Mopevac-based plateform for heterologous ORF(s) expression

Abstract

The invention relates to nucleic acid constructs which comprises a DNA molecule encoding a recombinant L or S segment of a Mopeia virus (MOPV), as well as an expression cassette or a vector comprising them, an eukaryotic cell comprising them, and a method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof, in a eukaryotic host cell, using in particular the nucleic acid constructs of the invention. The invention also relates to a composition comprising viral particles obtained from such a method, a viral particle obtained from such a method and a set of nucleic acid constructs or expression cassettes or vectors comprising them, wherein the set comprises at least one nucleic acid construct or expression cassette or vector comprising it, which encodes a recombinant L segment of a Mopeia virus (MOPV), and one nucleic acid construct or expression cassette or vector comprising it, which encodes a recombinant S segment of a Mopeia virus (MOPV) that encodes a MOPV nucleoprotein (NP) having attenuated exonuclease activity, wherein one or both nucleic acid constructs or expression cassettes or vectors comprise(s) a polynucleotide encoding a polypeptide or a protein that is heterologous to MOPV and the latter is different from a non-MOPV GPC when on the S segment, and wherein the positions where the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV is inserted in the said nucleic acid constructs or expression cassettes or vectors are peculiar.

Description

[0001] MOPEVAC-BASED PLATEFORM FOR HETEROLOGOUS ORF(S) EXPRESSION

[0002] The present invention pertains to the field of arenavirus-based platforms for expressing ORF(s) and genes, especially arenavirus-based vaccine platforms.

[0003] The invention relates to nucleic acid constructs and means comprising or using them. The invention also relates to a method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell while expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof. The invention also concerns therapeutic means and applications which derive from the use of the platform.

[0004] It is known from WO2017 / 068190 a so-called MOPEVACLASV vaccine based on a live attenuated Mopeia virus (MOPV), which is directed against the Lassa virus (LASV). WO2017 / 068190 therefore described a so-called MOPEVAC platform, enabling the provision of live attenuated MOPV where the attenuation is provided by mutations into the exonuclease domain of the nucleoprotein (NP) of the MOPV. Of note, the MOPEVACLASV vaccine is based on a chimeric construct: while the MOPEVACLASV vaccine is based on the Mopeia virus genome backbone, the glycoprotein precursor (GPC) of the Lassa virus replaces the GPC of MOPV in order to induce immunity against the Lassa pathogenic arenavirus (LASV). The MOPEVAC platform proved to be a versatile tool to generate recombinant live attenuated viruses expressing heterologous envelope glycoproteins of pathogenic arenaviruses using the genetic backbone of the Mopeia virus for which the exoribonuclease activity has been abrogated. This platform allowed the generation of vaccine candidates that protect animals in preclinical studies from lethal infection with the Old World arenavirus Lassa virus (Mateo M, Reynard S, Carnec X, et al. Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect macaques after a single shot. Sci Transl Med. 2019; 11 (512): 1 - 18) (Carnec X, Mateo M, Page A, et al. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Expressing Heterologous Glycoproteins. J Virol. 2018) or the New World arenaviruses Machupo and Guanarito (Reynard S, Carnec X, Picard C, et al. A MOPEVAC multivalent vaccine induces sterile protection against New World arenaviruses in non-human primates. Nat Microbiol. 2023), as also detailed in WO2023 / 175044. However, this platform is not tailored for the provision of something else than a live attenuated MOPV where the GPC of Lassa replaces the GPC of MOPV.

[0005] Therefore, the so-called MOPEVAC platform was not shown, to date, to be able to support the introduction of non-arenavirus encoding sequences, i.e., sequences encoding heterologous polypeptides or proteins, which are in particular foreign to arenaviruses for expression purposes, in the context of present description.

[0006] Furthermore, the genome of the Mopeia virus is of bi-segmented RNA nature. As a further question, it was unknown whether such a genome may be used for the expression altogether of a plurality of heterologous proteins from the same recombinant virus, especially non-arenavirus polypeptides or proteins.

[0007] Present invention arises from experiments devised to address this question.

[0008] Are described herein modifications to the MOPEVAC platform for the expression of heterologous ORFs, and the means, especially nucleic acid molecules, required to this end. The result is a novel MOPEVAC platform (so-called MOPEVAC NEXT in some of the illustrative Examples) enabling the expression of ORF(s) which are heterologous to arenaviruses. Consistent proof that the devised platform has very practical interest is provided by the description of the first application of the newly devised MOPEVAC vaccine platform of present invention, intended to protect against the Crimee-Congo Hemorrhagic Fever Virus (CCHFV), and the resulting live attenuated recombinant vaccines against the Crimee-Congo Hemorrhagic Fever virus obtained using the novel MOPEVAC platform of the present invention.

[0009] Arenavirus is a genus of virus that infects rodents and occasionally humans. At least eight arenaviruses are known to cause human disease. Arenaviruses are divided into at least two groups, the most representative groups being the Old World and the New World viruses. The differences between these groups are distinguished geographically and genetically. Arenaviruses are round, pleomorphic, and enveloped with a diameter of 60 to 300 nm. Although they are often miscategorized as negative sense viruses, they are in fact ambisense. This confusion stems from the fact that white sections of their genome are considered negative sense, and encode genes in the reverse direction, other sections encode genes in the opposite (forward / positive sense) direction. This complex gene expression structure is theorized to be the viruses primitive regulatory system, allowing the virus to control what proteins are synthesized when. The life cycle of the arenavirus is restricted to the cell cytoplasm. Virus particles, or virions, are pleomorphic because they vary in appearance but in many cases they are spherical in shape and covered with surface glycoprotein spikes.

[0010] Accordingly, Arenaviruses have a segmented RNA genome that consists of two single-stranded ambisense RNAs. The genomic RNA alone is not infectious and the viral replication machinery is required to initiate infection within a host cell. Genomic sense RNA packaged into the arenavirus virion is designated negative-sense RNA, and must first be copied into a positive-sense mRNA in order to produce viral protein. The two RNA segments are denoted Small (S) and Large (L), and code for four viral proteins in a unique ambisense coding strategy. Each RNA segment codes for two viral proteins in opposite orientation such that the negative-sense RNA genome serves as the template for transcription of a single mRNA and the positive-sense copy of the RNA genome templates a second mRNA. Specifically, the S-segment RNA encodes the viral nucleocapsid protein (NP) and the glycoprotein (GP), notably the glycoprotein precursor (GPC); and the L-segment RNA encodes the viral RNA-dependent RNA-polymerase (L) and a small RING- domain containing protein (Z). The separate coding sequences of the two viral proteins are divided by an intergenic region RNA sequence that is predicted to fold into a stable hairpin structure. The skilled person will appreciate that genomic sequences of the various arenaviruses, as well as of the proteins encoded by these viruses, are publicly available. They can be found e.g., on the web site of the Virus Sequence Database (VSD) established and maintained by the Center for Immunology and Pathology, National Institute of Health, Korea Centers for Disease Control and Prevention. As a result of the preceding, when reference is made a (RNA) virus in the present application, reference is equally (and implicitly) made to a clone of said (RNA) virus, such as a RNA, DNA or cDNA clone. As implemented herein, the invention relates to nucleic acid constructs comprising cDNA molecules encoding recombinant L or S segments of a Mopeia virus (MOPV herein), according to the features described hereafter. Common general definitions of the terms used are provided after three nucleic acid constructs are detailed. In this context, cDNA molecule means a DNA molecule synthesized or whose sequence originates from a single-stranded RNA. However, in the context of the invention, said cDNA molecule may also comprise non coding sequences in addition to its coding sequences, especially when those non coding sequences are necessary to ensure to possibility of an effective transcription of the coding sequences contained in the cDNA molecule. The nucleic acid constructs of the invention are in particular purified, if necessary isolated, cDNA molecules, obtained or obtainable by recombination of several polynucleotide segments as detailed herein, operatively linked or cloned together.

[0011] The invention relates to nucleic acid constructs, encoding L-segments or S-segments of a Mopeia virus (MOPV herein), as means equally useful for the purpose of producing viral particles while expressing heterologous polypeptides or proteins or fragments thereof using the platform system described herein, especially in a method as described herein. They accordingly have the same level of functionality to this end, participate equally to this end, and have similar constructions while differing by their relative disposition of their parts, due to the nature of the respective functions of the parts from which they are constituted. Furthermore, these nucleic acid constructs can also be used together, i.e., cooperatively, to the same end and for the purpose of expressing a plurality of heterologous polypeptides or proteins or fragments thereof.

[0012] According to a first aspect and when it comes to provision of a nucleic acid construct encoding a L-segment of a Mopeia virus (MOPV herein), the invention concerns a nucleic acid construct which comprises a DNA molecule encoding a recombinant L segment of a MOPV, wherein the DNA molecule comprises in the following order from its 5’ extremity to its 3’ extremity: a) a polynucleotide encoding a MOPV Lpolymerase (Lpol) Open Reading Frame (ORF), and b) a polynucleotide comprising an intergenic region (IGR) of a MOPV, and c) a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV, and d) a polynucleotide encoding a 2A self-cleaving peptide, optionally with a further polynucleotide linker sequence at the 5’ extremity of the polynucleotide encoding the 2A self-cleaving peptide, and e) a polynucleotide encoding a MOPV Z protein ORF, the polynucleotide of a) and the polynucleotide of e) being respectively flanked by polynucleotides consisting of non-coding sequences comprising regulatory elements for controlling the transcription of the coding sequences of the nucleic acid construct, and where the polynucleotides c), d) and e) are operatively linked for expression.

[0013] Such a nucleic acid construct therefore comprises a MOPV Lpol ORF and a MOPV Z protein ORF, the latter of which is in ambisense gene arrangement with respect to the Lpol ORF, as commonly found in L-segments RNA of MOPV. The at least one polypeptide or protein that is heterologous to a MOPV is placed between the intergenic region and the MOPV Z protein ORF, a position which has surprisingly been determined to be effective in the experiments described herein. Of note, the Z protein of arenaviruses is known to have multiple interactions with other factors in the bi-segmented genome of arenaviruses during, in particular, translation of the same, which means that effectiveness of this position could at least not be foreseen. The Z protein is small (about 100 residues) and adding a P2A sequence at the C-terminal extremity of the Z protein with a further linker adds 21 residues, which is comparatively large with respect to the initial size of the Z protein. Such a change could therefore have had an impact on the structure and function of the Z protein.

[0014] According to a particular embodiment, a nucleic acid construct of the invention does not comprise an “Internal Ribosome Entry Site” (IRES) sequence, notably in place of a P2A sequence as disclosed herein. An IRES is an RNA element that allows for translation initiation in a cap-independent manner, as part of the greater process of protein synthesis. A difference between IRES sequence and a P2A sequence is that an IRES sequence allows for the translation of downstream ORFs in a polycistronic mRNA, whereas an P2A sequence results in the production of two separate polypeptides from a single ORF. According to a particular embodiment, the c) part of the nucleic acid construct, i.e., the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV, is placed at the 5’ extremity of stop codon which may have been engineered to this end in the nucleic acid molecule sequence of the nucleic acid construct. According to a particular embodiment, this said stop codon is the stop codon of the MOPV Z protein ORF. Stop codons are well known in the art and field by the skilled person. By "placed at the 5’ extremity of a stop codon”, it can be understood that the position in 5’ is when “read in the genomic sense”, which is not necessarily the sense of the DNA molecule as linearly described as comprising in a specific order from its 5’ extremity to its 3’ extremity the items described above. In this respect, the “genomic” sense referred to above also corresponds to the manner the polypeptide or protein resulting from the corresponding polynucleotide is transcribed. By “placed at the 5’, when read in the genomic sense, extremity of’ it is alternatively meant “toward the 5’ end (or extremity, used as a synonym) of a nucleic acid molecule” and in particular “towards the 5’ end (or extremity, used as a synonym) of a nucleic acid molecule with respect to a considered position”, i.e., of a peculiar element of the said nucleic acid molecule, as recited. Conversely, by “placed at the 3’ extremity of“ or by “downstream” it is meant, according to conventional definitions used in the field, “toward the 3’ end (or extremity, used as a synonym) of a nucleic acid molecule”, and in particular “towards the 3’ end (or extremity, used as a synonym) of a nucleic acid molecule with respect to a considered position”. In the context of the present paragraph and similar paragraphs hereafter, it is to be understood that 5’ and 3’ ends of the nucleic acid molecules are, according to usual convention in the field, used herein and in the claims for a description of the nucleic acid constructs which are discussed, in particular to enable a description of the order of the sections constituting these nucleic acid constructs.

[0015] The expression “where the polynucleotides c), d) and e) are operatively linked for expression” conveys that the recited polypeptides and / or consequentially the DNA molecule in general, is(are) arranged so that the L-segment (or, mutatis mutandis, the S-Segment) of a Mopeia virus resulting from the corresponding polynucleotide can be transcribed.

[0016] It follows from the guidance provided herein (in particular from the description of the cloning strategy described in the Material and Methods section) and the constructions disclosed herein that the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV, can be, according to a particular embodiment, ultimately found placed between the last codon and the stop codon of the MOPV Z protein ORF. Since, per a cloning strategy that can be used in a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV is inserted within a cloning cassette that is inserted in the nucleic acid construct, between the last codon and the stop codon of the MOPV Z protein ORF, i.e., upstream of a stop codon when read in the genomic sense, it follows that in the ultimately resulting nucleic acid construct, the stop codon of MOPV Z protein ORF is found separated of the remainder of the MOPV Z protein ORF by the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV and the 2A self-cleaving peptide, possibly with a further polynucleotide linker sequence at the 5’, in particular when read in the genomic sense, extremity of the polynucleotide encoding the 2A self-cleaving peptide. In other words, according to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV of c) is just adjacent to (is found at the 5’ end of, in particular when read in the genomic sense) the stop codon of the MOPV Z protein ORF (the latter of which is in ambisense direction with respect to the MOPV Lpol ORF), and the polynucleotide encoding a MOPV Z protein ORF of e) has a sequence without its stop codon.

[0017] According to a second aspect, and when it comes to provision of a nucleic acid construct encoding a L-segment of a MOPV, the invention concerns a nucleic acid construct which comprises a DNA molecule encoding a recombinant L segment of a MOPV, wherein the DNA molecule comprises in the following order from its 5’ extremity to its 3’ extremity: a) a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV, and b) a polynucleotide encoding a 2A self-cleaving peptide, optionally with a further polynucleotide linker sequence at the 5’ extremity of the polynucleotide encoding the 2A self-cleaving peptide, and c) a polynucleotide encoding a MOPV Lpolymerase (Lpol) ORF, and d) a polynucleotide comprising an intergenic region (IGR) of MOPV, and e) a polynucleotide encoding a MOPV Z protein ORF, and the polynucleotide of a) and the polynucleotide of e) being respectively flanked by polynucleotides consisting of non-coding sequences comprising regulatory elements for controlling the transcription of the coding sequences of the nucleic acid construct, and where the polynucleotides a), b) and c) are operatively linked for expression.

[0018] Such a nucleic acid construct therefore comprises a MOPV Lpol ORF and a MOPV Z protein ORF, the latter of which is in ambisense gene arrangement with respect to the Lpol ORF, as commonly found in L-segments RNA of MOPV. The at least one polypeptide or protein that is heterologous to a MOPV is placed at the 5’ end of the nucleic acid construct as a whole, i.e., upstream the MOPV Lpol ORF, as a position determined to be effective in the experiments described herein.

[0019] According to a particular embodiment, the a) part of the nucleic acid construct, i.e., the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV, is placed downstream of a start codon which may have been engineered to this end in the nucleic acid molecule sequence of the nucleic acid construct. According to a particular embodiment, the start codon is the start codon of the MOPV Lpol ORF. Since, per a cloning strategy that can be used in a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV is inserted within a cloning cassette that is inserted in the nucleic acid construct, between the first and second codon of the Lpol ORF, it follows that in the ultimately resulting nucleic acid construct, the start codon of MOPV Lpol protein ORF is found separated of the remainder of the MOPV LPol protein ORF by the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV and the 2A self-cleaving peptide, possibly with a further polynucleotide linker sequence at the 5’, in particular when read in the genomic sense, extremity of the polynucleotide encoding the 2A self-cleaving peptide. In other words, according to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV of a) just follows (is found at the 3’ end of) the start codon of the MOPV LPol protein ORF (the Lpol protein ORF is in ambisense direction with respect to the MOPV Z ORF which is found at the 3’ extremity of the nucleic acid construct), and the polynucleotide encoding the MOPV Lpol protein ORF of c) has a sequence without its start codon. The polynucleotide encoding a 2A self-cleaving peptide, optionally with a further polynucleotide linker sequence of b) are at the 3’ end of the at least one polypeptide or protein that is heterologous to a MOPV and at the 5’ end of the remainder of the MOPV Lpol protein ORF (without its start codon). According to a third aspect, and when it comes to provision of a nucleic acid construct encoding a S-segment of a MOPV, the invention concerns a nucleic acid construct which comprises a DNA molecule encoding a recombinant S segment of a MOPV, wherein the DNA molecule comprises in the following order from its 5’ extremity to its 3’ extremity: a) a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV, and b) a polynucleotide encoding a 2A self-cleaving peptide, optionally with a further polynucleotide linker sequence at the 5’ extremity of the polynucleotide encoding the 2A self-cleaving peptide, and c) a polynucleotide encoding a MOPV nucleoprotein (NP) having attenuated exonuclease activity, and d) a polynucleotide comprising an intergenic region (IGR) of a MOPV, and e) a polynucleotide encoding a MOPV or a non-MOPV glycoprotein precursor (GPC), in particular a New World arenavirus GPC, and the polynucleotide of a) and the polynucleotide of e) being respectively flanked by polynucleotides consisting of non-coding sequences comprising regulatory elements for controlling the transcription of the coding sequences of the nucleic acid construct, and where the polynucleotides a), b) and c) are operatively linked for expression.

[0020] Such a nucleic acid construct therefore comprises a MOPV nucleoprotein (NP) ORF and a MOPV or a non-MOPV glycoprotein precursor (GPC), the latter of which is in ambisense gene arrangement with respect to the NP ORF, as commonly found in S-segments RNA of MOPV. The at least one polypeptide or protein that is heterologous to a MOPV is placed at the 5’ end of the nucleic acid molecule as a whole, i.e., upstream the MOPV NP ORF, as a position determined to be effective in the experiments described herein.

[0021] According to a particular embodiment, the a) part of the nucleic acid construct, i.e., the polynucleotide encoding the at least one polypeptide or protein that is heterologous to a MOPV, is placed downstream of a start codon which may have been engineered to this end in the nucleic acid molecule sequence of the nucleic acid construct. According to a particular embodiment, the start codon is the start codon of the sequence encoding the MOPV NP found in the nucleic acid sequence. Since, per a cloning strategy that can be used in a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV is inserted within a cloning cassette that is inserted in the nucleic acid construct, between the first and second codon of the NP ORF, it follows that in the ultimately resulting nucleic acid construct, the start codon of MOPV NP protein ORF is found separated of the remainder of the MOPV NP protein ORF by the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV and the 2A self-cleaving peptide, possibly with a further polynucleotide linker sequence at the 5’ extremity of the polynucleotide encoding the 2A self-cleaving peptide. In other words, according to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV of a) just follows (is found at the 3’ end of) the start codon of the MOPV NP protein ORF (the MOPV NP protein ORF is in ambisense direction with respect to the MOPV or non-MOPV GPC ORF which is found at the 3’ extremity of the nucleic acid construct), and the polynucleotide encoding the MOPV NP protein ORF of c) has a sequence without its start codon. The polynucleotide encoding a 2A self-cleaving peptide, optionally with a further polynucleotide linker sequence of b) are at the 3’ end of the at least one polypeptide or protein that is heterologous to a MOPV and at the 5’ end of the remainder of the MOPV NP protein ORF (without its start codon). According to a particular embodiment, when a non-MOPV GPC is found in part e) of the nucleic acid molecule, the non-MOPV GPC replaces the MOPC GPC naturally found in a MOPV. Furthermore, the non-MOPV GPC is not a “polypeptide or protein that is heterologous to a MOPV” in the sense of a “polypeptide or protein that is heterologous to a MOPV” as defined in part a) of the nucleic acid molecule. According to a particular embodiment a non-MOPV GPC glycoprotein precursor (GPC) is a GPC of an Old World arenavirus or the GPC of a New World arenavirus. Examples thereof are given in the present description.

[0022] Using a different syntax, it can be said with respect to the nucleic acid constructs described above, that items a) to e) are respectively numbered b) to f) (numbering can be adapted as relevant) and that the flanking polynucleotide regions are respectively: a) a 5’ non-coding sequence polypeptide comprising regulatory elements for controlling the transcription of the coding sequences of the nucleic acid construct, and g) a 3’ non-coding sequence polypeptide comprising regulatory elements for controlling the transcription of the coding sequences of the nucleic acid construct.

[0023] Of note, the 5’ and 3' non-coding sequence polypeptides comprise regulatory elements for controlling the transcription of the coding sequences of the nucleic acid construct, along with the IGR regions of d) above.

[0024] Furthermore, according to the above, when a cloning strategy using a cloning cassette is used for obtaining nucleic acid constructs of the present invention, the positions where a cloning cassette comprising the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV is inserted in the said nucleic acid constructs or expression cassettes or vectors, can be considered from the 5’ extremity to the 3’ extremity of a MOPV DNA segment to be: o in-between the MOPV Z protein ORF and its stop codon on a L segment of MOPV, or o in-between the start codon of the MOPV Lpol ORF and the rest of the MOPV Lpol ORF on a L segment of MOPV, or o in-between the start codon of the ORF of a MOPV nucleoprotein (NP) having attenuated exonuclease activity and the rest of the MOPV NP ORF on a S segment of MOPV.

[0025] The appended experimental section provides guidance regarding, precisely, the nucleotide positions that may be concerned by the insertions (which are nonetheless defined by the nature of the segments, as detailed herein).

[0026] It will now be described features which can apply to any one of nucleic acids constructs as described herein.

