Methods and products for assessing autophagic flux

Abstract

The present invention relates to methods and products for assessing autophagic flux, and more specifically provides a biochemical functional measure used to quantify autophagic flux in sub-populations of blood cells. The present invention also provides lysosomal system markers for use in the methods described herein, systems for assessing autophagic flux, methods of identifying markers indicative of autophagic flux, and methods of treating subjects found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction using the methods described herein.

Description

METHODS AND PRODUCTS FOR ASSESSING AUTOPHAGIC FLUX PRIORITY CLAIM

[0001] This application claims priority from Australian provisional patent application number 2024900604 filed on 7 March 2024, the contents of which are to be taken as incorporated herein by this reference. FIELD OF THE INVENTION

[0002] The present invention relates to methods and products for assessing autophagic flux, and more specifically provides a biochemical functional measure used to quantify autophagic flux in sub-populations of blood cells. The present invention also provides lysosomal system markers for use in the methods described herein, systems for assessing autophagic flux, methods of identifying markers indicative of autophagic flux, and methods of treating subjects found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction using the methods described herein. BACKGROUND OF THE INVENTION

[0003] Macroautophagy (referred to herein as “autophagy”) is a nutrient- and stress- responsive process that supports cellular resilience by recycling intracellular material. This allows the provision of nutrients during starvation, clearance of viruses, suppression of inflammation, and maintenance of the mitochondrial network. The consequences of poorly functioning autophagy, as determined in mouse models, include accelerated biological ageing, and age-related diseases that include atherosclerosis, dementia, and cancers. Autophagy is also modifiable in cell and preclinical models using pharmacological and nutrition-based interventions. This means that autophagy has huge potential as a pathway that could slow or delay the onset of age-related disease.

[0004] Although autophagy has immense translational potential, autophagy-based research generally does not progress beyond preclinical models. The reason for this lack of progression is, at least in part, because autophagy is very difficult to measure in subjects.

[0005] The gold standard test for assessing autophagic flux is western blot for a microtubule associated protein 1 light chain 3 (MAP1LC3) protein isoform without and with inhibition of lysosomal proteolysis. This technique is commonly applied to cells in culture. However, this method has not been adapted successfully to organotypic samples that reflect both the nutritional and endocrine status of a subject, both factors which directly impact mTOR signalling and thus lysosomal system function.

[0006] Towards addressing this block to translation, autophagic flux has been measured in whole blood of a subject by treating the blood with a lysosome inhibitor. MAP1LC3B (microtubule associated protein 1 light chain 3 beta) isoform II / LC3BII has then been measured to assess autophagic flux. Maintaining peripheral blood mononuclear cells (PBMCs), and therefore performing this assessment, in whole blood during blockade of lysosomal degradation is important because it leaves intact physiological concentrations of nutrients and hormones, such as insulin. The unphysiological conditions found in common cell culture media (RPMI for example) have very high nutrient concentrations, which are likely to suppress autophagy and result in measurements that do not reflect autophagy experienced by cells inside an actual subject.

[0007] Although the use of whole blood provides a valid method to assess autophagic flux, measuring physiological autophagic flux in a pooled sample of cell types may not take into account factors such as cell type differences in autophagy, and differential sensitivity to environmental factors that impact interpretation of results. Therefore, there is a need to develop more precise measures of autophagy in subjects that are robust to changes in proportions of cellular populations in the blood cell pool. This is especially important as development, age, obesity, weight loss, exercise, and high fat food, can all impact cell characteristics and population fractions within the blood cell pool. The ability to more accurately measure autophagy will allow the development of recommendations and techniques for more precise assessment of autophagic flux in subjects, and appropriate therapeutic intervention.

[0008] The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application. SUMMARY OF THE INVENTION

[0009] The present invention is based on the identification of intrinsic differences in basal autophagic flux among different leukocyte populations in the whole blood cell pool. This has led to the development of a physiological autophagic flux measurement, and direct measurement of flux in subpopulations of whole blood cells.

[0010] Accordingly, in a first aspect, the present invention provides a method of assessing autophagic flux in a subject, the method comprising determining the level of a lysosomalsystem marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, the level of the lysosomal system marker being determined based on the level of the marker following treatment of the sample of whole blood with an inhibitor of lysosomal system function.

[0011] In some embodiments, the inhibitor of lysosomal system function comprises one or more of chloroquine, hydroxychloroquine, bafilomycin A1, E-64d, leupeptin, pepstatin A, and concanamycin A.

[0012] In some embodiments, the lysosomal system marker comprises microtubule- associated protein 1 light chain 3 (MAP1LC3) protein, and / or a GABARAP / GATE-16 protein, and / or an MAP1LC3 or GABARAP / GATE-16 interacting cargo adaptor protein. In some embodiments, the lysosomal system marker comprises a MAP1LC3B protein.

[0013] In some embodiments, the method comprises a comparison of the determined level of the lysosomal system marker with the level of the marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject that has not been treated with an inhibitor of lysosomal system function.

[0014] In some embodiments, the method comprises determining the level of the lysosomal system marker using immunological detection. In some embodiments, the immunological detection comprises ELISA or immunocytochemical staining. In some embodiments, the immunological detection comprises Western blotting.

[0015] In some embodiments, the method comprises determining the level of the lysosomal system marker using flow cytometry.

[0016] In some embodiments, the level of the lysosomal system marker is determined in monocytes in the sample of whole blood. In some embodiments, the sample of whole blood is from a subject who has undergone nutrient restriction. In some embodiments, the monocytes are non-classical monocytes.

[0017] In some embodiments, the level of the lysosomal system marker is determined in T lymphocytes in the sample of whole blood. In some embodiments, the sample of whole blood is from a subject who has not undergone nutrient restriction.

[0018] In some embodiments, the method further comprises treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction based on the level of the lysosomal system marker following treatment of the sample of whole blood from the subject with an inhibitor of lysosomal system function.

[0019] In some embodiments, the disease, condition or state associated with autophagic flux dysfunction includes one or more of obesity, diabetes, ageing, lysosomal storage diseases, cardiovascular diseases, Alzheimer’s disease, Parkinson’s disease, frontotemporal dementia, motor-neuron disease, and cancer.

[0020] In some embodiments, the subject is a human.

[0021] In a second aspect, the present invention provides a method of assessing autophagic flux in a subject, the method comprising: (i) obtaining a sample of whole blood from the subject; (ii) treating the sample of whole blood with an inhibitor of lysosomal system function; and (iii) determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in the sample of whole blood so treated as compared to the level of the lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject that has not been treated with an inhibitor of lysosomal system function.

[0022] In a third aspect, the present invention provides a method of treating a subject suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction, the method comprising assessing autophagic flux in the subject by the method of the first or second aspects of the invention, and treating the subject on the basis of the level of autophagic flux assessed.

[0023] In a fourth aspect, the present invention provides a lysosomal system marker for use in, or when used for, assessing autophagic flux in a subject by the method of the first or second aspects of the invention.

[0024] In a fifth aspect, the present invention provides a method of treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction, wherein the level of autophagic flux in the subject has been assessed by a method comprising determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, the level of thelysosomal system marker being determined based on the level of the marker following treatment of the sample of whole blood with an inhibitor of lysosomal system function, and treating the subject on the basis of the level of autophagic flux assessed.

[0025] In a sixth aspect, the present invention provides a method of treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction, wherein the level of autophagic flux in the subject has been assessed by a method comprising: (i) obtaining a sample of whole blood from the subject; (ii) treating the sample of whole blood with an inhibitor of lysosomal system function; (iii) determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in the whole blood so treated as compared to the level of the lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject that has not been treated with an inhibitor of lysosomal system function; and (iv) treating the subject on the basis of the level of autophagic flux assessed.

[0026] In a seventh aspect, the present invention provides use of a lysosomal system marker to assess the level of autophagic flux in a subject, wherein the level of autophagic flux in the subject has been assessed by a method comprising determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, the level of the lysosomal system marker being assessed based on the level of the marker following treatment of the sample of whole blood with an inhibitor of lysosomal system function.

[0027] In an eighth aspect, the present invention provides a system for assessing autophagic flux in a subject, the system comprising: (i) a processor for receiving data indicative of a level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, wherein the sample of whole blood has been treated with an inhibitor of lysosomal system function; and (ii) a memory with software resident in the memory, and accessible to the processor, wherein the software comprises a series of instructions executable by the processor to convert the data to a measurement of autophagic flux in the subject.

[0028] In a ninth aspect, the present invention provides a method of identifying a marker present in blood indicative of autophagic flux in a subject, the method comprising:(i) determining the level of a candidate marker indicative of autophagic flux in T lymphocytes and / or monocytes in a sample of whole blood from the subject, wherein the sample of whole blood has been treated with an inhibitor of lysosomal system function; and (ii) identifying the candidate marker as a marker indicative of autophagic flux.

[0029] In some embodiments of the ninth aspect of the invention, the marker present in the sample of whole blood is a plasma and / or serum marker. In some embodiments, the marker is indicative of autophagic flux in the absence of treatment of the sample of whole blood with an inhibitor of lysosomal system function.

[0030] In some embodiments of the second, fifth, sixth, seventh, eighth and ninth aspects of the invention, the inhibitor of lysosomal system function comprises one or more of chloroquine, hydroxychloroquine, bafilomycin A1, E-64d, leupeptin, pepstatin A, and concanamycin A.

[0031] In some embodiments of the second, fifth, sixth, seventh, and eighth aspects of the invention, the lysosomal system marker comprises microtubule-associated protein 1 light chain 3 (MAP1LC3) protein, and / or a GABARAP / GATE-16 protein, and / or an MAP1LC3 or GABARAP / GATE-16 interacting cargo adaptor protein. In some embodiments, the lysosomal system marker comprises a MAP1LC3B protein.

[0032] In some embodiments of the fifth and seventh aspects of the invention, the method or use comprises a comparison of the determined level of the lysosomal system marker with the level of the marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject that has not been treated with an inhibitor of lysosomal system function.

[0033] In some embodiments of the second, fifth, sixth, seventh and ninth aspects of the invention, the method or use comprises determining the level of the lysosomal system marker using immunological detection. In some embodiments, the immunological detection comprises ELISA or immunocytochemical staining. In some embodiments, the immunological detection comprises Western blotting.

[0034] In some embodiments of the second, fifth, sixth, seventh and ninth aspects of the invention, the method or use comprises determining the level of the lysosomal system marker using flow cytometry.

[0035] In some embodiments of the second, fifth, sixth, seventh, eighth and ninth aspects of the invention, the level of the lysosomal system marker is determined in monocytes in the sample of whole blood. In some embodiments, the sample of whole blood is from a subject who has undergone nutrient restriction. In some embodiments, the monocytes are non-classical monocytes.

[0036] In some embodiments of the second, fifth, sixth, seventh, eighth and ninth aspects of the invention, the level of the lysosomal system marker is determined in T lymphocytes in the sample of whole blood. In some embodiments, the sample of whole blood is from a subject who has not undergone nutrient restriction.

[0037] In some embodiments of the second aspect of the invention, the method further comprises treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction based on the level of the lysosomal system marker following treatment of the sample of whole blood from the subject with an inhibitor of lysosomal system function.

[0038] In some embodiments of the second aspect of the invention, the disease, condition or state associated with autophagic flux dysfunction includes one or more of obesity, diabetes, ageing, lysosomal storage diseases, cardiovascular diseases, Alzheimer’s disease, Parkinson’s disease, frontotemporal dementia, motor-neuron disease, and cancer.

[0039] In some embodiments of the second to ninth aspects of the invention, the subject is a human. BRIEF DESCRIPTION OF THE FIGURES

[0040] For a further understanding of the aspects and advantages of the present invention, reference should be made to the following detailed description, taken in conjunction with the accompanying figures which illustrate certain embodiments of the present invention.

[0041] FIGURE 1 – Flow cytometry staining of wild type HEK 293T cells (i) and LC3B knockout HEK 293T cells (ii), treated with or without CQ, with unstained and IgG Alexa 647 conditions as controls (A). A plot representing LC3B-II flux from three independent experiments (B). A histogram representing LC3B-II flux in total PBMCs (C).

[0042] FIGURE 2 – Gating strategy for the identification of leukocyte populations in participant whole blood samples by flow cytometry (A-R). Leukocytes were identified bygating on time (A), single cells (B, C), live cells based on low fluorescence of BD Horizon Fixable Viability Stain 780 (D), selection of CD45+cells (E), followed by FSC and SSC gate for monocytes and lymphocytes (I). T cells were identified by staining for CD3 (H), which were further categorized into Natural Killer T (NKT) cells (CD3+CD56+) and other conventional T cells (CD3+CD56-) (L). Other conventional T cells were stratified into CD4 and CD8 T cells (M). CD4 T cells (CD3+CD4+) were then classified into the following sub- populations: Treg (CD25+CD127low / -) (N) and subsequently divided into naïve (CD45RA+CCR7+), central memory (CD45RA-CCR7+), effector memory (CD45RA-CCR7+), terminally differentiated effector memory (TEMRA; CD45RA+CCR7-) (R). A similar gating strategy was applied to CD8 T cell sub-populations, including naïve (CD45RA+CCR7+), central memory (CD45RA-CCR7+), effector memory (CD45RA-CCR7+), TEMRA (CD45RA+CCR7-) (Q) based on CD45RA and CCR7 expression. NK cells were identified by gating for CD3-CD56+(G), which were then further categorized into CD56hiCD16-, CD56hiCD16+, CD56dimCD16- and CD56dimCD16+sub-populations (F). Monocytes were gated based on CD3-CD56-CD14+(J), which were then divided into classical monocytes (CD14+CD16-), intermediate monocytes (CD14+CD16+), and non-classical monocytes (CD14lowCD16+) (K). B cells were identified by CD3-CD56-CD14-CD19+(O), which were subsequently characterized into naïve (CD19+CD27-) and memory B cells (CD19+CD27+) (P).

