Recombinant microorganism having improved l-lysine productivity, and l-lysine production method using same

Abstract

The present invention relates to a recombinant microorganism having improved L-lysine productivity, and a L-lysine production method using same. More specifically, a recombinant microorganism is produced by removing an endogenous cytochrome formate dehydrogenase and introducing an exogenous NAD-dependent formate dehydrogenase gene, and the recombinant microorganism is cultured in a medium containing formic acid so as to identify that L-lysine productivity is improved, wherein the microorganism producing L-lysine can produce L-lysine in an eco-friendly manner by using formic acid produced from carbon monoxide or carbon dioxide, which are greenhouse gases, through a bio-process, and the produced L-lysine can be widely used as an animal feed additive, a food additive, a pharmaceutical raw material, and a raw material for various chemical products such as polyamides and polyurethanes.

Description

Recombinant microorganism with improved L-lysine production ability and method for producing L-lysine using the same

[0001] The present invention provides a recombinant microorganism with improved L-lysine production ability, a method for producing L-lysine using the same, and a composition for producing L-lysine.

[0002] L-lysine is an essential amino acid for animal cells and is produced using aspartic acid as a precursor. It is widely used as a raw material for feed, food additives, pharmaceuticals, and plastic monomers.

[0003] L-lysine is produced through microbial fermentation. Due to intense competition among L-lysine producers, various studies have been conducted to increase the production yield and productivity per unit of raw material used by L-lysine-producing microorganisms. Furthermore, research has been conducted to reduce production costs by replacing food-derived raw materials, such as glucose and raw sugar, with less expensive raw materials.

[0004] For example, in Patent Registration No. 10-1146080, a microorganism of the genus Corynebacterium was developed by introducing an exogenous glycerol kinase and increasing the intrinsic activity of glycerol-3-phosphate dehydrogenase and glycerol uptake facilitator protein to produce L-lysine using a carbon source that partially or solely contains glycerol produced as a byproduct of biodiesel. In addition, in a paper reported by Ryabchenko et al. in Russia (LE Rybchenko, et. al., Appl Biochem Microbiol 56, 828-836, 2020), in order to supply NADPH required for L-lysine production, aspartic acid, the 221st amino acid of NAD-dependent formic acid dehydrogenase derived from the genus Pseudomonas, was mutated to glutamine to develop NADP-dependent formic acid dehydrogenase, and an L-lysine-producing Corynebacterium glutamicum was developed in which the endogenous cytochrome formic acid reductase gene was deleted and this mutated gene was introduced, and it was reported that when this was cultured in a medium containing formic acid in addition to the main raw material glucose, a higher L-lysine production yield was shown.

[0005] Meanwhile, research has been conducted on the development of biotechnology to produce various chemical products using these as raw materials in order to reduce the atmospheric concentration of C1 carbons, such as carbon dioxide, carbon monoxide, and methane gas, which are the main causes of global warming.

[0006] For example, as disclosed in Patent Publication No. 10-2022-0008755, a recombinant microorganism capable of growing only on carbon dioxide and formic acid through additional genetic manipulation by introducing and strengthening a metabolic pathway for synthesizing pyruvate from carbon dioxide and formic acid to increase the efficiency of pyruvate synthesis, and a method for producing a useful substance using the same have been reported.

[0007] Meanwhile, Patent No. 10-2527339 reported that a technology can economically produce large quantities of formic acid by converting toxic carbon monoxide and / or carbon dioxide in waste gas into formic acid without byproducts at room temperature and pressure using carbon monoxide dehydrogenase and formate dehydrogenase. However, the limited use of formic acid has hindered the production of large quantities of formic acid. Therefore, if L-lysine, which has a global market of approximately 3.5 million tons in 2022, can be produced using all or part of the low-cost formic acid produced through a bioprocess as a raw material, it can have the advantage of reducing the production cost of L-lysine and solving the problem of global warming.

[0008] Accordingly, the present inventors developed a novel NADP-dependent formic acid dehydrogenase and conducted research to use it for L-lysine production. During this research, unlike the paper reported by Ryabchenko et al., they confirmed that the production yield decreased regardless of the presence or absence of formic acid in an L-lysine-producing strain into which a novel NADP-dependent formic acid reductase was introduced. On the contrary, when the endogenous cytochrome formic acid dehydrogenase was removed and an exogenous NAD-dependent formic acid dehydrogenase was introduced, the production yield increased when glucose was used alone and an even higher production yield was shown in a medium to which some formic acid was added. Therefore, they aimed to develop a mutant strain with improved L-lysine production ability.

[0009] The purpose of the present invention is to provide a recombinant microorganism having improved L-lysine production ability, in which a gene encoding the endogenous cytochrome-dependent formate dehydrogenase of Corynebacterium glutamicum, which is a complex of two proteins, FdhF and FdhD (Cytochrome-dependent formate dehydrogenase, hereinafter referred to as Cg-fdh), is inactivated and a gene encoding an exogenous NAD-dependent formate dehydrogenase (NAD-dependent formate dehydrogenase, hereinafter referred to as Fdh) protein (hereinafter referred to as fdh) is introduced.