[0027] The expression “encoding” encompasses the ability of a DNA molecule of the invention to be transcribed as full length recombinant L or S Segments of MOPV comprising at least one polypeptide or protein that is heterologous to a MOPV, the said DNA or cDNA molecules serving especially as a template for transcription and where appropriate translation for product expression into cells or cell lines. Hence, when the DNA or the cDNA is a double stranded molecule, one of the strands serves this purpose. As explained later in the present description, use can be made of an expression cassette comprising promoters for transcription of full recombinant S or L segments of a Mopeia virus, whereas the viral ORFs, which are in ambisense orientation are expressed from the 5’ and 3’ non coding sequences of the nucleic acid constructs of the invention. The expression “encoding” is also applied to mean that the said DNA or cDNA molecules have the ability to give rise to peptides or polypeptides required for full length recombinant L or S Segments of MOPV comprising at least one polypeptide or protein that is heterologous to a MOPV, e.g., the MOPV Lpolymerase (Lpol) ORF, the at least one polypeptide or protein that is heterologous to a MOPV, the MOPV Z protein ORF, the MOPV nucleoprotein (NP) having attenuated exonuclease activity, and the MOPV or a non-MOPV glycoprotein precursor (GPC).

[0028] By “polynucleotides consisting of non-coding sequences comprising regulatory elements for controlling the transcription of the coding sequences of the nucleic acid construct”, which are found respectively at the 3’ and 5’ extremities of the nucleic acid construct, it is meant sequences which are conventionally known to enable the transcription and / or enable the control of the transcription of the coding sequences flanking them. Such regions are also known as “5’ flanking region” and “3’ flanking region” respectively. They are transcribed into RNA but not translated into a functional protein. Regulatory elements controlling the transcription of the coding sequences found in the flanking non-coding sequences are promoters and / or termination sequences for the transcription, and possibly enhancer and other cis-acting elements. Such elements are commonly known in the field. Such non-coding sequences conventionally have a size between 20 and 100 nucleotides. According to particular embodiments, they have a size of 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, or within any range between any one of these numbers taken as boundaries. In a specific embodiment, these regulatory elements are those of the plasmid nucleic acid construct used for embedding the coding sequences, such as the 5’ non coding sequence and 3’ non coding sequence of the pRF108 plasmid. Peculiar examples thereof are provided in the sequences described herein: SEQ ID NOs 25 and 26 described herein have been used as 5’ non coding and 3’ non coding sequences for a S Segment, respectively, and SEQ ID NOs 27 and 28 described herein have been used as 5’ non coding and 3’ non coding sequences for a L Segment, respectively. According to particular embodiments, 5’ non coding and 3’ non coding sequences can be sequences having at least 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 % identity with any one of SEQ ID NO: 26, 27, 28 or 29 taken as a reference sequence, to the proviso that the functionality of the regulatory elements of the reference sequence is kept. Identity percentages can be calculated according to the common knowledge of the skilled person in the field, or following the guidance provided later in present description. Software tools for carrying out identity percentage calculation are commonly known and readily accessible to the skilled person: they can in particular be freely accessible over the internet. The literature provides details regarding available tools. In particular, identity percentages can conventionally be calculated through local or global, sequence alignment algorithms and their available computerized implementations. In a particular embodiment, identity percentages are calculated over the entire length of the compared sequences. Local sequence alignment algorithms are designed to find the best matching subsequences between two sequences. An example of a local alignment algorithm is the Smith-Waterman Algorithm. Global alignments, which attempt to align every residue in every sequence, are most useful when the sequences in the query set are similar and of roughly equal size. A general global alignment technique is the Needleman-Wunsch algorithm. Computerized implementations of the algorithms used are generally associated with default parameters in the literature, which can be used for running on or the other of such algorithm(s). The skilled person can readily adapt the same taking into account its objective or the sequences comparison made. According to an aspect, which applies to any one of the nucleic acid constructs described in any embodiment disclosed herein, the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV (that is found within a nucleic acid construct of the invention) is operatively linked to the other elements of the nucleic acid construct, especially the elements recited in any of a) to e) (as relevant). The expression “operatively linked”, which can be substituted by the expression “operatively cloned”, refers to the functional cloning, or insertion, of a heterologous polynucleotide within a nucleic acid construct of the invention such that said polynucleotide and nucleic acid construct are effectively, or efficiently, transcribed and if appropriate translated, in particular in cells, cell line, host cell used as a part of a rescue system for the expression or production described herein.

[0029] Differently said with respect to this aspect, which applies to any one of the nucleic acid constructs described in any embodiment disclosed herein, the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV (that is found within a nucleic acid construct of the invention) can also be said to be placed “in frame” with respect to the different sections of the nucleic acid construct, to the proviso that the potentiality of being transcribed is present.

[0030] In a particular embodiment, it is placed in frame so that a single ORF is ultimately present in the nucleic acid construct.

[0031] The “at least one polypeptide or protein that is heterologous to a MOPV” encoded by the nucleic acid constructs of the invention is(are) the polypeptide or protein, whose expression is sought using the platform system of the invention. Accordingly, they correspond to nucleic acid sequences which are different from the nucleic acid sequences required for the system to be functional when used in a cell, even if the latter are, punctually, non-MOPV sequences (such as a non-MOPV GPC sequence).

[0032] The “at least one polypeptide or protein that is heterologous to a MOPV” encoded by the nucleic acid constructs of the invention therefore corresponds to at least one "heterologous nucleic acid" sequence which, according to a particular embodiment, does not originate from a MOPV arenavirus (i.e., is a non- MOPV nucleic acid molecule), and according to a more particular embodiment which does not originate from an arenavirus, in particular is not a GPC arenavirus sequence, and that is inserted e.g., cloned, into a genomic segment of a MOPV arenavirus where it does not naturally occur, for the purpose of being expressed in addition to the expression of the constitutive elements required for a MOPV-based platform to be functional.

[0033] According to a particular embodiment, the “heterologous” polypeptides or proteins expressed by the platform system of the invention are not mere tags aimed at detecting the presence or localizing a nucleic acid molecule or its sequence of interest within a cell, or are not mere reporter nucleic acid sequences, even reporter genes with a similar purpose, but correspond to “heterologous” polypeptides or proteins to be expressed by the platform of the invention while having a biological function in the area of animal or human medicine prophylaxis, diagnosis, theragnosis or therapy.

[0034] According to particular embodiments, the “heterologous” polypeptides or proteins expressed by the platform system of the invention are from arenaviruses or arenaviruses or even MOPV polypeptides or proteins, but in this case they are found (and expressed) in addition to the expression of the constitutive elements of platform system of the invention which are required for it to work.

[0035] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV has a size of at least 100 bp, in particular a size between 1000 bp and 2500 bp. According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV has a size of 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, or 2500 bp, or any size taken between any one of these boundaries according to all possible combinations thereof.

[0036] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV has a size of at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, or at least 2500 bp.

[0037] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV has a size of at most 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, or at most 1000 bp. Therefore, according to particular embodiments, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV has a size between 100 and 2500 bp, or 100 and 2000 bp, or 100 and 1500 bp, or 100 and 1000 bp, or 200 and 2500 bp, or 300 and 2500 bp, or 400 and 2500 bp, or 500 and 2500 bp. Other combinations are also similarly disclosed, based on the list of boundaries set in the paragraph just above the present one.

[0038] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV has a size of at least 1000 bp, in particular a size between 1000 bp and 2500 bp, or between 1100 bp and 2500 bp, or between 1200 bp and 2500 bp, or between 1300 bp and

[0039] 2500 bp, or between 1400 bp and 2500 bp, or between 1500 bp and 2500 bp, or between 1600 bp and

[0040] 2500 bp, or between 1700 bp and 2500 bp, or between 1800 bp and 2500 bp, or between 1900 bp and

[0041] 2500 bp, or between 2000 bp and 2500 bp, or between 2100 bp and 2500 bp, or between 2200 bp and

[0042] 2500 bp, or between 2300 bp and 2500 bp, or between 2400 bp and 2500 bp.

[0043] By encoding “at least one” polypeptide or protein, it is meant, according to particular embodiments, one, two, three, four or five polypeptides or proteins. Nevertheless, according to a particular embodiment reported above, while a plurality (several) heterologous polypeptides or proteins can be borne by the nucleic acid construct, they remain within a same reading frame, so that a single ORF is ultimately present in the nucleic acid construct (the nucleic acid sequence can be subsequently cleaved into several polypeptides or proteins, while a single ORF is present. A manner of determining whether a single ORF is present is the presence of a single start codon in the operatively linked sequence that is considered).

[0044] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV is a reporter gene. According to a particular embodiment, the said polynucleotide is a cellular ORF, in particular a human cellular ORF. According to a particular embodiment, the said polynucleotide encodes an antigenic determinant, or a fragment thereof, of a human or an animal pathogen, or which is derived from a human or an animal pathogen.

[0045] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV is neither a tag nor a reporter sequence or gene, similarly to what is stated in the preceding paragraphs, and has a size of at least 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, or at least 2500 bp, and / or a size of at most 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, or at most 1000 bp, or any size taken between any one of these boundaries according to all possible combinations thereof.

[0046] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV” encodes heterologous polypeptides or proteins to be expressed by the platform of the invention while having a biological function in the area of animal or human medicine prophylaxis, diagnosis, theragnosis or therapy - with the platform of the invention enabling the same - and has a size of at least 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, or 2500 bp, and / or a size of at most 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1 100, or 1000 bp, or any size taken between any one of these boundaries according to all possible combinations thereof. For instance, a GFP (or similar) reporter sequence, or a Cherry sequence or HA tags, are not elements having a biological function in the area of animal or human medicine prophylaxis, diagnosis, theragnosis or therapy. Biological function means that there is a purpose or interference in the context of animal, or human, medicine prophylaxis, diagnosis, theragnosis or therapy, which goes beyond the mere detection or localization of a molecule within a cell, but is purposeful to a patient body as a whole, or directly beneficial to patient health by interaction with the patient cellular or molecular machinery, in the context of animal or human, medicine prophylaxis, diagnosis, theragnosis or therapy.

[0047] According to a particular embodiment, combinable with any other embodiment described herein, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV is a cellular ORF, in particular a human cellular ORF, and / or encodes an antigenic determinant, or a fragment thereof, of a human or an animal pathogen, or which is derived from a human or an animal pathogen, and has a size of at least 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, or 2500 bp, and / or a size of at most 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, or 1000 bp, or any size taken between any one of these boundaries according to all possible combinations thereof.

[0048] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV encodes an antigenic determinant or a fragment thereof of a CCHFV as described in any embodiment described herein, especially in the Experimental Section, for example taken from the IBAR10200 strain (GenBank numbers NC_005302.1 (NC_005302.1 - SEQ ID NO: 50 - (Crimean-Congo hemorrhagic fever virus segment S, complete sequence and NC_005300.2 - SEQ ID NO: 51 - for the M segment (Crimean-Congo hemorrhagic fever virus segment M, complete sequence).

[0049] According to a particular embodiment, combinable with any embodiment disclosed herein, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV is codon- optimized for expression in a particular cellular type, such as codon-optimized to facilitate cellular expression in mammalian cells, especially human cells.

[0050] According to a particular embodiment, combinable with any embodiment disclosed herein, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV has at least 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 % identity with a reference sequence, to the proviso that the functionality of the reference sequence is kept. Identity percentages can be calculated according to the guidance provided earlier in the present description.

[0051] According to a particular embodiment, combinable with any embodiment disclosed herein, the reference sequence of the preceding paragraph is a corresponding non-optimized sequence.

[0052] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV encodes, as a codon-optimized sequence or not, the N ORF of CCHFV of the IBAR10200 strain (SEQ ID NO: 52) or the said N ORF that has been modified (Nmut: SEQ ID NO: 53) while keeping the functionality of the modified positions as described herein when optimized sequences are considered (switch to Alanine residues).

[0053] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV, as a codon-optimized sequence or not, encodes the GP38 sequence of the IBAR10200 strain as for example a fusion of polynucleotides corresponding to the residues 1-23 and 233-519 (included) of the ORF of the Crimean-Congo hemorrhagic fever virus segment M, as for example disclosed in SEQ ID NO: 50.

[0054] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV, as a codon-optimized sequence or not, encodes the Gn sequence of the IBAR10200 strain as for example a fusion of polynucleotides corresponding to the residues 1-23 and 506-843 (included) of the ORF of the Crimean-Congo hemorrhagic fever virus segment M disclosed in SEQ ID NO: 51.

[0055] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV, as a codon-optimized sequence or not, encodes the Gc sequence of the IBAR10200 strain as for example the polynucleotide corresponding to the residues 956-1684 (included) of SEQ ID NO: 51.

[0056] According to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV, as a codon-optimized sequence or not, encodes a sequence corresponding to a chimeric GcGn sequence of the IBAR10200 strain as for example a fusion of polynucleotides corresponding corresponding to the residues 1-23, 506-839 and 996-1684 (included) of SEQ ID NO: 51.

[0057] According to a particular embodiment applicable to any nucleic acid construct disclosed herein, when an heterologous sequence or in particular an heterologous ORF gene or an heterologous ORF whose expression is sought using the platform system of the invention is inserted in a nucleic acid construct as disclosed herein, it is cloned in frame with the any of the NP, Lpol, or Z sequences that are part of the considered nucleic acid construct.

[0058] According to a particular embodiment, the nucleic acid molecules described herein encode a full- length recombinant L segment or S segment of MOPV.

[0059] According to a particular embodiment, a N ORF or a Nmut ORF or a GP38 ORF of CCHFV, especially as described in any embodiment described above and herein, is comprised within a full-length S segment of MOPV.

[0060] According to a particular embodiment, a Gc, Gn or GcGn ORF of CCHFV, especially as described in any embodiment described above and herein, is comprised within a full-length L segment of MOPV.

[0061] The ORFs of MOPV Lpolymerase (Lpol) or MOPV Z protein are well known in the art. Reference is made is necessary to the content of WO2017 / 068190 or Mateo M, Reynard S, Carnec X, et al. Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect macaques after a single shot. Sci Transl Med. 2019;11 (512): 1 -18or (Carnec X, Mateo M, Page A, et al. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 or Reynard S, Carnec X, Picard C, et al. A MOPEVAC multivalent vaccine induces sterile protection against New World arenaviruses in non-human primates. Nat Microbiol. 2023, where they are documented. The skilled person can rely on such description as well as to annotated databases for a determination of their sequences. Examples are also provided herein, by references to specific sequences, which are part of present description. An exemplary reference sequence of MOPV is the sequence of Mopeia strain AN21366 (GenBank accession numbers JN561684.1 (S segment) and JN561685.1 (L segment)).

[0062] An intergenic region (IGR) is a stretch of nucleotides located between genes in the genomes of a species. The skilled person is also knowledgeable when it comes to intergenic regions (IGR), especially IGR regions of MOPV found in nucleic acid sequences encoding L and S segments of MOPV. Reference can be made to annotated databases in this respect, in particular to the reference sequence of MOPV is the sequence of Mopeia strain AN21366 (GenBank accession numbers JN561684.1 (S segment) and JN561685.1 (L segment)), as well as to the examples provided herein. In particular, SEQ ID NO: 29 provides an example of an intergenic region that can be used in a recombinant S Segment nucleic acid construct according to the invention, and SEQ ID NO: 30 provides an example of an intergenic region that can be used in a recombinant S Segment nucleic acid construct according to the invention. According to a particular embodiment, a polynucleotide comprising an intergenic region (IGR) of MOPV has, for a S segment nucleic acid construct, the sequence of SEQ ID NO: 29 or is a variant thereof having at least 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO: 29 taken as a reference sequence, in particular with a size which does not differ from the size of the reference sequence by more than 10%. According to a particular embodiment, a polynucleotide corresponding to, i.e., comprising, an intergenic region (IGR) of MOPV has, for a L segment nucleic acid construct, the sequence of SEQ ID NO: 29 or is a variant thereof having at least 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO: 30 taken as a reference sequence, in particular with a size which does not differ from the size of the reference sequence by more than 10%.

[0063] According to particular embodiments, variants of IGR described herein keep the functional properties of their reference sequence, which may be linked to the secondary structures of the same.

[0064] The skilled person is also knowledgeable when it comes to the sequence of a polynucleotide encoding a 2A self-cleaving peptide. Such sequences are well known in the art. 2A self-cleaving peptides, or 2A peptides, is a class of peptides of about 20 amino acids, generally having between 18 and 22 amino acids, which can induce ribosomal skipping during translation of a protein in a cell. Self-cleaving 2A peptides enable production of equimolar levels of multiple nucleic acid molecules from the same mRNA.

[0065] Exemplary sequences of common 2A peptides are provided below.

[0066] These peptides share a core sequence motif of DxExNPGP: in genetic engineering they can cleave a longer peptide into two shorter peptides. In some instances, the presence of an optional linker such as “GSG” (Gly-Ser-Gly) on the N-terminal (5' extremity) of a 2A peptide can be found, and this helps with efficiency.

[0067] Of note, are described herein the use of 2A self-cleaving peptides with or without such an optional linker such as “GSG”. According to a particular embodiment, the 2A self-cleaving peptides have a linker “GSG”. The nucleotide sequences corresponding to, i.e. comprising, the 2A peptide sequences may be codon optimized sequences. Accordingly, whether or not the nucleotide sequences corresponding to 2A peptide sequences are optimized sequence, they have the same peptide sequence. According to a particular embodiment, the nucleotide sequences corresponding to the 2A self-cleaving peptides are not optimized sequences. According to another particular embodiment, the nucleotide sequences corresponding to the 2A self-cleaving peptides are optimized sequences. According to a particular embodiment, the nucleotide sequences correspond to a P2A peptide.

[0068] Numerous examples of P2A sequences, optimized or not, are available in the literature. For example, one can cite the optimized sequences available under GenBank access numbers: MQ290132.1 , MQ290131.1 , MQ086759.1 , MP711669.1 , MP711668.1 , LP836003.1 , LP836002.1 , LP981116.1 , or LP981115.1 (SEQ ID NO: 31 to 33 herein). Theses sequences are 66 bp long, which includes the 9 bp of a so-called GSG linker and the 57 bp of the P2A sequence itself. Further examples are provided in the Examples section herein (see the provided construction sequences, as annotated). According to particular embodiments, the sequence of a polynucleotide encoding a 2A self-cleaving peptide is that of any one of SEQ ID NO: 31 to 33 without the “GSG” part, or a variant thereof having at least 95%, 96%, 97%, 98% or 99% identity with any one of SEQ ID NO: 31 to 33 taken as a reference sequence, in particular with a size which does not differ from the size of the reference sequence by more than 10%. According to particular embodiments, the sequence of a polynucleotide encoding a 2A self-cleaving peptide is as defined in any description provided herein, or a variant thereof having at least 95%, 96%, 97%, 98% or 99% identity with the said description provided herein taken as a reference sequence, in particular with a size which does not differ from the size of the reference sequence by more than 10%.

[0069] According to particular embodiments, variants of 2A peptide described herein keep the functional properties of their reference sequence, which may be linked to the secondary structures of the same.

[0070] The skilled person is also knowledgeable when it comes to the sequence of a polynucleotide linker sequence to be found at the 5’ extremity of a polynucleotide encoding the 2A self-cleaving peptide, an example of which is provided in the Examples section herein (see the provided construction sequences, as annotated). The length of such a sequence may be between 6 and 45 nucleotides, which corresponds to between 2 and 15 amino acids, known by the skilled person to have the functionality of a linker. Said functionality can be commonly appreciated by determining the cleavage efficiency of the 2A peptide just following the linker.

[0071] According to a particular embodiment, the length of the sequence is chosen among: 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44 and 45 nucleotides, which corresponds to an amino acid linker length of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14 and 15 amino-acids, respectively.

[0072] Most generally, the length of such a sequence is between 6 and 12 nucleotides, especially 9 nucleotides (corresponding to 3 amino acids). Such a 3 amino acids linker sequence generally has an amino acid sequence that is GSG, with a corresponding nucleotide sequence which takes into account nucleotide code degeneracy.

[0073] According to a particular embodiment, the selected linker has a sequence that is non immunogenic or has no immunogenic effect to an host that would have the same administered to him / her.

[0074] MOPV NP proteins having attenuated exonuclease activity and their corresponding nucleotide sequences are also well documented in the art. See for instance the descriptions of the same in WQ2017 / 068190 or WQ2023 / 175044, whose description are incorporated herein in their entirety. According to a particular embodiment where the nucleic acid construct encodes a MOPV nucleoprotein (NP) having attenuated exonuclease activity, the latter is encoded by a polynucleotide in which one or more mutations has(ve) been introduced with respect to the sequence of the wild-type MOPV NP, the latter of which result(s) in the partial or total loss of exonuclease activity of said NP.

[0075] By “nucleic acid encoding a MOPV nucleoprotein (NP) having attenuated exonuclease activity”, it is meant herein a nucleic acid molecule comprising the ORF for a nucleoprotein of the Mopeia virus wherein said ORF comprises codon mutation(s) with respect to the ORF of a wild-type Mopeia virus, in order to express a nucleoprotein that has attenuated exonuclease activity (also designated in the art as exoribonuclease activity). Mutations in the codons encompass mutations in at least two codons, in particular of 2, 3, 4, 5 or 6 codons wherein the mutation(s) collectively result in the impairment, especially the attenuation or the suppression of the exonuclease activity of the encoded mutated nucleoprotein with respect to the wild-type nucleoprotein of MOPV. Examples have been described in WO2017 / 068190 or WO2023 / 175044 which can be referred to herein in relation to the mutated amino acid residues of the wildtype nucleoprotein of a Mopeia virus and can be deduced from the substituting amino acid residues.

[0076] According to a particular embodiment, a “nucleoprotein (NP)” designates a nucleoprotein that is mutated with respect to the wild-type nucleoprotein of the MOPV strain AN21366 (GenBank accession number: AEO89356.1 ) by substitution of at least two, in particular substitution of 2, 3, 4, 5 or 6 amino acid residues wherein the mutation(s) collectively result in the impairment, especially the attenuation or the suppression, of the exonuclease activity of the wild-type nucleoprotein of MOPV (paralleling the disclosure of section “C. Attenuation of MOPV” of WO2017 / 068190). The intent is to obtain attenuated live MOPV able to replicate in a host to an extent that is sufficient for inducing an immune response but that is not sufficient for inducing a disease. Therefore, according to a particular embodiment of the present disclosure, a Mopeia virus (MOPV) is said to be attenuated through an impairment, especially an attenuation or a suppression, of the exonuclease activity of the wild-type nucleoprotein of MOPV, if its NP is mutated with respect to the wild-type NP of the MOPV strain AN21366 and the mutation(s) destabilize(s) and / or abolish(es) the exonuclease activity of the wild-type NP of the MOPV strain AN21366. In other words, the attenuation through mutation(s) of the MOPV used in the instant invention causes a loss of function of the NP of a MOPV when found in a virus, and said loss of function can readily be determined through an appropriate experimental set-up, according to thorough guidance known in the art and thus available to the skilled person, or provided in the literature, especially in WO2017 / 068190.