[0043] FIGURE 3 – Autophagic flux measurement in physiological and non-physiological environments. LC3B-II flux in PBMCs exposed to CQ in whole blood compared to RPMI containing 10% FBS (N = 9) is shown as follows: Total PBMCs (A); T cells, B cells, NK cells, and monocytes (B); and monocyte sub-populations, including classical, intermediate, and non-classical monocytes (C). Wilcoxon matched-paired signed rank tests were used. *p<0.05. Bars = median.

[0044] FIGURE 4 – Autophagic flux measurement in physiological and non-physiological environments. LC3B-II flux in PBMCs exposed to CQ in whole blood compared to 1:1 cognate plasma:DPBS (N = 7) is shown as follows: Total PBMCs (A); T cells, B cells, NK cells, and monocytes (B); and monocyte sub-populations, including classical, intermediate, and non-classical monocytes (C). Wilcoxon matched-paired signed rank tests were used. *p<0.05. Bars = median.

[0045] FIGURE 5 – Comparison of LC3B-II flux in different cell populations in whole blood (WB) and isolated PBMCs cultured in RPMI medium containing 10% FBS and presented as subpopulations of the following: NK cells (A) and B cells (B).

[0046] FIGURE 6 – Comparison of LC3B-II flux in different cell populations in whole blood (WB) and isolated PBMCs cultured in RPMI medium containing 10% FBS and presented as subpopulations of the following: T cells (A), CD4 T cells (B), and CD8 T cells (C).

[0047] FIGURE 7 – LC3B-II flux in different cell populations in whole blood and isolated PBMC cultured in diluted cognate plasma:DPBS (1:1) and presented as subpopulations of the following: NK cells (A) and B cells (B).

[0048] FIGURE 8 – LC3B-II flux in different cell populations in whole blood and isolated PBMC cultured in diluted cognate plasma:DPBS (1:1) and presented as subpopulations of the following: T cells (A), CD4 T cells (B), CD8 T cells (C).

[0049] FIGURE 9 – Basal physiological autophagic flux is intrinsically different in different cell types. Flow cytometry histogram representing LC3B-II fluorescent signal in whole blood treated with or without CQ (A). Summary data of LC3B-II flux in different cell populations, including T cells, B cells, NK cells, monocytes, and others (B). Measurement of LC3B-II flux was performed in N = 43 people and presented with median (Friedman test with multiple comparison, *p<0.05, **p<0.01, ***p<0.001).

[0050] FIGURE 10 – Basal physiological autophagic flux is intrinsically different in different cell types. Flow cytometry histogram representing LC3B-II fluorescent signal of monocyte sub-populations in whole blood treated with or without CQ including classical, intermediate, and non-classical monocytes (A). Summary data of LC3B-II flux in different sub-populations of monocytes (B). Measurement of LC3B-II flux was performed in N = 43 people and presented with median (Friedman test with multiple comparison, *p<0.05, **p<0.01, ***p<0.001).

[0051] FIGURE 11 – Basal physiological autophagic flux is intrinsically different in different cell types. Flow cytometry histogram representing LC3B-II fluorescent signal in different sub-populations of NK cells (A) and B cells (B). Measurement of LC3B-II flux was performed in N = 43 people and presented with median (Friedman test with multiple comparison and Wilcoxon matched-paired signed rank test analysis, *p<0.05, **p<0.01, ***p<0.001).

[0052] FIGURE 12 – Basal physiological autophagic flux is intrinsically different in different cell types. Flow cytometry histogram representing LC3B-II fluorescent signal in different sub-populations of T cells (A), CD4 T cells (B), and CD8 T cells (C). Measurement of LC3B-II flux was performed in N = 43 people and presented with median (Friedman test with multiple comparison, *p<0.05, **p<0.01, ***p<0.001).

[0053] FIGURE 13 – Plot representing LC3B-II flux of different cell populations including T cells, B cells, NK cells, monocytes, granulocytes and others (A). Distribution of LC3B-II flux of each population contributing to the total LC3B-II flux of the PBMC pool (excluding granulocytes): absolute number (B) and relative percentage (C).

[0054] FIGURE 14 – A heat map showing Spearman r value for the correlation between total LC3B-II flux and LC3B-II flux of individual cell populations including T cells, B cells, NK cells and monocytes (A) and flux of individual cell sub-populations (B).

[0055] FIGURE 15 – A heatmap representing the correlation matrix of individual cell populations and its corresponding sub-populations, including monocytes (A), NK cells (B), and B cells (C).

[0056] FIGURE 16 – A heatmap representing the correlation matrix of individual cell populations and its corresponding sub-populations, including T cells (A), CD4 T cells (B), and CD8 T cells (C).

[0057] FIGURE 17 – Autophagic flux in different cell types is correlated and shows sex- related differences. Graph showing the difference in LC3B-II flux between male and female in total PBMCs (A) and PBMC populations: T cells, B cells, NK cells and monocytes (B) and monocyte sub-populations (C) analysed by Mann-Whitney test, *p<0.05, **p<0.01. Bars = median.

[0058] FIGURE 18 – Autophagic flux increases with human age at the cell-type level. Linear regression between age and LC3B-II flux of total PBMCs (A); Monocytes (B); NK cells (C) CD8 T cells (D), TEMRA CD8 T cells (E) and TEMRA CD4 T cells (F); classical monocytes (G), intermediate monocytes (H) CD56dimCD16+NK cells (I), CD56dimCD16- NK cells (J), CD56hiCD16+NK cells (K) and CD56hiCD16- NK cells (L). r2and p value are displayed on graphs.

[0059] FIGURE 19 – Autophagic flux increases with human age at the cell-type level. Linear regression between age and proportions of cell populations of total PBMC pool including NK cells (A), memory B cells (B), non-classical monocytes (C), CD56dimCD16+NK cells (D) and TEMRA CD8 T cells (E). r2and p value are displayed on graphs.

[0060] FIGURE 20 – Analysis of LC3B-II flux of isolated PBMCs cultured under amino acid restriction. LC3B-II flux was measured in isolated PBMCs cultured in amino acid-free RPMI containing 10% dFBS (aa-) or the same medium spiked with amino acids (aa+) with or without BafA (N = 14) as follows: Total PBMCs (A), cell populations: T cells, B cells, NK cells, and monocytes (B), and monocyte sub-populations (C). Wilcoxon matched-paired signed rank test was used (*p<0.05, **p<0.01). Bars = median.

[0061] FIGURE 21 – Analysis of LC3B-II flux in different cell types in PBMCs cultured with glucose-free RPMI containing 10% dFCS (glucose-) or the same medium spiked with glucose (glucose+) (N = 8) and presented as follows: T cells, B cells, NK cells, and monocytes (A), and monocyte sub-populations (B).

[0062] FIGURE 22 – The differences observed in Figure 20 were further stratified into age group (20-35 and 35-50) and presented with LC3B-II flux of monocytes (A) and non- classical monocytes (B). Wilcoxon matched-paired signed rank test was used (*p<0.05, **p<0.01). Bars = median.

[0063] FIGURE 23 – The statistical differences in LC3B-II flux between aa- and aa+observed in Figure 20 were also analyzed with respect to sex for monocytes (A) and non- classical monocytes (B). Wilcoxon matched-paired signed rank test was used (*p<0.05, **p<0.01). Bars = median.

[0064] FIGURE 24 – The statistical differences in LC3B-II flux between aa- and aa+observed in Figure 20 were also analyzed with respect to sex for CD56dimCD16- (A) and CD56hiCD16+NK cells (B). Wilcoxon matched-paired signed rank test was used (*p<0.05, **p<0.01). Bars = median. DETAILED DESCRIPTION OF THE INVENTION

[0065] The present invention is based, in part, on the disclosure herein that autophagy is different in different subpopulations of whole blood cells, and that an intervention has the potential to change the fraction a sub-population occupies within the whole blood cell pool. Further, it has been discovered that different blood cell populations are differentially sensitive to nutritional cues. Specifically, the present disclosure establishes that different leukocytes possess intrinsically different rates of autophagic flux, and different leukocyte sub-populations are differentially sensitive to nutrient restriction.

[0066] Accordingly, certain disclosed embodiments of the present invention provide methods and products that have one or more combinations of advantages. For example, some of the advantages of the embodiments disclosed herein include one or more of the following: a sensitive and specific method for assessing autophagic flux in a subject; the identification of blood cell types that provide an accurate assessment of autophagic flux in response to varied physiological settings; improved methods for treating a subject found to be suffering from, or susceptible to, a disease confition or state associated with autophagic flux dysfunction; systems for assessing autophagic flux based on the identification of blood cell types that provide an accurate assessment of autophagic flux; methods of identifying a marker present in blood indicative of autophagic flux in a subject based on the identification of blood cell types that provide an accurate assessment of autophagic flux; improved compositions and kits for detecting autophagy; to address one or more problems in the art; to provide one or more advantages in the art; and / or to provide a useful commercial choice. Other advantages of certain embodiments are disclosed herein.

[0067] Accordingly, in a first aspect, the present invention provides a method of assessing autophagic flux in a subject, the method comprising determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, the level of the lysosomal system marker being determined based on the level of the marker following treatment of the sample of whole blood with an inhibitor of lysosomal system function.

[0068] As used herein, the term “autophagic flux” (or simply “autophagy”) refers to the activity of the lysosomal system. The lysosomal system comprises a series of organelles in the endocytic and autophagic pathways where various cargo molecules required for normal cellular function are internalized, sequestered, and recycled. The lysosomal system includes early endosomes, recycling endosomes, late endosomes, the lysosome, and autophagosomes which deliver intracellular contents to the lysosome. Maturation of endosomes and / or autophagosomes into a lysosome, or fusion with a lysosome creates an acidic environment within the cell for proteolysis and recycling of various cellular components. As such, “autophagic flux” refers to the sequestration of material in an autophagosome and its trafficking to the lysosome, whereupon fusion with the lysosome creates the autolysosome, which degrades the sequestered material.

[0069] The activity of the lysosomal system is likely influenced by individual genetic variation (such as genetic variation in lysosomal system genes that is known to associate with Alzheimer’s disease). It is also acutely impacted by changing physiological conditionsthat include the level and / or location of the various functions of the system, and includes, but is not limited to, activation of receptor signalling by ligands such as epidermal growth factor and insulin, or the activation of autophagy by calorie or protein restriction through activation of AMPK and the inhibition of mTOR. As such, lysosomal system function is also highly likely to be impacted by nutrition-related disorders in humans such as obesity and diabetes.

[0070] As described herein, the process of autophagic flux can be assessed or measured by comparing two replicate blood samples, one treated without, and one treated with, an inhibitor of lysosomal system function. With respect to the present invention, the steady state abundance of fusion proteins (for example singly fluorescent fusion proteins), endogenous autophagy proteins, or autophagy transcripts by themselves does not constitute measurement of autophagic flux.

[0071] The terms “physiological autophagic flux” and “physiological basal autophagic flux” as used herein refer to the measurement of autophagic flux in a tissue cultured in its native state. In the context of the present invention, use of an inhibitor of lysosomal system functon in whole blood satisfies this criterion. When artificial media is used, this changes the local environment and renders the measurement of autophagic flux non-physiological.

[0072] With respect to the present invention, the methods described herein permit assessing or determining autophagic flux in a subject using a marker that is indicative of lysosomal system function (herein referred to a “lysosomal system marker”). In this regard, it will be appreciated that the marker may be a marker directly associated with the activity of the lysosomal system, or alternatively may be a marker that is a proxy marker for the activity of the lysosomal system.

[0073] The methods described herein require determining the level of a lysosomal system marker. Where the marker is a particular gene or its encoded protein, the term “determining the level” includes: (1) measuring the level of transcription of the marker gene into a messenger RNA (mRNA) molecule; and / or (2) measuring the level of translation of the mRNA into the marker protein (i.e. measuring the level of marker protein per se). In effect, the level of a lysosomal system marker can be measured at the RNA and / or protein stages of expression.

[0074] Accordingly, in some embodiments, the lysosomal system marker is a protein. Methods for detecting and determining the level of protein markers are known in the art. Incertain embodiments, detection of a protein marker comprises immunological detection. Antibodies (and antigenic parts thereof) for use in immunological detection may be obtained commercially or produced by a method known in the art. Methods for detecting protein markers are described in further detail below.

[0075] In some embodiments, the lysosomal system marker is an RNA. Methods for detecting and determining the level of RNA markers are known in the art, such as Northern analysis, RNase protection and RT-PCR. In certain embodiments, detection of an RNA marker comprises RT-PCR detection. Primers for use with a reverse transcriptase and for PCR detection may be obtained commercially or produced by a method known in the art. Methods for detecting RNA markers are described in further detail below.

[0076] In some embodiments, the lysosomal system marker comprises a microtubule- associated protein 1 light chain 3 (MAP1LC3) protein, and / or a GABARAP / GATE-16 protein, and / or an MAP1LC3 or GABARAP / GATE-16 interacting cargo adaptor protein.

[0077] The MAP1LC3 protein in humans refers to one of three proteins: (1) MAP1LC3A (microtubule-associated protein 1 light chain 3 alpha – also known as MAP1ALC3, MAP1BLC3 – UniProtKB: Q9H492; NCBI Gene: 84557); (2) MAP1LC3B (microtubule- associated protein 1 light chain 3 beta – also referred to herein as LC3BII – UniProtKB: Q9GZQ8; NCBI Gene: 81631); and (3) MAP1LC3C (microtubule-associated protein 1 light chain 3 gamma – UniProtKB: Q9BXW4; NCBI Gene: 440738). In some embodiments, the lysosomal system marker comprises a MAP1LC3B protein.

[0078] The GABARAP / GATE-16 proteins in humans comprise: GABA Type A receptor- associated protein (GABARAP – UniProtKB: O95166; NCBI Gene: 11337); GABA Type A receptor-associated protein like 1 (GABARAPL1 – UniProtKB: Q9H0R8; NCBI Gene: 23710); and GABA Type A receptor-associated protein like 2 (GABARAPL2 – also known as GATE-16 – UniProtKB: P60520; NCBI Gene: 11345).

