all human viruses, and far lower than those thought to engage antiviral proteins
[0046] , Such low levels of CpG O / E values are only observed in <0.5% of all human mRNA sequences highlighting the uniqueness of this approach. Example 12 - GpG reduction provides no advantage in the expression of mRNA seouences
[0804] The inventors then asked if the advantages of extreme CpG reduction provided to saRNA were applicable to RNA expression in general. To test this, the inventors depleted CpG motifs from mRNA sequences encoding firefly luciferase (fLuc, sequence No 93) (Figure 13) and erythropoietin (EPO) (Figure 14). Comparison of the expression wildtype and CpG depleted sequences for both these mRNA constructs provided no apparent advantage. Indeed, for EPO, mRNA expression of GpG-depleted (SEQ ID No: 95) or UpA reduced (SEQ ID No: 97) were worse that the wildtype sequence (Figure 14d at 48h), while combined depletion of GpG and reduction of UpA (SEQ ID No: 99) was similar to WT sequence. This was unexpected given the surprising improvement that extreme CpG reduction provided alphavirus expression (as demonstrated for VEEV and SFV). These data highlight the uniqueness of the inventors' discovery that extreme CpG reduction is highly advantageous for saRNA expression, but not mRNA.
[0805] Example 13 - GpG-R and GpG-F saRNA represent low O / E values that exceed human interferon stimulated genes and match those of type I interferon transcripts
[0806] Having observed that maximal improvements in saRNA expression were gained by GpG-R and CpG-F variants of saRNA, the inventors assessed how representative these were with respect to O / E CpG frequency (Figure 15) for ISGs and type I interferons. It would be expected that a reduction in the O / E values of VEEV to match that of the majority of human mRNA would provide an advantage in terms of replication. Furthermore, matching that of ISGs might be predicted to provide further advantage However, surprisingly optimal replication of VEEV was achieved by extreme reductions in CpG frequency, where GpG-R (SEQ ID No: 87) and CpG-F (SEQ ID No: 91) had O / E values of 0.059 and 0.046, and these were seen to perform significantly better than CpG-Low with an O / E of 0.133. In this respect, optimal replication of VEEV was achieved by extreme reductions in CpG frequency that matches or is lower than many type I interferon mRNA, that have the most suppressed CpG frequencies of all human transcripts. The innovation to achieve CpG levels that are only seen in type 1 Interferon mRNA transcripts enables saRNA to avoid non-self recognition and interferon resistance highlighting the uniqueness of this approach.
[0807] Conclusions
[0808] CpG-modified self-amplifying vectors are described, which carry a nucleic acid molecule comprising the sequence of an alphavirus self-amplifying RNA (saRNA) vector including: the 5'UTR; non-structural proteins (NSP 1-4); subgenomic promotor; 5' subgenomic UTR; 3' UTR; and an exogenous gene sequence under the control of the subgenomic promotor which controls expression of the gene product. The nucleic acid sequences of the vectors and the exogenous gene of interest were modified to maximally reduce or eliminate CpG dinucleotides such that levels of CpG reduction expression of the vector is enhanced compared to the unmodified saRNA vector. Surprisingly this was achieved by reducing CpG levels to those only seen in type 1 Interferon mRNA transcripts enables saRNA to avoid non-self recognition and interferon resistance highlighting the uniqueness of this approach
[0809] The inventors therefore designed, constructed and tested CpG-modified saRNA vectors, which have reduced or deleted concentrations of CpG compared to their corresponding wildtype RNA sequence. The nucleic acid sequences of the vector and the exogenous gene of interest were modified to significantly reduce or eliminate the concentration of CpG dinucleotides, i.e. by (i) reducing the CpG content in the CpG- low saRNA construct by at least 90% compared to the corresponding wildtype parent RNA sequence, (II) deleting the CpG content in the CpG-R construct even further to less than 93.3% compared to the wildtype parent RNA sequence, or (ill) deleting all CpG sequences from all but the critical UTRs and 51 CSE, i.e. less than 94% compared to the wildtype RNA sequence. Such reductions are lower than for any human virus and far lower than the average O / E frequency for human RNA sequences (0.45) thought to prevent self-recognition of CpG dinucleotides. Indeed, maximal improvements in expression were seen with CpG-R (SEQ ID No: 89) and CpG-F (SEQ ID No: 91) sequences that have O / E values that are seen in less than 0.25 and 0.15% of human mRNA sequences
[0031] , The surprising benefit provided by extreme CpG reduction for saRNA, matching levels seen in type I interferon transcripts, was not seen for mRNA sequences, confirming the non-obvious nature of the invention.