[0010] Another object of the present invention is to provide a composition for producing L-lysine comprising the above-described combination of microorganisms, a culture thereof, or a lysate thereof.

[0011] Another object of the present invention is to provide a method for producing L-lysine, comprising the steps of: (a) culturing the recombinant microorganism in a culture medium; and (b) recovering L-lysine from the cultured culture medium.

[0012] To achieve the above object, the present invention provides a recombinant microorganism with improved L-lysine production ability, in which a gene encoding an endogenous cytochrome-dependent formate dehydrogenase of Corynebacterium glutamicum, which is a complex of two proteins, FdhF and FdhD, is inactivated and a gene encoding an exogenous NAD-dependent formate dehydrogenase (NAD-dependent formate dehydrogenase, fdh) is introduced.

[0013] In addition, the present invention provides a composition for producing L-lysine comprising the recombinant microorganism, a culture thereof, or a lysate thereof.

[0014] In addition, the present invention provides a method for producing L-lysine, comprising the steps of (a) culturing the recombinant microorganism in a culture medium; and (b) recovering L-lysine from the cultured culture medium.

[0015] The present invention relates to a recombinant microorganism having improved L-lysine productivity and a method for producing L-lysine using the same, and more specifically, to a recombinant microorganism produced by removing an endogenous cytochrome formic acid dehydrogenase gene and introducing an exogenous NAD-dependent formic acid dehydrogenase gene, and to culturing the recombinant microorganism in a culture medium containing formic acid, thereby confirming that the productivity of L-lysine is improved. The microorganism producing L-lysine can produce L-lysine in an environmentally friendly manner using formic acid produced through a bioprocess from carbon monoxide or carbon dioxide, which are greenhouse gases, and the produced L-lysine can be widely used as a raw material for various chemical products such as animal feed additives, food additives, pharmaceutical production raw materials, and polyamides and polyurethanes.

[0016] Figure 1 shows the structure of the operon consisting of fdhF-cg0617-fdhD of the cytochrome-dependent formic acid dehydrogenase of Corynebacterium glutamicum.

[0017] Figure 2 shows a vector map of vector pFAME61 for deletion of the endogenous cytochrome formic acid dehydrogenase gene.

[0018] Figure 3 shows a vector map of the vector pFAME62 introducing a foreign NAD-dependent formic acid dehydrogenase.

[0019] Hereinafter, the present invention will be described in more detail.

[0020]

[0021] The present invention provides a recombinant microorganism having L-lysine production ability, in which a gene encoding an endogenous cytochrome-dependent formate dehydrogenase is inactivated and a gene fdh (NAD-dependent formate dehydrogenase) encoding an exogenous NAD-dependent formate dehydrogenase is introduced.

[0022] The gene encoding the above exogenous NAD-dependent formic acid dehydrogenase may be derived from Candida boidini.

[0023] The gene encoding the above-mentioned inherent cytochrome-dependent formic acid dehydrogenase may be composed of the base sequence of sequence number 2.

[0024] The gene encoding the above NAD-dependent formic acid dehydrogenase may be composed of the base sequence of sequence number 3.

[0025] The protein expressed by the gene encoding the above NAD-dependent formic acid dehydrogenase may include, but is not limited to, any one or more selected from the group consisting of the polypeptide sequence of SEQ ID NO: 6 and polypeptide sequences having 90% or more homology or identity therewith.

[0026] The recombinant microorganism may be, but is not limited to, Corynebacterium sp., Escherichia sp., or Lactobacillus sp. For the purposes of the present invention, the microorganism may be included without limitation as long as the intrinsic activity of Cg-fdh is enhanced or the productivity of L-lysine is increased by introducing the gene fdh encoding an exogenous NAD-dependent formic acid dehydrogenase.

[0027] The above genus Corynebacterium may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli pollutisoli), Corynebacterium imitans, Corynebacterium testudinoris, Corynebacterium casei, Corynebacterium glycinophilum, and Corynebacterium flavescens, but is not limited thereto.

[0028] The above genus Escherichia may include all Escherichia microorganisms. Specifically, it may be Escherichia coli.

[0029] The above recombinant microorganism may be, but is not limited to, Corynebacterium glutamicum.

[0030] The above Corynebacterium glutamicum may have been deposited under the deposit number KCTC15817BP.

[0031] Meanwhile, it has already been known that the above-mentioned microorganisms of the genus Corynebacterium or Escherichia can produce L-lysine, but their production ability is significantly low, and neither the genes nor the mechanism acting on the production mechanism have been elucidated. Therefore, the 'microorganism producing L-lysine' of the present invention refers to a natural wild-type microorganism itself, a microorganism that has improved L-lysine production ability by strengthening or weakening / inactivating the activity of genes related to the L-lysine production mechanism, or a microorganism that has improved L-lysine production ability by introducing or strengthening the activity of an external gene. The culture of the microorganism of the present invention may be prepared by culturing the microorganism of the present invention in a medium.