[0079] Examples of cargo adaptor proteins that interact with MAP1LC3 and / or GABARAP / GATE-16 proteins include, but are not limited to: Sequestosome 1 (SQSTM1 – also known as P62 – UniProtKB: Q13501; NCBI Gene: 8878); NBR1 autophagy cargo receptor (NBR1 – UniProtKB: Q14596; NCBI Gene: 4077); Optineurin (OPTN – UniProtKB: Q96CV9; NCBI Gene: 10133); Nuclear Dot Protein 52 (NDP52 – also known as CALCOCO2 – UniProtKP: Q13137; NCBI Gene: 10241); Calcium Binding And Coiled-Coil Domain 1 (CALCOCO1 – UniProtKB: Q9P1Z2; NCBI Gene: 57658); Nuclear ReceptorCoactivator 4 (NCOA4 – UniProtKB:Q13772; NCBI Gene: 8031); and Tax1-binding protein 1 (TAX1BP1 – UniProtKB: Q86VP1; NCBI Gene: 8887).

[0080] Orthologues of the aforementioned proteins in other species may be identified by a method known in the art. For example, the human gene symbol for the aforementioned proteins may be queried at the HUGO Gene Nomenclature Committee (HGNC – www.genenames.org) to reveal information about these genes in other species. In this regard, MAP1LC3A has orthologues in at least bovine (UniProtKB: Q2HJ23; NCBI Gene: 514547), horse (UniProtKB: F7B3R2; NCBI Gene: 100146217), chimpanzee (UniProtKB: K7BI42; NCBI Gene: 744937), canine (UniProtKB: F1Q4J5; NCBI Gene: 477201), cat (UniProtKB: M3XB56; NCBI Gene: 101085618), mouse (UniProtKB: Q91VR7; NCBI Gene: 66734), and rat (UniProtKB: Q6XVN8; NCBI Gene: 362245). Furthermore, MAP1LC3B has orthologues in at least bovine (UniProtKB: O41515; NCBI Gene: 408001), chimpanzee (UniProtKB: Q5ZLF8; NCBI Gene: 427559), canine (UniProtKB: A0A8C0JUI5; NCBI Gene: 479619), mouse (UniProtKB: Q9CQV6; NCBI Gene: 67443), and rat (UniProtKB: Q62625; NCBI Gene: 64862).

[0081] In some embodiments, the lysosomal system marker comprises a lipid. Methods for detecting and determining the level of lipids are known in the art. Other types of lysosomal system markers are known in the art, such as small molecules. Indeed, the type of lysosomal system marker is not limited by the present invention, provided that the marker is a marker indicative of lysosomal system function.

[0082] Methods for detecting and determining the level of a lysosomal system marker protein can be achieved a number of ways as would be understood by a person skilled in the art. Exemplary methods include, but are not limited to, antibody-based (immunoassay- based) testing techniques (including enzyme-linked immunosorbant assay (ELISA), immunocytochemical staining, Western blotting, immunoblotting, "sandwich" immunoassays, radioimmunoassay (RIA), immunoprecipitation, immunohistochemistry, immunofluorescence, dissociation-enhanced lanthanide fluoro immuno assay (DELFIA), precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, immunoradiometric assays and protein A immunoassays), fluorescence activated cell sorting (FACS) and flow cytometry assays, polystyrene and / or bead-based assays (such as Singleplex and Multiplex Luminex® assays), protein microarrays, mass spectrometry-based techniques (including liquid chromatography coupled to tandem mass spectrometry (LC- MS / MS), nano LC-MS / MS, matrix-assisted laser desorption / ionization mass spectrometry (MALDI-MS) as described in WO 2009 / 004576 (including surface enhanced laserdesorption / ionization mass spectrometry (SELDI-MS), surface-enhanced affinity capture (SEAC), surface-enhanced need desorption (SEND) or surface-enhanced photo label attachment and release (SEPAR)), matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry, proteomics techniques, surface plasmon resonance (SPR), versatile fibre-based SPR, chemiluminescence, fluorescent polarization, phosphorescence, microcytometry, and microscopy. These techniques are known in the art.

[0083] In some embodiments, the methods of the present invention comprise determining the level of the lysosomal system marker protein using immunological detection. In certain embodiments, the immunological detection comprises ELISA or immunocytochemical staining. In some embodiments, the immunological detection comprises Western blotting.

[0084] In embodiments where ELISA is used for detection and analysis of the MAP1LC3B protein, it will be appreciated that typically a further reagent is used in conjunction with the regular reagents of an ELISA protocol, namely a saponin or a saponin-like detergent to remove soluble LC3B before use of a lysis reagent for homogenisation and analysis of the MAP1LC3B protein, which is known in the art.

[0085] With respect to antibody-based immunological detection methods such as ELISA, immunocytochemical staining, immunohistochemistry and immunoblotting, antibodies or antisera specific for the lysosomal system marker protein can be used to detect levels of the protein. Immunological detection methods are described, for example, in “Assay Guidance Manual” Sittampalam GS, Grossman A, Brimacombe K, et al., editors. Bethesda (MD): Eli Lilly & Company and the National Center for Advancing Translational Sciences; 2004-.

[0086] These techniques typically rely on the antibodies being detectably labelled. The antibody can be labelled by covalently or non-covalently combining the antibody with a substance or ligand that provides, or enables the generation of, a detectable signal. Some examples include, but are not limited to, radioactive isotopes, enzymes, fluorescent substances, luminescent substances, ligands, microparticles, redox molecules, substrates, cofactors, inhibitors, magnetic particles and the like. Examples of the radioactive isotopes include, but are not limited to,3H,12C,13C,32P,35S,36Cl,51Cr,57Co,58Co,59Fe,90Y,125I,131I, and186Re. Examples of enzymes available as detection labels include, but are not limited to, β-glucuronidase, β-glucosidase, β-galactosidase, urease, peroxidase or alkaline phosphatase, acetylcholinesterase, glucose oxidase, hexokinase and GDPase, RNase,glucose oxidase and luciferase, phosphofructokinase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphenolpyruvate decarboxylase, and β-latamase. Examples of the fluorescent substances include, but are not limited to, fluorescin, isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamin. Examples of luminescent substances include, but are not limited to, acridinium esters, luciferin and luciferase. Examples of ligands include, but are not limited to, biotin and its derivatives. Examples of the microparticles include, but are not limited to, colloidal gold and colored latex. Examples of the redox molecules include, but are not limited to, ferrocene, ruthenium complexes, viologen, quinone, Ti ions, Cs ions, diimide, 1,4- benzoquinone, hydroquinone, K4W(CN)8, [Os(bpy)3]2+, [RU(bpy)3]2+, and [MO(CN)8]4-. Alternatively, unlabelled primary antibody may be used in conjunction with a labelled secondary antibody that is specific for the primary antibody. Immunohistochemistry protocols and kits are well known in the art and are commercially available.

[0087] The term “antibody” is used herein in the broadest sense and encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as linear antibodies, single-chain antibody molecules, Fc or Fc' peptides, Fab, Fab', F(ab')2, and Fv fragments), single chain Fv (scFv) mutants, multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, fusion proteins comprising an antibody portion, and any other modified immunoglobulin molecule comprising an antigen recognition site so long as the antibodies exhibit the desired binding specificity for the lysosomal system marker protein. An antibody can be one of any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2), based on the identity of their heavy-chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively. The different classes of immunoglobulins have different and well-known subunit structures and three- dimensional configurations.

[0088] In some embodiments, the antibody may be a humanised antibody. A "humanised" antibody is an antibody that retains the reactivity of a non-human antibody while being less immunogenic in humans. This can be achieved, for example, by retaining the non-human CDR regions and replacing the remaining parts of the antibody with their human counterparts. See for example Morrison et al., 1984, Proc. Natl. Acad. Sci. USA, 81: 6851- 6855; Morrison and Oi, 1988, Adv. Immunol., 44: 65-92; Verhoeyen et al., 1988, Science, 239: 1534-1536; Padlan, 1991, Molec. Immun., 28: 489-498; and Padlan, 1994, Molec. Immun., 31: 169-217.

[0089] In some embodiments, the antibody may be a fully human antibody. As would be understood by a person skilled in the art, a fully human antibody is an antibody in which both the variable and constant regions are of human origin. Methods for producing or identifying such antibodies are described below.

[0090] Additional antibody types are also contemplated by the present invention. These include antibodies sourced from a non-mammalian animal such as a cartilaginous fish (e.g. shark IgNAR antibodies – see WO2012 / 073048) or modified human protein scaffolds that provide functionality similar to shark antibodies, such as i-bodies which have binding moieties based on shark IgNAR antibodies (see WO2005 / 118629).

[0091] Antibodies for any of the methods and applications referred to herein can be produced according to well-established techniques in the art. For example, various hosts including rabbits, rats, goats, mice, humans, and others may be immunised by injection with a lysosomal system marker protein or with any fragment, peptide or oligopeptide thereof which has immunogenic properties. Various adjuvants may be used to increase immunological response and include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface-active substances such as lysolecithin. Adjuvants used in humans include BCG (bacilli Calmette-Guerin) and Corynebacterium parvum.

[0092] It is preferred that lysosomal system marker oligopeptides, peptides, or fragments used to induce antibodies, have an amino acid sequence consisting of at least 5 amino acids, and, more preferably, of at least 10 amino acids of the native protein. It is also preferable that these oligopeptides, peptides, or fragments are identical to a portion of the amino acid sequence of the native protein and contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of amino acids from the relevant marker protein may be fused with those of another protein, such as keyhole limpet haemocyanin (KLH), and antibodies to the chimeric molecule may be produced.

[0093] Monoclonal antibodies to a lysosomal system marker protein may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (for example, see Kohler et al., 1975, Nature 256: 495-497; Kozbor et al., 1985, J. Immunol. Methods 81:31-42; Cote et al., 1983, Proc. Natl. Acad. Sci. USA 80: 2026-2030; and Cole et al., 1984, Mol. Cell Biochem.62: 109-120).

[0094] Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (for example, see Orlandi et al., 1989, Proc. Natl. Acad. Sci. USA 86: 3833-3837; and Winter and Milstein, 1991, Nature 349: 293-299). Antibodies may also be generated using phage display. For example, functional antibody domains are displayed on the surface of phage particles that carry the polynucleotide sequences encoding them. Such phage can be utilized to display antigen-binding domains expressed from a repertoire or combinatorial antibody library (e.g. human or murine). Phage expressing an antigen binding domain that binds to a relevant lysosomal system marker protein can be selected or identified using the marker protein or a portion thereof. Phage used in these methods are typically filamentous phage including fd and Ml 3 binding domains expressed from phage with Fab, Fv or disulfide stabilised Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein. Examples of phage display methods that can be used to make lysosomal marker protein antibodies may include those disclosed in Brinkman et al., 1995, J. Immunol. Methods 182: 41-50; Ames et al., 1995, J. Immunol. Methods 184: 177-186; Kettleborough et al., 1994, Eur. J. Immunol.24: 952-958; Persic et al., 1997, Gene 187: 9-18; Burton et al., 1994, Advances in Immunology 57: 191-280; PCT application number PCT / GB91 / 01134; PCT publications numbers WO 90 / 02809; WO 91 / 10737; WO 92 / 01047; WO 92 / 18619; WO 93 / 11236; WO 95 / 15982; WO 95 / 20401; and US Patent Numbers 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.

[0095] Techniques which can be used to produce single-chain Fvs and antibodies include those described in US Patent Numbers 4,946,778 and 5,258,498; Huston et al., 1991, Methods in Enzymology 203: 46-88; Shu et al., 1993, Proc. Natl. Acad. Sci. USA 90: 7995- 7999; and Skerra et al., 1988, Science 240: 1038-1040.

[0096] Antibody fragments which contain specific binding sites for a relevant lysosomal system marker protein may be generated using standard techniques known in the art. For example, F(ab')2 fragments may be produced by pepsin digestion of a marker protein antibody molecule and Fab fragments generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (for example, see Huse et al., 1989, Science 246: 1275-1281).

[0097] Fully human lysosomal system marker protein antibodies may be produced using a number of techniques. These include using display technologies as mentioned above in which human antibodies or antibody fragments are displayed on the surface of a phage for example. In another method (Lonberg N, 2008, Handb. Exp. Pharmacol., 69-97), first generation human antibodies to a lysosomal system marker protein may be produced by utilising transgenic animals that produce antibodies from human genes. When challenged with an antigen (i.e. a lysosomal system marker protein or an oligopeptide, peptide, or fragment thereof), these animals produce human antibodies avoiding the humanisation steps. Human antibodies can also be produced from B cells isolated from humans using a technique described in Crowe JE Jr, 2009, Vaccine 27: 47-51. Other techniques for human antibody production are described in PCT international publication number WO 2013 / 168150 and Duvall M et al., 2011, mAbs 3(2): 203-208, amongst others. For example, Duvall et al utilises technology which produces human IgG antibody libraries from naïve B cells isolated from human tonsil tissue. The antibodies are produced from human genes and are therefore 100% human antibodies.

[0098] Antibodies to a lysosomal system marker protein may also be purchased from commercial sources. For example, in embodiments where the lysosomal system marker protein is MAP1LC3B, antibodies to the protein can be purchased from sources such as Cell Signalling Technology (Danvers, MA, USA – LC3B (E5Q2K) Mouse mAb (Alexa Fluor 647 Conjugate), Santa Cruz Biotechnology Inc. (Dallas, TX, USA – LC3B Mouse mAB (G- 2): sc-271625), and ThermoFisher Scientific (Waltham, MA, USA - LC3B Rabbit polyclonalAB, Cat# PA1-16930), amongst others. Additional commercial sources of antibodies to MAP1LC3B protein may also be identified through GeneCards (www.genecards.org / cgi-bin / carddisp.pl?id_type=hgnc&id=13352).