[0810] As shown in Figures 1, 2 and 3, the expression levels of the vector were surprisingly enhanced in the CpG low vector compared to the unmodified (CpG high) saRNA vector. Moreover, the inventors observed that the CpG-low saRNA constructs showed surprisingly improved immunogenicity compared to the corresponding wild-type parenteral saRNA with normal (i.e. elevated) CpG levels in non-human primates. While the reduction in CpG frequency for CpG low vector (O / E 0.133) was already far below the mean O / E frequence for human mRNA sequences (0.45), subsequent experiments demonstrated that yet further gains were provided by reducing the CpG frequency even further as seen with GpG-R (SEQ ID No: 89) and GpG-F (SEQ ID No: 91) with O.E values of 0.59 and 0.046, respectively. This was highly surprising as this is lower than those observed in all human viruses and most human mRNA sequences (0.5%). Indeed such levels of reduction even exceeded those of interferon stimulated genes and matched that only seen in huma type I interferon transcripts. These data also indicate that maximal reduction to below O / E ratio of 0.133 is preferable.
[0811] The inventors believe that the uniqueness of their observations is the achieved level of CpG reduction seen with CpG-R and CpG-F saRNA, because no human mRNA transcript exists that has such a low frequency for such a long RNA sequence. Indeed, the longest human mRNA transcript with an O / E <0.133 is only 7.175 Kb (analogous to CpG-low), <0.06 is only 3.840 kb (analogous to CpG-R) and 0.046 is only 2.712 Kb (analogous to CpG-F). Clearly, saRNA sequences can be significantly longer. Therefore, the inventors have developed saRNA sequences with CpG frequencies that are so differentiated that they have no equivalence in either any human viral pathogen or human mRNA transcript.
[0812] Summary
[0813] CpG-depleted saRNA vectors are described as are methods for generating these sequences. More particularly, the sequence of any of the vector elements described herein for CpG-depletion may be synthesized, generated via site-directed mutagenesis, or in some cases obtained commercially. The techniques by which these modifications are made is not a limitation on the present invention. Similarly, once the CpG-depleted sequences are obtained, an saRNA vector may be produced using any suitable method.
[0814] The CpG-depleted saRNA vector may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques
[0037] , Similarly, methods of generating saRNA from a DNA template are well known and the selection of a suitable method is not a limitation on the present invention [37, 38],
[0815] Unless otherwise specified, the source of parental (i.e., wild-type or unmodified) saRNA sequences, and other selected saRNA components described herein, may be readily selected from among any alphavirus, including, those identified herein and may also contain chimeric sequences from two or more alphaviruses. These components may be readily isolated using techniques available to those of skill in the art from an alphavirus sequence. Such alphavirus sequence may be isolated or obtained from academic, commercial, or public sources (e.g., the Addgene Collection). Alternatively, the alphavirus sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank®, PubMed®, or the like. The alphavirus self-amplifying sequences and other expression cassette elements are CpG- depleted as described earlier in the specification. However, the approach described herein may be applied to self-amplifying vectors based on single-stranded positive genomes from the three phyla : Kitrinoviricota, Lenarviricota, and Pisuviricota.
[0816] While not repeated in each instance in the following description, it will be readily understood that each of the saRNA cassette elements may be CpG-depleted according to the present invention and optionally, one or more of these elements (e.g., the coding sequence) may be CpG-free.
[0817] The CpG-depleted vector is composed of: a 5'UTR, sequence encoding for the non- structural protein(s), a subgenomic promotor and subgenomic 5'UTR, a transgene inserted in place of the structural proteins, and a 3'UTR. The CpG-modified vector is packaged is formulated with a suitable carrier (LNP, polyplex etc) and delivered to a selected host cell.