[0032] Sequence number 1 refers to the sequence of the adjacent region including the Cg-fdh gene.

[0033]

[0034] In addition, the present invention provides a composition for producing L-lysine comprising the recombinant microorganism, a culture thereof, or a lysate thereof.

[0035]

[0036] In addition, the present invention may be a method for producing L-lysine, comprising the steps of (a) culturing the recombinant microorganism in a culture medium; and (b) recovering L-lysine from the cultured culture medium.

[0037] Formic acid may be additionally included in the culture medium of step (a).

[0038] The above recombinant microorganism may have its activity enhanced by additional genetic modification of at least one selected from the group consisting of aspartic acid aminotransferase, aspartic acid kinase, aspartic semialdehyde dehydrogenase, 4-hydroxy-tetrahydrodipicolic acid synthase, 4-hydroxy-tetrahydropicolic acid reductase, diaminopimelic acid dehydrogenase, diaminopimelic acid decarboxylase, pyruvate carboxylase, glucose-6-P dehydrogenase, gluconic acid-6-P dehydrogenase, and L-lysine efflux protein, but is not limited thereto.

[0039] The above recombinant microorganism may be further genetically modified to have its activity weakened or inactivated by one or more enzymes selected from the group consisting of homoserine dehydrogenase, NAD-dependent lactate dehydrogenase, and pyruvate decarboxylase, but is not limited thereto.

[0040]

[0041] The present inventors conducted research to develop a new microorganism with improved L-lysine production ability using a Corynebacterium glutamicum strain, and as a result, they removed the gene encoding the endogenous cytochrome-dependent formic acid dehydrogenase and introduced the gene fdh encoding the exogenous NAD-dependent formic acid dehydrogenase, and performed expression of the NAD-dependent formic acid dehydrogenase encoded by this gene, thereby confirming that the L-lysine production increased, thereby completing the present invention.

[0042] In the present invention, the term “formate dehydrogenase” refers to a set of enzymes that catalyze the oxidation of carbon dioxide, donate electrons to a second substrate such as NAD, NADP+, or cytochrome, and provide the following reaction:

[0043] Formic acid + X- <=> carbon dioxide + XH

[0044] X-: NAD, NADP+, or oxidized cytochrome

[0045] XH: NADH, NADPH, or reduced cytochrome

[0046] In the present invention, the term “NAD-dependent dehydrogenase” is an enzyme that transfers electrons to NAD to convert it into carbon dioxide and NADH when promoting the oxidation of formic acid to carbon dioxide.

[0047] In the present invention, the term “cytochrome dehydrogenase” is an enzyme that, when promoting the oxidation of formic acid to carbon dioxide, transfers electrons to cytochrome and converts it into carbon dioxide and reduced cytochrome.

[0048] According to one specific example of the present invention, the gene encoding the NAD-dependent dehydrogenase may be derived from a Candida genus microorganism.

[0049] Specifically, it may be derived from, but is not limited to, strains of Candida boidini.

[0050] In the present invention, the term "enhancing the activity of a protein compared to its intrinsic activity" can also be expressed as "increased activity", and means that the intrinsic activity of a protein of a microorganism prior to a genetic modification or a non-modified or unmodified microorganism is enhanced compared to the activity before modification. The term "intrinsic" in the present invention means the state that the parent strain originally had before the change in traits, when the traits of a microorganism are changed due to genetic mutation caused by natural or artificial factors. The activity increase may include both the introduction of an exogenous protein and the enhancement of the activity of an endogenous protein. The activity increase / enhancement of the protein can be achieved by the increase / enhancement of gene expression.

[0051] Specifically, in the present invention, active enhancement is

[0052] 1) Increase in the copy number of the polynucleotide encoding the above protein,

[0053] 2) Modification of the expression control sequence to increase the expression of the above polynucleotide,

[0054] 3) Modification of the polynucleotide sequence on the chromosome to enhance the activity of the above protein;

[0055] 4) Introduction of a foreign polynucleotide exhibiting the activity of the above protein or a codon-optimized variant polynucleotide of the above polynucleotide, or

[0056] 5) It can be performed by a method of transforming it to be strengthened by a combination of these, but is not limited thereto.

[0057] The above 1) increase in the copy number of the polynucleotide may be performed, but is not particularly limited thereto, in a form operably linked to a vector, or by inserting an additional homologous gene into a chromosome in a host cell. Specifically, the increase may be performed by introducing a polynucleotide encoding the protein of the present invention into a host cell by being operably linked to a vector capable of replicating and functioning independently of the host, or by introducing the polynucleotide into a host cell by being operably linked to a vector capable of inserting the polynucleotide into a chromosome in the host cell, thereby increasing the copy number of the polynucleotide in the chromosome of the host cell.