[0077] According to particular embodiments, a loss of function of the exonuclease activity of the NP with respect to the exonuclease activity of the NP of the MOPV strain AN21366 can reach an extent of (minus) 50%, 60%, 70%, 80%, 90% or 100% with respect to a reference value, as comparatively measured through an appropriate experimental set-up, for example a reporter gene assay such as disclosed in Example 6 of WO2017 / 068190 (and Figure 7 of WO2017 / 068190). According to such an exemplary reporter gene assay, the IFN-antagonist activity of tested NP mutants was measured. In a particular implementation of such an exemplary assay, cells transfected with a plasmid encoding an IRF-3-promoter driven luciferase and a plasmid encoding wild-type (wt) or mutant forms of NP can be infected with the Sendai virus (SeV), a strong inducer of IRF-3 and IFN responses. Then, the induction of the IFN-derived promoter by Sendai virus (SeV) can be assessed in transfected cells expressing different NP mutants. Figure 7B of WO2017 / 068190 demonstrate that in the context of WO2017 / 068190, NP-wt could block the induction of the luciferase expression in response to SeV. On the contrary, all the tested mutants of WO2017 / 068190, mutated in the so-called ExoN domain, were affected in their ability to reduce induction of the reporter gene expression. Accordingly, by comparing the extent of modulation of the observed signal (in the case of an assay as disclosed in Example 6 and Figure 7 of WO2017 / 068190, the signal can correspond to an absolute value or to a fold change in IRF3 induction, if necessary by reference to the induction observed for SeV), the skilled person can readily determine whether the loss of function of the exonuclease activity of the NP of a particular mutant, with respect to the exonuclease activity of the NP of the MOPV strain AN21366 reaches an extent of (minus) 50%, 60%, 70%, 80%, 90% or 100% as defined herein for assessing the presence of a loss of function of the exonuclease activity of the NP of a MOPV.

[0078] The suitability of the mutations leading to a loss of function mutations can therefore readily be determined by the skilled person. The domain responsible for the exonuclease activity of the wild-type NP of the MOPV strain AN21366 is located between residues 340 and 570 of GenBank accession number: AEO89356.1 (this entry, also reproduced under SEQ ID NO: 34 herein) describes the nucleoprotein itself: therefore, it can be used to identify the amino acids which are referred to in the present description, and corresponding amino acids can, as a result, readily be identified within a different sequence, starting from their first identification in sequence AEO89356.1. For example, accession JN561684.1 describes the complete CDS of the glycoprotein precursor (GPC) and nucleoprotein (NP) genes of the S segment of the Mopeia virus strain AN 21366-BNI segment S - a correspondence can also be made in corresponding nucleic acid sequences, starting from the positions in amino acid sequences). Any part of the domain located between residues 340 and 570 of GenBank accession number: AEO89356.1 can be mutated so as to destabilize and / or abolish the exonuclease activity of the wild-type NP of the MOPV strain AN21366, in particular with a loss of function of the exonuclease activity of the NP with respect to the exonuclease activity of the NP of the MOPV strain AN21366 can reach an extent of (minus) 50%, 60%, 70%, 80%, 90% or 100% with respect to a reference value, as described above.

[0079] According to a particular, specific, aspect, residues 390, 392, 393, 430, 467, 529 et 534 of the sequence found under GenBank accession number: AEO89356.1 , which are in the domain responsible for the exonuclease activity of the wild-type NP of the MOPV strain AN21366, are specifically known to be involved in the exonuclease activity (ExoN) of MOPV. Accordingly, such residues may be targeted by mutations, being understood that mutations of residue(s) around residues 390, 392, 393, 430, 467, 529 and 534 of SEQ ID NO: 34, and / or residue(s) between residues 340 and 570 of SEQ ID NO: 34 can also be suited as loss of function mutations, as defined herein (see remarks above regarding how to identify these residues in any sequence which may comprise them).

[0080] According to a particular embodiment, the amino acid positions D390 and G393 of the MOPV nucleoprotein are substituted to attenuate the exonuclease function of the nucleoprotein (NP) (see remarks above regarding how to identify these residues in any sequence which may comprise them. This applies to any amino acid number mentioned herein in the same context). In a specific embodiment, the amino acid substitutions are D390A and G393A (MOPV-ExoN in WO2017 / 068190). While the specific mutations recited above are identified by reference to the position of the amino acid residues in the sequence of the nucleoprotein of the Mopeia strain AN21366, the skilled person can readily define the corresponding polynucleotide sequences to be considered. The S segment of Mopeia strain AN21366 is disclosed under GenBank accession number JN561684.1 , and includes the MOPV nucleoprotein sequence AEO89356.1 ), and the L segment of Mopeia strain AN21366 is disclosed under GenBank accession number JN561685.1 - correspondence with the polypeptide sequence can readily be done using the annotated sequences of the databases.

[0081] If a different strain of Mopeia virus than Mopeia strain AN21366 is used according to the invention, the amino acid residues may easily be determined by alignment of the amino acid sequence with the NP sequence of the Mopeia strain AN21366.

[0082] According to other embodiments, which can be cumulated to the embodiment above, or according to any combinations of possible substitutions, at least one further amino acid substitution is added at a position selected from E392, H430, D467, H529, and D534 of the MOPV nucleoprotein of Mopeia strain AN21366. In specific embodiments, the further substitution is selected from E392A, H430A, D467A, H529A, and D534A or any combination thereof.

[0083] In some embodiments, the nucleoprotein comprises an amino acid substitution at amino acid position D390 or G393 with respect to the NP sequence of Mopeia strain AN21366. In some embodiments, the nucleoprotein comprises an amino acid substitution at amino acid position D390 or G393, and further comprises at least one amino acid substitution at a position selected from E392, H430, D467, H529, and D534 with respect to the NP sequence of Mopeia strain AN21366. In some embodiments, the nucleoprotein comprises amino acid substitutions at amino acid positions D390 and G393 with respect to the NP sequence of Mopeia strain AN21366. In some embodiments, the nucleoprotein comprises amino acid substitutions at amino acid positions D390 and G393, and further comprises at least one amino acid substitution at a position selected from E392, H430, D467, H529, and D534 with respect to the NP sequence of Mopeia strain AN21366.

[0084] In some embodiments, the nucleoprotein comprises a D390A or G393A amino acid substitution. In some embodiments, the nucleoprotein comprises D390A and G393A amino acid substitutions. In some embodiments, the nucleoprotein further comprises at least one amino acid substitution selected from E392A, H430A, D467A, H529A, and D534A. In some embodiments, it comprises amino acid substitution D390A, G393A, E392A, H430A, D467A, H529A, and D534A. A recombinant attenuated MOPV comprising amino acid substitutions at amino acid positions D390A, G393A, E392A, H430A, D467A, H529A, and D534A is named MOPV-ExoN enhanced in WO2017 / 068190, also referred to herein as the “ExoNko NP ORF” in the “MOPEVAC NP plasmid” of the Examples section - Figure 7 - where the six mutant residues responsible for the abrogation of the exonucleasic activity are in white font before a black background (or underlined per the description “For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described herein”).

[0085] However, it can be readily understood from the above that the skilled person can define different mutations for the same purpose of abrogating exonuclease function. According to a particular embodiment, the amino acid positions D390, H430 and D467 of the MOPV nucleoprotein of Mopeia strain AN21366 are substituted to attenuate the exonuclease function of the nucleoprotein (NP). In a specific embodiment, the amino acid substitutions are D390A, H430A and D467A. According to other embodiments, which can be cumulated to the embodiment previously described, or according to any combinations of possible substitutions, at least one further amino acid substitution is added at a position selected from E392, G393, H529, and D534 of the MOPV nucleoprotein of Mopeia strain AN21366. In specific embodiments, the further substitution is selected from E392A, G393A, H529A, and D534A or any combination thereof. In some embodiments, the nucleoprotein comprises a D390A, a H430A or a D467A amino acid substitution (1 substitution), in particular with respect to the sequence of Mopeia strain AN21366. In some embodiments, the nucleoprotein comprises a D390A, a H430A and a D467A amino acid substitutions (3 substitutions), in particular with respect to the sequence of Mopeia strain AN21366. In some embodiments, the nucleoprotein further comprises at least one amino acid substitution selected from E392A, G393A, H529A, and D534A, in particular with respect to the sequence of Mopeia strain AN21366. In some embodiments, it comprises amino acid substitution D390A, H430A, D467A, E392A, G393A, H529A, and D534A, in particular with respect to the sequence of Mopeia strain AN21366.

[0086] When substitution(s) is(are) present, they are defined above with respect to the Mopeia strain AN21366. According to particular embodiments, the remainder of the nucleic acid of the ORF which encodes the MOPV nucleoprotein (NP) having attenuated exonuclease activity, discussed in the previous paragraphs, has a sequence that is the sequence of the Mopeia strain AN21366 or a sequence that has at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with the corresponding (aligned) wild-type sequence of the MOPV, in particular with the corresponding sequence in the MOPV strain AN21366 (Genbank accession numbers JN561684.1 (which includes the MOPV nucleoprotein sequence AEO89356.1 ) and JN561685.1 , respectively. Identity percentages can be calculated according to the common knowledge of the skilled person in the field. If needed the following guidance is provided. Software tools for carrying out identity percentage calculation are commonly known and readily accessible to the skilled person: they can in particular be freely accessible over the internet. The literature provides details regarding available tools. In particular, identity percentages can conventionally be calculated through local or global, sequence alignment algorithms and their available computerized implementations. In a particular embodiment, identity percentages are calculated over the entire length of the compared sequences. Global alignments, which attempt to align every residue in every sequence, are most useful when the sequences in the query set are similar and of roughly equal size. Computerized implementations of the algorithms used are generally associated with default parameters in the literature, which can be used for running on or the other of such algorithm(s). The skilled person can readily adapt the same taking into account its objective or the sequences comparison made.

[0087] According to a particular embodiment, mutation(s) of a MOPV NP carried out for attenuation of a MOPV, still makes the mutated NP capable of supporting viral transcription and replication, in order to produce recombinant viruses (production step).

[0088] MOPV or a non-MOPV glycoprotein precursor (GPC) (including arenaviruses glycoprotein precursor (GPC) and their corresponding nucleotide sequences) are also well documented in the art. See for instance the descriptions of the same in WO2017 / 068190 or WO2023 / 175044, whose description are incorporated herein in their entirety.

[0089] According to a particular embodiment where the nucleic acid construct encodes a GPC, the GPC can be, non limitatively, from one of the following arenaviruses: Lassa virus (LASV) - Genbank access number AAA46286.1 (protein) from J04324.1 (S segment), Machupo virus (MACV) - see access number below), Sabia virus (SABV - see access number below), Chapare virus (CHAPV - see access number below), Junin virus (JUNV - see access number below), Guanarito virus (GTOV - see access number below), Lujo virus (see access number below), and Whitewater Arroyo virus (see access number below ) .

[0090] The skilled person will appreciate that genomic sequences of the various cited arenaviruses, as well as of the proteins encoded by these arenaviruses, are publicly available. They can be found, e.g., on the web site of the Virus Sequence Database (VSD) established and maintained by the Center for Immunology and Pathology, National Institute of Health, Korea Centers for Disease Control and Prevention.

[0091] Furthermore, and for example, the GPC (protein) sequences of:

[0092] Machupo virus (MACV) can be found under Genbank access number AAT40451.1 (protein) and Genbank access number AY619643 (S segment),

[0093] Sabia virus (SABV) can be found under Genbank access number YP_089665.1 (protein) and Genbank access number NC_006317 (S segment),

[0094] Chapare virus (CHAPV) can be found under Genbank access number YP_001816782.1 (protein) and Genbank access number NC_010562 (S segment),

[0095] Junin virus (JUNV) can be found under Genbank access number WAD86878.1 (protein) from OL774853.1 (S segment),

[0096] Guanarito virus (GTOV) can be found under Genbank access number AAN05423.1 (protein) and Genbank access number AY129247 (S segment),

[0097] Lujo virus can be found under GenBank access number YP_002929490.1 (protein) from NC_012776.1 (S segment), and

[0098] Whitewater Arroyo virus can be found under GenBank access number AAN09950.1 (protein) from AF485264.1 (S segment).

[0099] The corresponding nucleotide sequences can be readily inferred from the sequences above, if not available in public databases, if relevant taking into account genetic code degeneracy or codon optimization. Examples are also provided in the exemplary plasmid constructions of SEQ ID NO: 17 to 24 of the present description.

[0100] According to a particular embodiment, a nucleic acid construct of the invention encoding a recombinant L segment of a Mopeia virus (MOPV) has, in all sections that are not sections annotated as corresponding to a cloning cassette (for SEQ ID NO: 1 or SEQ ID NO: 2) or an heterologous ORF (SEQ ID NO: 15 or SEQ ID NO: 16) or to the pRF108 plasmid (all of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 15 or SEQ ID NO: 16) at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with any one of the corresponding sections of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 15 or SEQ ID NO: 16 (excluded sections apart). Such a nucleic acid construct further comprises a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV as defined herein.

[0101] According to a particular embodiment, a nucleic acid construct of the invention encoding a recombinant S segment of a Mopeia virus (MOPV) has, in all sections that are not sections annotated corresponding to a cloning cassette (for SEQ ID NO: 3 or any one of SEQ ID NO: 17 to 24) or an heterologous ORF (SEQ ID NO: 13 or SEQ ID NO: 14) or to the pRF108 plasmid (all of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24) at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with any one of the corresponding sections of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24 (excluded sections apart). Such a nucleic acid construct further comprises a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV as defined herein. The invention also relates to an expression cassette or a vector comprising a nucleic construct encoding a recombinant S or L segment of a Mopeia virus according to any embodiment as defined or disclosed herein, in particular a vector that is an expression vector, more particularly a vector that is a plasmid.

[0102] Generally, an expression cassette is a component of a nucleotide vector consisting of one or more ORF(s) or gene(s) and regulatory sequence(s) controlling its / their expression, to be expressed by a transfected cell. An expression cassette usually comprises a promoter sequence and at least one ORF or gene. It can comprise a 3’ untranslated region. According to a particular embodiment, the murine Pol I promoter and terminator (pPoll) may be used, within an expression cassette, to express the transcripts of the S and L segments described herein.

[0103] According to a particular embodiment, a nucleic construct of the invention is embedded in a pRF108 plasmid as an expression cassette (Flick R, Pettersson RF. Reverse genetics system for Uukuniemi virus (Bunyaviridae): RNA polymerase l-catalyzed expression of chimeric viral RNAs. J Virol. 2001 Feb;75(4):1643-55), which also contains the murine Pol I promoter and terminator (pPoll), and may be used to express the transcripts of the S and L segments of recombinant MOPV according to the invention.

[0104] According to a particular embodiment, an expression cassette or vector of the invention encoding a recombinant L segment of a Mopeia virus (MOPV) has, in all sections that are not sections annotated as corresponding to a cloning cassette (for SEQ ID NO: 1 or SEQ ID NO: 2) or an heterologous ORF (SEQ ID NO: 15 or SEQ ID NO: 16) at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with any one of the corresponding sections of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 15 or SEQ ID NO: 16 (excluded sections apart). Such a nucleic acid construct further comprises a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV as defined herein.

[0105] According to a particular embodiment, an expression cassette or vector of the invention encoding a recombinant S segment of a Mopeia virus (MOPV) has, in all sections that are not sections annotated corresponding to a cloning cassette (for SEQ ID NO: 3 or any one of SEQ ID NO: 17 to 24) or an heterologous ORF (SEQ ID NO: 13 or SEQ ID NO: 14) at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with any one of the corresponding sections of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24 (excluded sections apart). Such a nucleic acid construct further comprises a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV as defined herein.

[0106] The skilled person will be aware that other plasmids may be used for expression the recombinant viral segments of the present invention, for example plasmids where a nucleic construct encoding a recombinant S or L segment of a Mopeia virus is cloned between, for example, the promoter and the terminator of the T7 RNA polymerase enabling the production of the segments in the cytoplasm of the host cell) - see for example Albarino CG, Bergeron E, Erickson BR, Khristova ML, Rollin PE, Nichol ST. Efficient reverse genetics generation of infectious junin viruses differing in glycoprotein processing. J Virol. 2009 Jun;83(11 ):5606-14.

[0107] Of note, promoters for transcription of full recombinant S or L segments of a Mopeia virus may be found within the expression cassette, especially plasmid, whereas the viral ORFs, which are in ambisense orientation are expressed from the 5’ and 3’ non coding sequences of the nucleic acid constructs of the invention. According to such a scheme, the ambisense character of this final expression is independent from the promoters used for transcription of full recombinant S or L segments of a Mopeia virus, which may be present in the expression cassette, especially plasmid.

[0108] The invention also relates to an eukaryotic cell, in particular an eukaryotic host cell comprising the nucleic acid construct or expression cassette or vector according to any embodiment as defined or disclosed herein.

[0109] According to a particular embodiment, the cell or host cell is a VeroE6 cell. According to a particular embodiment, the cell or host cell is a VeroNP cell, i.e., a cell derived from a VeroE6 cell and stably expressing the wild-type (wt) Mopeia NP. According to a particular embodiment, the cell or host cell is the VERO-NP cell deposited under Accession number CNCM 1-6034 at the CNCM (Collection Nationale de Cultures de Microorganismes) on February, 2, 2024.

[0110] In order to express one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments, a reverse genetic system such as disclosed in the art (notably a system paralleling the disclosure of section “B. Reverse Genetic System for MOPV” of WO2017 / 068190) has to be used. Accordingly, in such a system a eukaryotic cell is used as a helper cell to express recombinant MOPV particles, while, according to the present invention, expressing heterologous sequences. In a reverse genetic system such eukaryotic cell is transformed, especially transfected, with a plurality of polynucleotides encompassing: a) a first plasmid that comprises a polynucleotide which is an expression cassette encoding a DNA molecule encoding a recombinant L segment of a MOPV (L segment expression cassette), b) a second plasmid that comprises a polynucleotide which is an expression cassette encoding a DNA molecule encoding a recombinant S segment of a MOPV (S segment expression cassette), c) an expression cassette for the L protein of the Mopeia virus wherein, in particular, said cassette is contained in a third plasmid, d) an expression cassette for the NP protein of the Lassa or Mopeia virus wherein, in particular, said cassette is contained in a fourth plasmid.

[0111] Accordingly, the invention also relates a method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof, in a eukaryotic host cell, wherein the method comprises the steps of: a) transfecting the eukaryotic host cell with the following: o a first plasmid that comprises a polynucleotide which is an expression cassette encoding a recombinant L segment of MOPV; o a second plasmid that comprises a polynucleotide which is an expression cassette encoding a recombinant S segment of MOPV; o an expression cassette for the Lpol protein of MOPV wherein in particular said cassette is contained in a third plasmid; and o an expression cassette for the NP protein of Lassa virus or MOPV wherein in particular said cassette is contained in a fourth plasmid; wherein the first plasmid and / or the second plasmid comprise(s) a nucleic acid construct as defined in any one of the embodiments in the present description, which comprises a polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV, and b) allowing ribonucleoproteins of recombinant MOPV to form, thereby enabling expression of an assembly of recombinant live attenuated viral particles while enabling expression of the at least one polypeptide(s) or protein(s) encoded by the polynucleotide(s) of the first plasmid and / or the second plasmid, and c) recovering the expressed polypeptide(s) or protein(s) and optionally recovering the recombinant live attenuated Mopeia viruses produced after step b).

[0112] Depending on the eukaryotic host cells used the formed recombinant live attenuated Mopeia virus may be recovered after budding from the cell membrane.

[0113] A peculiar protocol may be followed or used for guidance in order to carry out the method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof, in a eukaryotic host cell described herein. For example, reference is made to Carnec X, Baize S, Reynard S, Diancourt L, Caro V, Tordo N, Bouloy M. Lassa virus nucleoprotein mutants generated by reverse genetics induce a robust type I interferon response in human dendritic cells and macrophages. J Virol. 2011 Nov;85(22): 12093-7. Reference is also made to the material and methods section of the present application (“Rescue experiments and viral stock preparation” section).

[0114] According to a particular embodiment, and as an example of a first plasmid that comprises a polynucleotide which is an expression cassette encoding a recombinant L segment of MOPV, such a polynucleotide can encompass a nucleic acid sequence which has, in all sections that are not sections annotated as corresponding to a cloning cassette (for SEQ ID NO: 1 or SEQ ID NO: 2) or an heterologous ORF (SEQ ID NO: 15 or SEQ ID NO: 16) or to the pRF108 plasmid (all of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 15 or SEQ ID NO: 16) at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with any one of the corresponding sections of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 15 or SEQ ID NO: 16 (excluded sections apart). Such a nucleic acid construct further comprises a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV as defined herein. Such a polynucleotide can also encompass with at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity the sections annotated as pertaining to the pRF108 plasmid of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 15 or SEQ ID NO: 16.

[0115] According to a particular embodiment, a first plasmid in the context of the method described above has the sequence of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 15 or SEQ ID NO: 16 in all parts that do not correspond to the heterologous ORF of said sequences, and further comprises polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV as defined herein.

[0116] According to a particular embodiment, and as an example of a second plasmid that comprises a polynucleotide which is an expression cassette encoding a DNA molecule encoding a recombinant S segment of a MOPV (S segment expression cassette), such a polynucleotide can encompass a nucleic acid sequence which has, in all sections that are not sections annotated corresponding to a cloning cassette (for SEQ ID NO: 3 or any one of SEQ ID NO: 17 to 24) or an heterologous ORF (SEQ ID NO: 13 or SEQ ID NO: 14) or to the pRF108 plasmid (all of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO:

[0117] 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24) at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with any one of the corresponding sections of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO:

[0118] 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24 (excluded sections apart). Such a nucleic acid construct further comprises a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV as defined herein. Such a polynucleotide can also encompass with at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity the sections annotated as pertaining to the pRF108 plasmid of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24.

[0119] According to a particular embodiment, a first plasmid in the context of the method described above has the sequence of SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24 in all parts that do not correspond to the heterologous ORF of said sequences, and further comprises polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV as defined herein.

[0120] According to a particular embodiment, and as an example of a third plasmid, an expression cassette for the L protein of the Mopeia virus can be a relevant part of SEQ ID NO: 4 or be a plasmid as provided under SEQ ID NO: 4 herein.

[0121] According to a particular embodiment, and as an example of a fourth plasmid, an expression cassette for the NP protein of MOPV can be a relevant part of SEQ ID NO: 5 or be a plasmid as provided under SEQ ID NO: 5 herein.