[0818] References i. Lundstrom K. Self-Replicating RNA Viruses for RNA Therapeutics. Molecules. 2018;23(12):3310. doi: 10.3390 / molecules23123310.
[0819] 2. McKay PF, Hu K, Blakney AK, Samnuan K, Brown JC, Penn R, Zhou J, Bouton CR, Rogers P, Polra K, Lin PIC, Barbosa C, Tam YK, Barclay WS, Shattock RJ. Self-amplifying RNA SARS-CoV-2 lipid nanoparticle vaccine candidate induces high neutralizing antibody titers in mice. Nat Common. 2020;ll(l):3523. doi: 10.1038 / S41467-020-17409-9.
[0820] 3. Pollock KM, Cheeseman HM, Szubert AJ, Libri V, Boffito M, Owen D, Bern H, O'Hara J, McFarlane LR, Lemm NM, McKay PF, Rampling T, Yim YTN, Milinkovic A, Kingsley C, Cole T, Fagerbrink S, Aban M, Tanaka M, Mehdipour S, Robbins A, Budd W, Faust SN, Hassanin H, Cosgrove CA, Winston A, Fidler S, Dunn DT, McCormack S, Shattock RJ; COVAC1 study Group. Safety and immunogenicity of a self-amplifying RNA vaccine against COVID-19: COVAC1, a phase I, dose-ranging trial. EClinicalMedicine. 2022;44: 101262. doi: 10.1016 / j.eclinm.2021.101262.
[0821] 4. Elliott T, Cheeseman HM, Evans AB, Day S, McFarlane LR, O'Hara 3, Kalyan M, Amini F, Cole T, Winston A, Fidler S, Pollock KM, Harker JA, Shattock RJ. Enhanced immune responses following heterologous vaccination with self-amplifying RNA and mRNA COVID-19 vaccines. PLoS Pathog. 2022;18(10):el010885. doi: 10.1371 / journal.ppat. l010885.
[0822] 5. Nance KD, Meier IL. Modifications in an Emergency: The Role of Nl-Methylpseudouridine in COVID-19 Vaccines. ACS Cent Sci. 2021;7(5) :748-756. doi: 10.1021 / acscentsci. lc00197.
[0823] 6. Hagai, T., Chen,X., Miragaia,RJ., Rostom,R., Gomes, T., Kunowska,N., Henriksson, J., Park, J.E., Proserpio, V., Donati, G., et al. Gene expression variability across cells and species shapes innate immunity. Nature 2018;563, 197-202.
[0824] 7. Komori M, Morey AL, Quinones-Molina AA, Fofana 3, Romero L, Peters E, Matsuda K, Gummuluru S, Smith IF, Akahata W, Akiyama H. Incorporation of 5 methylcytidine alleviates innate immune response to self- amplifying RNA vaccine. bioRxiv [Preprint]. 2023 Nov 1:2023.11.01.565056. doi: 10.1101 / 2023.11.01.565056.
[0825] 8. McGee JE, Kirsch JR, Kenney D, Chavez E, Shih TY, Douam F, Wong WW, Grinstaff MW. Complete substitution with modified nucleotides suppresses the early interferon response and increases the potency of self-amplifying RNA. bioRxiv [Preprint]. 2023:2023.09.15.557994. doi: 10.1101 / 2023.09.15.557994
[0826] 9. Lin G, Zhang Y. Mutations in the non-structural protein coding region regulate gene expression from replicon RNAs derived from Venezuelan equine encephalitis virus. Biotechnol Lett. 2023;45(8): 1029-1038. doi: 10.1007 / S10529-023-03379-7.
[0827] 10. Ilya Frolov, Eugene Agapov, Thomas A. Hoffman, Be' la M. Pra'gai, Mara Lippa, Sondra Schlesinger, Charles M. Rice, Selection of RNA replicons capable of persistent noncytopathic replication in mammalian cells, J. Virol. 73 (5) (1999) 3854-3865, https: / / doi.Org / 10.1128 / JVI.73.5.3854-3865.1999.