[0058] Next, 2) Modification of the expression control sequence to increase the expression of the polynucleotide may be performed by, but is not particularly limited to, inducing a sequence mutation in the nucleic acid sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control sequence, or by replacing the nucleic acid sequence with a nucleic acid sequence having stronger activity. The expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence regulating the termination of transcription and translation, etc. A strong heterologous promoter may be linked upstream of the above polynucleotide expression unit instead of the original promoter. Examples of the strong promoter include, but are not limited to, endogenous promoters derived from Corynebacterium such as the gapA promoter, the EF-Tu promoter, the groEL promoter, the aceA or aceB promoter, promoters derived from foreign microorganisms such as the CJ7 promoter (Korean Patent No. 0620092 and WO2006 / 065095), and synthetic promoters such as the lysCP1 promoter (WO2009 / 096689), the spl1 promoter, the spl7 promoter, and the spl13 promoter (Korean Patent No. 1783170).

[0059] In addition, 3) modification of the polynucleotide sequence on the chromosome is not particularly limited thereto, but may be performed by inducing mutations in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof of the nucleic acid sequence to further enhance the activity of the polynucleotide sequence, or by replacing it with a polynucleotide sequence that has been improved to have stronger activity.

[0060] In addition, 4) introduction of a foreign polynucleotide sequence can be performed by introducing a foreign polynucleotide encoding a protein exhibiting the same / similar activity as the protein, or a codon-optimized mutant polynucleotide thereof, into a host cell. The foreign polynucleotide can be used without limitation in its origin or sequence as long as it exhibits the same / similar activity as the protein. In addition, the introduced foreign polynucleotide can be introduced into a host cell by optimizing its codons so that optimized transcription and translation can occur within the host cell. The introduction can be performed by a person skilled in the art appropriately selecting a known transformation method, and the introduced polynucleotide can be expressed within the host cell, thereby producing a protein and increasing its activity.

[0061] Finally, 5) the method of modifying to be strengthened by a combination of the above 1) to 4) can be performed by applying at least one of the following methods together: increasing the copy number of the polynucleotide encoding the protein, modifying the expression control sequence to increase the expression thereof, modifying the polynucleotide sequence on the chromosome, and modifying a foreign polynucleotide exhibiting the activity of the protein or a codon-optimized mutant polynucleotide thereof.

[0062] The term "vector" of the present invention refers to a DNA construct containing a polynucleotide sequence encoding a target protein operably linked to a suitable regulatory sequence so as to enable expression of the target protein in a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector, after being transformed into a suitable host cell, can replicate or function independently of the host genome, and can be integrated into the genome itself. For example, a vector for intracellular chromosomal integration can be used to replace a polynucleotide encoding a target protein in a chromosome with a mutated polynucleotide. The insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, such as, but not limited to, homologous recombination.

[0063] The vector of the present invention is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.

[0064] The term "transformation" of the present invention refers to introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed within the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or outside the chromosome, as long as it can be expressed within the host cell. Furthermore, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all the elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0065] In addition, the term "operably linked" in the present invention means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target protein of the present invention. The method for transforming the vector of the present invention includes any method for introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples thereof include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0066] The above microorganism may be a microorganism that produces L-lysine.

[0067] The term "microorganism producing L-lysine" of the present invention refers to a microorganism that naturally has the ability to produce L-lysine or a microorganism that has been given the ability to produce L-amino acids to a parent strain that does not have the ability to produce L-amino acids. For example, the microorganism producing L-lysine may be a microorganism with an enhanced L-lysine biosynthetic pathway or a weakened degradation pathway. For example, one or more proteins selected from the group consisting of aspartic acid aminotransferase, aspartic acid kinase, aspartic semialdehyde dehydrogenase, 4-hydroxy-tetrahydrodipicolic acid synthase, 4-hydroxy-tetrahydropicolic acid reductase, diaminopimelic acid dehydrogenase, diaminopimelic acid decarboxylase, pyruvate carboxylase, glucose-6-P dehydrogenase, gluconate-6-P dehydrogenase, and L-lysine excretion protein may be further genetically modified to enhance their activity, thereby enhancing the L-lysine biosynthetic pathway, enhancing the ability to supply reducing power required for L-lysine production, or enhancing the excretion of L-lysine to increase its production ability, but is not limited thereto. Alternatively, one or more selected from the group consisting of homoserine dehydrogenase, NAD-dependent lactate dehydrogenase, and pyruvate decarboxylase may be additionally genetically modified to weaken or inactivate the activity thereof, thereby improving L-lysine production ability through reducing the production of by-products, but is not limited thereto.

[0068] The term "weakening / inactivation of protein activity" of the present invention means that the expression of an enzyme or protein is not expressed at all, or even if expressed, the activity is absent or reduced compared to a natural wild-type strain, a parent strain, or a strain in which the protein is not modified. In this case, the reduction is a concept that also includes cases in which the activity of the protein is reduced compared to the activity of the protein originally possessed by the microorganism due to mutation of the gene encoding the protein, modification of the expression regulatory sequence, deletion of part or all of the gene, etc., and cases in which the overall activity of the protein in the cell is lower than that of the natural strain or the strain before modification due to inhibition of expression or translation of the gene encoding the protein, etc., and combinations thereof. In the present invention, the inactivation / weakening can be achieved by applying various methods well known in the art.Examples of the above method include: 1) a method of deleting all or part of the gene encoding the protein; 2) modification of an expression regulatory sequence so as to reduce the expression of the gene encoding the protein; 3) modification of the gene sequence encoding the protein so as to eliminate or weaken the activity of the protein; 4) introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the protein; 5) a method of forming a secondary structure by adding a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of the gene encoding the protein, thereby making attachment of the ribosome impossible; 6) There is a method of adding a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the polynucleotide sequence of the gene encoding the protein (Reverse transcription engineering, RTE), and a combination of these can also be achieved, but is not particularly limited thereto, and an inactivation method known in the art can be appropriately selected and applied.