[0099] Methods for detecting and determining the level of a lysosomal system marker RNA (i.e. at the transcriptional level) can be achieved a number of ways as would be understood by a person skilled in the art. For example, levels of marker mRNA may be measured by techniques which include, but are not limited to, Northern blotting, RNA in situ hybridisation, reverse-transcriptase PCR (RT-PCR), real-time (quantitative) RT-PCR, microarrays, or “tag based” technologies such as SAGE (serial analysis of gene expression). Microarrays and SAGE may be used to simultaneously quantitate the expression of more than one lysosomal system marker gene. Primers or probes may be designed based on nucleotide sequences of the relevant marker genes or transcripts thereof. Methodology similar to that disclosed in Paik et al., 2004 (NEJM, 351(27): 2817-2826), or Anderson et al., 2010 (Journal of Molecular Diagnostics, 12(5): 566-575) may be used to measure RNA expression levels.Many methods are also disclosed in standard molecular biology text books such as Green MR and Sambrook J, Molecular Cloning: A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press, 2012.

[0100] With respect to RT-PCR, the first step is typically the isolation of total RNA from the relevant blood cell type under investigation. Messenger RNA (mRNA) may be subsequently purified from the total RNA sample. The total RNA sample (or purified mRNA) is then reverse transcribed into cDNA using a suitable reverse transcriptase. The reverse transcription step is typically primed using oligo-dT primers, random hexamers, or primers specific for the relevant marker gene, depending on the RNA template. The cDNA derived from the reverse transcription reaction then serves as a template for a typical PCR reaction. In this regard, two oligonucleotide PCR primers specific for the relevant marker gene are used to generate a PCR product. A third oligonucleotide, or probe, designed to detect a nucleotide sequence located between the other two PCR primers is also used in the PCR reaction. The probe is non-extendible by the Taq DNA polymerase enzyme used in the PCR reaction, and is labelled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together, as they are on the probe. During the PCR amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template- dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is freed from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.

[0101] In real-time RT-PCR the amount of product formed, and the timing at which the product is formed, in the PCR reaction correlates with the amount of starting template. RT- PCR product will accumulate quicker in a sample having an increased level of mRNA compared to a standard or “normal” sample. Real-time RT-PCR measures either the fluorescence of DNA intercalating dyes such as Sybr Green into the synthesized PCR product, or can measure PCR product accumulation through a dual-labelled fluorigenic probe (i.e. TaqMan probe). The progression of the RT-PCR reaction can be monitored using PCR machines such as the Applied Biosystems' Prism 7000 or the Roche LightCycler which measure product accumulation in real-time. Real-time RT-PCR is compatible both with quantitative competitive PCR and with quantitative comparative PCR. The former uses an internal competitor for each target sequence for normalization, while the latter uses a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.

[0102] The production and application of microarrays for measuring the level of expression of a relevant lysosomal system marker gene at the transcriptional level are well known in the art. In general, in a microarray, a nucleotide sequence (for example an oligonucleotide, a cDNA, or genomic DNA) representing a portion, or all, of the relevant marker gene would occupy a known location on a substrate. Typically, the substrate includes a multitude of nucleotide sequences such that other relevant marker genes can be assayed simultaneously. A nucleic acid target sample (for example total RNA or mRNA) obtained from a blood cell source under analysis is then hybridized to the microarray and the amount of target nucleic acid hybridized to each probe on the array is quantified and compared to the hybridisation which occurs to a standard or “normal” sample. One exemplary quantifying method is to use confocal microscope and fluorescent labels. The Affymetrix GeneChip™ Array system (Affymetrix, Santa Clara, California, USA) and the Atlas™ Human cDNA Expression Array system are particularly suitable for quantifying the hybridization; however, it will be apparent to those of skill in the art that any similar systems or other effectively equivalent detection methods can also be used. Fluorescently labelled cDNA probes may also represent the nucleic acid target sample. Such probes can be generated through incorporation of fluorescent nucleotides during reverse transcription of total RNA or mRNA extracted from a blood sample of the subject to be tested. Labelled cDNA probes applied to the microarray will hybridize with specificity to the equivalent spot of DNA on the array. Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance in the sample compared to the abundance observed in a standard or “normal” sample. With dual colour fluorescence, separately labelled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously.

[0103] Detection and quantification of a relevant lysosomal system marker gene at the transcriptional level can also be achieved through the use of next-generation sequencing technologies, such as the RNA-Seq (RNA sequencing) methodology. Kits and protocols for adopting this technology can be purchased commercially from sources such as Illumina, Inc. (San Diego, CA, USA). The technology involves total RNA isolation from the source under investigation (such as T lymphocytes or monocytes from whole blood), optional RNA selection to analyse the signal of interest (i.e. the lysosomal system marker gene of interest), cDNA synthesis from reverse transcription of the RNA, sequencing of the cDNA synthesised, and then analysis of the sequence reads (including transcriptome assembly, gene expression quantification, differential expression, and the like). The methodology for conducting these techniques is known in the art (for a summary of methods seewww.illumina.com / content / dam / illumina- marketing / documents / products / research_reviews / rna-sequencing-methods-review- web.pdf).

[0104] The methods of the present invention comprise determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from a subject being tested. The methods therefore require identifying and / or isolating these blood cell types from whole blood cell populations in order to determine the level of the marker in these cells. Methods for doing so are known in the art and include flow cytometry, identification of specific cell types based on the expression of proteins on the surface of the cells, isolation and purification of said identified cell types using techniques such as magnetic bead purification or similar techniques, coupled with ELISA.

[0105] Isolation of the specific blood cell types for analysis can first encompass red blood cell depletion from the whole blood sample of the subject. There are several methods to deplete red blood cells, including red blood cell lysis with ammonium chloride (which maintains leukocytes intact), dextran sedimentation (Hardwicke J et al., “Effect of dextran of various molecular sizes on erythrocyte sedimentation rate, 1950, Nature, 166: 988-989), use of HetaSepTM(StemCell Technologies, Vancouver, BC, Canada - Cat#07806), immunomagnetic cell separation (for example using the EasySepTMRBC Depletion Reagent – StemCell Technologies, Vancouver, BC, Canada - Cat#18170), or hypotonic lysis.

[0106] After the red blood cell depletion is complete, the resulting sample will contain peripheral blood mononuclear cells (PBMCs) which includes all nucleated white blood cells (leukocytes). PBMCs include lymphocytes (i.e. T cells, B cells, and NK cells), monocytes, and dendritic cells, and are defined as white blood cells with round nuclei. Preparation of a PBMC fraction from whole blood is a common step prior to the isolation of specific immune cell subsets. The most common PBMC isolation method involves using a density gradient medium (e.g. Ficoll™ or Lymphoprep™ (StemCell Technologies, Vancouver, BC, Canada - Cat#07811) and centrifugation. This method takes advantage of the differences in density between the cells in blood and the density gradient medium. After obtaining PBMCs, immunomagnetic cell separation and other cell sorting techniques can be used to isolate specific cell subsets.

[0107] Methods of cell separation and cell sorting typically fall into two major categories – fluorescence activated cell sorting (FACS) and immunomagnetic cell sorting. With respect to FACS (which is also known as flow cytometry cell sorting), the technique uses flowcytometry to separate cells based on morphological parameters and the expression of multiple extracellular and intracellular proteins. This method allows multiparameter cell sorting and involves encapsulating cells into small liquid droplets which are selectively given electric charges and sorted by an external electric field. Fluorescence activated cell sorting has several systems that work together to achieve successful sorting of events of interest. These include fluidic, optical, and electrostatic systems. The fluidic system has to establish a precisely timed break off from the liquid stream in small uniform droplets, so that droplets containing individual cells can then be deflected electrostatically. Droplet formation of the liquid jet of a cell sorter is stabilized by vibrations of an ultrasonic transducer at the exit of the nozzle orifice. The disturbances grow exponentially and lead to break up of the jet in droplets with precise timing. A cell of interest that should be sorted is measured at the sensing zone and moves down the stream to the breakoff point. During the separation of the droplet with the cell in it from the intact liquid jet, a voltage pulse is given to the liquid jet so that droplets containing the cells of interest can be deflected in an electric field between two deflection plates for sorting. The droplets are then caught by collection tubes or vessels placed below the deflection plates. Pre-enrichment of a blood cell population of interest may also be utilized (for example by immunomagnetic cell sorting – see further below), particularly when the target cells are comparatively rare and a large batch of cells is to be processed.

[0108] A variety of fluorescent dyes (flurochromes) can be used in FACS to design multi- color panels to achieve successful, simultaneous sorting of multiple, precisely defined cell- types. Generally, a fluorescent dye will be excited by a light source (a laser) at a particular wavelength and emit light at a lower energy and longer wavelength. The most common dyes act by binding to antigens presented on cells through an antibody coupled to the fluorescent dye. Common cell surface antigens targeted are clusters of differentiation (CDs) which are specific for particular cell types.

[0109] With respect to T lymphocytes, common CD antigens targeted for sorting can include CD3, CD56, CD4, CD8, CD25, CD127, and CD45RA. Sorting T lymphocytes though the use of other cell surface proteins can also be utiised, for example C-C chemokine receptor type 7 (CCR7). The expression pattern of these cell surface antigens dictates the T lymphocyte type, namely, natural killer T (NKT) cells (CD3+CD56+) and conventional T cells (CD3+CD56-). Conventional T cells can then be further sorted into sub-populations such as CD4 and CD8 T cells, with CD4 T cells (CD3+CD4+) capable of further sorting into Treg cells (CD25+CD127low / -), naïve (CD45RA+CCR7+), central memory (CD45RA-CCR7+), effector memory (CD45RA-CCR7+), and terminally differentiated effector memory (TEMRA;CD45RA+CCR7-) cells. CD8 T cell sub-populations, include naïve (CD45RA+CCR7+), central memory (CD45RA-CCR7+), effector memory (CD45RA-CCR7+), and TEMRA (CD45RA+CCR7-) cells based on CD45RA and CCR7 expression.

[0110] With respect to natural killer (NK) cells, common CD antigens targeted for sorting can include CD3, CD56 and CD16. NK cells can be categorized into CD56hiCD16-, CD56hiCD16+, CD56dimCD16- and CD56dimCD16+sub-populations.

[0111] With respect to monocytes, common CD antigens targeted for sorting can include CD3, CD56, CD14, CD16, CD19 and CD27. For example, monocytes can be identified based on a CD3-CD56-CD14+expression pattern and can be further divided into classical monocytes (CD14+CD16-), intermediate monocytes (CD14+CD16+), and non-classical monocytes (CD14lowCD16+).

[0112] With respect to B cells, common CD antigens targeted for sorting can include CD3, CD56, CD14, CD19 and CD27. For example, B cells can be identified based on a CD3- CD56-CD14-CD19+expression pattern and can be subsequently characterized into naïve (CD19+CD27-) and memory B cells (CD19+CD27+).

[0113] Antibodies for detecting these CD and other cell surface antigens can be produced using the methods described herein, or can be purchased from a number of commercial sources, as would be understood by those skilled in the art. These antibodies are typically conjugated to different fluorochromes, such as BUV395, BUV615, BUV496, BUV805, BV421, BV480, BV786, BV750, FITC, BB700, PE, PE-CF594, PE-Cy7, Live / dead 780, and Alexa647 to assist in the FACS procedure.

[0114] In some embodiments, the methods of the present invention comprise determining the level of the lysosomal system marker using flow cytometry. Techniques for conducting flow cytometry are described above and are known in the art. An exemplary text includes Teresa S Hawley and Robert G Hawley (Editors), 2017, Flow Cytometry Protocols Fourth Edition, Springer Protocols, Humana Press. See also https / / biotech.ufl.edu / wp- content / uploads / 2021 / 04 / flow-cytometry-basics-guide.pdf. Once a particular blood cell type has been isolated, the level of a relevant lysosomal system marker in that cell type can be determined using the techniques described above.

[0115] As indicated above, immunomagnetic cell sorting is another technique to identify and isolate particular blood cell types, such as T lymphocytes and monocytes, for use in thepresent invention. Immunomagnetic cell sorting is also known as immunomagnetic cell separation, immunomagnetic cell enrichment, or magnetic-activated cell sorting, and commonly known by the acronym MACS. Immunomagnetic cell sorting provides a method for enriching a heterogeneous mixture of cells based on cell-surface protein expression, as per the FACS methodology (see above). MACS is based on the attachment of small, inert, supra-magnetic particles to antibodies specific for antigens on the target cell population (such as CD antigens as described above). Cells labelled with these antibody-bead conjugates are then separated via a column containing a ferromagnetic matrix. By applying a magnetic field to the matrix, the beads stick to the matrix inside the column and the bead- carrying cells are held back from passing through. Unlabelled cells can pass through the matrix and are collected in the flow-through. To elute the trapped cells from the column, the magnetic field is simply removed. Immunomagnetic cell sorting therefore enables different strategies for positive enrichment or depletion of cells.

[0116] Techniques for conducting Immunomagnetic cell sorting are known in the art. Exemplary texts include Wang ECY et al., “Cell sorting using immunomagnetic beads”, Methods in Molecular Biology: Immunochemical Protocols, 1992, Volume 10, ISBN: 978-0- 89603-204-0; Legut M and Canjana NE, 2019, “Immunomagnetic cell sorting”, Nature Biomedical Engineering, 3: 759-760; and Witek MA et al., 2020, “Cell separations and sorting”, Analytical Chemistry, 92: 105-131.

[0117] The methods of the present invention require determining the level of the lysosomal system marker following treatment of the sample of whole blood with an inhibitor of lysosomal system function. In some embodiments, the inhibitor of lysosomal system function comprises one or more of chloroquine, hydroxychloroquine, bafilomycin A1, E-64d, leupeptin, pepstatin A, and concanamycin A. Such agents are known in the art and may be obtained commercially or obtained by a method known in the art. Other inhibitors are contemplated. Methods for determining the ability of an agent to act as an inhibitor of lysosomal system function are known in the art.

[0118] In some embodiments, the inhibitor of lysosomal system function comprises chloroquine (also referred to herein as “CQ”) and / or bafilomycin A1.

[0119] A suitable concentration of the inhibitor to be used for treating whole blood may be selected.