[0828] 11. S.A. Dryga, O.A. Dryga, S. Schlesinger, Identification of mutations in a Sindbis virus able to establish persistent infection in BHK cells. The importance of a mutation in the nsP2 gene, Virology. 1997; 228: 74- 83. https: / / doi.org / 10.1006 / viro.1996.8364. 12. Silvia Perri, David A. Driver, Jason P. Gardner, Scott Sherrill, Barbara A. Belli, Thomas W. Dubensky, John M. Polo, Replicon vectors derived from sindbis virus and semliki forest virus that establish persistent replication in host cells, J. Virol. 2000; 74: 9802-9807, https: / / doi.org / 10.1128 / JVI.74.20.9802- 9807.2000.
[0829] 13. Olga Petrakova, Eugenia Volkova, Rodion Gorchakov, Slobodan Paessler, Richard M. Kinney, Ilya Frolov, Noncytopathic replication of Venezuelan equine encephalitis virus and eastern equine encephalitis virus replicons in mammalian cells, J. Virol. 2005; 79:7597-7608, https: / / doi.org / 10.1128 / JVI.79.12.7597- 7608.2005.
[0830] 14. Y. Li, B. Teague, Y. Zhang, Z. Su, E. Porter, B. Dobosh, T. Wagner, D.J. Irvine, R. Weiss, In vitro evolution of enhanced RNA replicons for immunotherapy, Sci. Rep. 2019; 9: 1-10, httDs: / / doi.oro / 10.1038 / s41598- 019-43422-0.
[0831] 15. Beissert, T., Koste, L., Perkovic, M., Walzer, K.C., Erbar, S., Selmi,A., Diken, M., Kreiter, S., Tureci, 0., Sahin, U. Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins. Hum. Gene Ther. 2017, 28, 1138-1146.
[0832] 16. Blakney AK, McKay PF, Bouton CR, Hu K, Samnuan K, Shattock RJ. Innate Inhibiting Proteins Enhance Expression and Immunogenicity of Self-Amplifying RNA. Mol Ther. 2021;29: 1174-1185. doi:
[0833] 10.1016 / j.ymthe.2020.11.011.
[0834] 17. Kim DY, Atasheva S, McAuley AJ, Plante JA, Frolova El, Beasley DW, Frolov I. Enhancement of protein expression by alphavirus replicons by designing self-replicating subgenomic RNAs. Proc Natl Acad Sci U S A. 2014;l 11(29): 10708-13. doi: 10.1073 / pnas.1408677111. 18. Perkovic M, Gawletta S, Hempel T, Brill S, Nett E, Sahin U, Beissert T. A trans-amplifying RNA simplified to essential elements is highly replicative and robustly immunogenic in mice. Mol Ther. 2023;31(6): 1636- 1646. doi: 10.1016 / j.ymthe.2023.01.019.
[0835] 19. LaPointe AT, Sokoloski KJ. De-Coding the Contributions of the Viral RNAs to Alphaviral Pathogenesis. Pathogens. 2021;10(6):771. doi: 10.3390 / pathogensl0060771. 20. Strauss JH, Strauss EG. The alphaviruses: gene expression, replication, and evolution. Microbiol Rev. 1994;58(3):491-562. doi: 10.1128 / mr.58.3.491-562.1994.
[0836] 21. Hyde JL, Gardner CL, Kimura T, White JP, Liu G, Trobaugh DW, Huang C, Tonelli M, Paessler S, Takeda K, Klimstra WB, Amarasinghe GK, Diamond MS. A viral RNA structural element alters host recognition of nonself RNA. Science. 2014;3:783-7. doi: 10.1126 / science.1248465. 22. Logue CH, Sheahan BJ, Atkins GJ. The 5’ untranslated region as a pathogenicity determinant of Semliki Forest virus in mice. Virus Genes. 2008;36:313-21. doi: 10.1007 / S11262-008-0209-1. 23. Kulasegaran-Shylini R, Thiviyanathan V, Gorenstein DG, Frolov I. The 5'UTR-specific mutation in VEEV TC- 83 genome has a strong effect on RNA replication and subgenomic RNA synthesis, but not on translation of the encoded proteins. Virology. 2009;387(l):211-21. doi: 10.1016 / j. viral.2009.02.027.