[0069] The term "cultivation" of the present invention means growing the microorganism under appropriately controlled environmental conditions. The culturing process of the present invention can be performed according to an appropriate medium and culture conditions known in the art. This culturing process can be easily adjusted and used by a person skilled in the art according to the selected strain. The step of culturing the microorganism is not particularly limited thereto, but can be performed by a known batch culture method, continuous culture method, fed-batch culture method, etc. At this time, the culture conditions are not particularly limited thereto, but can be adjusted to an appropriate pH (e.g., pH 5 to 9, specifically pH 7 to 9) using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid). In addition, during the culture, an antifoaming agent such as fatty acid polyglycol ester can be used to suppress bubble formation, and in addition, in order to maintain an aerobic state of the culture, oxygen or an oxygen-containing gas can be injected into the culture, or in order to maintain an anaerobic or microaerobic state, no gas can be injected or nitrogen, hydrogen or carbon dioxide gas can be injected. The culture temperature can be maintained at 25°C to 40°C, specifically 30°C to 37°C, but is not limited thereto. The culture period can be continued until the desired amount of useful material is obtained, and specifically, the culture can be performed for about 0.5 to 60 hours, but is not limited thereto. In addition, the culture medium used may be used as a carbon source, including, but not limited to, sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasses, starch, and cellulose), fats and oils (e.g., soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol, ethanol, and methanol), and organic acids (e.g., formic acid, lactic acid, and acetic acid), which may be used individually or in combination.Nitrogen sources include, but are not limited to, nitrogen-containing organic compounds (e.g., peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea), or inorganic compounds (e.g., ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), which may be used individually or in combination. Phosphorus sources include, but are not limited to, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and their corresponding sodium-containing salts, which may be used individually or in combination. In addition, the medium may include essential growth promoting substances, such as other metal salts, amino acids, and vitamins.

[0070] The method may comprise recovering L-lysine from the microorganism or culture medium.

[0071] The above-described recovery step can recover L-lysine from the medium using a suitable method known in the art according to the culture method of the microorganism of the present invention, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC and combinations thereof can be used, but the present invention is not limited to these examples.

[0072] The above recovery step may include an additional purification process. The purification process may utilize any suitable method known in the art.

[0073] Another aspect of the present invention provides a microorganism for producing L-lysine, wherein the protein activity encoded by an exogenous NAD-dependent formic acid dehydrogenase gene is enhanced compared to the endogenous activity.

[0074] Another aspect of the present invention provides a microorganism, or a culture thereof, in which the activity of a protein encoded by an exogenous NAD-dependent formic acid dehydrogenase gene is enhanced compared to the endogenous activity; and a composition for producing L-lysine.

[0075] The proteins, microorganisms, and cultures encoded by the foreign NAD-dependent formic acid dehydrogenase genes are as described above.

[0076] The above composition may further include any component that can assist in the production of L-lysine, and such component may be appropriately selected from those known in the art.

[0077]

[0078] Hereinafter, to aid understanding of the present invention, examples and other embodiments will be described in detail. However, the following examples and other embodiments merely illustrate the content of the present invention and are not intended to limit the scope of the present invention. The examples and other embodiments of the present invention are provided to more fully explain the present invention to those of average skill in the art.

[0079] Example 1. Construction of a recombinant vector for replacing the endogenous cytochrome-dependent formic acid dehydrogenase gene with an exogenous NAD-dependent formic acid dehydrogenase.

[0080] A vector was constructed to realize the expression of the protein of NAD-dependent formic acid dehydrogenase by replacing the exogenous NAD-dependent formic acid dehydrogenase gene fdh with the endogenous cytochrome-dependent dehydrogenase gene of Corynebacterium glutamicum NK-4, an L-lysine-producing strain.

[0081] Specifically, as disclosed in Fig. 1, the endogenous cytochrome-dependent formic acid dehydrogenase of Corynebacterium glutamicum was reported to be composed of a complex of FdhF, cg0617, and FdhD proteins expressed from an operon consisting of fdhF-cg0617-fdhD (hereinafter referred to as Cg-fdh) (Sabrina Witthoff et. al., Microbiology, 158, 2428-2439, 2012 Jul.). In order to remove the endogenous cytochrome-dependent formic acid dehydrogenase gene and introduce the NAD-dependent formic acid dehydrogenase gene from Candida boidinii, the Cgfdh base sequence (SEQ ID NO: 2), the gene for the endogenous cytochrome-dependent formic acid dehydrogenase of Corynebacterium glutamicum, and the base sequence (SEQ ID NO: 3) of the NAD-dependent formic acid dehydrogenase gene from Candida boidinii were secured based on the base sequences reported in the NIH Genbank of the United States.