[0120] In some embodiments, the inhibitor of lysosomal system function comprises chloroquine. In some embodiments, the concentration of chloroquine to be used in treating whole blood is in the range from about 10 µM to 300 µM. In some embodiments, the concentration of chloroquine to be used in treating whole blood is in the range from one of about 10 µM to 250 µM, about 10 µM to 200 µM, about 50 µM to 300 µM, about 50 µM to 250 µM, or about 50 µM to 200 µM. Other ranges are contemplated. In some embodiments, the concentration of chloroquine to be used in treating whole blood is about 150 µM.

[0121] In some embodiments, the inhibitor of lysosomal system function comprises bafilomycin A1. In some embodiments, the concentration of bafilomycin A1 to be used in treating whole blood is in the range from about 50 nM to 800 nM. In some embodiments, the concentration of bafilomycin A1 to be used in treating whole blood is in the range from one of about 50 nM to 800 nM, about 50 nM to 500 nM, about 50 nM to 400 nM, about 50 nM to 300 nM, about 50 nM to 200 nM, or about 50 nM to 200 nM. Other ranges are contemplated. In some embodiments, the concentration of bafilomycin A1 to be used in treating whole blood is about 200 nM.

[0122] In some embodiments, the whole blood sample is treated with the inhibitor of lysosomal system function for a time of about 2 hours or less, about 90 minutes or less, about 60 minutes or less, about 45 minutes or less, about 30 minutes or less, or about 15 minutes or less.

[0123] In some embodiments, the whole blood sample is treated with the inhibitor of lysosomal system function for a time of at least about 15 minutes, at least about 30 minutes, at least about 45 minutes, at least about 60 minutes, at least about 90 minutes or at least about 2 hours.

[0124] In some embodiments, the whole blood sample is treated with the inhibitor of lysosomal system function for a period of time of time ranging from about 15 minutes to 2 hours, about 30 minutes to 2 hours, about 45 minutes to 2 hours, about 60 minutes to 2 hours, about 90 minutes to 2 hours, about 15 minutes to 90 minutes, about 30 minutes to 90 minutes, about 45 minutes to 90 minutes, about 60 minutes to 90 minutes, about 15 minutes to 60 minutes, about 30 minutes to 60 minutes, about 15 minutes to 45 minutes, about 30 minutes to 45 minutes, or about 15 to 30 minutes. In some embodiments, the whole blood sample is treated with the inhibitor of lysosomal system function for a period of about 60 minutes.

[0125] Methods for obtaining samples from blood are known in the art. Blood samples obtained from a subject may be processed as described herein. A suitable amount of blood may be used for analysis in the present disclosure. In this regard, typically about 6 ml of blood is used, which is split in two 3 ml samples, one 3 ml sample without the inhibitor and one 3 ml sample with the lysosomal system function inhibitor (eg chloroquine, bafolimycin). However, it will be appreciated that the amount of blood used for analysis may be reduced. In this regard, an amount of 1 ml or less of blood can be used, for example when testing children or babies.

[0126] In some embodiments, the sample of whole blood is exposed to, or treated with, the inhibitor of lysosomal system function as soon as it is collected.

[0127] In some embodiments, the sample of whole blood is stored at reduced temperature, such as about 4oC or below, for about 4 hours or less, about 3 hours or less, about 2 hours or less, about 1 hour or less, or about 30 minutes or less before being treated with the inhibitor of lysosomal system function.

[0128] In some embodiments, the sample of blood is placed into a collection container already containing the inhibitor of lysosomal system function at the time of sampling.

[0129] In some embodiments, the sample of whole blood is treated with an anti-coagulant. In some embodiments, the sample of whole blood is treated with lithium heparin. In some embodiments, the sample of whole blood is treated with EDTA.

[0130] In some embodiments, the methods of the present invention comprise a comparison of the determined level of the lysosomal system marker with the level of the marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject that has not been treated with an inhibitor of lysosomal system function. In some embodiments, the method comprises comparison of the level of the lysosomal system marker before and after treatment with an inhibitor of lysosomal system function. In some embodiments, the method comprises comparison of the level of the lysosomal system marker with the level of a different marker in T lymphocytes and / or monocytes in a sample of whole blood that has not been treated with an inhibitor of lysosomal system function. In some embodiments, the method comprises comparison of the level of the lysosomal system marker with a known level of that marker.

[0131] A comparison between the level of the lysosomal system marker in T lymphocytes and / or monocytes in the two sample types (inhibitor vs no inhibitor) enables autophagic flux to be assessed and quantified as follows: Autophagic flux (ΔX) = X[+I] – X[-I]

[0132] In the equation above, X represents the level of the lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject treated with an inhibitor of lysosomal system function (+I) or without an inhibitor of lysosomal system function (-I).

[0133] In an embodiment where the lysosomal system marker is MAP1LC3B and the inhibitor of lysosomal system function is chloroquine (CQ), autophagic flux to be assessed and quantified as follows: Autophagic flux (ΔMAP1LC3B) = MAP1LC3B[+CQ] – MAP1LC3B[-CQ]

[0134] It is to be made clear that the sample of whole blood from the subject, or T lymphocytes and / or monocytes isolated and sorted therefrom, that is analysed by the methods of the present invention may have previously been obtained from the subject, and, for example, may have been stored in an appropriate repository. In this instance, the sample or cells therefrom would have been obtained from the subject in isolation of, and therefore separate to, the methods of the present invention. Accordingly, the methods of the aforementioned aspects of the invention can be practiced wholly in vitro.

[0135] As described herein, it has been found that monocytes and monocyte sub-types, particularly non-classical monocytes, exhibited a significant reduction in MAP1LC3B (LC3BII) flux in nutrient-rich artificial media or plasma compared with whole blood. Autophagic flux in non-classical monocytes appeared particularly sensitive to different nutritional conditions, and in the absence of amino acids autophagic flux increased in non- classical monocytes. This means that measurement of autophagic flux in monocytes, and in particular non-classical monocytes, is especially relevant to monitoring autophagy for nutrient intervention studies and during nutrient restriction in subjects.

[0136] Accordingly, in some embodiments of the methods of the present invention, the level of the lysosomal system marker is determined in monocytes in the sample of whole blood.In some embodiments, the sample of whole blood is from a subject who has undergone nutrient restriction. In some embodiments, the monocytes are non-classical monocytes.

[0137] As described herein, it has been found that T lymphocyte autophagic flux remained stable across different conditions, and in particular autophagic flux in T lymphocytes did not vary much in response to the changing nutritional environments. This means that T lymphocytes could be especially well placed for measurement of autophagic flux with regards to factors such as ageing, sex, and ethnicity.

[0138] Accordingly, in some embodiments of the methods of the present invention, the level of the lysosomal system marker is determined in T lymphocytes in the sample of whole blood. In some embodiments, the sample of whole blood is from a subject who has not undergone nutrient restriction.

[0139] As used herein, the term “subject” refers to any animal (e.g. a mammal), including, but not limited to humans, non-human primates, dogs, horses, cattle, sheep, pigs, rodents, and any other animal in which autophagy manifests. Therefore, it should be appreciated that the methods of the present invention are not limited to humans.

[0140] In some embodiments, the subject is a human subject, for example an adult human subject. In some embodiments, the subject is a paediatric subject or a neonatal subject. In some embodiments, the subject is suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction.

[0141] In some embodiments, the subject is a subject for which assessment of lysosomal system flux provides information as to the state of the subject. In certain embodiments, the subject is a subject for which information on lysosomal system flux is required for diagnostic or prognostic purposes. In certain embodiments, the subject is a subject for which information on lysosomal system flux is required for treatment purposes.

[0142] Accordingly, in some embodiments the methods of the present invention include the further step of treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction based on the level of the lysosomal system marker following treatment of the sample of whole blood from the subject with an inhibitor of lysosomal system function.

[0143] In some embodiments, a disease, condition or state associated with autophagic flux dysfunction may include, but is not limited to, obesity, diabetes, ageing, lysosomal storage diseases, cardiovascular diseases, Alzheimer’s disease, Parkinson’s disease, frontotemporal dementia, and motor-neuron disease, all of which are likely to be caused by, or exacerbated by low autophagic flux. It is highly likely that other diseases of ageing are also exacerbated by low autophagic flux. Another disease associated with autophagic flux dysfunction is cancer, wherein the disease can be exacerbated by the process of autophagy. In this setting, autophagy can assist cancerous cells survive and resist treatment by providing them with nutrients and removing toxic substances.

[0144] Methods of treatment of these diseases, conditions or states are also known in the art. For example, certain diseases, conditions or states will require a treatment that increases autophagic flux in the subject, such as through the use of a promoter of autophagic flux (e.g. rapamycin). For other states, such as cancer, the treatment will ideally decrease autophagic flux, such as through the use of an inhibitor of autophagic flux (e.g. inhibitors of Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3 (PIK3C3) such as SAR405). Other promoters and inhibitors of autophagic flux are known in the art.

[0145] Methods for identifying subjects suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction are known in the art.

[0146] Accordingly, in a further aspect the present invention provides a method of treating a subject suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction, the method comprising assessing autophagic flux in the subject by the method as described above, and treating the subject on the basis of the level of autophagic flux assessed.

[0147] In a specific aspect, the present invention provides a method of treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction, wherein the level of autophagic flux in the subject has been assessed by a method comprising determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, the level of the lysosomal system marker being determined based on the level of the marker following treatment of the sample of whole whole blood with an inhibitor of lysosomal system function, and treating the subject on the basis of the level of autophagic flux assessed.

[0148] In a still further specific aspect, the present invention provides a method of treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction, wherein the level of autophagic flux in the subject has been assessed by a method comprising: (i) obtaining a sample of whole blood from the subject; (ii) treating the sample of whole blood with an inhibitor of lysosomal system function; (iii) determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in the whole blood so treated as compared to the level of the lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject that has not been treated with an inhibitor of lysosomal system function; and (iv) treating the subject on the basis of the level of autophagic flux assessed.

[0149] In a further aspect, the present invention provides a lysosomal system marker for use in, or when used for, assessing autophagic flux in a subject by the method as described above.

[0150] In a still further aspect, the present invention provides use of a lysosomal system marker to assess the level of autophagic flux in a subject, wherein the level of autophagic flux in the subject has been assessed by a method comprising determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, the level of the lysosomal system marker being assessed based on the level of the marker following treatment of the sample of whole blood with an inhibitor of lysosomal system function.

[0151] In a further aspect, the present invention provides a system for assessing autophagic flux in a subject. In some embodiments, the system comprises: (i) a processor for receiving data indicative of a level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, wherein the sample of whole blood has been treated with an inhibitor of lysosomal system function; and (ii) a memory with software resident in the memory, and accessible to the processor, wherein the software comprises a series of instructions executable by the processor to convert the data to a measurement of autophagic flux in the subject.

[0152] In some embodiments, the system comprises a device. Suitable devices are described herein. In this regard, in a further aspect the present invention provides a system for assessing autophagic flux in a subject, the system comprising: (i) a device for determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, wherein the sample of whole blood has been treated with an inhibitor of lysosomal system function; (ii) a processor for receiving data from the device indicative of the level of the lysosomal system marker; and (iii) a memory with software resident in the memory, and accessible to the processor, wherein the software comprises a series of instructions executable by the processor to convert the data to a measurement of autophagic flux in the subject.

[0153] In some embodiments, the device for determining the level of a lysosomal system marker comprises a device for utilising immunological detection. Examples include ELISA based assays or flow cytometric techniques, as described above.

[0154] In some embodiments, the system further comprises one or more further devices as described herein. In some embodiments, a further device comprises a device for separating T lymphocytes and / or monocytes from whole blood. Examples of such devices include devices utilising density gradient centrifugation techniques or magnetic separation techniques, or devices which utilise fluorescent dyes (flurochromes) such as in fluorescence activated cell sorting (FACS) techniques. Examples of these devices and techniques are described herein.

[0155] Computer processors, and software for converting data to a measurement of a parameter, are known in the art.

[0156] In a further aspect, the present invention provides a method of identifying a marker present in blood indicative of autophagic flux in a subject. In some embodiments, the method comprises: (i) determining the level of a candidate marker indicative of autophagic flux in T lymphocytes and / or monocytes in a sample of whole blood from the subject, wherein the sample of whole blood has been treated with an inhibitor of lysosomal system function; and (ii) identifying the candidate marker as a marker indicative of autophagic flux.

[0157] Methods for determining the level of a candidate marker are as described herein. In some embodiments, the candidate marker is a protein. In some embodiments, thecandidate marker is an RNA. In some embodiments, the candidate marker is a small molecule. In some embodiments, the candidate marker is a lipid. Other types of markers are contemplated.

[0158] In some embodiments, the marker present in the sample of whole blood is a plasma and / or serum marker.

[0159] In some embodiments, the method comprises the use of blood from an animal and / or a human subject. In certain embodiments, the method comprises the use of a suitable animal model.

[0160] In some embodiments, the marker is indicative of autophagic flux in the absence of treatment of the sample of whole blood with an inhibitor of lysosomal system function.

[0161] In some embodiments, the marker is indicative of autophagic flux in a sample of whole blood treated with an inhibitor of lysosomal system function.

[0162] In some embodiments, the method comprises machine learning, or more conventional computational analysis of ‘omic’ datasets to identify the candidate marker as a marker indicative of autophagic flux. Methods for utilising machine learning and computational analysis are known in the art.

[0163] It is to be noted that where a range of values is expressed, it will be clearly understood that this range encompasses the upper and lower limits of the range, and all numerical values or sub-ranges in between these limits as if each numerical value and sub- range is explicitly recited. The statement "about X to Y" has the same meaning as "about X to about Y," unless indicated otherwise.

[0164] The term “about” as used in the specification means approximately or nearly and in the context of a numerical value or range set forth herein is meant to encompass variations of + / - 10% or less, + / - 5% or less, + / - 1% or less, or + / - 0.1% or less of and from the numerical value or range recited or claimed.

[0165] As used herein, the singular forms “a,” “an,” and “the” may refer to plural articles unless specifically stated otherwise.