[0837] 24. Hyde JL, Chen R, Trobaugh DW, Diamond MS, Weaver SC, Klimstra WB, Wilusz J. The 5’ and 3’ ends of alphavirus RNAs— Non-coding is not non-functional. Virus Res. 2015;206:99-107. doi: 10.1016 / j.virusres.2015.01.016.
[0838] 25. Michel G, Petrakova O, Atasheva S, Frolov I. Adaptation of Venezuelan equine encephalitis virus lacking 51- nt conserved sequence element to replication in mammalian and mosquito cells. Virology.
[0839] 2007;362(2):475-87. doi: 10.1016 / j.virol.2007.01.009. 26. Levis R, Schlesinger S, Huang HV. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription. J Virol. 1990;64(4): 1726-33. doi: 10.1128 / JVI.64.4.1726-1733.1990.
[0840] 27. Kim DY, Firth AE, Atasheva S, Frolova El, Frolov I. Conservation of a packaging signal and the viral genome RNA packaging mechanism in alphavirus evolution. J Virol. 2011;85(16):8022-36. doi: 10.1128 / JVI.00644- 11. 28. Hellstrdm K, Kallio K, Merilainen HM, Jokitalo E, Ahola T. Ability of minus strands and modified plus strands to act as templates in Semliki Forest virus RNA replication. J Gen Virol. 2016;97(6) : 1395-1407. doi: 10.1099 / jgv.0.000448.
[0841] 29. Firth AE, Wills NM, Gesteland RF, Atkins JF. Stimulation of stop codon readthrough: frequent presence of an extended 3’ RNA structural element. Nucleic Acids Res. 2011;39(15):6679-91. doi: 10.1093 / nar / gkr224. 30. Pros 33, Visser I, Tang B, Yan K, Nakayama E, Visser TM, Koenraadt CJM, van Oer...
Claims
Claims1. A modified self-amplifying RNA (saRNA) molecule comprising a CpG-reduced or CpG-depleted RNA sequence compared to an unmodified, wild-type RNA sequence.
2. A modified saRNA molecule according to claim 1, wherein the saRNA molecule comprises or is derived from a single-stranded positive RNA virus (ss+ RNA), optionally wherein the single-stranded positive genome is from one of the following phyla : Kitrinoviricota, Lenarviricota, and Pisuviricota.
3. A modified saRNA molecule according to either claim 1 or claim 2, wherein the saRNA molecule comprises or is derived from a single-stranded positive RNA virus selected from the group of genus consisting of: alphavirus; picornavirus; flavivirus; rubivirus; pestivirus; hepacivirus; nodavirus; calicivirus and coronavirus.
4. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule comprises or is derived from an alphavirus, optionally wherein the alphaviruses includes Aura, Bebaru virus, Cabassou, Chikungunya virus, Eastern equine encephalomyelitis virus, Fort Morgan, Getah virus, Kyzylagach, Mayaro, Mayaro virus, Middleburg, Mucambo virus, Ndumu, Pixuna virus, Ross River virus, Semliki Forest virus, Sindbis virus, Tonate, Triniti, Una, Venezuelan equine encephalomyelitis virus (VEEV), Western equine encephalomyelitis, Whataroa, or Y-62-33.
5. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule comprises or is derived from VEEV.
6. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule comprises a sequence of an alphavirus self-amplifying RNA (saRNA) vector and a transgene, which encodes a therapeutic biomolecule.
7. A modified saRNA molecule according to claim 6, wherein the transgene comprises an RNA sequence coding for a specific protein, a non-coding RNA sequence, RNAi, ribosomal RNA, catalytic RNAs, siRNA, small hairpin RNA, trans-splicing RNA, or antisense RNA.
8. A modified saRNA molecule according to claim 6 or claim 7, wherein the transgene encodes: (i) a protein designed to elicit an immune response, optionally against an oncologic target or a pathogenic organism which result in bacterial or viraldisease; or (ii) a therapeutic protein, optionally for protein replacement or supplementation.
9. A modified saRNA molecule according to any one of claims 6-8, wherein the transgene coding sequence is CpG-depleted and operatively linked to regulatory components in a manner which permits transgene amplification, translation, and / or expression in a host cell.
10. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule comprises an individual CpG reduced or depleted transgene or multiple transgenes, linked by multiple subgenomic promotor sequences, IRES sequences, or ribosomal skip sites, optionally T2A, F2A, E2A, or P2A.
11. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule maintains its secondary structure to allow replication of the saRNA, optionally by conserving stem loop structures.
12. A modified saRNA molecule according to claim 11, wherein the secondary structure of the saRNA molecule is maintained at: (i) one or more conserved sequence element (CSE) selected from CSE1, CSE2, CSE3 and / or CSE4, (II) the 5'-UTR; (ill) the NSP1; (iv) one or more non-structural protein (nsP) selected from nsPl, nsP2, nsP3 and / or nsP4; and / or (v) the 3'-UTR.
13. A modified saRNA molecule according to any preceding claim, wherein :(i) a transgene sequence comprises a reduced or depleted number of CpG di- nucleotides as compared to the native coding sequence for the gene product;(ii) a non-structural protein sequence (NSP1-4) comprises a reduced or depleted number of CpG di-nucleotides as compared to the unmodified, wild-type RNA sequence;(ill) a 5' and / or 3' untranslated sequence comprises a reduced or depleted number of CpG di-nucleotides as compared to the unmodified, wild-type RNA sequence;(iv) a subgenomic promotor comprises a reduced or depleted number of CpG di-nucleotides as compared to the unmodified, wild-type RNA sequence;(v) a subgenomic 5'UTR comprises a reduced or depleted number of CpG di- nucleotides as compared to the unmodified, wild-type RNA sequence; and / or(vi) a 5' conserved sequence element (CSE) comprises a reduced or depleted number of CpG di-nucleotides as compared to the unmodified, wild-type RNA sequence.
14. A modified saRNA molecule according to any preceding claim, wherein the CpG di-nucleotides which are removed or depleted are located within a codon triplet for a selected amino acid.
15. A modified saRNA molecule according to any preceding claim, wherein the CpG di-nucleotides which are removed or depleted are located within the interface between triplets.
16. A modified saRNA molecule according to any preceding claim, wherein the modified saRNA molecule comprises an RNA sequence, which is both : (i) CpG-reduced or CpG-depleted, compared to an unmodified, wild-type RNA sequence; and (II) codon optimised.
17. A modified saRNA molecule according to any preceding claim, the number of CpG di-nucleotides in the saRNA molecule is reduced by:(i) at least about 25%, at least about 30%, at least about 45%, at least about 50%;(II) at least about 75%, at least about 80%, at least about 85%, at least about 90%, or about 90% to 100% CpG-depleted, as compared to a nucleic acid molecule having the corresponding native sequences;(iii) at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%; and / or(iv) at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% CpG-depleted, as compared to a nucleic acid molecule having the corresponding native sequences.
18. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule has a CpG O / E odds ratio of:-(i) less than about 0.65, or less than about 0.60, or less than about 0.55, or less than about 0.50;(II) less than about 0.45, or less than about 0.43, or less than about 0.40, or less than about 0.35, or less than about 0.30; and / or(ill) less than about 0.25, or less than about 0.2.
19. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule has a CpG O / E odds ratio of:-(i) less than about 0.15, or less than 0.133;(II) less than about 0.10, or less than 0.09;(ill) less than about 0.08, or less than about 0.07;(iv) less than about 0.06, or less than about 0.05;(v) less than about 0.04, or less than about 0.03; and / or(vi) less than about 0.02, or less than 0.01, or zero.
20. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule is:(I) at least 1000 bases in length, at least 2000 bases in length, at least 3000 bases in length, at least 4000 bases in length, at least 5000 bases in length, at least 6000 bases in length, at least 7000 bases in length, at least 8000 bases in length, at least 9000 bases in length, at least 10,000 bases in length, at least 11,000 bases in length or at least 12,000 bases in length;(II) at least 13,000 bases in length, at least 14,000 bases in length, at least 15,000 bases in length, at least 16,000 bases in length, at least 18,000 bases in length or at least 20,000 bases in length; and / or(ill) between 5000 and 20,000 bases in length, between 6000 and 15,000 bases in length, between 7000 and 14,000 bases in length, between 7500 and 13,000 bases in length, between 8000 and 12,000 bases in length, between 8500 and 11,000 bases in length, between 9000 and 10,000 bases in length.
21. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule:(I) is at least at least 1000 bases in length, and has a CpG O / E odds ratio of less than about 0.15;(II) is at least at least 3000 bases in length, and has a CpG O / E odds ratio of less than about 0.13;(ill) is at least at least 7200 bases in length and has a CpG O / E odds ratio of less than about 0.06; and / or(iv) is at least 8000 bases in length and has a CpG O / E odds ratio of less than about 0.02.
22. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule comprises a CpG reduced or deleted sequence that is further modifiedto additionally reduce or delete UpA-dinucleotides that may be recognised by antiviral proteins in RNA sequences compared to an unmodified, wild-type RNA sequence or more prominently on CpG reduced / depleted RNA sequence, optionally wherein :(a) the number of UpA di-nucleotides in the saRNA molecule is reduced by:(i) at least about 25%, at least about 30%, at least about 45%, at least about 50%;(II) at least about 75%, at least about 80%, at least about 85%, at least about 90%, or about 90% to 100% UpA-depleted, as compared to a nucleic acid molecule having the corresponding native sequences;(iii) at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%;(iv) at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% UpA-depleted, as compared to a nucleic acid molecule having the corresponding native sequences; and / or wherein(b) the saRNA molecule has a CpG O / E odds ratio of:-(i) less than about 0.65, or less than about 0.60, or less than about 0.55, or less than about 0.50;(II) less than about 0.45, or less than about 0.43, or less than about 0.40, or less than about 0.35, or less than about 0.30; and / or(iii) less than about 0.25, or less than about 0.20, or less than about 0.15, or less than about 0.10.
23. A modified saRNA molecule according to any preceding claim, wherein the modified saRNA molecule comprises an RNA sequence, which is both : (i) CpG-reduced or CpG-depleted compared to an unmodified, wild-type RNA sequence, and (II) UpA- reduced or UpA-depleted, compared to an unmodified, wild-type RNA sequence,24. A modified saRNA molecule according to any preceding claim, wherein the modified saRNA molecule comprises an RNA sequence, which is: (i) CpG-reduced or CpG-depleted compared to an unmodified, wild-type RNA sequence, (II) UpA-reduced or UpA-depleted compared to an unmodified, wild-type RNA sequence, and (iii) codon optimised.
25. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule comprises an RNA sequence substantially as set out in SEQ ID NO: 3, 7, 9, 11, 15, 19, 21, 23, 27, 29, 31, 33, 35, 37, 39, 51, 53, 55, 57, 61, 63, 67, 69, 71, 73, 87, 89 or 91, or a variant or fragment thereof.
26. A modified saRNA molecule according to any preceding claim, wherein the saRNA molecule comprises an RNA sequence encoded by a DNA template substantially as set out in SEQ ID NO: 4, 8, 10, 12, 16, 20, 22, 24, 28, 30, 32, 34, 36, 38, 40, 52, 54, 56, 58, 62, 64, 68, 70, 72, 74, 88, 90 or 92, or a variant or fragment thereof.
27. Use of the saRNA molecule according to any one of claims 1-26, for:(i) reducing the activation of innate sensing, reducing RNA recognition, reducing binding by RNA binding proteins, reducing interferon generation and / or reducing degradation of the saRNA molecule; and / or(ii) enhancing the expression and / or translation of a transgene harboured on the saRNA molecule, optionally wherein the expression and / or translation of a transgene harboured on the saRNA molecule is enhanced in the context of an innate response.
28. A method for enhancing the expression and / or translation of a transgene harboured on the saRNA molecule according to any one of claims 1-26, the method comprising delivering the saRNA molecule into a cell, and allowing it to carry out saRNA-mediated gene expression of the transgene.
29. A nucleic acid sequence encoding the saRNA molecule according to any one of claims 1-26.
30. An expression cassette comprising a nucleic acid sequence according to claim 29.
31. A recombinant vector comprising the expression cassette according to claim 30.
32. A pharmaceutical composition comprising the saRNA molecule according to any one of claims 1-26, the nucleic acid sequence according to claim 29, the expression cassette according to claim 30, or the vector according to claim 31, and a pharmaceutically acceptable vehicle.