[0122] In some embodiments, the supernatant of the eukaryotic cells expressing the recombinant live attenuated Mopeia virus is used in an additional step of amplification by adding the supernatant to VeroE6 (or VeroNP) cells.

[0123] In a particular embodiment, the first, second, and when used, the third and fourth polynucleotides are DNA or cDNA.

[0124] In a particular embodiment, the expression cassette for the NP protein of the Lassa or Mopeia virus is contained in a fourth plasmid, and contains a non-mutated NP protein, i.e., a wild-type NP protein from Lassa or Mopeia virus. Although not mandatory, this may favor the rescue. Of note, in this case the expression of the wild-type NP protein is strictly limited to the said fourth plasmid.

[0125] In another particular embodiment, the expression cassette for the NP protein of the Lassa or Mopeia virus in particular as contained in a fourth plasmid, contains a NP protein which is mutated by amino acid residue substitution(s) in the wild-type NP of the Lassa or Mopeia virus to have attenuated exonuclease activity.

[0126] According to a particular embodiment of the method described herein, the first plasmid comprises a nucleic acid construct as defined in any one of the embodiments in the present description, which comprises a nucleic acid molecule encoding a recombinant L segment of a Mopeia virus (MOPV). It is to be understood that according to a particular embodiment, only one of the nucleic acid constructs described above is be used in a such a method, either in the first plasmid of step a) of the method above, or in the second plasmid of step b) of the method above.

[0127] According to a more particular embodiment, when the only one nucleic acid construct described above used is the nucleic acid construct is in the recombinant L segment of the first plasmid, then according to a particular embodiment the second plasmid used in the method comprises a nucleic acid construct comprising a polynucleotide encoding a MOPV nucleoprotein (NP) having attenuated exonuclease activity, in particular comprises the ORF of a nucleoprotein (NP) protein which is mutated by amino acid residue substitution(s) in the wild-type NP of the Mopeia virus to have attenuated exonuclease activity. Examples of the same are provided herein. Similarly, the second plasmid used in the method can then also comprise a polynucleotide encoding a MOPV or a non-MOPV glycoprotein precursor (GPC), in particular an Old World or New World arenavirus GPC. Examples of the same are provided herein.

[0128] According to a particular embodiment of the method described herein, the second plasmid comprises a nucleic acid construct as defined in any one of the embodiments description in the present description, which comprises a nucleic acid molecule encoding a recombinant S segment of a Mopeia virus (MOPV), in particular a nucleic acid molecule encoding a recombinant chimeric S segment of a Mopeia virus (MOPV) that is deleted for the ORF of the glycoprotein precursor (GPC) of the Mopeia virus and comprises the ORF of the GPC protein of an Old World or a New World arenavirus selected among: Lassa virus (LASV), Lujo virus (LUJV), Machupo virus (MACV), Sabia virus (SABV), Chapare virus (CHAPV), Junin virus (JUNV), Guanarito virus (GTOV) or Whitewater Arroyo virus. Examples are provided herein. Then, the first plasmid used can be based on a nucleic acid construct of the invention as disclosed herein or not.

[0129] According to another embodiment, two of the nucleic acid constructs of the invention as described in any embodiment herein can be used in a such a method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell while expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof, i.e., one nucleic acid construct for the recombinant L segment and one nucleic acid construct for the recombinant S segment.

[0130] When each of the first plasmid and the second plasmid comprise a nucleic acid construct comprising a polynucleotide encoding at least one a polypeptide or protein that is heterologous to MOPV, it allows for the expression of at least two heterologous ORFs from a single recombinant virus, because of the bi-segmented nature of the MOPV genome and the finding that both the S and le L segments of MOPV can carry “foreign” sequences, as described herein.

[0131] For implementation of the method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell while expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof of the invention, the skilled person can appreciate that, generally, nucleic acid constructs of the invention can be found in an expression cassette or a vector comprising a nucleic construct according to any embodiment as defined or disclosed herein, in particular a vector that is an expression vector, more particularly a vector that is a plasmid, enabling the use of the described nucleic constructs in a method such as discussed in the above paragraphs. The skilled person can readily prepare the same based on his / her knowledge, the information present in the art, notably in the patent applications and literature documents relied upon in the present description, and the experimental section disclosed herein for guidance if further needed.

[0132] For instance, an expression cassette, contains in addition to ORFs, expression control sequences including a promoter and a terminator suitable for expression of the nucleic acid in a host cell.

[0133] When cloned in a plasmid, nucleic acid constructs of the invention can also make use of the control sequences of the plasmid, such as a promoter and / or a terminator suitable for expression of the nucleic acid in a host cell. An extra non templated-G base can be included at the beginning of the cloned sequence, i.e., the heterologous nucleic acid, for a correct transcription and replication of the viral segments drived by the plasmid (see for instance, the Material and Methods section “Plasmids” of WO2017 / 068190, and / or the Material and methods section of Carnec X, Mateo M, Page A, Reynard S, Hortion J, Picard C, Yekwa E, Barrot L, Barron S, Vallve A, Raoul H, Carbonnelle C, Ferron F, Baize S. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 May 29;92(12):e02230-17; Zivcec M, Scholte FE, Spiropoulou CF, Spengler JR, Bergeron E. Molecular Insights into Crimean-Congo Hemorrhagic Fever Virus. Viruses. 2016 Apr 21 ;8(4):106).

[0134] Therefore, according to a particular embodiment, the polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV that is found in any one of the nucleic acid constructs described herein, has an extra non templated-G base at its 5’ end.

[0135] In some embodiments, for the implementation of the method described above according to the invention by reverse genetic system, the polynucleotides encoding the L and S segment of the genome of the MOPV strain AN21366 (GenBank accession numbers JN561684.1 and JN561685.1 ) are used as templates for the constructs required for production by reverse genetics, for each concerned L or S segment.

[0136] In a particular embodiment, in the context of the above method of production, the MOPV strain encoding the antigenomic transcript for the L and the S segments to provide the first, the second, and optionally the third and the fourth polynucleotides, is the MOPV strain AN21366 (GenBank accession numbers JN561684.1 and JN561685.1 ).

[0137] For the purpose of preparing rescued recombinant live attenuated Mopeia virus, the first, second, and when used herein the third and fourth polynucleotides comprise transcription and expression control of sequences such as promoter and terminator sequences.

[0138] Basically, for implementation of the method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell while expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof of the invention, and according to an embodiment, the complete transcription of viral segments to provide the sequences of polynucleotides comprising respectively the L and S sequences of the MOPV is obtained starting from viral RNA extracts and the obtained cDNA is then cloned into a plasmid that drives the correct transcription under the control of the murine RNA polymerase I - see Examples and references to WO2017 / 068190 or WO2023 / 175044 and Mateo M, Reynard S, Carnec X, et al. Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect macaques after a single shot. Sci Transl Med. 2019; 11 (512): 1 -18; Carnec X, Mateo M, Page A, et al. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 and Reynard S, Carnec X, Picard C, et al. A MOPEVAC multivalent vaccine induces sterile protection against New World arenaviruses in nonhuman primates. Nat Microbiol. 2023, which all describe such steps. For both correct transcription and replication of the viral segments, an extra non templated-G base, may be included at the beginning of the cloned sequences (Carnec X, Baize S, Reynard S, Diancourt L, Caro V, Tordo N, Bouloy M. Lassa virus nucleoprotein mutants generated by reverse genetics induce a robust type I interferon response in human dendritic cells and macrophages. J Virol. 2011 Nov;85(22):12093-7).

[0139] In an embodiment, each of the first, the second, and when used the third and fourth polynucleotides is provided on a plasmid suitable for transfection of the eukaryotic host cell used. All plasmids may be sequenced and where necessary corrected by site directed mutagenesis. pRF108 plasmids (Flick R, Pettersson RF. Reverse genetics system for Uukuniemi virus (Bunyaviridae): RNA polymerase l-catalyzed expression of chimeric viral RNAs. J Virol. 2001 Feb;75(4): 1643-55) containing the murine Pol I promoter and terminator (pPoll) may be used to express the transcripts of the S and L segments of the recombinant MOPV.

[0140] In a particular embodiment, the third and the fourth polynucleotides are cloned each on a pTM1 plasmid (Elroy-Stein O, Fuerst TR, Moss B. Cap-independent translation of mRNA conferred by encephalomyocarditis virus 5' sequence improves the performance of the vaccinia virus / bacteriophage T7 hybrid expression system. Proc Natl Acad Sci U S A. 1989 Aug;86(16):6126-30), similarly to what is disclosed in Carnec X, Mateo M, Page A, Reynard S, Hortion J, Picard C, Yekwa E, Barrot L, Barron S, Vallve A, Raoul H, Carbonnelle C, Ferron F, Baize S. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 May 29;92(12):e02230-17, describing the reverse genetics of the Mopeia virus.

[0141] In order to enable their transcription and expression in the recombinant eukaryotic cell, the third and fourth polynucleotides comprise transcription regulatory sequences suitable to enable expression of the polypeptides that they respectively encode. In a particular embodiment, the transcription regulatory sequences for the third and fourth polynucleotide comprise a T7 promoter and terminator.

[0142] In a particular embodiment, the eukaryotic cells used for the rescue of the recombinant live attenuated Mopeia virus express the T7 RNA polymerase. When used, such third and fourth plasmids may require expression of T7 RNA polymerase to transcribe the NP and Lpol genes coded by the sequences contained in these plasmids.

[0143] Examples of third and fourth plasmids are provided in the Experimental section of the present application, as well as a protocol for a method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof, in a eukaryotic host cell. Annotated versions of exemplary and particular sequences of use for implementing the invention are therefore documented herein.

[0144] In another particular embodiment, the eukaryotic cells transformed with the first, second, and optionally third and optionally fourth polynucleotides are further capable of expressing a RNA polymerase such as the T7 RNA polymerase. In particular, the eukaryotic cells used for the rescue of the recombinant live attenuated Mopeia virus constitutively express the T7 RNA polymerase of T7 bacteriophage.

[0145] In some embodiments, the eukaryotic cells of interest for rescuing the recombinant live attenuated MOPV are BHKT7 / 9 cells (cell line that expresses the T7 RNA polymerase). These cells are maintained in culture as described in Carnec X, Baize S, Reynard S, Diancourt L, Caro V, Tordo N, Bouloy M. Lassa virus nucleoprotein mutants generated by reverse genetics induce a robust type I interferon response in human dendritic cells and macrophages. J Virol. 2011 Nov;85(22):12093-7.

[0146] In some embodiments, the plasmids encoding the first, second, third and fourth polynucleotides are transfected in the host eukaryotic cells with a 1 :1 :1 :1 ratio.

[0147] In a particular embodiment of the method, an amplification step is carried out after production of the virus in the host cells. Vero cells may be used to enable amplification and recovery of virus stock. In particular, Vero cells are grown in Glutamax Dulbecco Modified Eagle's Medium (DMEM - Life Technologies) supplemented with 5% FCS and 0.5% Penicillin-Streptomycin.

[0148] Since both a first plasmid and a second plasmid comprising a nucleic acid construct comprising a polynucleotide encoding at least one a polypeptide or protein that is heterologous to MOPV of the invention are to be used within a method of production as described herein, the invention also relates a set of nucleic acid constructs or expression cassettes or vectors comprising them, wherein the set comprises at least: i. one nucleic acid construct or expression cassette or vector comprising it, which encodes a recombinant L segment of a Mopeia virus (MOPV), and ii. one nucleic acid construct or expression cassette or vector comprising it, which encodes a recombinant S segment of a Mopeia virus (MOPV) that encodes a MOPV nucleoprotein (NP) having attenuated exonuclease activity, wherein one or both nucleic acid constructs or expression cassettes or vectors comprise(s) a polynucleotide encoding a polypeptide or a protein that is heterologous to MOPV and the latter is different from a non- MOPV GPC when on the S segment, and wherein the positions where a cloning cassette comprising the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV is inserted in the said nucleic acid constructs or expression cassettes or vectors are, considered from the 5’ extremity to the 3’ extremity of a MOPV DNA segment: o in-between the MOPV Z protein ORF and its stop codon on a L segment of MOPV, or o in-between the start codon of the MOPV Lpol ORF and the rest of the MOPV Lpol ORF on a L segment of MOPV, or o in-between the start codon of the ORF of a MOPV nucleoprotein (NP) having attenuated exonuclease activity and the rest of the MOPV NP ORF on a S segment of MOPV.

[0149] According to a particular embodiment of the set, the nucleic acid construct or expression cassette or vector comprising it of i. and / or ii. of the set is as defined in any one of the embodiments for nucleic acid construct or expression cassette or vector described in the present application.

[0150] In particular, a cloning cassette further comprises a polynucleotide encoding a 2A self-cleaving peptide, optionally with a further polynucleotide linker sequence at the 5’ extremity of the polynucleotide encoding the 2A self-cleaving peptide in particular when the latter is read in the genomic sense. The “genomic” sense also corresponds to the manner the polypeptide or protein resulting from the corresponding polynucleotide is transcribed. Indeed, for example when C-terminal heterologous ORF cloning is carried out in a MOPV L Segment, a cloning cassette is introduced in C-terminal position in the Z ORF (see Figure 1B). However, the Z ORF is in antigenomic orientation in the polynucleotide sequence encoding such a Segment, with respect to the Lpol sequence. Nevertheless, a linker sequence will always be found at the 5’ extremity of the polynucleotide encoding the 2A self-cleaving peptide adjacent to the Z ORF, in particular when the cloning cassette is read in the genomic sense. As a result, the relative positions of the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV with respect to the other parts of the said nucleic acid constructs or expression cassettes or vectors are, considered from the 5’ extremity to the 3’ extremity of a MOPV DNA segment: o between the MOPV Lpol protein and the MOPV Z protein on a L segment of MOPV, i.e., between the 5' extremity of the MOPV Lpol protein and the 3’ extremity of the MOPV Z protein on a L segment of MOPV, or o before the MOPV Lpol protein, i.e., at the 5’ extremity of the MOPV Lpol protein on a L segment of MOPV, or o before the MOPV nucleoprotein (NP) having attenuated exonuclease activity, i.e., at the 5’ extremity of the MOPV NP having attenuated exonuclease activity on a S segment of MOPV.

[0151] In particular embodiments, the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV is within a nucleic acid construct comprising the polynucleotides of a) to e) (numbering to be adapted if relevant, per the disclosure found elsewhere in the present text) and further non-coding sequences as defined, in particular with their relative positions between each other, in any embodiment disclosed in the present description.

[0152] According to a particular embodiment, the set comprises vectors that are plasmids and further comprises a third and / or a fourth plasmid(s) as disclosed in any embodiment described herein.

[0153] The invention accordingly also relates to the use of a set of nucleic acid constructs or expression cassettes or vectors (including plasmids) comprising them as defined in any one of the embodiments for nucleic acid construct or expression cassette or vector described in the present application, for in vitro or ex vivo expressing one or more proteins that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof in a eukaryotic host cell and / or in vitro or ex vivo producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell, especially though a method according to any embodiment as disclosed herein.

[0154] The invention accordingly also relates to the use of a set of nucleic acid constructs or expression cassettes or vectors (including plasmids) comprising them as defined in any embodiment disclosed herein, in a method for expressing one or more proteins that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof in a eukaryotic host cell and / or in vitro or ex vivo producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell, according to any embodiment as disclosed herein.

[0155] It is understood that such methods or uses, for expressing one or more proteins that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof in a eukaryotic host cell and / or in vitro or ex vivo producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell, are intended to be carried out in vitro or ex vivo, and do not encompass any method for treatment of the human or animal body by surgery or therapy practiced on the human or animal body.

[0156] Accordingly, a method or use of the invention, for expressing one or more proteins that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or in vitro or ex vivo producing recombinant live attenuated Mopeia virus (MOPV), which is carried out in a eukaryotic host cell, can be said to be carried out in cultures of such eukaryotic host cells, i.e., not on the human or animal body, and they do not encompass any step of surgical nature, as otherwise apparent from the experimental section.

[0157] Back to the method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell while expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof of the invention, and according to a particular embodiment, the host cell used in the method is a cell stably expressing the wild-type version of the NP of MOPV or Lassa virus, in particular a VeroE6 cell stably expressing the wild-type version of the NP of MOPV or Lassa virus (such as a VeroNP cell, including from the deposited cell line described herein).

[0158] The experimental section describes the principle of the use of a “helper” VeroE6 cell line specifically engineered to enhance, as a matter of optimization, viral production.

[0159] The engineered VeroE6 derived cell line has been deposited under the name VERO-NP (Identification reference) and the Accession number CNCM 1-6034 at the CNCM (Collection Nationale de Cultures de Microorganismes) on February, 2, 2024. Throughout the present application, CNCM stands for Collection Nationale de Cultures de Microorganismes (Institut Pasteur, 25 rue du Docteur Roux, F-75724 Paris Cedex 15, France). The address of CNCM is: Collection Nationale de Culture de Microorganismes, Institut Pasteur, 28 rue du Dr Roux, 75724 Paris CEDEX 15, France.

[0160] The VERO-NP cell line is a genetically modified cell line. VERO cells are Cercopithecus aethiops epithelial kidney cells. Vero cells have been transduced with a VSV-G pseudotyped lentivirus (pLV-NP-ires- Hygro) as disclosed in the Examples in order to stably express a bicistronic mRNA encoding the NP (nucleoprotein) of Mopeia virus and an hygromycin resistance gene. VERO-NP is also written “VeroNP” in the present description.

[0161] According to another aspect, the invention also relates to the VERO-NP cell line deposited at the CNCM (Collection Nationale de Cultures de Microorganismes) on February, 2, 2024 under Accession number CNCM I-6034, or a variant cell line derived from the VERO-NP cell line deposited at the CNCM (Collection Nationale de Cultures de Microorganismes) on February, 2, 2024 under Accession number CNCM I-6034, which keeps the properties of the parent cell line, notably the property of expressing the NP (nucleoprotein) of Mopeia virus, i.e., of wild-type Mopeia virus. According to a particular embodiment, such a variant cell line has a genome whose nucleic acid sequence does not differ by more than 5% identity percentage with respect to the genomic nucleic acid sequence of the VERO-NP cell line.

[0162] The invention also relates to a cell pertaining to said I-6034 cell line, or a variant thereof as defined herein.

[0163] Nevertheless, it can be appreciated that the skilled person can readily, for the purpose of carrying out a method of production of the invention implementing the use of a cell line stably expressing the wildtype version of the NP of MOPV or Lassa virus, use another host cell with this capacity. A cell line can be prepared by retroviral integration into the cell genome or different preparation methods, such as integration via CRISP / CAS9 knock-in. Kits are readily available in this respect.

[0164] The capacity of a cell line to stably express the wild-type version of the NP of MOPV or Lassa virus can be readily assessed by the skilled person by assays well known in the art. For instance, verifying the expression of a gene integrated to a cell line can be made through diverse methods, one of which being the detection by immunofluorescence of the presence of the desired NP protein in cells once produced. The literature and even present application provide guidance in this respect of needed.

[0165] It also disclosed herein the use of the VERO-NP cell line deposited at the CNCM (Collection Nationale de Cultures de Microorganismes) on February, 2, 2024 under Accession number CNCM I-6034, or a variant cell line as defined herein, in a method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell while expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof, as defined in any embodiment described throughout the present description.

[0166] The sequence of the S segment of Lassa virus (Josiah strain) is readily accessible under Genbank number J04324.1 (protein). The sequence of the nucleoprotein of Lassa virus is accessible under Genank number AAA46285.1 (protein) (Auperin DD, McCormick JB. Nucleotide sequence of the Lassa virus (Josiah strain) S genome RNA and amino acid sequence comparison of the N and GPC proteins to other arenaviruses. Virology. 1989 Feb;168(2):421-5). The corresponding nucleotide sequence is readily derivable, taken into account nucleotide code degeneracy, if needed.

[0167] The invention also relates to a recombinant live attenuated Mopeia virus (MOPV), in particular embedding, e.g., internally, or displaying, e.g., at its surface, one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof, the recombinant live attenuated Mopeia virus (MOPV) being obtainable or obtained from the method described in above paragraphs, above. The invention also relates to a cell comprising such recombinant live attenuated Mopeia viruses (MOPV).

[0168] The invention also relates to a composition comprising viral particles obtained from the method of the invention, in particular an immunogenic or vaccine composition. Such a composition can comprise any one of: pharmaceutically acceptable carrier(s), delivery vehicle(s), excipient(s), preservative(s), or any combination thereof.

[0169] As defined herein, a “pharmaceutically acceptable carrier(s), delivery vehicle(s), excipient(s)” or “preservative(s)” encompass any substance that enables the formulation of a pharmaceutical composition, in particular an immunogenic or vaccine composition, which makes it suited for administration to a human host and / or proper handling of such a composition for delivery to administration centres, respectively. In a particular embodiment, the composition is said immunogenic against the at least one polypeptide or protein that is heterologous to a MOPV, whose polynucleotide sequence has(have) been inserted into the plasmid(s) encompassing it(them) in the method according to any embodiment as described herein.

[0170] According to a particular embodiment, a composition of the invention is vaccine composition that is either a monovalent or multivalent, especially bivalent vaccine composition. Obtaining the same based on the new platform of the invention described herein is eased by the specific design of the said platform. Reference is made to the Experimental section in this respect. For instance, illustration is provided that either monovalent or bivalent vaccines could be devised (MOPEVAC NEXT CCHF 1 is a monovalent vaccine expressing Nmut and a fused GnGc, MOPEVAC NEXT CCHF 2 is a bivalent vaccine expressing Nmut and Gc from a first virus and GP38 and Gn from a second virus and MOPEVAC NEXT CCHF 3 is a bivalent vaccine expressing Nmut and Gn from a first virus and Gc from a second virus).

[0171] A carrier or delivery vehicle is any substance or combination of substances physiologically acceptable, i.e., appropriate for its use in a composition to be administered to a human, and thus non-toxic. Examples of such vehicles are phosphate buffered saline solutions, distilled water, emulsions such as oil / water emulsions, various types of wetting agents sterile solutions and the like. Examples of carriers, delivery vehicles, excipients or preservatives are commonly available to the skilled person.