[0082] Based on the obtained sequence, a vector was constructed to produce a microorganism in which the endogenous cytochrome-dependent formic acid dehydrogenase gene was deleted as a control for the effect of introducing an exogenous NAD-dependent formic acid dehydrogenase gene.

[0083] Specifically, in order to synthesize a 507 bp DNA fragment 5' upstream from the start codon of fdhF and a 516 bp DNA fragment 5' downstream from the stop codon of fdhD located at the end of the operon, pCGI, a vector for genetic modification of the chromosome of Corynebacteria (reference Il Kwon Kim et al., Appl. Microbiol. Biotechnol., 52:541-545, 1999), and the pCGI vector and the chromosomal DNA of Corynebacterium glutamicum ATCC13932, as templates, the PCR primers presented in Table 1 were used to synthesize a 10-12 bp DNA fragment at each end so that it could be applied to the self-assembly cloning (SAC) method (reference Akira Matsumoto, Biotechniques, 51(1), 2011 Jul.) method at each DNA synthesis site. Two DNA fragments containing the ligation site sequence were synthesized by PCR. 100 ng of each synthesized fragment were mixed together, treated with DpnI enzyme at 37°C for 2 hours, and then the vector was assembled using the SAC method. For vector assembly, the mixture was treated at 98°C for 3 minutes, and then the temperature was lowered to 18°C ​​at a rate of 1°C per minute. After this, the reaction was repeated five times at 18°C ​​for 3 minutes and then 30°C for 3 minutes. After five reactions, the solution was transformed into E. coli DH5a using the calcium carbonate precipitation method, and then selected on Luria-Bertani agar plates containing kanamycin (50 mg / L). The selected Cg-fdh deletion vector was named pFAME61 (Fig. 2).

[0084] Additionally, a vector was constructed for introduction of the fdh gene encoding NAD-dependent formic acid dehydrogenase from Candida boidini into L-lysine-producing Corynebacterium glutamicum NK-4.

[0085] Specifically, using the primers listed in Table 2, a DNA fragment for homologous recombination into the chromosome was synthesized using the pFAME61 vector as a template. In addition, the base sequence (SEQ ID NO: 4) of the transcriptional regulatory region of the gapA gene encoding glyceraldehyde-3-phosphate decarboxylase, known to have strong transcription in Corynebacterium glutamicum, was confirmed, and a foreign NAD-dependent formic acid dehydrogenase gene was linked to it to design a method for regulating its expression. In addition, the transcription termination sequence of the gene encoding aspartate semialdehyde dehydrogenase presented in SEQ ID NO: 5 was designed to be linked to the 3' end of the open reading frame (ORF) of formic acid dehydrogenase so that the transcription of mRNA can be terminated, and two DNA fragments with overlapping sequences of 10-12 bp in size at both ends of the same region were synthesized using the PCR primers presented in Table 2 so that they can be applied to the self-assembly cloning (SAC) method (reference Akira Matsumoto, Biotechniques, 51(1), 2011 Jul.) method, and a vector was constructed using the SAC method. The constructed vector was introduced into Escherichia coli DH5a using the calcium chloride precipitation method and selected on a Luria-Bertani agar plate containing kanamycin (50 mg / L). The selected vector was named pFAME62 (Fig. 3).

[0086]

[0087] Primer base sequence (5'->3') Purpose of DNA fragment generation pCGI-FLAATTCACTGGCCGTCGTTTTACSAC pCGI vector DNA fragment for cloning 1pCGI-RSTFTFTFAAATTFTTATCCGCTCACpCGI-FSGTCGTTTTACAACGTCGTGACTGSAC pCGI vector DNA fragment for cloning 2pCGI-RLAGCTGTTTCCTGTGTGAAATTGTTCM-0543GGAAACAGCTGAAGACTGTGCATTCGCAGCSAC Cg-fdh 5'-adjacent region DNA fragment for cloning 1CM-0544ACATTATAGACCCGGCAATTGAACCM-0545GAAGACTGTGCATTCGCAGCSAC Cg-fdh 5'-adjacent region DNA fragment for cloning 2CM-0546GGCATAGGTCACATTATAGACCCGGCCM-0547GACCTATGCCAGAACAGGTAGAACAGCSAC Cg-fdh 3'-flanking DNA fragment for cloning 1CM-0548GTACGCCAGGTTAGCGAAACCM-0549AGAACAGGTAGAACAGCCGAATCSAC Cg-fdh 3'-flanking DNA fragment for cloning 2CM-0550GGCCAGTGAATTGTACGCCAGGTTAGCGAAAC