33. A process for making the pharmaceutical composition according to claim 32, the method comprising contacting the saRNA molecule according to any one of claims 1-26, the nucleic acid sequence according to claim 29, the expression cassette according to claim 30, or the vector according to claim 31, with a pharmaceutically acceptable vehicle.
34. A method of preparing the saRNA molecule according to any one of claims 1-26, the method comprising: a) i) introducing, into a host cell, the vector according to claim 31; and ii) culturing the host cell under conditions to result in the production of theRNA construct according to any one of claims 1-26; or b) transcribing the RNA construct from the vector according to claim 31.
35. A saRNA molecule according to any one of claims 1-26, the nucleic acid sequence according to claim 29, the expression cassette according to claim 30, the vector according to claim 31, or the pharmaceutical composition according to claim 32, for use as a medicament or in therapy.
36. A saRNA molecule according to any one of claims 1-26, the nucleic acid sequence according to claim 29, the expression cassette according to claim 30, the vector according to claim 31, or the pharmaceutical composition according to claim 32, for use in the prevention, amelioration or treatment of a protozoan, fungal, bacterial or viral infection.
37. A saRNA molecule according to any one of claims 1-26, the nucleic acid sequence according to claim 29, the expression cassette according to claim 30, the vector according to claim 31, or the pharmaceutical composition according to claim 32, for use in the prevention, amelioration or treatment of cancer.
38. A vaccine comprising the saRNA molecule according to any one of claims 1-26, the nucleic acid sequence according to claim 29, the expression cassette according to claim 30, the vector according to claim 31, or the pharmaceutical composition according to claim 32, and optionally an adjuvant39. A vaccine according to claim 38, wherein the adjuvant incorporated into a delivery formulation is selected form the group consisting of a bacterial lipopeptide, lipoprotein and lipoteichoic acid; mycobacterial lipoglycan; yeast zymosan, porin, Lipopolysaccharide, Lipid A, monophosphoryl lipid A (MPL), Flagellin, CpG DNA, hemozoin, Tomatine, ISCOM, ISCOMATRIXTM, squalene based emulsions, polymers, such as PEI, Carbopol, lipid nanoparticles (LNPs), bacterial toxins (CT, LT), aluminium salt, a synthetic form of DNA, a carbohydrate, a tablet binder, an ion exchange resin, preservative, a polymer, an emulsion, a lipid, monosodium glutamate, sucrose, dextrose, aluminum bovine, human serum albumin, cytosine phosphoguanine, potassium phosphate, plasdone C, anhydrous lactose, cellulose, polacrilin potassium,glycerine, asparagine, citric acid, potassium phosphate magnesium sulfate, iron ammonium citrate, 2-phenoxyethanol, aluminium, beta-propiolactone, bovine extract, DOPC, EDTA, formaldehyde, thimerosal, phenol, potassium aluminum sulfate, potassium glutamate, sodium borate, sodium metabisulphite, urea, PLGA, PVA, PLA, PVP, cyclodextrin-based stabilisers, oil in water emulsion adjuvants and / or lipid-based adjuvants.
40. A vaccine according to claim 38 or 29, wherein the saRNA molecule is formulated with a suitable carrier, optionally an LNP or polyplex.
41. A saRNA molecule according to any one of claims 1-26, the nucleic acid sequence according to claim 29, the expression cassette according to claim 30, the vector according to claim 31, or the pharmaceutical composition according to claim 32, for use in stimulating an immune response in a subject.
42. A saRNA molecule according to any one of claims 1-26, the nucleic acid sequence according to claim 29, the expression cassette according to claim 30, the vector according to claim 31, or the pharmaceutical composition according to claim 32, for use in stem cell therapy.
Citation Information
Patent Citations
Modified nodavirus RNA for gene delivery
US7179457B2
Enhanced expression of RNA vectors
US20190060262A1
Adeno associated viral vector delivery of antibodies for the treatment of disease mediated by dysregulated plasma kallikrein
US20220186252A1
Compositions and methods for treating and / or preventing glycogen storage diseases
WO2022140703A1