[0166] Throughout this specification, unless the context requires otherwise, the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

[0167] The subject headings used herein are included only for the ease of reference of the reader and should not be used to limit the subject matter found throughout the disclosure or the claims. The subject headings should not be used in construing the scope of the claims or the claim limitations.

[0168] The description provided herein is in relation to several embodiments which may share common characteristics and features. It is to be understood that one or more features of one embodiment may be combinable with one or more features of the other embodiments. In addition, a single feature or combination of features of the embodiments may constitute additional embodiments.

[0169] All methods described herein can be performed in any suitable order unless indicated otherwise herein or clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the example embodiments and does not pose a limitation on the scope of the claimed invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential.

[0170] Reference is made to standard textbooks of molecular biology that contain methods for carrying out basic techniques encompassed by the present invention. See, for example, Green and Sambrook, 2012 (supra).

[0171] It will be apparent to the person skilled in the art that while the invention has been described in some detail for the purposes of clarity and understanding, various modifications and alterations to the embodiments and methods described herein may be made without departing from the scope of the inventive concept disclosed in this specification.

[0172] The invention is further illustrated in the following example. The example is for the purpose of describing particular embodiments only and is not intended to be limiting with respect to the above description.EXAMPLE 1 Assessment of Autophagic Flux in PMBC Sub-types

[0173] The aim of this study was to understand how autophagy changes in response to human disease and nutrient restriction, through the optimization of a technique for the measurement of physiological autophagic flux using the peripheral blood mononuclear cell (PBMC) pool. Throughout this Example, the term “LC3BII” refers to MAP1LC3B (microtubule-associated protein 1 light chain 3 beta), as described above. MATERIALS AND METHODS

[0174] The reagents and resources used for the methods in this Example are shown in Table 1. TABLE 1 Antibodies Source Identifier BD Horizon™ BB700 Mouse Anti-Human CD127 BD Biosciences 566398 R-Bovine serum albumin Sigma Aldrich A9647-100G Chloroquine diphosphate Sigma Aldrich C6628 ’ ’Human Ethics Approval

[0175] The use of the blood samples in the current study was approved by The University of Adelaide Human Research Ethics Committee (Approval HREC H-2021-154). Electronic consent for participation was given after participants had been fully informed of the study. Sample Collection

[0176] Blood samples were collected in lithium heparin Vacuette tubes from study participants between April 2023 and August 2024. The study participants includes both men and women aged 20 to 50 years who had normal body weight or were overweight (BMI 18.5-29.9 kg / m2), were not obese, had no history of chronic diseases, and did not have any vaccines or infections within two weeks before the visit. The participants were fasted for a minimum of 12 h before blood collection and the samples were processed within 1 h of collection. Treatment of Whole Blood with Chloroquine (CQ)

[0177] Following collection, 1 mL of whole blood was spilt into two 10 mL conical centrifuge tubes treated with chloroquine diphosphate at a final concentration of 150 µM. The corresponding control tubes were treated with similar amounts of vehicle (water). Peripheral Blood Mononuclear Cell (PMBC) Isolation

[0178] PBMCs were isolated using Lymphoprep. Blood was mixed with an equal volume of Dulbecco’s phosphate-buffered saline (DPBS) at a ratio of 1:1 before being carefully layered on top of 15 mL of Lymphoprep. PBMCs were collected after being centrifuged for 30 min at 800 x g at room temperature without brake, then washed with DPBS and treated with 1X red blood cell lysis buffer. The PBMCs were then washed twice with DPBS before culturing. Culture of Isolated PBMCs – Incubation in RMPI Containing 10% FBS or Plasma

[0179] RPMI containing 10% FBS and diluted cognate plasma (in a 1:1 ratio with DPBS, derived from a lymphoprep-based PBMC isolation, to achieve similar concentration of PBMCs relative to plasma as in whole blood) was directly compared to whole blood as a medium for addition of CQ for lysosomal inhibition (with respect to Figures 3 to 8). To do this, isolated PBMCs were resuspended in either cognate plasma or RPMI containing 10% FBS and incubated with or without CQ. All samples described here were incubated for 1 h at 37°C with rotation at 10 revolutions per minute using a ThermoFisher Scientific Tube Revolver.Culture of HEK 293 T Cells

[0180] Wild-type and LC3B knockout HEK293T cells were seeded at 0.5 × 10⁶ cells per well in a 12-well plate one day prior to the experiment in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% FBS. The cells were treated with CQ or its vehicle for 1 hour at 37°C before performing flow cytometry. CRISPR Cas9 Gene Editing (MAP1LC3B KO)

[0181] Lentiviral vectors (expressing Cas9 and scramble gRNA 5’- GTGTAGTTCGACCATTCGTG (SEQ ID NO: 1) or gRNA against human LC3B 5’- CATCCAACCAAAATCCCGGT (SEQ ID NO: 2) (pLV[CRISPR]-hCas9:T2A:Bsd- U6>hMAP1LC3B[gRNA#954]) (Vectorbuilder) were transfected into HEK293T cells with plasmids psPAX2 (Addgene #12260) and pCMV-VSV-G (Addgene #8454) using lipofection (Lipofectamine 3000, Thermo Fisher, L3000015). Supernatant containing virus 48 hours post-transfection was passed through a 0.45 µM filter.8 µg / mL polybrene was added to the filtrate. Target cells (HEK293T) were incubated with virus for 24 h and were left to recover for 48 h before selection (6 µg / mL blasticidin, 7 d). Monoclonal KO cell lines were generated by sorting cells into a 96-well plate at 1 cell / well using a BD FACSAria Fusion. Single cell clones were grown for 2-3 weeks before passaging and analysis. Western blotting was used to verify LC3B KO. psPAX2 was a gift from Didier Trono (Addgene plasmid #12260; http: / / n2t.net / addgene:12260; RRID:Addgene_12260). pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid #8454; http: / / n2t.net / addgene:8454; RRID:Addgene_8454). Culture of Isolated PBMCs – Nutritional Interventions

[0182] In Figures 20 to 24, isolated PBMCs were cultured in various nutritional conditions, as indicated below.

[0183] Figures 20 and 22 to 24: amino acid-free RPMI prepared according to manufacturer’s instructions containing 10% dFBS, and amino acid-free RPMI prepared according to manufacturer’s instructions containing 10% dFBS spiked with amino acids, as described in Table 2.

[0184] Figure 21: glucose-free RPMI containing 10% dFBS, and glucose-free RPMI containing 10% dFBS spiked with glucose at a final concentration of 2 g / L.TABLE 2 Amino Acids and Concentrations Spiked into aa+ conditions in Figures 20 and 22-24 Amino Acids Molecular Weight Concentration (mM) Glycine 75 0.133up cae soae s e e eae a o yc a a a nal concentration of 200 nM. The corresponding control tubes were treated with DMSO as a vehicle control. All cultures were incubated at 37oC for 1 h in 12-well plates. Flow Cytometry Staining

[0186] Whole blood incubated with CQ and then lysed with red blood cell lysing buffer for 15 minutes at room temperature (RT); PBMCs after being cultured under different conditions; and wild-type and LC3B knockout HEK 293T cells after being cultured with CQ for 1h at 37°C; were harvested, washed twice with DPBS, and incubated for 10 minutes at RT with the recommended amount of fixable viability dye. They were then washed with DPBS before staining with saturated concentrations of surface monoclonal antibodies diluted in BD Horizon Brilliant Stain Buffer Plus for 30 minutes at 4°C (this step was not applied to HEK cells). After staining, cells were washed twice with DPBS and permeabilized with 0.05% saponin for 5 minutes at RT, and then washed with DPBS to remove LC3B-I from the cytosol, leaving only LC3B-II attached to the lysosomal membrane. The cells were then fixed with 4% v / v neutral formalin for 15 mins at RT; washed with DPBS. Finally,samples were incubated with or without anti-LC3B Alexa Fluor-647 (for unstained control) or IgG Alexa Fluor-647 for IgG control (for PBMCs, wildtype, and LC3B knockout HEK 293T cells), diluted 1:50 in DPBS containing 2% bovine serum albumin (BSA) and 0.01% saponin for 1 hour at 4°C. The samples were then washed twice with DPBS containing 2% BSA and 0.01% saponin before flow cytometry analysis using a BD FACSymphony A5 Cell Analyzer (BD Biosciences) at a fixed speed. The FACS Symphony is calibrated daily with BD Cytometer Setup and Tracking Beads.

[0187] Surface monoclonal antibodies conjugated to different fluorochromes, including BUV395, BUV615, BUV496, BUV805, BV421, BV480, BV786, BV750, FITC, BB700, PE, PE-CF594, PE-Cy7, Live / dead 780, and Alexa647 were employed in this study to characterize different PBMC sub-populations (detailed in Table 1). Quantification and Statistical Analysis

[0188] Flow cytometry data analysis was performed using Flowjo 10.8.0 (BD Biosciences, San Jose, CA, USA) for Windows with a gating strategy performed by a single operator (LVPD) with gating strategy shown in Figures 2A to 2R. Autophagic flux was quantified as the difference in Mean Fluorescence Intensity (MFI) of LC3BII for each cell population in whole blood treated with or without a saturated concentration of CQ or BafA as described by Bensalem J et al., 2021, “Measurement of autophagic flux in humans: an optimized method for blood samples”, Autophagy, 17:3238-3255: ΔMFI (LC3BII) = (MFI of LC3BII with CQ) – (MFI of LC3BII without CQ). ΔMFI (LC3B-II) = (MFI of LC3B-II with BafA) – (MFI of LC3B-II without BafA).

[0189] Graphs were generated using GRAPHPAD PRISM version 10.3.0, for Windows (GraphPad Software, La Jolla, CA, USA) or R version 4.3.2 (R Foundation for Statistical Computing, Vienna, Austria) / RStudio (Integrated Development for R. RStudio, PBC, Boston, MA, USA). Data were analyzed using statistical tests described in figure legends (Friedman test, paired Wilcoxon matched-paired signed rank test, Mann-Whitney test, Spearman correlation and simple linear regression). All tests were performed as two-tailed tests and significant levels are presented as *p<0.05, **p<0.01, or ***p<0.001. RESULTS Physiological Autophagic Flux Retained in Whole Blood but not in RPMI or Plasma

[0190] LC3B-II flux was defined as the difference in LC3B-II abundance with the lysosomal inhibitor chloroquine (CQ) minus the LC3B-II abundance in a parallel sample where CQ wasnot added. While autophagic flux in PBMCs cultured in whole blood or culture media (RPMI) has been successfully measured using western blot and ELISA (Bensalem J et al., 2023, “Basal autophagic flux measured in blood correlates positively with age in adults at increased risk of type 2 diabetes”, GeroScience, 45(6): 3549-3560; and Bensalem J et al., 2021, “Measurement of autophagic flux in humans: an optimized method for blood samples”, Autophagy 17: 3238-3255), and LC3B levels have been analyzed in various leukocyte populations using flow cytometry (Bensalem J et al., 2023, supra; Bensalem J et al., 2021, supra; Alonzi T et al., 2019, “Optimization of the autophagy measurement in a human cell line and primary cells by flow cytometry”, Eur. J. Histochem.63(2): 3044; and Phadwal K et al., 2012, “A novel method for autophagy detection in primary cells: impaired levels of macroautophagy in immunosenescent T cells”, Autophagy 8: 677-689), physiological autophagic flux in whole blood has not been measured in different cell types using flow cytometry. We, therefore, aimed to do this by culturing whole blood without and with CQ and analysing autophagy in cell types using flow cytometry for LC3B-II. To evaluate antibody specificity for measuring LC3B-II flux, we analysed wildtype and LC3B knockout (KO) HEK 293T cells. We observed a higher signal for LC3B-II in CQ-treated samples compared to control samples, but only in wildtype HEK cells – not in the LC3B KO cells (Figures 1A and B). Similarly, LC3B-II flux was observed in PBMCs (Figure 1C) where LC3B staining was appreciably higher than the IgG isotype control.

[0191] We subsequently investigated physiological LC3B-II flux (measured in the context of whole blood) of major blood cell types by flow cytometry, including: monocytes (classical, intermediate and non-classical monocytes); T lymphocytes (CD4 T lymphocytes: T regulatory cells (Treg), naïve, central memory (CM), effector memory (EM), and terminally differentiated (TEMRA), and CD8 T lymphocytes: naïve, CM, EM and TEMRA); B lymphocytes (naïve and memory B cells); and natural killer (NK) cells (CD56hiC16-, CD56hiCD16+, CD56dimCD16, and CD56dimCD16+NK cells) (gating strategy is shown in Figures 2A-R).