[0088] Primer base sequence (5'->3') Purpose of DNA fragment generation pCGI-FLAATTCACTGGCCGTCGTTTTACSAC 1 pCGI vector DNA fragment for cloning pCGI-RSTGTGTGAAATTGTTATCCGCTCACpCGI-FSGTCGTTTTACAACGTCGTGACTGSAC 2 pCGI vector DNA fragment for cloning pCGI-RLAGCTGTTTCCTGTGTGAAATTGTTCM-0543GGAAACAGCTGAAGACTGTGCATTCGCAGCSAC 1 Cg-fdh 5'-adjacent region DNA fragment for cloning 1CM-0551AGGTCACATTATAGACCCGGCCM-0545GAAGACTGTGCATTCGCAGCSAC 5'-adjacent region DNA fragment for cloning Cg-fdh 2CM-0552CACCCAGCTTAGGTCACATTATAGACCCGGCCM-0135AAGCTGGGTGTTTTGAATGTGTCTGTATGATTTTGCATCTSAC PgapA-Cb-fdh DNA fragment for cloning 1CM-0087TTTTGAATGTGTCTGTATGATTTTGCATCTCM-0137AGAACAGGTAGAACAGCCGAATCSAC PgapA-Cb-fdh DNA fragment for cloning 2CM-0089AATCGAGGAGTCCACTTCACAAGCTCGACCCCM-0553CTCCTCGATTATGCCAGAACAGGTAGAACAGCSAC Cg-fdh 3'-flanking region DNA fragment for cloning 2CM-0548GTACGCCAGGTTAGCGAAACCM-0554ATGCCAGAACAGGTAGAACAGCSAC Cg-fdh 3'-flanking region DNA fragment for cloning 2CM-0550GGCCAGTGAATTGTACGCCAGGTTAGCGAAAC

[0089]

[0090] Example 2. Production and cultivation of a strain with enhanced expression of an exogenous NAD-dependent formic acid dehydrogenase gene.

[0091] Using the vector produced in Example 1 above, a paper on chromosomal recombination using a mutation in rpsL, a gene encoding small ribosomal protein 12 that confers streptomycin resistance to Corynebacterium glutamicum (Il Kwon Kim et al., Appl. Microbiol. Biotechnol., 52:541-545, 1999) was referenced to produce a strain lacking the endogenous cytochrome-dependent dehydrogenase gene (Cg-fdh) and a strain in which an exogenous NAD-dependent formic acid dehydrogenase gene (fdh) was introduced to replace the endogenous cytochrome-dependent dehydrogenase gene (Cg-fdh).

[0092] The pFAME61 and pFAME62 vectors, which cannot replicate in Corynebacterium, were transformed into NK-4, a genetically recombinant L-lysine producing strain derived from Corynebacterium ATCC13032, by electroporation through homologous recombination on the chromosome. Colonies in which the vectors were introduced into the chromosome by the first homologous recombination were selected on CM agar medium containing kanamycin.

[0093]

[0094] (CM agar medium, pH 6.8)

[0095] Glucose 10 g, polypeptone 10 g, yeast extract 10 g, urea 1.2 g, NaCl 1.5 g, agar 18 g, kanamycin 50 mg (per 1 liter of distilled water)

[0096]

[0097] Afterwards, colonies containing the vector in the chromosome by the first homologous recombination were cultured in CM liquid medium excluding CM agar medium, and then the secondarily recombined strains were selected on CM agar medium containing streptomycin (50 mg / L) instead of kanamycin. Using the PCR primers presented in Table 3 below, the adjacent region including the endogenous cytochrome-dependent dehydrogenase gene was amplified through colony PCR for the above-mentioned Corynebacterium glutamicum transformants that completed the second recombination, and then the strains in which the endogenous cytochrome-dependent dehydrogenase gene was deleted or replaced with an exogenous NAD-dependent formic acid dehydrogenase gene were confirmed through base sequence analysis, and these genetically recombinant strains were named Corynebacterium glutamicum NK-5 and Corynebacterium glutamicum NK-6. Among the produced microorganisms, the microorganism with the foreign formic acid dehydrogenase gene replaced was deposited at the Biological Resource Center (International) of the Korea Research Institute of Bioscience and Biotechnology and assigned the accession number KCTC15817BP.

[0098]

[0099] Primer sequence (5'->3') CM-0555TCTGCATCGATGCACTGACGCM-0556AAGATGAACGGTGCCGAAAC

[0100]

[0101] Example 3. Analysis of L-lysine production capacity of an L-lysine-producing strain in which the endogenous cytochrome-dependent dehydrogenase gene was replaced with an exogenous NAD-dependent formic acid dehydrogenase gene.

[0102] In order to analyze the L-lysine production ability of Corynebacterium glutamicum NK-5 and Corynebacterium glutamicum NK-6 produced in Example 2 above, they were cultured together with the parent strain, Corynebacterium glutamicum NK-4 microorganism, using the following method.

[0103] Corynebacterium glutamicum NK-5 and Corynebacterium glutamicum NK-6 were each inoculated into a bioreactor tube containing 10 ml of the following seed medium and cultured for 16 hours at 30°C and 180 rpm. Afterwards, 1 ml of the seed culture was inoculated into a 150 ml corner-baffle flask containing 15 ml of the production medium and cultured for 72 hours at 30°C and 180 rpm. The compositions of the seed medium and the production medium are as follows. In addition, in the case of the formic acid addition condition, L-lysine production ability was confirmed by adding it at a concentration of 5 g / L.

