Polypeptide sequence specifically targeting human tissue and use thereof in construction of delivery vector
Patent Information
- Application Number
- PCT/CN2025/080510
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-04
- Filing Date
- 2025-03-04
- Publication Date
- 2025-10-02
AI Technical Summary
Existing adeno-associated virus (AAV) gene therapy vectors have problems such as high immunogenicity, poor tissue targeting, limited gene delivery capacity, high production costs and limited indications. In particular, they are blocked by the blood-brain barrier in the treatment of neurological diseases. In addition, the mutation library of existing directed evolution technology has low richness and low conversion efficiency.
By constructing targeted peptides and inserting them into delivery vectors, especially the specificity-determining region of the AAV capsid, a high-throughput AAV mutation library is established to screen out AAV mutants that specifically target human tissues, and optimize the AAV capsid protein to improve tissue specificity and safety.
The AAV vector has achieved efficient targeting of specific human tissues, reduced immunogenicity and off-target risks, improved the distribution efficiency and safety of gene drugs in target tissues, and expanded the range of indications.
Abstract
Description
Polypeptide sequences specifically targeting human tissues and their application in constructing delivery vectors Technical Field
[0001] The present invention relates to the field of biotechnology, in particular to a polypeptide sequence specifically targeting human tissues and an application thereof in constructing a delivery vector. Background Art
[0002] Gene therapy, a novel technology combining modern medicine and molecular biology, has become a new approach for treating cancer and genetic diseases. Gene therapy requires the use of vectors to introduce exogenous genes into biological cells. Commonly used gene therapy vectors include liposome nanoparticles (LNPs), lentiviruses, adenoviruses, adeno-associated viruses, and virus-like particles.
[0003] Adeno-associated virus (AAV) vectors offer excellent safety, targeting, and transfection efficiency. Over the past few years, recombinant adeno-associated virus (rAAV) has demonstrated promising results as a gene delivery vehicle in areas such as liver, heart, and muscle transduction. To date, over 40 gene therapies have been approved for marketing worldwide, including five AAV-based gene therapies.
[0004] Although AAV, a star vector in gene therapy, possesses advantages unmatched by other viral vectors, it still faces numerous limitations in clinical practice: 1. It has high immunogenicity and poor tissue targeting. Both immunogenicity and tissue targeting depend on the AAV subtype or serotype. Hundreds of AAV serotypes have been identified based on variable regions within the AAV capsid, with varying properties influencing immunogenicity and tissue tropism. Due to poor targeting, safety incidents following high-dose administration have been reported. 2. Immune barriers remain to be overcome. The blood-brain barrier impedes drug delivery and absorption, making the treatment of neurological diseases difficult. 3. Gene length limitations exist. AAV is a single-stranded DNA virus that can deliver target genes of approximately 4.5 kb. Compared to adenovirus and retrovirus vectors, AAV has a smaller gene delivery capacity, which limits its targeted indications to the expression of small transgene fragments. 4. Production costs are high, and many aspects of industrial production have not been fully optimized. 5. Indications are limited. By analyzing the types of diseases currently covered by gene therapy for metabolic diseases in the clinical and preclinical stages, it was found that the types of diseases covered in the clinical stage are mainly concentrated in rare metabolic diseases.
[0005] AAV vectors require modification to further improve their efficacy and safety. Directed evolution can be used to develop novel AAV vectors. Directed evolution primarily includes error-prone PCR, gene shuffling, targeted recombination of protein fragments, strategies combining rational design and directed evolution, and in vivo directed evolution. However, these methods have limitations in developing novel AAV vectors, such as low library richness; the mutation library used is random rather than naturally occurring, potentially leading to immunogenicity issues; and the AAVs selected may be ethnically specific and have low conversion efficiency.
[0006] Therefore, there is an urgent need in this field to develop a novel method for preparing adeno-associated virus (AAV) mutant library and its application. Summary of the Invention
[0007] The purpose of the present invention is to provide a novel method for preparing adeno-associated virus mutation library and its application.
[0008] In the first aspect of the present invention, a targeting polypeptide is provided, which is inserted into a delivery vector so that the delivery vector has the property of specifically targeting specific cells; the targeting of the delivery vector with the targeting polypeptide to the tissue / cell is T1, and the targeting of the same delivery vector without the targeting polypeptide to the same tissue / cell is T0, T1 / T0 ≥ 5, preferably T1 / T0 ≥ 10, and more preferably T1 / T0 ≥ 20.
[0009] In another preferred embodiment, T1 / T0≥50, preferably T1 / T0≥100, more preferably T1 / T0≥500.
[0010] In another preferred embodiment, T1 / T0≥1000, preferably T1 / T0≥2000, more preferably T1 / T0≥5000.
[0011] In another preferred embodiment, the targeting refers to the enrichment in tissues / cells.