[0172] The invention also relates to a viral particle obtained from the method according to any embodiment disclosed herein or a composition according to any embodiment disclosed herein for use: a) For eliciting an immune response in a subject, in particular eliciting a protective immune response in a subject, especially against the at least one polypeptide or protein that is heterologous to a MOPV, whose polynucleotide sequence has(have) been inserted into the plasmid(s) encompassing it(them) in the method according to any embodiment as described herein and / or b) As a medicament, in particular as a vaccine especially against a condition caused or linked to the at least one polypeptide or protein or to the organism, in particular the pathogenic organism (especially an arenavirus) providing such polypeptide or protein that is heterologous to a MOPV, whose polynucleotide sequence has(have) been inserted into the plasmid(s) encompassing it(them) in the method according to any embodiment as described herein.

[0173] Accordingly, the invention also relates to a method eliciting an immune response in a subject, in particular against the at least one polypeptide or protein that is heterologous to a MOPV, whose polynucleotide sequence has(have) been inserted into the plasmid(s) encompassing it(them) in the method according to any embodiment as described herein (e.g., prophylactic or therapeutic immunogenic response), in particular against a pathogen, especially an arenavirus in a subject, especially an Old World or New World arenavirus, comprising administering to said subject active ingredient(s) such as viral particles or immunogenic composition(s) as defined in any embodiment herein, including combinations of features from different embodiments. Optionally, an active ingredient or a multivalent immunogenic composition, especially when formulated for use as a vaccine or a therapeutic, can be administered in combination with an adjuvant or an immunostimulant component, wherein the adjuvant or immunostimulant component is administered before, concomitantly with, or after administration of the active ingredient(s) or multivalent immunogenic composition. Optionally, any one of: pharmaceutically acceptable carrier(s), delivery vehicle(s), excipient(s), preservative(s), or any combination thereof can be present, based on the same description for this feature as the description provided throughout present description.

[0174] Of note, instant description makes use of the “for use” wording for defining therapeutic, especially selected among: immunogenic, prophylactic, vaccine and therapeutic (i.e., treatment of an host, especially a mammal host, in particular an human host infected with a pathogen, especially an arenavirus) applications. Throughout the description, a wording using the expression “method of’ can alternatively be used without the intended meaning being different.

[0175] By “protective immune response”, it is meant in that context that the active ingredient, i.e., the viral particle or composition, in particular the immunogenic composition, provides to the host or subject in need thereof a complete or partial protection against a subsequent challenge (or infection) with a pathogen, especially an arenavirus, against which the protection was targeted. A protective immune response is one that reduces the risk that a subject will become infected with a pathogen, especially an arenavirus, and / or reduces the severity of an infection (including the spreading of the infection in an individual or the onset of the disease resulting from the infection as disclosed herein) with the targeted pathogen, especially arenavirus. Accordingly, protective immune responses include responses of varying degrees of protection.

[0176] By “medicament”, it is meant that administration results in improving the clinical condition of a subject.

[0177] According to a particular embodiment, the subject has been infected with a targeted pathogen, when relevant, especially an arenavirus, and / or suffer from symptom(s) or disease(s) caused by this pathogen infection(s), especially arenavirus infection(s), (or may be asymptomatic). Such treatment aims at improving the clinical status of the infected subject, especially human subject, by diminishing the viral load caused by the infection(s) and / or eliminating or lowering or alleviating the symptoms from which the subject suffers and / or in a particular embodiment, restoring to health. According to a particular embodiment, it is meant by “treatment” or “therapeutic treatment”, the fact of abolishing, or preventing, or decreasing the mortality associated with the infection(s) by the targeted pathogen, especially targeted arenavirus, in an extent that the odds of survival to the infection(s) are increased. According to a particular embodiment, a treatment according to the invention comes with 40%, or 50%, or 60%, or 70% reduction of the mortality rate for the treated subject.

[0178] According to a particular embodiment, it is also meant by “treatment” or “therapeutic treatment”, protecting the subject from more severe consequences, on its health status, of the treated disease, compared to the consequences that would arise in the absence of treatment. This includes eliminating or lowering or alleviating the symptoms associated with the disease(s).

[0179] Conventional routes of administration, dosages and administration regimen can be used.

[0180] The invention also relates to the use of an active ingredient, such as a viral particle or immunogenic composition as defined herein, according to any one of the embodiments or possible combinations described herein, for the preparation (or manufacture) of a medicament having the immunogenic, prophylactic, or vaccine effect(s).

[0181] Other examples and features of the invention will be apparent when reading the examples and the Figures, which illustrate the experiments conducted by the inventors, in complement to the features and definitions given in the present description.

[0182] Legend of the Figures

[0183] Figure 1 Cloning strategy for the introduction of heterologous ORFs in the genome of MOPEVAC. A) MOPEVAC S (Figure 1A.1) and L (Figure 1A.2) segments modifications for N-terminal heterologous ORF cloning. Introduction of a cloning cassette in N-terminal the NP and Lpol ORFs of MOPEVAC. B) MOPEVAC L segment modifications for C-terminal heterologous ORF cloning. Introduction of a cloning cassette in C-terminal in the Z ORF of MOPEVAC. A PCR amplified heterologous ORF gene is cloned in frame with NP, Lpol or Z that are separated from each other by the linker-P2A sequence. The resulting mRNAs are translated but due to ribosomal skipping, the proximal polypeptide is cleaved from the distal polypeptide at the level of the 2A sequence. The N-terminal ORF bears 21 residues in C-terminal corresponding to the linker-P2A sequence while the C-terminal ORF bears a P residue in N-terminal (from the 2A sequence). C) MOPEVAC NEXT focus forming units for recombinant virus carrying the mCherry ORF. Figure 1A.1 MOPEIA S segment modification for N-terminal heterologous ORF cloning. Figure 1A.2 MOPEIA L segment modification for N-terminal heterologous ORF cloning. Figure 1B MOPEIA L segment modification for C-terminal heterologous ORF cloning. C) Focus forming units of recombinant MOPEVAC NEXT viruses carrying a mCherry reporter gene as set in Figure 1A.1 (left), Figure 1A.2 (middle) and Figure 1 B (right).

[0184] Figure 2 Use of VeroNP for the production of MOPEVAC NEXT derived viruses. A) Immunofluorescence staining of VeroNP cells for the expression of MOPV WT NP (green). Nuclei were counterstained with dapi (blue). Scale bar 100pm. B) Comparison of MOPEVAC (S) mCherry and (L) MOPEVAC mCherry viruses production and titration on VeroE6 and VeroNP cells. The cells were infected at MOI 0.01 and incubated for 4 days and corresponding cell culture supernatants were titrated. Titers are expressed as Focus Forming Units I mL (FFU / mL). Figure 3 Western Blot analyses of cellular extracts of VeroNP cells infected with (S) NMT1 or (L) Nectine4 viruses. HA-NMT1 , Nectine4-flag and the 0-actine were respectively detected with an anti HA tag, anti Flag tag and anti 0-actine, all HRP conjugated monoclonal antibodies. Molecular weights in kDa are indicated.

[0185] Figure 4 Rescue of a recombinant MOPEVAC NEXT virus carrying the ORFs of the YFP (S) and mCherry (L). A) Focus forming units of MOPEVAC (S) YFP + (L) mcherry in VeroNP cells. B) Expression of fluorescent protein YFP and mCherry in VeroNP cells infected with MOPEVAC (S) YFP + (L) mcherry recombinant virus. Cells were infected at a multiplicity of infection of 0.1 and incubated for 48h before fixation. Cells were counterstained with DAPI. Scale bar 20pm.

[0186] Figure 5 Restriction map of MOPEVAC NEXT (Z) plasmid

[0187] Figure 6 Restriction map of MOPEVAC NEXT (Lpol) plasmid

[0188] Figure 7 Restriction map of MOPEVAC NEXT (NP) plasmid

[0189] Figure 8 Restriction map of pTM1 Lpolymerase MOPEIA plasmid

[0190] Figure 9 Restriction map of pTM1 NP WT Mopeia plasmid

[0191] Figure 10 Restriction map of pLV-NP MOPV-IRES-Hygro plasmid used for stable expression of WT NP in VeroE6 cells

[0192] Figure 11 Restriction map of Plasmid MOPEVAC NEXT (NP)HA-NMTI

[0193] Figure 12 Restriction map of Plasmid MOPEVAC NEXT (NP) YFP

[0194] Figure 13 Restriction map of Plasmid MOPEVAC NEXT (Z) NECTIN4-Flag, codon optimized sequence from MN030916

[0195] Figure 14 Restriction map of Plasmid MOPEVAC NEXT (Z) mCherry-HA

[0196] Figure 15 Restriction map of Plasmid MOPEVAC NEXT (NP) GPC Guanarito, INH-95551 strain

[0197] Figure 16 Restriction map of Plasmid MOPEVAC NEXT (NP)GPC MACHUPO, Carvallo strain

[0198] Figure 17 Restriction map of Plasmid MOPEVAC NEXT (NP) GPC CHAPARE

[0199] Figure 18 Restriction map of Plasmid MOPEVAC NEXT (NP)GPC SABIA

[0200] Figure 19 Restriction map of Plasmid MOPEVAC NEXT (NP)GPC JUNIN, P3790 Espindola strain Figure 20 Restriction map of Plasmid MOPEVAC NEXT (NP)GPC LASSA, Josiah strain

[0201] Figure 21 Restriction map of Plasmid MOPEVAC NEXT (NP) GPC LUJO

[0202] Figure 22 Restriction map of Plasmid MOPEVAC NEXT (NP) GPC WHITEWATER ARROYO, 9310141 strain

[0203] Figure 23 Description of the MOPEVAC NEXT CCHF vaccines. A) Cloning of the CCHFV sequences in the MOPEVAC NEXT (S) and (L). The Nmut ORF or GP38 sequences were cloned in MOPEVAC NEXT (S) and Gn, Gc or GnGc sequences were cloned in the MOPEVAC NEXT (L) using their respective cloning strategy described in the present application. B) After rescue in the BHKT7 cells, five recombinant viruses were divided to generate three vaccines: MOPEVAC NEXT CCHF 1 , a monovalent vaccine expressing Nmut and a fused GnGc, MOPEVAC NEXT CCHF 2, a bivalent vaccine expressing Nmut and Gc from a first virus and GP38 and Gn from a second virus and MOPEVAC NEXT CCHF 3, a bivalent vaccine expressing Nmut and Gn from a first virus and Gc from a second virus.

[0204] Figure 24 MOPEVAC NEXT CCHF vaccines protect IFNARko mice from a lethal challenge with CCHFV. A) Design of the study. Forty-height mice were divided in four groups of twelve. The first three groups received two doses of MOPEVAC NEXT CCHF 1 , 2 or 3 vaccines one month apart (Prime + Boost) and were challenged with CCHFV forty days later. The fourth group was sham vaccinated (controls). Four days after infection, half group number were sacrificed to study T-cell and antibody response and evaluate viral dispersion. The survival was evaluated until day twenty-eight for the remaining animals of each group. B) Survival results represented with a Kaplan-Meier curve.

[0205] Figure 25 Quantification of the viral titers in the plasmas and organs from mice sacrificed at day four post infection. A) Viral infectious titers in plasmas titers expressed at FFU / mL. B) Viral infectious titers in the liver, spleen, lungs, brain, testis and female reproductive tract. As all controls were males, not results could be collected for female reproductive tract. Results are expressed as FFU / mg of organ.

[0206] Figure 26 Assessment of the antibody response to CCHFV derived antigens after vaccination (A-B) and during challenge (C-F). The presence of antibodies to NP or Gc was measured by indirect Elisa in serial dilutions of plasmas collected after Prime and Boost for NP (A) and Gc (B), four days after infection for NP (C) and Gc (D) and at twenty-eight days after infection for NP (E) and Gc (F).

[0207] Figure 27 Assessment of the activation of the specific CD3+ CD4+ and CD3+ CD8+ lymphocyte populations to CCHFV derived NP or Gc antigens. Splenocytes from animals sacrificed four days postinfection were isolated and incubated with overlapping peptides encompassing the full NP (A and C) or Gc (B and D) sequences. The activation of CD3+ CD8+ (A-B) and CD3+ CD4+ (C-D) lymphocytes was measured by the intracellular detection of IFNy, TNFa, CD137 or CD154. * P<0,05 and ** P<0,01

[0208] Figure 28 Restriction map of the plasmid used to generate the MOPEVAC NEXT CCHF (S) Nmut vaccine Figure 29 Restriction map of the plasmid used to generate the MOPEVAC NEXT CCHF (S) GP38 vaccine

[0209] Figure 30 Restriction map of the plasmid used to generate the MOPEVAC NEXT CCHF (L) Gn vaccine

[0210] Figure 31 Restriction map of the plasmid used to generate the MOPEVAC NEXT CCHF (L) Gc vaccine

[0211] Figure 32 Restriction map of the plasmid used to generate the MOPEVAC NEXT CCHF (L) GnGc vaccine

[0212] Figure 33 Restriction map of the plasmid used to generate the MOPEVAC NEXT CCHF 3, virus 2, segment S

[0213] Material and Methods

[0214] Plasmid constructs

[0215] The four plasmid’s strategy required for the rescue of Mopeia virus, Mopevac Lassa and Mopevac New is described elsewhere (Carnec et al 2011 , in “Lassa Virus Nucleoprotein Mutants Generated by Reverse Genetics Induce a Robust Type I Interferon Response in Human Dendritic Cells and Macrophages”, Journal of Virology, Volume 85 ’ Number 22 « 15 November 2011 , Pages: 12093 - 12097, PubMed: 21880754, https: / / doi.org / 10.1128 / jvi.00429-11 ; Carnec X, Mateo M, Page A, Reynard S, Hortion J, Picard C, Yekwa E, Barrot L, Barron S, Vallve A, Raoul H, Carbonnelle C, Ferron F, Baize S. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 May 29;92(12):e02230-17). The pTM1 plasmid drives the expression of the Lpol and the NP proteins under the T7 promoter. MOPV Lpol (pTM1-Lpol) and NP (pTM1-NP) ORFs were cloned respectively between the Ncol and Xhol sites of the plasmid. To obtain a complete transcription of both viral segment, the L and S sequences in antigenomic orientation of the MOPV were reverse transcripted from viral RNA extracts and the cDNA finally cloned into the pRF108 plasmid that drives the transcription under the control of the mouse RNA polymerase I. For both transcription and replication of the viral segments, an extra non templated-G base, was included at the beginning of the cloned sequences. The 3’-5’ exonuclease activity of the MOPV NP was abrogated by the modification into alanine of six codons of its active site, namely D390, E392, G393, H430, D467 and D534 residues by site directed mutagenesis. Residues number are given, as detailed herein, by reference to GenBank entry AEO89356.1 (also reproduced under SEQ ID NO: 3 herein). The skilled person can readily, by comparison, find corresponding residues or nucleotide in a different sequence, starting from a comparison with this entry.

[0216] The introduction of the cloning cassette and the linker-P2A sequences was done in a three-step site directed mutagenesis strategy.

[0217] First, the cloning cassette (20bp) itself was introduced between the first and second codon of the NP or Lpol ORFs and between the last codon and the stop codon of the Z ORF.

[0218] Second, positive clones for the cassette were used as intermediate plasmids to introduce the P2A sequence (57bp). The P2A sequence was introduced between the last nucleotide of the cassette and the first nucleotide of the second codon of the NP or Lpol ORFs or between the last nucleotide of the last codon of the Z ORF and the first nucleotide of the cassette.

[0219] Third, the GSG linker (9bp) was then introduced between the last nucleotide of the cassette and the first nucleotide of the P2A sequence for pPOL-S-NP-N-KP2A and pPOL-S-Lpol-N-KP2A plasmids or between the last nucleotide of the last codon of the Z ORF and the first nucleotide of the P2A sequence in the pPOL-L-Z-C-KP2A plasmids

[0220] The site directed mutagenesis strategy was carried out accordingly to manufacturer instructions (Agilent). All plasmid constructs were sequenced to confirm the presence of the correct insertions / mutations.

[0221] Cloning of heterologous ORFs in the MOPEVAC NEXT plasmids

[0222] The cloning of the reporter gene YFP and the human ORF encoding an N-terminal HA- tagged NMT1 was carried out in the pPOL-S-NP-N-KP2A plasmid. The cloning of the reporter gene mCherry (with a C-terminal HA tag) and the human ORF encoding the C-terminal Flag-tagged NECTIN4 was carried out in the pPOL-L-Z-C-KP2A plasmid. Briefly, all ORFs were amplified by PCR (KOD, Sigma Aldrich) using primers with BsmBI restriction sites before the start codon and after the stop codon. The PCR products were then purified restricted with BsmBI (NEB) and cloned into their respective BsmBI restricted plasmids. Clones positive for the presence of the ORFs were sequenced, amplified and purified to reach transfection grade preparation and used to rescue recombinant viruses.

[0223] Rescue experiments and viral stock preparation

[0224] 1.2 x 106BHK-T7 / 9 cells were seeded in 25cm2flasks. The following day, cells were transfected with four polynucleotides: the NP, the Lpol in pTM1 plasmids and plasmids responsible for the transcription of a MOPV derived S and L segment using Fugene HD reagent (Promega, France). Transfection was performed for 6h at 37°C. Cells were then washed and left for 7 days in DMEM 2 % SVF. Supernatants of BHK-T7 / 9 cells constitute the seed stocks. The virus of the seed stock was then amplified on VeroNP cells for 6 to 7 days. The first passage of seed stock on VeroNP constitute the “passage 1” virus stock. After titration, the “passage 1” virus was used to infect VeroNP cells at a multiplicity of infection (MOI) of 0.0001 . Infection was carried out for 6 to 7 days, before the supernatant collection. This tittered second passage on VeroNP cells provides the viral stocks used for all experiments. For all viral stocks, the absence of mycoplasma contamination was determined using Mycoplasma detection kit (Lonza, Switzerland). Viral RNAs were extracted from stocks using QiAmp (QIAGEN) and amplified by One step RT-PCR (Titan, Roche Applied Biosciences). PCR products were sequenced by Sanger sequencing (Eurofins, Germany).

[0225] Virus titration

[0226] Supernatants containing viruses were collected and clarified by centrifugation at 1500 rpm for 10min. Ten-fold serial dilutions of viral supernatants were added to subconfluent VeroNP cells. After one- hour incubation, the cells were covered with a 1 :1 mixture of 5% SVF-DMEM and 2% Carboxy-Methyl Cellulose (CMC), and incubated for 10 days. Cells were then fixed with paraformaldehyde (PFA, Sigma Aldrich), permeabilized with Triton X100 (Sigma Aldrich). The presence of the virus was revealed by immunostaining with a rabbit polyclonal antibody against the Z protein, a goat anti-rabbit polyclonal antibody conjugated with alkaline phosphatase (Sigma Aldrich) and the NBT / BCIP substrate (Thermo Fisher). Results were expressed in FFU / ml (Focus Forming Unit / ml).

[0227] Immunofluorescence experiments

[0228] To detect the expression of the WT NP protein in VeroNP cells, cells were seeded on ibidi coverslips (Clinisciences), fixed with a paraformaldehyde 4% solution, permeabilized with Triton X100 and stained with a mouse monoclonal antibody to the NP of MOPV and an A488 conjugated goat anti-mouse polyclonal antibody (Invitrogen) and counter stained with DAPI (Sigma Aldrich). Images of fluorescence of stained cells and reporter gene expressing recombinant viruses (YFP and mCherry) infected cells were captured on a Leica DMIL microscope with LASX software.

[0229] SOS PAGE separation and Western Blot analysis

[0230] VeroNP cells were infected with the indicated recombinant viruses before cell lysis with 1X Laemmli buffer and sample were boiled for 15min at 95°C. Whole cell extracts were then loaded and separated on 4-15% gradient precast gels and transferred onto PVDF membranes. Immunoblotting of the membranes was performed with the HRP conjugated mouse anti HA tag (Miltenyi, 1 / 3000), mouse anti Flag (Sigma Aldrich 1 / 3000) or mouse anti-human 0-actin (Sigma Aldrich 1 / 12000) antibodies. Substrate for HRP was Westdura SuperSignal (Pierce, Thermo-Fisher). Chemiluminescence was monitored on a LAS400 (General Electric) and images analyzed with Imaged.