[0192] LC3B-II flux was measured in different environments including by addition of lysosomal inhibitors to whole blood, nutrient-rich artificial media (RPMI containing 10% FBS, a common culture medium for PBMCs) or in diluted cognate plasma / Dulbecco's phosphate- buffered saline (DPBS) mixed in a ratio of 1:1 (Figures 3 to 8). We observed a significant reduction in overall LC3B-II flux in PBMCs cultured in RPMI containing 10% FBS (Figures 3A-C) or plasma / DPBS (Figures 4A-C) compared to PMBCs exposed to CQ in the context of whole blood. This was particularly evident in NK cells (Figure 3B and Figure 4B), non-classical monocytes in RPMI medium containing 10% FBS (Figure 3C), and intermediate and non-classical monocytes in cognate plasma / DPBS (Figure 4C). Basal Autophagic Flux is Intrinsically Different in Different Sub-populations of the Peripheral Blood Mononuclear Cell (PBMC) Pool

[0193] Assessing physiological autophagy at the level of leukocyte sub-populations is important to understand how autophagic flux in the PBMC pool as a whole may be impacted by shifting sub-population fractions, which is known to occur with factors such as ageing (Kverneland AH et al., 2016, “Age and gender leucocytes variances and references values generated using the standardized ONE-Study protocol”, Cytometry A 89: 543-564). To understand what cell-type specific physiological autophagic flux looks like, we analysed LC3B-II flux in whole blood in 43 participants. Participant characteristics are presented in Table 3. TABLE 3 Participant characteristics, analyzed by Mann-Whitney and Kruskal Wallis test Total (n=43) Males (n=19) Female (n=24) p value Age (years) 28 (20-45) 27(20-44) 29.5 (20-45) 0.19 Gender, female n (%) 24 (55.8%) Body mass index 23.8 25.1 21.9 (BMI, kg / m2) (19.1-30.9) (20.4-30.9) (19.1-29.5) 0.05 EthnicityCaucasian 18(41.6%) 6 (31.6%) 12(50%) 0.14 Asian 24 (58.1%) 13 (68.4%) 11(45.8%) Others 1(2.3%) 0 1(4.2%)

[0194] Among broad cell type classifications, no significant differences in LC3B-II flux were observed across different cell types (Figures 9A and 9B). Within each broad cell population, non-classical monocytes had the highest LC3B-II flux of the monocytes (Figures 10A and 10B); CD56dimCD16+cells had the highest flux within the NK cells (Figure 11A); naive B cells exhibited significantly higher LC3B-II flux compared to memory B cells (Figure 11B); and higher LC3B-II flux was found in NKT cells compared to CD4 and CD8 T cells (Figure 12A). CD4 T and CD8 T lymphocyte sub-populations did not show significant within-group differences (Figures 12B and 12C). Granulocytes showed very high LC3B-II flux (Figure 13A). The proportion of flux contributed by each cell type to the overall flux of the PBMC pool varied significantly from person to person, both in absolute (Figure 13B) and relative amounts (Figure 13C).Basal Autophagic Flux in Different Cell Types is Highly Correlated

[0195] While we observed differences in basal LC3B-II flux across various sub-populations, we next investigated whether the flux of each individual cell type correlates with the total PBMC flux. The correlation matrix showed statistically significant correlation between the flux of the total PBMCs and individual cell populations (T cells, B cells, NK cells and monocytes) (Figure 14A and Table 4) as well as sub-populations (Figure 14B and Table 5). TABLE 4 Correlation of total LC3B-II flux with major blood cell populations r / p value Total T cells B cells Monocytes NK cells Total <0.01 <0.01 <0.01 <0.01 T cells 0.63 0.05 <0.01 <0.01 B cells 0.51 0.31 0.10 0.01 Monocytes 0.61 0.74 0.25 <0.01 NK cells 0.69 0.63 0.38 0.72 Analyzed by correlation matrix with data presented as Spearman r and p value

[0196] Correlation was also statistically significant among each cell type (T cells, B cells, NK cells and monocytes) and their corresponding sub-populations (Figure 15, Figure 16 and Tables 6 to 11). The results suggest that basal LC3B-II flux of individual cell populations is highly correlated with the total flux of the whole blood under physiological conditions.

[0197] Sex differences in autophagy have been reported in various animal studies. We also analyzed the basal LC3B-II flux with regard to sex and observed a trending difference in total LC3B-II flux between males and females (Figure 17A (p = 0.06) and Table 12). However, when examining individual cell populations, we noted that female has significantly higher LC3B-II flux compared to male in monocytes (Figure 17B and Table 12), particularly in non-classical monocytes (Figure 17C and Table 12). Basal Autophagic Flux Positively Correlates with Age

[0198] As age has been reported to be positively correlated with autophagic flux in the PBMC pool in older individuals aged 35-70 in people at risk of type-2 diabetes (Bensalem J et al., 2023, supra), we sought to investigate whether this is also true for healthy younger individuals. Crucially, we also wanted to determine whether PBMC sub-populations also exhibited increases in autophagy with age.TABLE 5 Correlation of total LC3B-II flux with major blood cell sub-populationsTABLE 6 Correlation of total LC3B-II flux with T cells r / p valueT cells NKT CD4 CD8T cells <0.01 <0.01 <0.01 NKT0.66<0.01 <0.01 CD40.96 0.57<0.01CD80.96 0.61 0.94Analyzed by correlation matrix with data presented as Spearman r and p value TABLE 7 Correlation of total LC3B-II flux with CD4 T cells r / p valueCD4 CM EM Naïve TEMRA Treg CD4 <0.01 <0.01 <0.01 <0.01 <0.01 CM0.976<0.01 <0.01 <0.01 <0.01 EM0.894 0.871 <0.01 <0.01 <0.01 Naïve0.967 0.947 0.850<0.01 <0.01 TEMRA0.783 0.708 0.809 0.793<0.01Treg0.771 0.759 0.694 0.788 0.778 Analyzed by correlation matrix with data presented as Spearman r and p value TABLE 8 Correlation of total LC3B-II flux with CD8 T cells r / p value CD8 CM EM Naïve TEMRA CD8 <0.01 <0.01 <0.01 <0.01 CM 0.928 <0.01 <0.01 <0.01 EM 0.877 0.831 <0.01 <0.01 Naïve 0.844 0.834 0.732 <0.01 TEMRA 0.790 0.790 0.823 0.775 Analyzed by correlation matrix with data presented as Spearman r and p value TABLE 9 Correlation of total LC3B-II flux with B cells r / p valueB cells Memory NaïveB cells<0.01 <0.01Memory 0.511<0.01Naïve 0.987 0.473 Analyzed by correlation matrix with data presented as Spearman r and p valueTABLE 10 Correlation of total LC3B-II flux with monocytes r / p valueMonocytes Classical Intermediate Non-classical Monocytes <0.01 <0.01 <0.01 Classical0.915<0.01 <0.01 Intermediate0.793 0.775<0.01Non-classical0.523 0.414 0.403Analyzed by correlation matrix with data presented as Spearman r and p value TABLE 11 Correlation of total LC3B-II flux with NK cells r / p value CD56dim CD56dim CD56hi CD56hi NK cells CD16+ CD16- CD16+ CD16- NK cells <0.01 <0.01 <0.01 <0.01 CD56dimCD16+0.932<0.01 <0.01 <0.01 CD56dimCD16-0.820 0.704<0.01 <0.01 CD56hiCD16+0.739 0.636 0.704<0.01CD56hiCD16-0.835 0.700 0.743 0.814 Analyzed by correlation matrix with data presented as Spearman r and p value TABLE 12 Sex differences for autophagic flux in different cell populations LC3BII flux Total (n=43) Males (n=19) Female (n=24) p value Total 41.4 (0.1-1427) 24.9(0.1-742) 61.5(0.1-1427) 0.059 T cells 15.8 (0-96.65) 8.4 (0-70) 21.75 (0-96.65) 0.059 NKT cells 34 (0-571) 12.8 (0-539) 40.75 (0-571) 0.16 CD4 T cells 13.9 (0-100.6) 4.5 (0-61) 18 (0-100.6) 0.14 Central memory 14.9 (0-93.2) 9.4 (0-63) 17.35 (0-93.2) 0.14 Effector memory 14 (0-84) 7.5 (0-79.7) 16.2 (0-84) 0.49 Naïve 14.5 (0-113.3) 7.3 (0-64) 15.2 (0-113.3) 0.21 TEMRA 15.11 (0-106) 13.1 (0-80.8) 15.56 (0-106) 0.79 Regulatory 9.3 (0-177.72) 7.1 (0-56.8) 12.98 (0-177.72) 0.49 CD8 T cells 15 (0-79.2) 86. (0-66.8) 19 (0-79.2) 0.15 Central memory 14.7 (0-407) 12.8 (0-61.4) 16.7 (0-407) 0.19 Effector memory 11 (0-82.1) 6.5 (0-75) 14.73 (0-82.1) 0.3 Naïve 9.6 (0-135.1) 3 (0-74) 15.5 (0-135.1) 0.057 TEMRA 15 (0-89.4) 12.6 (0-74.1) 15.45 (0-89.4) 0.9 B cells 41.1 (0-120.1) 46.9 (0-110) 32.75 (0-120.1) 0.98 Naïve 36 (0-148) 47.5 (0-134) 28.55 (0-148) 0.79 Memory 18.62 (0-126.9) 7 (0-87.2) 20.96 (0-126.9) 0.17 Monocytes 10.9 (0-339) 3 (0-93) 18.39 (0-339) 0.03 Classical monocytes 10.2 (0.79-21.8) 8.41 (0.79-17.3) 10.35 (1.67-21.8) 0.62 Intermediate monocytes 21 (0-259) 21 (0-111) 20.195 (0-259) 0.36Non-classical monocytes 78 (0-3175) 45 (0-174) 180 (0-3175) <0.01 NK cells 18.49 (0-711) 11.9 (0-198) 22.31 (0-711) 0.23 CD56dimCD16+23.65 (0-1034) 24.3 (0-257) 17.86 (0-1034) 0.46 CD56dimCD16- 15 (0-234) 8.8 (0-132.5) 17.15 (0-234) 0.21 CD56hiCD16+15.6 (0-217) 15.6 (0-216) 15.57 (0-217) 0.47 CD56hiCD16- 9.38 (0-67) 7 (0-64) 10.79 (0-67) 0.38 Analyzed by Mann-Whitney test

[0199] We observed a positive correlation between age and LC3B-II flux in total PBMCs (Figure 18A); and other populations including monocytes (Figure 18B), NK cells (Figure 18C); and sub-populations such as T cell subpopulations (including CD8, TEMRA CD8, and TEMRA CD4 T cells, Figures 18D-18F), classical monocytes (Figure 18G), intermediate monocytes (Figure 18H), and all NK cell sub-populations (Figures 18I-18L). Non-classical monocytes trended with a p-value of 0.053, R2=0.09 (data not shown). However, after normalising for sex, autophagic flux of monocytes (p=0.07, R2=0.15) and classical monocytes (p=0.89, R2=0.15), lost significance. However, other significant correlations remained including total PBMCs (p=0.01, R2=0.18), NK cells (p=0.01, R2=0.18); and T cell sub-populations (TEMRA CD4 T cells (p=0.02, R2=0.14), CD8 T cells (p=0.03, R2=0.15), TEMRA CD8 T cells (p=0.03, R2=0.11)), intermediate monocytes (p=0.03, R2=0.16), NK cell sub-populations (CD56dimCD16+NK cells (p=0.02, R2=0,15), CD56dimCD16- NK cells (p<0.01, R2=0.23), CD56hiCD16+NK cells (p<0.01, R2=0.19), and CD56hiCD16- NK cells (p=0.01, R2=0.15)).

[0200] Certain cell populations are reported to change with age with regards to abundance (Kverneland AH et al., 2016, supra), therefore we performed regression analyses and found significant positive correlation of age with frequency of NK cells (Figure 19A); memory B cells (Figure 19B), non-classical monocytes (Figure 19C), and CD56dimCD16+ NK cells (Figure 19D), while TEMRA CD8 T cells showed a negative correlation (Figure 19E). After normalising for the sex in the analysis we found only NK cells (p<0.01, R2=0.31); and TEMRA CD8 T cells (p=0.02, R2=0.14), non-classical monocytes (p=0.01, R2=0.16), and CD56dimCD16+NK cells (p<0.01, R2=0.32) retained their significant correlation. Additionally, only percentage of non-classical monocytes (p=0.01, R2=0.15) was significantly correlated with total LC3B-II flux and the correlation was even stronger after normalising for age and sex (p<0.01, R2=0.82) by linear regression analysis. Autophagy Induced by Nutrient Restriction Shows Cell-type Specificity

[0201] Autophagic flux is activated by nutrient restriction, because nutrients regulate mTORC1, which inhibits the initiation of autophagy (Kim J et al., 2011, “AMPK and mTORregulate autophagy through direct phosphorylation of Ulk1”, Nat. Cell Biol., 13: 132-141). We wanted to determine whether sensitivity to nutrient restriction was cell-type specific as this has implications for how human autophagy is monitored during nutritional intervention studies.

[0202] We cultured PBMCs in RPMI formulations with amino acids (aa+) and without amino acids (aa-), both containing 10% dialyzed fetal bovine serum (dFBS) for 1 h at 37°C and observed no change in total LC3B-II flux (Figure 20A). However, significant increases in LC3B-II flux was observed in monocytes (Figure 20B) and non-classical monocytes (Figure 20C). Glucose did not elicit a strong response (Figures 21A and 21B) during the incubation period. When data for autophagic flux was categorised into groups of 20-35 or 35-50 years of age, LC3B-II flux of monocytes showed no significant difference between the aa- and aa+conditions (Figure 22A). However, significant higher autophagic flux in response to amino acid restriction was observed in non-classical monocytes in the 35-50 year old group (Figure 22B), but not in the 20-35 year old group. Significantly higher LC3B-II flux was observed only in females for both monocytes (Figure 23A) and non-classical monocytes (Figure 23B) in aa- compared to aa+condition. Lack of significance in males was likely due to a lack of statistical power rather than a lack of effect. Surprisingly, even though total NK cells were not significantly different with regards to amino acid restriction, we observed increased autophagic flux in CD56dimCD16- (Figure 24A) and CD56hiCD16+NK cells (Figure 24B) as the result of aa withdrawal in females. Discussion

[0203] This study introduces a flow cytometry protocol for evaluating physiological basal autophagic flux in leukocyte sub-populations. We showed that physiological basal autophagic flux differs within different sub-populations of PBMCs, which might reflect their differentiation and functional status. Additionally, we observed that monocyte sub-types, particularly non-classical monocytes, exhibited a significant reduction in LC3BII flux in nutrient-rich artificial media or plasma compared with whole blood. Autophagic flux in non- classical monocytes appeared particularly sensitive to the presence of amino acids. T lymphocyte autophagic flux remained stable across different conditions. Thus, measurement of stable T lymphocyte flux could be suitable for determining the most physiologically accurate flux when assessing the impact of important parameters such as age, sex, ethnicity, body composition, or disease status. On the other hand, the most nutrient-sensitive cells, monocytes (and in particular non-classical monocytes), could be most suited for nutritional intervention studies.

[0204] This study also confirmed the importance of using whole blood for measuring physiological autophagic flux and that autophagic flux shows cell-type specific variation. Furthermore, this study shows that a positive correlation between age and autophagic flux exists at the total PBMC pool and individual cell type levels. Sex was also found to impact autophagic flux. Together, these observations provide useful guidance on how to monitor human autophagy in a study appropriate manner.