[0104]

[0105] (seed medium, pH 6.8)

[0106] Glucose 10 g, polypeptone 10 g, yeast extract 10 g, urea 1.2 g, NaCl 1.5 g (per 1 liter of distilled water)

[0107]

[0108] (Production medium, pH 6.8)

[0109] Glucose 100 g, soybean meal acid hydrolyzate 20 g, (NH4)2SO4 45 g, KH2PO4 1 g, MgSO4·7H2O 1.2 g, biotin 1.8 mg, thiamine hydrochloride 9 mg, nicotinamide 60 mg, calcium pantothenate 60 mg, CaCO3 50 g (based on 1 liter of distilled water).

[0110] Formic acid addition conditions: 5 g (based on 1 liter of distilled water)

[0111]

[0112] The L-lysine concentration in the culture solution was analyzed by HPLC using the above culture method and is shown in Table 4.

[0113]

[0114] Carbon source: Glucose, Glucose + Formic Acid Bacteria, ODL-Lysine (mM), ODL-Lysine (mM), NK-454.627.348.646.6NK-553.727.448.246.7NK-652.730.547.447.2

[0115] As a result, it was confirmed that the yield of L-lysine increased when the endogenous cytochrome-dependent formic acid dehydrogenase gene in the L-formic acid producing strain was replaced with an exogenous NAD-dependent formic acid dehydrogenase gene.

[0116] The foregoing description of the present invention is for illustrative purposes only. Those skilled in the art will readily appreciate that modifications to other specific embodiments can be made without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

[0117] The scope of the present invention is indicated by the claims set forth below, and all changes or modifications derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.

[0118]

[0119]

Claims

1. A recombinant microorganism having L-lysine production ability, in which the gene encoding the endogenous cytochrome-dependent formate dehydrogenase is inactivated and the gene fdh (NAD-dependent formate dehydrogenase) encoding the exogenous NAD-dependent formate dehydrogenase is introduced.

2. In claim 1, A recombinant microorganism characterized in that the gene encoding the above-mentioned foreign NAD-dependent formic acid dehydrogenase is derived from Candida boidinii.

3. In claim 1, A recombinant microorganism characterized in that the gene encoding the above-mentioned endogenous cytochrome-dependent formic acid dehydrogenase consists of the base sequence of sequence number 2.

4. In claim 2, A recombinant microorganism characterized in that the gene encoding the above NAD-dependent formic acid dehydrogenase consists of the base sequence of sequence number 3.

5. In claim 2, A recombinant microorganism characterized in that the protein expressed by the gene encoding the NAD-dependent formic acid dehydrogenase comprises at least one selected from the group consisting of the polypeptide sequence of SEQ ID NO: 6 and polypeptide sequences having 90% or more homology or identity therewith.

6. In claim 1, A recombinant microorganism characterized in that the recombinant microorganism is Corynebacterium sp., Escherichia sp., or Lactobacillus sp.

7. In claim 6, The above Corynebacterium genus includes Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, and Corynebacterium. A recombinant microorganism characterized by being at least one selected from the group consisting of Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, Corynebacterium casei, Corynebacterium glycinophilum, and Corynebacterium flavescens.

8. In claim 6, A recombinant microorganism characterized in that the above Escherichia genus is Escherichia coli.

9. In claim 1, The recombinant microorganism is characterized by being Corynebacterium glutamicum.

10. In claim 9, The above Corynebacterium glutamicum is a recombinant microorganism, characterized in that it has been deposited under the deposit number KCTC15817BP.

11. A composition for producing L-lysine comprising a recombinant microorganism according to any one of claims 1 to 10, a culture thereof, or a lysate thereof. 12.(a) A step of culturing a recombinant microorganism according to any one of claims 1 to 10 in a culture medium; and (b) A method for producing L-lysine, comprising the step of recovering L-lysine from the cultured culture medium.

13. In claim 12, A method for producing L-lysine, characterized in that formic acid is additionally added to the culture medium of step (a).

14. In claim 12, A method for producing L-lysine, wherein the recombinant microorganism is characterized in that at least one selected from the group consisting of aspartic acid aminotransferase, aspartic acid kinase, aspartic semialdehyde dehydrogenase, 4-hydroxy-tetrahydrodipicolic acid synthase, 4-hydroxy-tetrahydropicolic acid reductase, diaminopimelic acid dehydrogenase, diaminopimelic acid decarboxylase, pyruvate carboxylase, glucose-6-P dehydrogenase, gluconic acid-6-P dehydrogenase, and L-lysine excretion protein is additionally genetically modified to enhance activity.

15. In claim 12, A method for producing L-lysine, wherein the recombinant microorganism is further genetically modified to have at least one enzyme selected from the group consisting of homoserine dehydrogenase, NAD-dependent lactate dehydrogenase, and pyruvate decarboxylase, thereby weakening or inactivating its activity.

Images