[0231] Plasmids used

[0232] A. MOPEVAC NEXT (Z) - SEQ ID NO: 1 - Figure 5

[0233] L segment 5 ' non coding sequence : 1-57 Lpolymerase ORF : 58-6771 Intergenic Region : 6772-6881

[0234] Stop codon for Z-P2A_inserted ORF : 6882-6884

[0235] Cloning cassette : 6885-6904

[0236] P2A sequence : 6905-6961

[0237] Linker : 6962-6970

[0238] Z protein ORF (without stop codon) 6971-7279 L segment 3 ' non coding sequence : 7280-7358 pRF108 plasmid : 7359-10354

[0239] B. MOPEVAC NEXT (Lpol) - SEQ ID NO: 2 - Figure 6

[0240] L segment 5 ' non coding sequence : 1-57

[0241] Start codon for ORF-P2A-Lpol : 58-60

[0242] Cloning cassette : 61-80

[0243] Linker : 81-89

[0244] P2A sequence : 90-146

[0245] Lpolymerase ORF : 147-6857

[0246] Intergenic Region : 6858-6967

[0247] Z protein ORF 6968-7279

[0248] L segment 3 ' non coding sequence : 7280-7358 pRF108 plasmid : 7359-10354 C. MOPEVAC NEXT (NP) - SEQ ID NO: 3 - Figure 7

[0249] S segment 5' non coding sequence : 1-69 Start codon for ORF-P2A-NP : 70-72 Cloning cassette : 73-92 Linker : 93-101

[0250] P2A sequence : 102-158

[0251] ExoNko NP ORF : 159-1868

[0252] Intergenic Region : 1869-1991

[0253] MOPEIA GPC ORF : 1992-3461

[0254] S segment 3' non coding sequence : 3462-3514 pRF108 plasmid : 3515-6510

[0255] For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0256] TCCAATTCAAAGGAGGTGAAGTCCTTCTTGTGGACACAGAGCCTGAGGAGAGAACTCTCAGGGTACTGCTCCAACAT AAAGATCCAAGTCATCAAGGATGCTCAAGCACTTCTTCATGGGCTGGACTTCTCTGAAGTTGCCAATGTTCAAAGGT TGATGAGAAAGGAGAAGAGGGATGACTCTGACCTGAAAAGATTGAGGGACCTAAACCAGGCAGTGAACAATCTAGTT GAGTTAAAGTCAGTCCAACAGAAGAATGTTTTGAGAGTGGGGACACTAACCTCTGATGACCTCCTCGTCCTTGCTGC CGACCTGGACAGACTCAAAGCAAAAGTCATCAGAGGTGAGAGGCCTCTTGCTGCTGGAGTCTATATGGGCAACCTAA CAGCTCAGCAGCTAGAACAGAGGAGGGTTTTGTTACAGATGGTCGGAATGGGTGGCGGGTTCCGGGCAGGAAACACT CTCGGAGATGGCATTGTTAGAGTGTGGGATGTTCGAAACCCAGAGCTTTTAAACAATCAGTTTGGGACAATGCCAAG CCTGACGATTGCTTGCATGTGCAAACAAGGGCAGGCAGATCTGAATGATGTGATCCAATCGTTGTCAGACTTGGGGC TTGTGTACACTGCAAAGTATCCAAACATGTCTGACTTAGACAAACTCTCTCAGACCCACCCAATCTTGGGGATCATT GAGCCCAAGAAAAGTGCCATAAACATATCAGGGTACAATTTTAGCCTGTCAGCTGCGGTGAAAGCTGGTGCTTGTCT AATAGACGGCGGAAACATGCTGGAGACCATCAAAGTAACAAAATCCAATTTGGAAGGAATTTTGAAGGCTGCCTTGA AAGTCAAGCGTTCTTTGGGAATGTTTGTCTCTGACACGCCAGGGGAAAGGAACCCTTATGAAAATCTCCTCTACAAA CTATGTCTTTCTGGTGAGGGTTGGCCTTACATAGCATCAAGAACATCGATCGTCGGCAGGGCTTGGGATAACACAAC TGTTGATCTGAGTGGTGATGTGCAACAGAATGCAAAGCCTGACAAAGGTAACTCCAACAGACTCGCTCAGGCCCAAG GCATGCCTGCTGGTTTGACCTACTCTCAGACAATGGAACTCAAAGACAGCATGTTGCAATTGGATCCAAATGCTAAG ACATGGATTGCCATAGCAGCGAGACCTGAAGACCCCGTGGAGATAGCTATCTATCAACCTAATAATGGTCAGTATAT T C AT T T T T AC AGGGAACC AAC AGAC AT T AAAC AAT T C AAAC AAGAC TCCAAAGCCT CTCATGGCATT GAC AT CC AAG ACCTATTCTCAGTTCAGCCGGGGTTGACAAGTGCTGTAATTGAGAGCCTGCCAAAGAACATGGTCTTGTCGTGTCAA

[0257] GGTGCTGATGCCATCAGAAAGCTTCTTGACTCCCAGAACAGGAGGGACATAAAACTGATTGATGTGTCCATGCAGAA AGACGATGCAAGAAAATTTGAGGATAAGATCTGGGATGAATACAAACACCTTTGTAGAATGCATACGGGGATTGTAA CGCAAAAGAAGAAGAGAGGTGGCAAAGAAGAGGTGACACCACACTGTGCATTGCTGGCTTGTCTCATGTTTGAAGCA GCAGTCATAGGGAGTCCACAAATTCCAACCCCCAGACCAGTCTTGAGTAGAGACCTGGTGTTTAGAACAGGTCCTCC CAGAGTTGTCCTGTAA

[0258] D. pTM1 Lpolymerase MOPEIA - SEQ ID NO: 4 - Figure 8 pTMl plasmid : 1-793

[0259] T7 promoter : 794-813 IRES EMCV : 824-1422 Lpolymerase ORF : 1423-8085 T7 terminator : 8189-8236 pTMl plasmid : 8237-11576

[0260] E. pTM1 NP WT Mopeia - SEQ ID NO: 5 - Figure 9 pTMl plasmid : 1-793

[0261] T7 promoter : 794-813 IRES EMCV : 824-1422 NP WT ORF : 1423-3135 T7 terminator : 3239-3286 pTMl plasmid : 3287-6626

[0262] F. pLV-NP MOPV-IRES-Hygro (for stable expression of the WT NP protein in VeroE6 cells) - SEQ ID NO: 6 - Figure 10

[0263] Genetic material inserted into VeroE6 cells for the constitutive expression of the MOPEIA WT NP ORF

[0264] 5' LTR : 1-634

[0265] HIV1 encapsidation sequence : 680-806 RRE : 1503-1536 cPPT / CTS : 2027-2143

[0266] EF-la core promoter : 2209-3380 NP WT ORF : 3378-5099 IRES : 5106-5764

[0267] Hygromycine resistance gene : 5765-7405 WPRE : 6814-7405 3' LTR : 7609-8242

[0268] This material originates from the pLV-NP MOPV-IRES-Hygro plasmid - see Figure 10

[0269] G. Sequences of the ORFs cloned into MOPEVAC NEXT (NP) and

[0270] MOPEVAC NEXT (Z)

[0271] MOPEVAC NEXT (NP) HA-NMT1

[0272] NMT1 is an enzyme that catalyzes the incorporation myristic acid to the N-terminal of a glycine G2 polypeptide after methionine M1 removal by methionine aminopeptidases or by release of a N-terminal G residue after protein cleavage. It is a 1491 bp long ORF for 496 residues. The inventors cloned an N-terminal HA tagged NMT1 ORF in the MOPEVAC NEXT (NP).

[0273] Sequence of the HA tag: TACCCATACGATGTTCCAGATTACGCT (SEQ ID NO: 7)

[0274] Sequence of the human N-myristoyl transferase 1 (NMT1 ), GenBank: BC006538.2 (SEQ ID NO: 8)

[0275] MOPEVAC NEXT (NP) YFP

[0276] The Yellow Fluorescent Protein is a derivative of the Green Fluorescent Protein reporter gene. It is a 720bp long ORF for 239 residues. The inventors cloned the YFP ORF in the MOPEVAC NEXT (NP). Sequence of the YFP, Genbank: OQ253287.1 (SEQ ID NO: 9)

[0277] MOPEVAC NEXT (Z) NECTIN4-Flaq

[0278] NECTIN4 belongs to the immunoglobulin superfamily and is involved in cell adhesion through trans- homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. NECTIN4 acts as a receptor for Measles virus. It is a 1554bp long ORF for 518 residues. The sequence used here has been codon optimized for better expression and originates from the MN030916 sequence. The inventorscloned a C-terminal Flag tagged NECTIN4 ORF in MOPEVAC NEXT (Z).

[0279] Sequence for Flag tag: GATTACAAAGACGATGACGACAAG (SEQ ID NO: 10)

[0280] Sequence for human NECTIN4, Genbank: codon optimized from MN030916 (SEQ ID NO: 11 ) MOPEVAC NEXT (Z) mCherry-HA

[0281] The mCherry is a fluorescent protein reporter gene. It is a 711 bp long for 236 residues. The inventors cloned a C-terminal HA tagged mCherry ORF in MOPEVAC NEXT (Z).

[0282] Sequence of the HA tag: TACCCATACGATGTTCCAGATTACGCT (SEQ ID NO: 7)

[0283] Sequence of the mCherry, GenBank: MN781138.1 (SEQ ID NO: 12)

[0284] H. Plasmids used when the ORFs described above have been cloned into MOPEVAC NEXT (NP) and MOPEVAC NEXT (Z)

[0285] Plasmid MOPEVAC NEXT (NP)HA-NMTI- SEQ ID NO: 13 - Figure 11

[0286] Sequence of MOPEVAC NEXT (NP)HA-NMTI

[0287] S segment 5 ' non coding sequence : 1-69 Start codon for ORF-P2A-NP : 70-72 HA-NMT1 BC006538 .2 : 73-1584 Linker : 1585-1593

[0288] P2A sequence : 1594-1650

[0289] ExoNko NP ORF : 1651-3360

[0290] Intergenic Region : 3361-3483

[0291] MOPEIA GPC ORF : 3484-4953

[0292] S segment 3 ' non coding sequence : 4954-5006 pRF108 plasmid : 5007-8002

[0293] For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0294] Plasmid MOPEVAC NEXT (NP) YFP - SEQ ID NO: 14 - Figure 12

[0295] Sequence of MOPEVAC NEXT (NP) YFP

[0296] S segment 5 ' non coding sequence : 1-69 Start codon for ORF-P2A-NP : 70-72 YFP ORF (OQ253287 . 1) : 73-786 Linker : 787-795

[0297] P2A sequence : 796-852

[0298] ExoNko NP ORF : 853-2562

[0299] Intergenic Region : 2563-2685

[0300] MOPEIA GPC ORF : 2686-4155

[0301] S segment 3 ' non coding sequence : 4156-4208 pRF108 plasmid : 4209-7204

[0302] For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0303] Plasmid MOPEVAC NEXT (Z) NECTIN4-Flaq, codon optimized sequence from MN030916 - SEQ ID NO: 15 - Figure 13

[0304] Sequence of MOPEVAC NEXT (Z) NECTIN4-Flaq, codon optimized from MN030916

[0305] L segment 5 ' non coding sequence : 1-57

[0306] Lpolymerase ORF : 58-6771

[0307] Intergenic Region : 6772-6881 Stop codon for Z-P2A_inserted ORF : 6882-6884 NEC! IN4 -Flag ORF : 6885-8459

[0308] P2A sequence : 8460-8516

[0309] Linker : 8517-8525

[0310] Z protein ORF (without stop codon) 8526-8834 L segment 3 ' non coding sequence : 8835-8913 pRF108 plasmid : 8914-11909

[0311] Plasmid MOPEVAC NEXT (Z) mCherry-HA- SEQ ID NO: 16 - Figure 14

[0312] Seguence of MOPEVAC NEXT (Z) mCherry-HA

[0313] L segment 5 ' non coding sequence : 1-57 Lpolymerase ORF : 58-6771 Intergenic Region : 6772-6881

[0314] Stop codon for Z-P2A_inserted ORF : 6882-6884 mCherry-HA ORF : 6885-7616

[0315] P2A sequence : 7617-7673

[0316] Linker : 7674-7682

[0317] Z protein ORF (without stop codon) 7683-7991 L segment 3 ' non coding sequence : 7992-8070 pRF108 plasmid : 8071-11066

[0318] I. Exchange of the Mopeia GPC ORF with GPC ORF of distinct Mammarenavi ruses

[0319] The following plasmid constructs provide examples for the exchange of the Mopeia GPC ORF with GPC

[0320] ORF of the following Mammarenaviruses:

[0321] Guanarito sequence: AAN05423.1 (protein) from AY129247 (S segment)

[0322] Machupo sequence: AAT40451.1 (protein) from AY619643 (S segment)

[0323] Sabia sequence: YP_089665.1 (protein) from NC_006317 (S segment)

[0324] Chapare sequence: YP_001816782.1 (protein) from NC_010562 (S segment)

[0325] Junin sequence: WAD86878.1 (protein) from OL774853.1 (S segment)

[0326] Whitewater Arroyo sequence: AAN09950.1 (protein) from AF485264.1 (S segment)

[0327] Lassa sequence: AAA46286.1 (protein) from J04324.1 (S segment)

[0328] Lujo sequence: YP_002929490.1 (protein) from NC_012776.1 (S segment)

[0329] Plasmid MOPEVAC NEXT (NP) GPC Guanarito, INH-95551 strain - SEQ ID NO: 17 - Figure 15

[0330] Seguence of MOPEVAC NEXT (NP) GPC Guanarito INH-95551 strain

[0331] S segment 5 ' non coding sequence : 1-69 Start codon for ORF-P2A-NP : 70-72 Cloning cassette : 73- 92 Linker : 93-101

[0332] P2A sequence : 102-158

[0333] ExoNko NP ORF : 159-1868

[0334] Intergenic Region : 1869-1991

[0335] GUANARITO (AAN05423 . 1) GPC ORF : 1992-3431

[0336] S segment 3 ' non coding sequence : 3432-3484 pRF108 plasmid : 3485-6480 For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0337] Plasmid MOPEVAC NEXT (NP)GPC MACHUPO, Carvallo strain - SEQ ID NO: 18 - Figure 16

[0338] Sequence of MOPEVAC NEXT (NP)GPC MACHUPO (Carvallo strain)

[0339] S segment 5 ' non coding sequence : 1-69 Start codon for 0RF-P2A-NP : 70-72 Cloning cassette : 73- 92 Linker : 93-101

[0340] P2A sequence : 102-158

[0341] ExoNko NP ORF : 159-1868

[0342] Intergenic Region : 1869-1991

[0343] MACHUPO (AAT40451 . 1) GPC ORF : 1992-3482

[0344] S segment 3 ' non coding sequence : 3483-3535 pRF108 plasmid : 3536-6531

[0345] For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0346] Plasmid MOPEVAC NEXT (NP) GPC CHAPARE - SEQ ID NO: 19 - Figure 17

[0347] Sequence of MOPEVAC NEXT (NP) GPC CHAPARE

[0348] S segment 5 ' non coding sequence : 1-69

[0349] Start codon for 0RF-P2A-NP : 70-72

[0350] Cloning cassette : 73- 92 Linker : 93-101

[0351] P2A sequence : 102-158

[0352] ExoNko NP ORF : 159-1868

[0353] Intergenic Region : 1869-1991

[0354] CHAPARE (YP_001816782 . 1) GPC ORF : 1992-3449 S segment 3 ' non coding sequence : 3450-3502 pRF108 plasmid : 3503-6498

[0355] For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0356] Plasmid MOPEVAC NEXT (NP)GPC SABIA - SEQ ID NO: 20 - Figure 18

[0357] Sequence of MOPEVAC NEXT (NP) GPC SABIA

[0358] S segment 5 ' non coding sequence : 1-69

[0359] Start codon for ORF-P2A-NP : 70-72

[0360] Cloning cassette : 73- 92

[0361] Linker : 93-101

[0362] P2A sequence : 102-158

[0363] ExoNko NP ORF : 159-1868

[0364] Intergenic Region : 1869-1991

[0365] SABIA (YP_089665 . 1) GPC ORF : 1992-3458

[0366] S segment 3 ' non coding sequence : 3459-3511 pRF108 plasmid : 3512-6507 For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0367] Plasmid MOPEVAC NEXT (NP)GPC JUNIN, P3790 Espindola strain - SEQ ID NO: 21 - Figure 19

[0368] Sequence of MOPEVAC NEXT (NP) GPC JUNIN P3790 Espindola strain

[0369] S segment 5 ' non coding sequence : 1-69

[0370] Start codon for 0RF-P2A-NP : 70-72

[0371] Cloning cassette : 73- 92

[0372] Linker : 93-101

[0373] P2A sequence : 102-158

[0374] ExoNko NP ORF : 159-1868

[0375] Intergenic Region : 1869-1991

[0376] JUNIN GPC ORF : 1992-3449

[0377] S segment 3 ' non coding sequence : 3450-3502 pRF108 plasmid : 3503-6498

[0378] For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0379] Plasmid MOPEVAC NEXT (NP)GPC LASSA, Josiah strain - SEQ ID NO: 22 - Figure 20

[0380] Sequence of MOPEVAC NEXT (NP) GPC LASSA (Josiah strain)

[0381] S segment 5 ' non coding sequence : 1-69 Start codon for ORF-P2A-NP : 70-72 Cloning cassette : 73- 92 Linker : 93-101

[0382] P2A sequence : 102-158

[0383] ExoNko NP ORF : 159-1868

[0384] Intergenic Region : 1869-1991

[0385] LASSA GPC ORF : 1992-3467

[0386] S segment 3 ' non coding sequence : 3468-3520 pRF108 plasmid : 3521-6516

[0387] For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0388] Plasmid MOPEVAC NEXT (NP) GPC LUJO - SEQ ID NO: 23 - Figure 21

[0389] Sequence of MOPEVAC NEXT (NP) GPC LUJO

[0390] S segment 5 ' non coding sequence : 1-69 Start codon for ORF-P2A-NP : 70-72 Cloning cassette : 73- 92 Linker : 93-101

[0391] P2A sequence : 102-158

[0392] ExoNko NP ORF : 159-1868

[0393] Intergenic Region : 1869-1991

[0394] LUJO (YP_002929490 . 1) GPC ORF : 1992-3356

[0395] S segment 3 ' non coding sequence : 3457-3409 pRF108 plasmid : 3410-6405 For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0396] Plasmid MOPEVAC NEXT (NP) GPC WHITEWATER ARROYO, 9310141 strain - SEQ ID NO: 24 - Figure 22

[0397] Sequence of MOPEVAC NEXT (NP) GPC WHITEWATER ARROYO (9310141 strain)

[0398] S segment 5 ' non coding sequence : 1-69

[0399] Start codon for ORF-P2A-NP : 70-72

[0400] Cloning cassette : 73- 92

[0401] Linker : 93-101

[0402] P2A sequence : 102-158

[0403] ExoNko NP ORF : 159-1868

[0404] Intergenic Region : 1869-1991

[0405] WHITEWATER ARROYO (AAN09950 . 1) GPC ORF : 1992-3434

[0406] S segment 3 ' non coding sequence : 3435-3487 pRF108 plasmid : 3488-6483

[0407] For the ExoNko NP ORF, the six mutant residues responsible for the abrogation of the exonucleasic activity are shown underlined in SEQ ID NO: 41 described above.

[0408] Material and Methods for the generation of MOPEVAC NEXT CCHF vaccines

[0409] Cloning, virus rescue and sequencing

[0410] All sequences of CCHFV were from the IBAR10200 strain (GenBank numbers NC_005302.1 (NC_005302.1 - SEQ ID NO: 50 - (Crimean-Congo hemorrhagic fever virus segment S, complete sequence) for the S segment, encoding the N ORF of CCHFV, and NC_005300.2 - SEQ ID NO: 51 - for the M segment (Crimean-Congo hemorrhagic fever virus segment M, complete sequence), encoding a polyprotein complex responsible for viral entry that includes the proteins known as MLD, GP38, Gn, NSm and Gc) and were codon-optimized to facilitate cellular expression in mammalian cells. The N ORF of CCHFV of the IBAR10200 strain (SEQ ID NO: 52) was modified by site directed mutagenesis following manufacturer instructions and is cloned into the MOPEVAC NEXT (S). Basically, the N ORF has been modified by the substitution of five codons into alanine to inhibit its endonuclease activity and decrease its capacity to interact with RNAs (Jeeva S, Mir S, Velasquez A, Ragan J, Leka A, Wu S, Sevarany AT, Royster AD, Almeida NA, Chan F, O'Brien L, Mir MA. Crimean-Congo hemorrhagic fever virus nucleocapsid protein harbors distinct RNA-binding sites in the stalk and head domains. J Biol Chem. 2019 Mar 29;294(13):5023- 5037), (Guo Y, Wang W, Ji W, Deng M, Sun Y, Zhou H, Yang C, Deng F, Wang H, Hu Z, Lou Z, Rao Z. Crimean-Congo hemorrhagic fever virus nucleoprotein reveals endonuclease activity in bunyaviruses. Proc Natl Acad Sci U S A. 2012 Mar 27; 109(13):5046-51 ). These mutations are K132A, Q300A, K41 1A, H453A and Q457A. The mutated N is referred as Nmut herein (A sequence of the N ORF of CCHFV of the IBAR10200 strain mutated as indicated herein is provided in SEQ ID NO: 53).

[0411] The GP38 sequence was cloned in the MOPEVAC NEXT (S). The GP38 sequence cloned into MOPEVAC NEXT (S) is disclosed in SEQ ID NO: 54. It is the fusion of residues 1-23 and 233-519 (included) of the GPC of the IBAR10200 strain (310 residues in total), corresponding to nucleotides 1 to 69 fused to nucleotides 697-1557 in the GPC ORF of SEQ ID NO: 54 (930 bp long in total), . The Gn and Gc sequences cloned into MOPEVAC NEXT (L) are the following:

[0412] Gn is the fusion of polynucleotides corresponding to the residues 1-23 and 506-843 (included) of the ORF of the Crimean-Congo hemorrhagic fever virus segment M disclosed in SEQ ID NO: 51 ,

[0413] Gc is the polynucleotide corresponding to the residues 956-1684 (included) of SEQ ID NO: 51 ,

[0414] GnGc is the fusion of the polynucleotides corresponding to the residues 1-23, 506-839 and 996- 1684 (included) of SEQ ID NO: 51.

[0415] The rescue of MOPEVAC NEXT based viruses in BHKT7 cells is identical to MOPEVAC based viruses and is described in Carnec X, Mateo M, Page A, et al. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018 (and herein). The passage 0 is then amplified on the helper VeroNP cell line, a Vero E6 cells derived cell line transduced to stably express the WT NP of MOPV. Passage 3 viruses were sequenced before inoculation to the IFNARko mice for the Prime + Boost immunization. The consensus sequences for all the segments of all the viruses are in a separate file.