[0205] Within monocyte sub-populations, higher basal autophagic flux was observed in non- classical monocytes compared to classical monocytes. Autophagy is required for monocyte differentiation, survival, and bacterial clearance (reviewed in Germic N et al., 2019, “Regulation of the innate immune system by autophagy: monocytes, macrophages, dendritic cells and antigen presentation”, Cell Death Differ., 26:715-727). Classical monocytes exhibit higher proliferation capacity (reviewed in Wolf AA et al., 2019, “The Ontogeny of Monocyte Subsets”, Front. Immunol., 10: 1642), a process involving mTOR activation, which is a negative regulator of autophagy (reviewed in Kim YC et al., 2015, “mTOR: a pharmacologic target for autophagy regulation”, J. Clin. Invest., 125: 25-32). Additionally, non-classical monocytes exhibit heightened inflammatory characteristics and a more robust response to virus-associated signals, particularly in terms of increased cytokine expression (Wolf AA et al., 2019, supra). Furthermore, they also express higher levels of pro-apoptotic proteins and have a higher production of ROS from mitochondria (Zhao C et al., 2010, “The CD14(+ / low)CD16(+) monocyte subset is more susceptible to spontaneous and oxidant-induced apoptosis than the CD14(+)CD16(-) subset”, Cell Death Dis., 1: e95). Given that autophagy protects cells from ROS-induced cell death, the increased autophagy levels observed in non-classical and intermediate monocytes may (similar to NK cells) signify a protective mechanism.

[0206] We also revealed differences in autophagic flux in peripheral human NK cell subsets, where the autophagic flux of immature NK cells (CD56hiCD16-) was lower compared to mature NK cells (NK cells that lose CD56 and gain CD16 expression). In contrast, Wang et al reported higher autophagic flux in immature NK cells isolated from bone marrow and cultured in RPMI containing 10% FBS compared to mature NK cells in GFP-LC3 transgenic mice (Wang S et al., 2016, “FoxO1-mediated autophagy is required for NK cell development and innate immunity”, Nat. Commun., 7: 11023). This inconsistency in the data might be explained by the loss of physiological autophagic flux in NK cells cultured in artificial media (Figure 3B), the reduction of autophagic flux in immature NK cells in the periphery due to further differentiation, or differences between murine and human NK cells. Additionally, consistent with our finding, Keating et al noted higher mTORC1 activity (a negative regulatorof autophagy) in human CD56hiNK cells compared to CD56dimNK cells (Keating SE et al., 2016, “Metabolic Reprogramming Supports IFN-gamma Production by CD56bright NK Cells”, J. Immunol., 196: 2552-2560), suggesting lower autophagy levels in immature NK cells.

[0207] We observed a positive correlation between age and basal autophagic flux. While this had previously been reported in individuals aged 35-75 that were on average obese (Bensalem J et al., 2023, supra), the current study is the first to report a positive correlation between age and autophagy in a young to middle-aged adult cohort, and importantly at the leukocyte sub-population level. We found a positive correlation between age and autophagic flux in monocytes, NK cells and T lymphocytes and their sub-populations. Other research in human samples showed inconsistent results. While some reported decreased overlap between MAP1LC3B / LC3B and the acidic compartment in CD8 T cells in older individuals (Phadwal K et al., 2012, supra), others showed increased autophagosomes in CD4 T cells in older individuals along with inconsistent changes in autophagy-gene expression (Bektas A et al., 2019, “Age-associated changes in human CD4(+) T cells point to mitochondrial dysfunction consequent to impaired autophagy”, Aging (Albany NY), 11: 9234-9263). However, work from previous relevant studies has not documented autophagic flux and has performed experiments under non-physiological conditions. The relevance of these findings to our work is therefore difficult to ascertain. The data from the current study that show autophagy increases with human ageing in leukocytes suggest that at least in these cell types, autophagy can be upregulated in response to age-related challenges.

[0208] Nutritional withdrawal has been shown to induce autophagy through different mechanisms, including the activation of AMPK and suppression of mTORC1 activity, and subsequent and activation of ULK1, a key initiator of autophagy (reviewed in Russell RC et al., 2014, “Autophagy regulation by nutrient signaling”, Cell Res., 24: 42-57). In the current study, we observed population specific changes in autophagic flux in response to nutrient restriction. While lymphocyte flux remained relatively stable in different ex-vivo conditions, monocytes (especially non-classical monocytes) exhibited significant responses to amino acid restriction. Consistent with this observation, monocytes are more sensitive than lymphocytes to fasting and exercise with regards to steady-state abundance of autophagy proteins (Kropfl JM et al., 2022, “Lymphocytes are less sensitive to autophagy than monocytes during fasting and exercise conditions”, Apoptosis 27: 730-739); autophagic flux, however, has not previously been assessed. Zhang and colleagues also noted monocytes increase autophagy in response to starvation (Zhang Y et al., 2012, “Induction of autophagy is essential for monocyte-macrophage differentiation”, Blood 119: 2895-2905). Although ithas been shown that monocytes are nutrient responsive, T lymphocyte autophagy is also likely responsive, albeit to different stimuli not tested in the current study; T lymphocytes increase autophagy in response to growth stimulating factors anti-CD3 antibody and IL-2 (Li C et al., 2006, “Autophagy is induced in CD4+ T cells and important for the growth factor- withdrawal cell death”, J. Immunol.177: 5163-5168; and Alsaleh G et al., 2020, “Autophagy in T cells from aged donors is maintained by spermidine and correlates with function and vaccine responses”, Elife 9: e57950).

[0209] The ability to induce autophagy for nutrient recovery in response to starvation promotes survival under nutrient stress (Kuma A et al., 2004, “The role of autophagy during the early neonatal starvation period”, Nature 432: 1032-1036; and Komatsu M et al., 2005, “Impairment of starvation-induced and constitutive autophagy in Atg7-deficient mice”, J. Cell Biol.169: 425-434). However, this is not the immune system’s only coping mechanism with regards to nutrient restriction. T lymphocytes (Collins N et al., 2019, “The Bone Marrow Protects and Optimizes Immunological Memory during Dietary Restriction”, Cell 178: 1088- 1101 e1015) and monocytes (Janssen H et al., 2023, “Monocytes re-enter the bone marrow during fasting and alter the host response to infection”, Immunity 56: 783-796 e787; and Jordan S et al., 2019, “Dietary Intake Regulates the Circulating Inflammatory Monocyte Pool”, Cell 178: 1102-1114 e1117) can relocate from the periphery to the nutrient-rich bone marrow during starvation, which has been suggested as a mechanism to protect cells during nutrient restriction. Jordan and colleagues noted the profound migration of Ly-6Chimonocytes (equivalent to classical monocytes in humans) from blood to bone marrow, while the numbers of Ly-6Clo(equivalent to non-classical monocytes in humans) did not differ significantly in mice after four hours of starvation (Jordan S et al., 2019, supra). Non- classical monocytes, which can more effectively induce autophagy upon starvation, might survive better in the periphery during nutrient depletion compared to other cell populations that need to migrate immediately to a nutrient-rich environment such as the bone marrow. The changes in cell populations in peripheral blood during starvation suggest the importance of using individual autophagic flux to better monitor changes in autophagy activity. Given their responsiveness to nutrients, monitoring autophagy in monocytes – especially non-classical monocytes – rather than B or T lymphocytes could provide a more sensitive approach to determining whether nutrient restriction promotes autophagy in humans.

[0210] Results from this study indicate how best to measure autophagy in human research. We have demonstrated that human cells maintained in artificial media could be subject to large changes in autophagy, meaning that autophagy observed in culture does notresemble autophagy that takes place within a human being. This provides evidence supporting the use of whole blood to assess physiological autophagic flux. We have also shown that autophagy is different in different cellular populations. Thus, changing sub- cellular population fractions within the PBMC pool could impact interpretation of human autophagy studies that measure the whole PBMC pool. We further demonstrated that autophagic flux in humans varies with ageing and sex, even at the cellular sub-population level. This shows that both factors must be considered when designing studies for measurement of autophagy in humans. We also show that autophagy in certain cell types (specifically monocytes / non-classical monocytes) is more sensitive to nutrient restriction than in other cell types – pointing to use of these cells as a better means of measuring autophagy in dietary studies.

[0211] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described, and the invention includes all such variations and modifications. The invention also includes all of the steps, uses and systems referred to, or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features.

Claims

CLAIMS 1. A method of assessing autophagic flux in a subject, the method comprising determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, the level of the lysosomal system marker being determined based on the level of the marker following treatment of the sample of whole blood with an inhibitor of lysosomal system function.

2. The method of claim 1, wherein the inhibitor of lysosomal system function comprises one or more of chloroquine, hydroxychloroquine, bafilomycin A1, E-64d, leupeptin, pepstatin A, and concanamycin A.

3. The method of claim 1 or claim 2, wherein the lysosomal system marker comprises microtubule-associated protein 1 light chain 3 (MAP1LC3) protein, and / or a GABARAP / GATE-16 protein, and / or an MAP1LC3 or GABARAP / GATE-16 interacting cargo adaptor protein.

4. The method of any one of claims 1 to 3, wherein the lysosomal system marker comprises a MAP1LC3B protein.

5. The method of any one of claims 1 to 4, wherein the method comprises a comparison of the determined level of the lysosomal system marker with the level of the marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject that has not been treated with an inhibitor of lysosomal system function.

6. The method of any one of claims 1 to 5, wherein the method comprises determining the level of the lysosomal system marker using immunological detection.

7. The method of claim 6, wherein the immunological detection comprises ELISA or immunocytochemical staining.

8. The method of claim 6, wherein the immunological detection comprises Western blotting.

9. The method of any one of claims 1 to 8, wherein the method comprises determining the level of the lysosomal system marker using flow cytometry.

10. The method of any one of claims 1 to 9, wherein the level of the lysosomal system marker is determined in monocytes in the sample of whole blood.

11. The method of claim 10, wherein the sample of whole blood is from a subject who has undergone nutrient restriction.

12. The method of claim 10 or claim 11, wherein the monocytes are non-classical monocytes.

13. The method of any one of claims 1 to 9, wherein the level of the lysosomal system marker is determined in T lymphocytes in the sample of whole blood.

14. The method of claim 13, wherein the sample of whole blood is from a subject who has not undergone nutrient restriction.

15. The method of any one of claims 1 to 14, further comprising treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction based on the level of the lysosomal system marker following treatment of the sample of whole blood from the subject with an inhibitor of lysosomal system function.

16. The method of claim 15, wherein the disease, condition or state associated with autophagic flux dysfunction includes one or more of obesity, diabetes, ageing, lysosomal storage diseases, cardiovascular diseases, Alzheimer’s disease, Parkinson’s disease, frontotemporal dementia, motor-neuron disease, and cancer.

17. The method of any one of claims 1 to 16, wherein the subject is a human.

18. A method of assessing autophagic flux in a subject, the method comprising: (i) obtaining a sample of whole blood from the subject; (ii) treating the sample of whole blood with an inhibitor of lysosomal system function; and (iii) determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in the sample of whole blood so treated as compared to the level of the lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject that has not been treated with an inhibitor of lysosomal system function.

19. A method of treating a subject suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction, the method comprising assessing autophagic flux in the subject by the method of any one of claims 1 to 18, and treating the subject on the basis of the level of autophagic flux assessed.

20. A lysosomal system marker for use in, or when used for, assessing autophagic flux in a subject by the method of any one of claims 1 to 18.

21. The lysosomal system marker of claim 20, wherein the lysosomal system marker comprises a MAP1LC3B protein.

22. A method of treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction, wherein the level of autophagic flux in the subject has been assessed by a method comprising determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, the level of the lysosomal system marker being determined based on the level of the marker following treatment of the sample of whole blood with an inhibitor of lysosomal system function, and treating the subject on the basis of the level of autophagic flux assessed.

23. A method of treating a subject found to be suffering from, or susceptible to, a disease, condition or state associated with autophagic flux dysfunction, wherein the level of autophagic flux in the subject has been assessed by a method comprising: (i) obtaining a sample of whole blood from the subject; (ii) treating the sample of whole blood with an inhibitor of lysosomal system function; (iii) determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in the whole blood so treated as compared to the level of the lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject that has not been treated with an inhibitor of lysosomal system function; and (iv) treating the subject on the basis of the level of autophagic flux assessed.

24. The method of claim 22 or claim 23, wherein the lysosomal system marker comprises a MAP1LC3B protein.

25. Use of a lysosomal system marker to assess the level of autophagic flux in a subject, wherein the level of autophagic flux in the subject has been assessed by a methodcomprising determining the level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, the level of the lysosomal system marker being assessed based on the level of the marker following treatment of the sample of whole blood with an inhibitor of lysosomal system function.

26. The use of claim 25, wherein the lysosomal system marker comprises a MAP1LC3B protein.

27. A system for assessing autophagic flux in a subject, the system comprising: (i) a processor for receiving data indicative of a level of a lysosomal system marker in T lymphocytes and / or monocytes in a sample of whole blood from the subject, wherein the sample of whole blood has been treated with an inhibitor of lysosomal system function; and (ii) a memory with software resident in the memory, and accessible to the processor, wherein the software comprises a series of instructions executable by the processor to convert the data to a measurement of autophagic flux in the subject.

28. The system of claim 27, wherein the lysosomal system marker comprises a MAP1LC3B protein.

29. A method of identifying a marker present in blood indicative of autophagic flux in a subject, the method comprising: (i) determining the level of a candidate marker indicative of autophagic flux in T lymphocytes and / or monocytes in a sample of whole blood from the subject, wherein the sample of whole blood has been treated with an inhibitor of lysosomal system function; and (ii) identifying the candidate marker as a marker indicative of autophagic flux.

30. The method of claim 29, wherein the marker present in the sample of whole blood is a plasma and / or serum marker.

31. The method of claim 29 or claim 30, wherein the marker is indicative of autophagic flux in the absence of treatment of the sample of whole blood with an inhibitor of lysosomal system function.