[0416] Sequences for MOPEVAC NEXT CCHF 1 (1 virus, 2 segments)

[0417] Virus 1 carries the CCHFV Nmut ORF in the MOPEVAC NEXT (S) segment and the CCHFV GnGc sequence in the MOPEVAC NEXT (Z) segment

[0418] The consensus sequence of Passage 3 for MOPEVAC NEXT CCHF 1 , virus 1 , segment MOPEVAC NEXT CCHF (S) Nmut is provided in SEQ ID NO: 44

[0419] The consensus sequence of Passage 3 for MOPEVAC NEXT CCHF 1 , virus 1 , segment MOPEVAC NEXT CCHF (Z) GnGc is provided in SEQ ID NO: 45

[0420] Sequences for MOPEVAC NEXT CCHF 2 (2 virus, 4 segments)

[0421] Virus 1 carries the CCHFV Nmut ORF in the MOPEVAC NEXT (S) segment and the CCHF Gc sequence in the MOPEVAC NEXT (Z) segment

[0422] The consensus sequence of Passage 3 for MOPEVAC NEXT CCHF 2, virus 1 , segment MOPEVAC NEXT CCHF (S) Nmut is provided in SEQ ID NO: 44

[0423] The consensus sequence of Passage 3 for MOPEVAC NEXT 2, virus 1 , segment MOPEVAC NEXT CCHF (Z) Gc is provided in SEQ ID NO: 46

[0424] Virus 2 carries the CCHFV GP38 sequence in the MOPEVAC NEXT (S) segment and the CCHF Gn sequence in the MOPEVAC NEXT (Z) segment

[0425] The consensus sequence of Passage 3 for MOPEVAC NEXT CCHF 2, virus 2, segment MOPEVAC NEXT CCHF (S) GP38 is provided in SEQ ID NO: 47. SEQ ID NO: 47 is annotated as follows : 1- 69MOPEIA S5-NC ; 2776-2898 MOPEIA S segment intergenic region ; 4369-4421 MOPEIA S segment 3'NC ; 70-72 MOPEIA NP ORF M6b ;1066-2775 MOPEIA NP ORF M6b(1 ) ;1000-1008 linker 1009-1065 P2A sequence ; 4422-7417 pRF108 ; 2899- 4368 MOPEIA GPC ORF ; 73-999 GP38 CCHF IBAR10200

[0426] The consensus sequence of Passage 3 for MOPEVAC NEXT 2, virus 2, segment MOPEVAC NEXT CCHF (Z) Gn is provided in SEQ ID NO: 48 Sequences for MOPEVAC NEXT CCHF 3 (2 virus, 4 segments)

[0427] Virus 1 carries the CCHFV Nmut ORF in the MOPEVAC NEXT (S) segment and the CCHF Gn sequence in the MOPEVAC NEXT (Z) segment

[0428] The consensus sequence of Passage 3 for MOPEVAC NEXT CCHF 3, virus 1 , segment MOPEVAC NEXT CCHF (S) Nmut is provided in SEQ ID NO: 44

[0429] The consensus sequence of Passage 3 for MOPEVAC NEXT 3, virus 1 , segment MOPEVAC NEXT CCHF (Z) Gn is provided in SEQ ID NO: 48

[0430] Virus 2 carries the CCHFV Gc sequence in the MOPEVAC NEXT (Z) segment, the S segment is has described herein

[0431] The consensus sequence of Passage 3 for MOPEVAC NEXT CCHF 3, virus 2, segment S (as described herein - see for instance the disclosure of Figure 33 herein and in SEQ ID NO: 49, the segment S used is the MOPEIA S Segment with the NP mutated in 6 positions as described in WO2017 / 068190, and in SEQ ID NO: 49. This sequence is annotated as follows: 1-69 MOPEIAS5-NC ; 70-72 MOPEIA NP ORF M6b ; 73-1782 MOPEIA NP ORF M6b(1 ) ; 1783-1905 MOPEIA S segment intergenic region ;1906- 3375 MOPEIA GPC ORF ; 3376-3428 MOPEIA S segment 3'NC ; 3429-6424 pRF108

[0432] The consensus sequence of Passage 3 for MOPEVAC NEXT 3, virus 2, segment MOPEVAC NEXT CCHF (Z) Gc (SEQ ID NO: 46)

[0433] Immunization and challenge

[0434] The B6.129S2-lfnar1tm1Agt / Mmjax “IFNARko” mice were bred and housed at Institut Pasteur. Animals were ten to twelve weeks old when entering the protocol. Each group was housed in two cages of six littermates of the same sex. The animals sacrificed at day four post-infection were randomly chosen before the beginning of the study. Mice were immunized in a Prime + Boost strategy by intraperitoneal injection (500pL of vaccine / animal). Mice were infected with the CCHFV lbar10200 strain (400 FFU / animal expected) in the BSL4 Jean Merieux I INSERM facility. Animals were anesthetized with Vetflurane (Virbac) before injections or blood draw. All procedures were approved by the Comite Regional d'Ethique en Matiere d'Experimentation Animale de Paris (2023122213424805) and the Comite Regional d’Ethique pour I’Experimentation Animale Rhone Alpes (2024010310515108).

[0435] Viral titration

[0436] Plasmas samples or fluids from crushed organs were titrated on Vero E6 cells. Samples were tenfold diluted in DMEM 5% FBS, 0.5% PenStrep and added to Vero E6 cells in 12 well plates (200 pL inocula for plasmas and 100 pL for organs) and incubated 1 h at 37°C 5% CO2 before the addition a semi solid CMC DMEM medium for five days. Presence of viral infection spots was detected by immunostaining with a mouse anti CCHFV ascites and a PA-conjugated goat anti mouse polyclonal antibody and NBT / BCIP substrate. Results are represented are Focus Forming Unit per mL or mg of organ (FFU / mL or FFU / mg).

[0437] Enzyme-Linked Immunosorbent Assay

[0438] Recombinant CCHFV N or Gc proteins were coated in Maxisorp 96 well plates diluted at 1 pg / mL in PBS with an overnight incubation. After blocking 2 h in PBS BSA 1 % at room temperature (RT), fivefold dilutions of mouse plasmas (1 / 100 to 1 / 12500) diluted in PBS 0.05% Tween, 1 % BSA were added to the wells and incubated 1 h at RT. Plates were washed three times with PBS 0.05% Tween. Mouse antibodies to CCHFV antigens were detected with an HRP-conjugated anti-mouse IgG rabbit polyclonal antibody (1 / 10000 in PBS 0.005% Tween, 1 % BSA). Plates were washed three times with PBS 0.05% Tween before addition of the TMB substrate. Reaction was stopped by the addition of a H3PO4 solution. Signals in plates were measured with Tecan plates readers. The positive control for the detection of CCHFV N and Gc was an inhouse mouse ascites to CCHFV and negative control was a pool of plasmas of from IFNARko mice infected with Mopeia virus. Presence of CCHFV IgG was considered positive when values were superior to a value equivalent to twice the mean of the negative control + one SD.

[0439] T-cell activation

[0440] Splenocytes from animals sacrificed at day four post infection were isolated and resuspended in RPMI 10% FBS, 2 mM Glutamine, 0.1 mM beta-mercaptoethanol, 0.2 mM NaPyruvate, 0.5% Penstrep. A mix of Brefeldin A (10 pg / ml final) and pools of fifteen residues long CCHFV derived peptides of N or Gc (1 pg / ml final) were added to one million splenocytes and incubated overnight at 37°C, 5% CO2. Cells were then stained for cell surface expression of CD3, CD4, CD8 and for intracellular expression of IFNy, TNFa, CD137 and CD154 with the following antibodies: anti CD3-APC (100312, Biolegend), anti CD4-APC (100536, Biolegend) anti CD8-APCH7 (100714, Biolegend), anti IFNy-PC7 (505826, Biolegend), anti TNFa-BV421 (506328, Biolegend), anti CD137-PE (106106, Biolegend) and anti CD154-FITC (157006, Biolegend). Fluorescence of stained cells were acquired with a Gallios flow cytometer (Beckman Coulter) and data analyzed with Kaluza software.

[0441] Experiments

[0442] Modification of the MOPEVAC platform for the expression of heterologous ORFs:

[0443] The inventors present here a modification of the MOPEVAC platform, that they named MOPEVAC NEXT, the latter of which allows the production of recombinant MOPEVAC based viruses that express at least one heterologous protein in addition to the four proteins encoded by the arenavirus genome. In turn, the MOPEVAC platform consists of a MOPV (AN21366 strain, GenBank accession nos. JN561684 and JN561685) that carries the GPC of a virus of interest in place of its own GPC and is mutated in the nucleoprotein gene to abolish the exonuclease function, as described in WO2017 / 068190 or (Carnec X, Mateo M, Page A, et al. A Vaccine Platform against Arenaviruses Based on a Recombinant Hyperattenuated Mopeia Virus Expressing Heterologous Glycoproteins. J Virol. 2018), which are incorporated herein in their entirety. In the present experiment, the inventors identified the positions on the genome of MOPEVAC that allow the introduction of encoding sequences forward or backward of viral ORFs. Only some positions of insertion for heterologous ORFs worked when cloning ORFs, especially cellular ORFs in the MOPEVAC backbone.

[0444] The modifications of the viral segments for the expression of heterologous proteins from MOPEVAC is a two-step strategy:

[0445] A cloning cassette constituted by a universal cloning strategy based on the type II BsmBI enzyme and a linker sequence coupled to a 2A self-cleaving peptide sequences is introduced by site directed mutagenesis either downstream of the start codon of an ORF (ATG-Bsmbl-CGGCCC-BsmBI-XXX- linker-2A-ORF, Figure 1 A) or upstream of a stop codon (0RF-linker-2A-XXX-BsmBI-CGGCC-BsmBI- Stop, Figure 1B).

[0446] Once the cassettes were independently introduced in six out of the eight possible positions offered by the four ORFs of MOPEVAC, a reporter gene coupled with a HA tag was cloned into the cassette cloning site using standard cloning procedures.

[0447] From the plasmids expressing MOPEVAC viral segment S (pPOL-S) or L (pPOL-L), the cassettes described in Figure 1A and Figure 1B were introduced in N-terminal of the NP, Lpol or Z ORF as well as in C-terminal of the NP, GPC or Z ORFs raising plasmids: pPOL-S-NP-N-KP2A (for: NP-(N)-terminal insertion of- linker (K) and PA2 sequences) pPOL-S-NP-C-KP2A (for: NP-(C)-terminal insertion of- linker (K) and PA2 sequences) PPOL-S-GPC-C-KP2A pPOL-L-Lpol-N-KP2A pPOL-L-Z-N-KP2A pPOL-L-Z-C-KP2A

[0448] The mCherry reporter gene with a HA tag in either N-terminal (HAmCherry) or C-terminal (mCherryHA) was then cloned in the six previously described plasmids, raising plasmids: pPOL-S-NP-N-HAmCherry pPOL-S-NP-C-mCherryHA pPOL-S-GPC-C-mCherryHA pPOL-L-Lpol-HAmCherry pPOL-L-Z-N-HAmCherry

[0449] POL-L-Z-C-mCherryHA

[0450] From the six constructs, six rescues experiments were undertaken as technically previously described in W02017 / 068190 and (Mateo M, Reynard S, Carnec X, et al. Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect macaques after a single shot. Sci Transl Med. 2019; 11(512):1-18)-(Reynard S, Carnec X, Picard C, et al. A MOPEVAC multivalent vaccine induces sterile protection against New World arenaviruses in non-human primates. Nat Microbiol. 2023), which are incorporated herein in their entirety, and three viruses were recovered:

[0451] MOPEVAC NEXT Lpol N-HAmCherry

[0452] MOPEVAC NEXT Z C-mCherryHA

[0453] MOPEVAC NEXT NP N-HAmCherry

[0454] The results of rescues, amplification and titration experiments showed in Figure 1C indicated that it is possible to rescue MOPEVAC derived viruses expressing one heterologous protein in N-terminal of the NP and Lpol ORFs as well as in the C-terminal of the Z ORF. Because the expression of the HA-mCherry from the Lpol ORF is weaker than the others, the inventors did not investigate this approach further for the purpose of the present report. Therefore, when an ORF is cloned into the L segment, it can refer to a Z ORF C-terminal cloning because it was primarily investigated. The two remaining positions allow differentiating recombinant viruses with the following classification:

[0455] MOPEVAC NEXT NP N-HAmCherry = MOPEVAC (S) mCherry

[0456] MOPEVAC NEXT Z C-mCherryHA = MOPEVAC (L) mCherry Use of VeroE6 cells stably expressing the WT NP of Mopeia for MOPEVAC NEXT amplification.

[0457] MOPEVAC NEXT viruses showed limited infectious titers kinetics in VeroE6. The presence of mutations in the NP gene as well as the introduction of the heterologous sequences are responsible for the observed attenuation. To improve this, the inventors engineered a VeroE6 derived cell line that stably express the wild-type version of the NP of MOPV. To do so, the WT NP ORF was cloned into the pLV- MCS-IRES-Hygro, a lentivirus-based vector that allows the cloning of an ORF upstream an IRES followed by the Hygromycine resistance gene. Retroviral particles pseudotyped with the VSV-G envelope glycoprotein were generated and used to infect VeroE6 cells. Hygromycine was then added to the culture medium for selection of cells that have integrated viral DNA. Clones of VeroNP were then isolated, amplified and verified for the expression of NP by immunofluorescence (Figure 2A). They then compared the production of MOPEVAC mCherry (S) and MOPEVAC mCherry (L) viruses when produced and titrated on either VeroE6 cells and / or VeroNP cells. The results in Figure 2B show that when both viruses are produced and titrated on VeroNP cells, they reach infectious titers similar to a recombinant Mopeia virus. The production of MOPEVAC NEXT viral particles is greatly enhanced by the expression of WT NP in VeroE6 cells. The engineered VeroE6 derived cell line is the VERO-NP cell line deposited under Accession number CNCM 1-6034 at the CNCM (Collection Nationale de Cultures de Microorganismes) on February, 2, 2024.

[0458] Human cellular ORFs cloned into the (S) or the (L) segments of MOPEVAC NEXT are expressed from recombinant virus during infection.

[0459] As a proof of principle and in order to verify whether it is possible to express ORFs aside from reporter genes in the MOPEVAC NEXT backbone, the inventors cloned ORFs with different cellular functions and locations to evidence the array of possibilities of the MOPEVAC NEXT platform. The cloned ORFs were the N-terminal HA tagged N-Myristoyl Transferase 1 ORF (HA-NMT1 , 1515bp) cloned in the pPOL-S-NP-N-KP2A plasmid and the C-terminal Flag tagged Nectine4 ORF (1584bp) in the pPOL-L-Z-C- KP2A plasmid. NMT1 is a cytoplasmic enzyme responsible for the myristoylation of cellular protein and Nectin4 is single-pass type I membrane protein with immunoglobulin-like domains involved in cell adhesion. After rescue experiments, they obtained (S) HA-NMT1 and (L) Nectine4-Flag viruses that were used to infect VeroNP cells. After cellular lysis, total protein extracts were collected and separated by SDS-PAGE and analyzed by Western Blot for the presence of HA-NMT1 and Nectine4-flag. The results in Figure 3 showed the presence of full-length HA-NMT1 and Nectine4-flag in cellular extracts of VeroNP cells infected with respective viruses.

[0460] Combination of S and L MOPEVAC NEXT derived segments for the expression of two heterologous ORFs from a single recombinant virus.

[0461] In order to determine whether it is possible to rescue a MOPEVAC derived virus expressing a first reporter gene from the S segment and second reporter gene from the L segment, the CFP ORF was cloned into the plasmid pPOL-S-NP-N-KP2A to generate the pPOL-S-NP-CFP plasmid and rescue experiments were undertaken to generate a virus expressing the CFP from the NP ORF and the mCherryHA from the Z ORF. The corresponding virus was successfully rescued as shown in Figure 4 where cells infected with MOPEVAC (S) YFP + (L) mCherry express both reporter genes.

[0462] Combining MOPEVAC NEXT with MOPEVACLAS and MOPEVACNEW

[0463] The heterologous ORFs cloned in the pPOL-S-NP-N-KP2A and the pPOL-L-Z-C-KP2A plasmids are here reporter genes and cellular ORFs, but ORFs derived from animal or human pathogens, including antigenic or highly antigenic ORFs derived from animal or human pathogens can be used as well.

[0464] Furthermore, all plasmid constructs generated in the present report were done with an S segment that carries the GPC of Mopeia. But the cloning cassettes introduced into the S segments of the MOPEVACLAS and the MOPEVACNEW backbones, can be such that the GPC ORF of MOPV is swapped with the GPC of Lassa, Machupo, Junin, Guanarito, Chapare or Sabia viruses so as to produce recombinant viruses expressing heterologous ORFs within a virus harboring another envelope glycoprotein.

[0465] Generation of MOPEVAC NEXT CCHF vaccines

[0466] CCHFV belongs to the Orthonairovirus genus in the Nairoviridae family of the Bunyavirales order. It is an enveloped virus with a genome consisting in three negative sense RNA molecules. The S segment encodes for the nucleoprotein N and the NSs protein in an opposite-sense orientation. The M segment encodes the GPC polyprotein precursor that is proteolytically processed into Gn and Gc, responsible for viral entry, but also the Mucin-Like Domain MLD, GP38 and the NSm proteins. The L segment encodes for the large RNA-dependent RNA polymerase (Hawman DW, Feldmann H. Recent advances in understanding Crimean-Congo hemorrhagic fever virus. F OORes. 2018 Oct 29;7:F1000 Faculty Rev- 1715; Zivcec M, Scholte FE, Spiropoulou CF, Spengler JR, Bergeron E. Molecular Insights into Crimean- Congo Hemorrhagic Fever Virus. Viruses. 2016 Apr 21 ;8(4):106). The CCHF is a zoonosis that is mainly transmitted to humans during blood feeding by ticks of the Hyalomma genus (reservoir species) already infected with the virus. CCHF is the widely distributed hemorrhagic fever with cases reported throughout Africa, Europe, and Southeast Asia. Reports of CCHFV infection in humans can also occur from handling and butchering of infected livestock as well as in a nosocomial and intrafamilial environment. Because Hyalomma ticks can feed from a wide variety of domestic and wild animals (which are not symptomatic) and have a widespread geographical distribution, the chain of transmission of the virus to humans increases (Hawman DW, Feldmann H. Crimean-Congo haemorrhagic fever virus. Nat Rev Microbiol. 2023 Jul;21(7):463-477 ). In 2024, CCHF virus was identified in the South of France for the first time in livestock and ticks (Bernard C, Joly Kukla C, Rakotoarivony I, Duhayon M, Stachurski F, Huber K, Giupponi C, Zortman I, Holzmuller P, Pollet T, Jeanneau M, Mercey A, Vachiery N, Lefrangois T, Garros C, Michaud V, Comtet L, Despois L, Pourquier P, Picard C, Journeaux A, Thomas D, Godard S, Moissonnier E, Mely S, Sega M, Pannetier D, Baize S, Vial L. Detection of Crimean-Congo haemorrhagic fever virus in Hyalomma marginatum ticks, southern France, May 2022 and April 2023. Euro Surveill. 2024 Feb;29(6):2400023), (Kiwan P, Masse S, Piorkowski G, Ayhan N, Gasparine M, Vial L, Charrel RN, de Lamballerie X, Falchi A. Crimean-Congo Hemorrhagic Fever Virus in Ticks Collected from Cattle, Corsica, France, 2023. Emerg Infect Dis. 2024 May;30(5): 1036-1039). In humans, the infection is often asymptomatic but can evolve to a fatal hemorrhagic fever with a high fatality rate (Hawman DW, Feldmann H. Crimean-Congo haemorrhagic fever virus. Nat Rev Microbiol. 2023 Jul;21(7):463-477).

[0467] The MOPEVAC NEXT platform features the cloning of the following CCHFV sequences into the modified MOPEVAC NEXT S and L constructs described herein:

[0468] Cloning of the N ORF or GP38 sequences in the MOPEVAC NEXT (S) plasmid (Figures 28-29)

[0469] Cloning of the Gn, Gc or GnGc sequences in the MOPEVAC NEXT (L) plasmid (Figures 30, 31 and 32)

[0470] The CCHFV cloned sequences into MOPEVAC NEXT are derived from the “reference” strain IBAR10200 (GenBank numbers NC_005302.1 for the S segment, encoding the N ORF of CCHFV, and NC_005300.2 for the M segment, encoding a polyprotein complex responsible for viral entry that includes the proteins known as MLD, GP38, Gn, NSm and Gc). All derived CCHFV sequences cloned into MOPEVAC NEXT plasmids were originally codon optimized in order to increase the expression of the cloned sequences in mammalian cells.

[0471] The N ORF has been modified by the substitution of five codons into alanine to inhibit its endonuclease activity and decrease its capacity to interact with RNAs (Jeeva S, Mir S, Velasquez A, Ragan J, Leka A, Wu S, Sevarany AT, Royster AD, Almeida NA, Chan F, O'Brien L, Mir MA. Crimean-Congo hemorrhagic fever virus nucleocapsid protein harbors distinct RNA-binding sites in the stalk and head domains. J Biol Chem. 2019 Mar 29;294(13):5023-5037), (Guo Y, Wang W, Ji W, Deng M, Sun Y, Zhou H, Yang C, Deng F, Wang H, Hu Z, Lou Z, Rao Z. Crimean-Congo hemorrhagic fever virus nucleoprotein reveals endonuclease activity in bunyaviruses. Proc Natl Acad Sci U S A. 2012 Mar 27;109(13):5046-51 ). These mutations are K132A, Q300A, K411A, H453A and Q457A. The mutated N is referred as Nmut herein.

[0472] The Gn, Gc and GnGc cloned sequences were engineered from the original and full sequence of the GPC polyprotein of 5052 nucleotides 1 1486 residues long as followed:

[0473] Gn is the fusion of polynucleotides corresponding to the residues 1-23 and 506-843 (included),

[0474] Gc, is the polynucleotide corresponding to the residues 956-1684 (included)

[0475] GnGc is the fusion of the polynucleotides corresponding to the residues 1-23, 506-839 and 996- 1684 (included)

[0476] The three MOPEVAC NEXT based vaccine candidates for CCHFV are described in Figure 23 and are composed of:

[0477] The monovalent MOPEVAC CCHF 1 , carrying the Nmut ORF and GnGc sequence, for a total of three CCHFV derived antigens

[0478] The bivalent MOPEVAC CCHF 2, a mix of two recombinant viruses, one carrying the Nmut ORF and Gc sequence, the other carrying the GP38 and Gn sequences, for a total of four CCHFV derived antigens

[0479] The bivalent MOPEVAC CCHF 3, a mix of two recombinant viruses, one carrying the Nmut ORF and Gn sequence, the other carrying the Gc sequence, for a total of three CCHFV derived antigens

[0480] To rescue these five viruses, the 4 plasmids encoding the dedicated polynucleotides were then transfected in the BHKT7 cell line. The detailed procedure for the rescue of the MOPEVAC NEXT derived viruses is described herein in particular in the material and methods section of present application (“Rescue experiments and viral stock preparation” section). Supernatants for each virus were subsequently amplified in the VeroNP cells as described in the Experimental section of the present application.

[0481] Protection by MOPEVAC CCHF vaccines in the lethal IFNARko mouse model of infection

[0482] In order to evaluate the capacity of the three MOPEVAC CCHF live attenuated recombinant vaccines to protect against CCHFV, the inventors used the well described model of infection in the IFNARko mouse. This model has been used in more than ten studies to assay vaccines or antivirals wherein no animal, male or female has ever survived the infection without efficacious prophylaxis or treatment (reviewed in Pirincal A, Doymaz MZ. The Role of Nucleocapsid Protein (NP) in the Immunology of Crimean- Congo Hemorrhagic Fever Virus (CCHFV). Viruses. 2024 Sep 30; 16(10): 1547)).

[0483] Procedure for vaccination and challenge in the IFNARko mouse model:

[0484] The experiment started with a total of forty-eight animals divided into four groups of twelve. Three groups received vaccines and the fourth was sham vaccinated (controls). All groups were six males and six females, except the control group which was all males. The vaccination strategy consisted in the injection one month apart of two identical doses of MOPEVAC CCHF (Prime + Boost). The doses of MOPEVAC CCHF 1 , 2 and 3 were respectively 3.6x105FFU, 1.0x10® FFU and 4.4x105FFU / dose. The detailed timeline of the experiment is depicted in the Figure 2A. During the immunization phase, blood samples were collected twenty-one days after the Prime and fourteen days after the Boost to extract plasmas and evaluate the antibody response to CCHFV derived antigens (Ags). During the immunization phase, one female in the MOPEVAC CCHF 2 group did not fully recover from anesthesia and was euthanized according to the endpoint criteria. One month after the second immunization, all surviving animals entered the Jean Merieux I INSERM BSL4 facility and after an eight days long acclimatization period, were intraperitoneally inoculated with CCHFV, IBAR10200 strain (501 FFU / animal titrated inocula and 340 FFU / animal back-titrated inocula). Animals were weighted and scored every day following a standardized scoring table. Four days after infection, corresponding to the pic of the disease, 6 out of the 11 to 12 animals of each group (3 males + 3 females when possible) were sacrificed to collect samples in order to analyze and compare the T-cell and the antibody responses between groups. The survival of the remaining animals was evaluated until day twenty-height post-infection.

[0485] Challenge results:

[0486] The Kaplan-Meier survival curves of the challenge are presented in the Figure 2B. All animals vaccinated with the MOPEVAC CCHF 1 and 3 survived the infection while all controls reached the pre- established scoring conditions for euthanasia (n=6) or succumbed to infection (n=6) between days three and four. Five out the six animals vaccinated with MOPEVAC CCHF 2 survived infection except one female that was euthanized two days post challenge because it never fully recovered from the anesthesia required for the infection procedure and rapidly reached endpoint criteria. Ten out of the twelve controls started to lose weight from day three. All vaccinated animals increased in weight during the study but were regularly scored for pulled back ears and whiskers positions. MOPEVAC NEXT CCHF vaccines protect against viral dissemination

[0487] The inventors first evaluated the presence of infectious CCHFV in the plasmas and the organs from sacrificed animals four days after infection. To do so, serial dilutions of plasmas and organ lysates were titrated on Vero E6 cells and the presence of the virus was detected by immunostaining. The results in Figure 3A showed that all the sham vaccinated animals had a high viremia while no infectious CCHFV could be detected in animals vaccinated with MOPEVAC CCHF 1 , 2 or 3. Similar results were observed in the organs (Figure 3B): all control animals had a strong and widespread presence of the virus in the liver, the spleen, the lungs and the brain. The presence of the virus in the testis varied in-between animals. They did not detect infectious CCHFV in the plasmas and the organs from all MOPEVAC CCHF vaccinated animals except for the lungs of one animal in the MOPEVAC CCHF 2 vaccinated group. These results indicated that the MOPEVAC CCHF vaccines promoted an immune response that blocked the dissemination of the virus.

[0488] MOPEVAC CCHF vaccines promote a strong antibody response to CCHFV antigens:

[0489] During the immunization phase, blood was collected from all animals and plasmas were extracted to analyze the IgG antibody response to CCHFV Ags by indirect ELISA. Recombinant N or Gc proteins were coated in 96 well plates, saturated and fivefold serial dilutions of plasmas were added to the wells (range od dilutions: 1 / 100-1 / 12500). Mouse IgG to CCHFV Ags were detected using an HRP conjugated anti-mouse IgG polyclonal antibody and TMB substrate. The results in Figure 4A showed that all animals in all MOPEVAC CCHF vaccinated groups had a strong antibody response to recombinant CCHFV N protein as soon as twenty-one days after the Prime injection. The antibody titers were still positive at 1 / 12500 dilution after the Boost injection. In Figure 4B, differences in the titers of antibodies to recombinant CCHFV Gc protein could be observed. Prime plasma antibody titers from MOPEVAC CCHF 3 vaccinated animals were higher than antibody titers from plasmas of MOPEVAC CCHF 2 ones, while no antibodies to Gc in plasmas from MOPEVAC CCHF 1 vaccinated animals could be detected. Boost plasmas showed higher Gc antibody titers for all vaccines compared to Prime with the same hierarchy. Plasmas from MOPEVAC CCHF 1 vaccinated animals were not all positive for anti-Gc IgG after Boost.

[0490] Similar results were obtained when assessing the antibody responses to N et Gc Ags in plasmas from sacrificed animals four days post infection (Figure 4C-D). Plasmas from control animals did not contained IgG recognizing CCHF Ags contrary to all vaccinated ones indicating that the presence of IgG to CCHF Ags originates on vaccination only. N protein antibody titers were still positive at the 1 / 12500 dilutions for all vaccinated animals. Gc antibody titers were evenly distributed for all three groups of vaccinated animals with higher titers for MOPEVAC CCHF 2 and 3 compared to MOPEVAC CCHF 1. Twenty-eight days post-infection, all surviving animals had N and Gc antibody titers positive at the 1 / 12500 dilution, excepted two animals vaccinated with MOPEVAC CCHF 1 and one animal vaccinated with MOPEVAC CCHF 2, all for Gc (Figure 4E-F), but these increases in titer for antibodies to Gc were rather linked to the host response to the infection.

[0491] The assessment of the antibody response to CCHFV pre- and post-challenge showed that the expression of Nmut from the MOPEVAC NEXT (S), a common feature to all MOPEVAC CCHF vaccines, promoted a strong IgG response to CCHFV N protein while the IgG response to Gc varied from a vaccine to another. The earliest and strongest IgG response to Gc is obtained with MOPEVAC CCHF 2 and 3, with expression of Gc driven by the MOPEVAC NEXT (L). The introduction of the fused GnGc sequences in the MOPEVAC CCHF 3 promoted a weaker IgG response to Gc compared to MOPEVAC CCHF 1 and 2.

[0492] MOPEVAC CCHF vaccines promote a strong T CD4+ and CD8+ lymphocyte responses to CCHFV

[0493] The inventors measured the capacity of the MOPEVAC CCHF vaccines to promote a specific T- cell response to CCHFV in an assay based on the stimulation of splenocytes isolated from the animals sacrificed on day four post-infection. Isolated splenocytes were incubated with CCHFV N or Gc derived peptides and after 24 h of incubation, the cells were stained with antibodies to characterize the activation status of the CD4+ or CD8+ lymphocytes through the detection of intracellular IFNy, TNFa, CD154 or CD137. The results in Figure 5A showed a non-significant increase of the mean of the CD3+ CD8+ IFNy+ lymphocyte population stimulated with N derived peptides in animals vaccinated with all MOPEVAC CCHF vaccines compared to sham vaccinated animals. In all three vaccinated groups, several animals did not respond better to N derived antigens than the controls. These results were similar for the population of CD3+ CD8+ CD137+ lymphocytes. The results of Figure 5B showed that the controls had limited responses to Gc derived peptides compared to the animals vaccinated with all MOPEVAC CCHF. On average, between 3 to 4% of the CD3+ CD8+ lymphocytes were IFNy or TNFa positive upon the stimulation by Gc derived peptides for all MOPEVAC CCHF vaccines, excepted for the TNFa positive population for MOPEVAC CCHF 1 that did not respond better than controls. All vaccinated groups had a significant increase of the mean population of CD3+ CD8+ lymphocyte that were CD137 or CD154 positive except for MOPEVAC CCHF 1 . The CD3+ CD4+ lymphocytes populations that were stimulated with N or Gc derived peptides presented higher scattering profiles of activation compared to the CD3+ CD8+ lymphocytes (Figure 5C-D). In each vaccinated group, several animals had a high percentage of IFNy or TNFa positive populations, reaching up to 6% of positive cells, while other animals had percentage of activated cells similar to the controls, exemplified by the MOPEVAC CCHF 1 CD3+ CD4+ IFNy to N of Gc derived peptides (Figures 5C-D, left graphs). The CD3+ CD4+ populations positive for CD154 or CD137 were also scattered with animals presenting up to 2.5% of positive cells (Figure 5C middle panel) while other animals did not responded better than the sham vaccinated animals. Taken together, these results demonstrated that all MOPEVAC CCHF vaccines rapidly primed robust populations of CD8+ lymphocytes against CCHFV derived antigens and CD4+ populations to a lesser extent. Our results also highlighted that the envelope glycoprotein Gc seemed a rather better activator of the CD8+ lymphocyte response than the N nucleoprotein while N and Gc seemed equivalent in the capacity to promote the CD4+ lymphocyte response.

[0494] Conclusions

[0495] Present disclosure describes the genesis of a modified MOPEVAC platform to generate recombinant viruses which can, according to a particular embodiment, express one or two heterologous ORFs in helper VeroNP cells. The platform allows expressing non-arenavirus antigens using a live- attenuated virus vector and constitutes a new and improved new vaccine platform. Furthermore, a first application of the MOPEVAC NEXT vaccine platform intended to protect against the Crimee-Congo Hemorrhagic Fever Virus has been completed. Indeed, the MOPEVAC NEXT platform is designed to expressed antigens of pathogens for vaccines purposes. As a proof of concept, one monovalent and two bivalent vaccines expressing CCHFV derived antigens have been generated and have been used with a Prime / Boost strategy in the IFNARko model of infection with CCHFV. When assessing the host response to vaccines, similarity and heterogeneity in-between the vaccines were observed. The N nucleoprotein of CCHF is expressed from the MOPEVAC NEXT (S) and is a common feature to all the vaccines generated in this study. The IgG response to this Ag was rapid and strong as soon as the Prime injection and lasted throughout the study for all MOPEVAC CCHF vaccines. The inventors observed heterogeneity in the IgG titers to Gc, weaker for MOPEVAC CCHF1 compared to the two other vaccines. The Gc expression in all three vaccines comes from the MOPEVAC NEXT (L), but with differences that might explain these discrepancies. The Gc expression in MOPEVAC CCHF 3 is unique in its virus while it is coupled with another CCHFV Ag in MOPEVAC CCHF 2 or directly fused to Gn in MOPEVAC CCHF 1 . Conversely, the CD8+ lymphocyte response from all three vaccines was stronger for Gc than N. One explanation for these differences might originate from the nature of the Ags themselves, their cellular localization (N is a soluble protein found in the cytoplasm while Gc is a transmembrane glycoprotein that transit from the ER to the Golgi to reach cellular surface) and how derived peptides from Gc and N are presented to the HCM-I. Our study has demonstrated that despite differences in the antibody and T-cell responses induces by the three

[0496] MOPEVAC CCHF vaccines, they all protected infected animals from the widespread viral multiplication and dissemination leading to death four days post-infection.

Claims

CLAIMS1 . A nucleic acid construct which comprises a DNA molecule encoding a recombinant L segment of a Mopeia virus (MOPV) wherein the DNA molecule comprises in the following order from its 5’ extremity to its 3’ extremity: a) a polynucleotide encoding a MOPV Lpolymerase (Lpol) Open Reading Frame (ORF), and b) a polynucleotide comprising an intergenic region (IGR) of a MOPV, and c) a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV, and d) a polynucleotide encoding a 2A self-cleaving peptide, optionally with a further polynucleotide linker sequence at the 5’ extremity of the polynucleotide encoding the 2A self-cleaving peptide, and e) a polynucleotide encoding a MOPV Z protein ORF, and the polynucleotide of a) and the polynucleotide of e) being respectively flanked by polynucleotides consisting of non-coding sequences comprising regulatory elements for controlling the transcription of the coding sequences of the nucleic acid construct, and where the polynucleotides c), d) and e) are operatively linked for expression.

2. A nucleic acid construct which comprises a DNA molecule encoding a recombinant L segment of a Mopeia virus (MOPV), wherein the DNA molecule comprises in the following order from its 5’ extremity to its 3’ extremity: a) a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV, and b) a polynucleotide encoding a 2A self-cleaving peptide, optionally with a further polynucleotide linker sequence at the 5’ extremity of the polynucleotide encoding the 2A self-cleaving peptide, and c) a polynucleotide encoding a MOPV Lpolymerase (Lpol) Open Reading Frame (ORF), and d) a polynucleotide comprising an intergenic region (IGR) of a MOPV, and e) a polynucleotide encoding a MOPV Z protein ORF, and the polynucleotide of a) and the polynucleotide of e) being respectively flanked by polynucleotides consisting of non-coding sequences comprising regulatory elements for controlling the transcription of the coding sequences of the nucleic acid construct, and where the polynucleotides a), b) and c) are operatively linked for expression.

3. A nucleic acid construct which comprises a DNA molecule encoding a recombinant S segment of a MOPV, wherein the DNA molecule comprises in the following order from its 5’ extremity to its 3’ extremity: a) a polynucleotide encoding at least one polypeptide or protein that is heterologous to a MOPV, and b) a polynucleotide encoding a 2A self-cleaving peptide, optionally with a further polynucleotide linker sequence at the 5’ extremity of the polynucleotide encoding the 2A self-cleaving peptide, and c) a polynucleotide encoding a MOPV nucleoprotein (NP) having attenuated exonuclease activity, and d) a polynucleotide comprising an intergenic region (IGR) of a MOPV, and e) a polynucleotide encoding a MOPV or a non-MOPV glycoprotein precursor (GPC), in particular a New World arenavirus GPC, and the polynucleotide of a) and the polynucleotide of e) being respectively flanked by polynucleotides consisting of non-coding sequences comprising regulatory elements for controlling the transcription of thecoding sequences of the nucleic acid construct, and where the polynucleotides a), b) and c) are operatively linked for expression.

4. The nucleic acid construct of claim 3, wherein the polynucleotide encoding a MOPV nucleoprotein (NP) having attenuated exonuclease activity is a polynucleotide encoding a MOPV NP in which one or more mutations has(ve) been introduced with respect to the sequence of the wild-type MOPV NP and result(s) in the partial or total loss of exonuclease activity of said NP.

5. The nucleic acid construct of claim 3 or 4, wherein the GPC is from one of the following arenaviruses: Lassa virus (LASV), Lujo virus (LUJV), Machupo virus (MACV), Sabia virus (SABV), Chapare virus (CHAPV), Junin virus (JUNV) and Guanarito virus (GTOV), and Whitewater Arroyo virus.

6. The nucleic acid construct of any one of claims 1 to 5, wherein the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV: i. has a size of at least 100 bp, in particular a size between 1000 bp and 2500 bp, especially has a size chosen among: 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400 or 2500 bp, and / or ii. comprises a nucleic acid encoding an antigenic determinant, or a fragment thereof, from a human or an animal pathogen, or which is derived from a human or an animal pathogen, and / orHi. comprises a nucleic acid encoding an antigenic determinant that is the CCHFV N ORF of SEQ ID NO: 52 or SEQ ID NO: 53, or a fragment thereof, or is derived, especially codon-optimized to facilitate cellular expression in a mammalian cell, from the CCHFV N ORF of SEQ ID NO: 52 or SEQ ID NO: 53, or a fragment thereof, or iv. comprises a nucleic acid encoding an antigenic determinant that is the GP38 sequence of the IBAR10200 strain, or a fragment thereof, or is derived, especially codon-optimized to facilitate cellular expression in a mammalian cell, from the GP38 sequence of the IBAR10200 strain, or v. comprises a nucleic acid encoding an antigenic determinant that is the Gc sequence of the IBAR10200 strain, or a fragment thereof, or is derived, especially codon-optimized to facilitate cellular expression in a mammalian cell, from the Gc sequence of the IBAR10200 strain, or vi. comprises a nucleic acid encoding an antigenic determinant that is the Gn sequence of the IBAR10200 strain, or a fragment thereof, or is derived, especially codon-optimized to facilitate cellular expression in a mammalian cell, from the Gn sequence of the IBAR10200 strain, or vii. comprises a nucleic acid encoding an antigenic determinant that is a chimeric GcGn sequence of the IBAR10200 strain, or a fragment thereof, or is derived, especially codon-optimized to facilitate cellular expression in a mammalian cell, from a chimeric GcGn sequence of the IBAR10200 strain.

7. An expression cassette or a vector comprising a nucleic construct according to any one of claims 1 to 6, in particular a vector that is an expression vector, more particularly a vector that is a plasmid.

8. A eukaryotic cell comprising the nucleic acid construct or expression cassette or vector according to any one of claims 1 to 7.

9. A method of expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof and / or producing recombinant live attenuated Mopeia virus (MOPV) expressing one or more polypeptide(s) or protein(s) that is(are) heterologous to MOPV or fragments thereof, in a eukaryotic host cell, wherein the method comprises the steps of: a) transfecting the eukaryotic host cell with the following: o a first plasmid that comprises a polynucleotide which is an expression cassette encoding a DNA molecule encoding a recombinant L segment of MOPV; o a second plasmid that comprises a polynucleotide which is an expression cassette encoding a a DNA molecule encoding a recombinant S segment of MOPV; o an expression cassette for the L protein of MOPV wherein in particular said cassette is contained in a third plasmid and; o an expression cassette for the NP protein of the Lassa virus or MOPV wherein in particular said cassette is contained in a fourth plasmid; wherein the first plasmid and / or the second plasmid comprises a nucleic acid construct according to any one of claims 1 to 6, which comprises a polynucleotide encoding at least one polypeptide or a protein that is heterologous to MOPV, and b) allowing ribonucleoproteins of recombinant MOPV to form, thereby enabling expression of an assembly of recombinant live attenuated viral particles while enabling expression of the at least one polypeptide(s) or protein(s) encoded by the polynucleotide(s) of the first plasmid and / or the second plasmid and; c) recovering the expressed polypeptide(s) or protein(s) and optionally recovering the recombinant live attenuated Mopeia viruses produced after step b).

10. The method of claim 9, wherein the first plasmid comprises a nucleic acid construct according to any one of claims 1 , 2 or 6, which encodes a recombinant L segment of a Mopeia virus (MOPV).

11. The method of claim 9 or 10, wherein the second plasmid comprises a nucleic acid construct comprising a polynucleotide encoding a MOPV nucleoprotein (NP) having attenuated exonuclease activity, in particular comprising the ORF of a MOPV nucleoprotein (NP) protein which is mutated by amino acid residue substitution(s) in the wild-type NP of the Mopeia virus to have attenuated exonuclease activity.

12. The method of claim 9 or 10 or 11 , wherein the second plasmid comprises a nucleic acid construct according to any one of claims 3 to 6 encoding a recombinant S segment of a Mopeia virus (MOPV), in particular a nucleic acid molecule encoding a recombinant chimeric S segment of a Mopeia virus (MOPV) that is deleted for the ORF of the glycoprotein precursor (GPC) of the Mopeia virus and comprises the ORF of the GPC protein of a New World arenavirus selected among: Machupo virus (MACV), Sabia virus (SABV), Chapare virus (CHAPV), Junin virus (JUNV), Guanarito virus (GTOV) and Whitewater Arroyo virus, or the ORF of the GPC protein of an Old World arenavirus selected among: Lassa virus (LASV) and Lujo virus (LUJV).

13. The method of any one of claims 9 to 12, wherein each of the first plasmid and the second plasmid comprises a nucleic acid construct comprising a polynucleotide encoding a polypeptide or a protein that is heterologous to MOPV.

14. The method of any one of claims 9 to 13, wherein the eukaryotic host cell is a cell stably expressing the wild-type version of the NP of MOPV, in particular a VeroE6 cell stably expressing the wild-type version of the NP of MOPV.

15. A composition comprising viral particles obtained from the method according to any one of claims 9 to 14, in particular an immunogenic or vaccine composition, especially a composition that is immunogenic against the at least one polypeptide or protein that is heterologous to a MOPV, whose polynucleotide sequence has(have) been inserted into the plasmid(s) encompassing it(them) in the method according to any one of claims 9 to 14.

16. A viral particle obtained from the method according to any one of claims 9 to 14 or a composition according to claim 15 for use: a. For eliciting an immune response in a subject, in particular eliciting a protective immune response in a subject, especially against the at least one polypeptide or protein that is heterologous to a MOPV, whose polynucleotide sequence has(have) been inserted into the plasmid(s) encompassing it(them) in the method according to any one of claims 9 to 14 and / or b. As a medicament, in particular as a vaccine, especially against a condition caused or linked to the at least one polypeptide or protein or to the organism, in particular the pathogenic organism providing such polypeptide or protein that is heterologous to a MOPV, whose polynucleotide sequence has(have) been inserted into the plasmid(s) encompassing it(them) in the method according to any one of claims 9 to 14, and / or c. As a monovalent or multivalent, especially bivalent, vaccine, especially against a condition caused or linked to the at least one polypeptide or protein or to the organism, in particular the pathogenic organism providing such polypeptide or protein that is heterologous to a MOPV, whose polynucleotide sequence has(have) been inserted into the plasmid(s) encompassing it(them) in the method according to any one of claims 9 to 14.

17. A set of nucleic acid constructs or expression cassettes or vectors comprising them, wherein the set comprises at least: i. one nucleic acid construct or expression cassette or vector comprising it, which encodes a recombinant L segment of a Mopeia virus (MOPV), and ii. one nucleic acid construct or expression cassette or vector comprising it, which encodes a recombinant S segment of a Mopeia virus (MOPV) that encodes a MOPV nucleoprotein (NP) having attenuated exonuclease activity, wherein one or both nucleic acid constructs or expression cassettes or vectors comprise(s) a polynucleotide encoding a polypeptide or a protein that is heterologous to MOPV and the latter is different from a non- MOPV GPC when on the S segment, andwherein the positions where the polynucleotide encoding at least one polypeptide or protein that is heterologous to MOPV is inserted in the said nucleic acid constructs or expression cassettes or vectors are, considered from the 5’ extremity to the 3’ extremity of a MOPV DNA segment: o between the 5' extremity of the MOPV Lpol protein and the 3’ extremity of the MOPV Z protein on a L segment of MOPV, or o at the 5’ extremity of the MOPV Lpol protein on a L segment of MOPV, or o at the 5’ extremity of the MOPV NP having attenuated exonuclease activity on a S segment of MOPV.

18. The set of claim 17, wherein a nucleic acid construct or expression cassette or vectors comprising it is as defined in any one of claims 1 to 6.

19. Use of a set of nucleic acid constructs or expression cassettes or vectors comprising them as defined in any one of claims 17 to 18, for in vitro or ex vivo expressing one or more proteins that is(are) heterologous to Mopeia virus (MOPV) or fragments thereof in a eukaryotic host cell and / or in vitro or ex vivo producing recombinant live attenuated Mopeia virus (MOPV) in a eukaryotic host cell.

20. Use of a set of nucleic acid constructs or expression cassettes or vectors comprising them as defined in any one of claims 17 to 18, in a method according to any one of claims 9 to 14.

21. Cell line or cell derived from the said cell line, wherein the cell line is the VERO-NP cell line deposited under Accession number CNCM I-6034 at the CNCM on February 2, 2024, or a variant cell line derived from it, which keeps the properties of the parent I-6034 cell line.

Images