[0012] In another preferred embodiment, the targeting polypeptide comprises a motif selected from the following groups: SSPIGTG (SEQ ID NO: 116), SSLAGAN (SEQ ID NO: 117), RNVIGGG (SEQ ID NO: 118), SSLX1X2GS (SEQ ID NO: 119), wherein X1 is selected from G or V, and X2 is selected from Q or G; SSRLTGL (SEQ ID NO: 120), SSFNLVT (SEQ ID NO: 121), SSVGVGG (SEQ ID NO: 123) and SSMKGDSG (SEQ ID NO: 122).
[0013] In another preferred embodiment, the targeting polypeptide comprises a SSPIGTG (SEQ ID NO: 116) motif.
[0014] In another preferred embodiment, the targeting polypeptide further contains a primer backbone sequence, including an upstream primer backbone sequence located at the N-terminus, and a downstream primer backbone sequence located at the C-terminus.
[0015] In another preferred embodiment, the sequence of the targeting polypeptide is shown in any one of SEQ ID NOs: 16-87.
[0016] In another preferred embodiment, the targeting polypeptide is a polypeptide sequence encoded by a fragment from the human cell genome.
[0017] In another preferred embodiment, the delivery vector is a viral delivery vector or a non-viral delivery vector.
[0018] In another preferred embodiment, the delivery vector is selected from the following group: adeno-associated virus (AAV), adenovirus, lentivirus, virus-like particles (VLP), liposome nanoparticles (LNP).
[0019] In another preferred embodiment, the delivery vector is adeno-associated virus (AAV).
[0020] In another preferred embodiment, the delivery vehicle is liposome nanoparticles (LNP).
[0021] In another preferred embodiment, the delivery vector is inserted with one or more targeting polypeptides.
[0022] In another preferred embodiment, the delivery vector is inserted with multiple targeting polypeptides having the same or different sequences.
[0023] In another preferred embodiment, the delivery vector is inserted with multiple targeting polypeptides that target the same or different cells.
[0024] In another preferred embodiment, the delivery vector is inserted with multiple targeting polypeptides at the same position or different positions.
[0025] In another preferred embodiment, the position is located in the specificity determining region of the delivery vector.
[0026] In another preferred embodiment, the specific cells are one or more cells.
[0027] In another preferred embodiment, the cells are human cells.
[0028] In another preferred embodiment, the specific cells are isolated cells or cells located in specific tissues.
[0029] In another preferred embodiment, the tissue is selected from the group consisting of skeletal muscle, cardiac muscle, nerve, pancreas, liver, or a combination thereof.
[0030] In another preferred embodiment, the skeletal muscles include: diaphragm (DIA), tibialis anterior (TA), gastrocnemius (GAS) and soleus (Sol).
[0031] In another preferred embodiment, the specific cells are selected from the group consisting of skeletal muscle cells, cardiomyocytes, neural cells, pancreatic cells, liver cells, or a combination thereof. In another preferred embodiment, the targeting polypeptide specifically targets skeletal muscle cells, and the targeting polypeptide comprises a motif selected from the group consisting of SSPIGTG (SEQ ID NO: 116), SSLAGAN (SEQ ID NO: 117), RNVIGGG (SEQ ID NO: 118), SSLX1G(V)X2Q(G)GS (SEQ ID NO: 119), wherein X1 is selected from G or V, and X2 is selected from Q or G; and SSRLTGL (SEQ ID NO: 120).
[0032] In another preferred embodiment, the targeting polypeptide specifically targets cardiomyocytes, and the targeting polypeptide comprises a motif selected from the group consisting of SSPIGTG (SEQ ID NO: 116), SSFNLVT (SEQ ID NO: 121), RNVIGGG (SEQ ID NO: 118), SSVGVGG (SEQ ID NO: 123) and SSMKGDSG (SEQ ID NO: 122).
[0033] In another preferred embodiment, the targeting polypeptide is specific for muscle cells, and the targeting polypeptide comprises the motif SSPIGTG (SEQ ID NO: 116).
[0034] In another preferred embodiment, the targeting polypeptide targets skeletal muscle cells, and the targeting polypeptide sequence is shown in any one of SEQ ID NOs: 16-40.
[0035] In another preferred embodiment, the preferred polypeptide sequence targeting skeletal muscle cells is shown in any one of SEQ ID NOs: 16-19, 22-33.
[0036] In another preferred embodiment, the targeting polypeptide targets cardiomyocytes, and the targeting polypeptide sequence is shown in any one of SEQ ID NOs: 16, 17, 28, 31, 41-83.
[0037] In another preferred embodiment, the preferred polypeptide sequence targeting cardiomyocytes is shown in any one of SEQ ID NOs: 17, 41-46, 48-65, 68-73, and 80-82.
[0038] In another preferred embodiment, the targeting polypeptide targets skeletal muscle cells and liver cells simultaneously, and the targeting polypeptide sequence is shown in any one of SEQ ID NOs: 19, 20, and 34.
[0039] In another preferred embodiment, the targeting polypeptide targets both myocardial cells and liver cells, and the targeting polypeptide sequence is shown in any one of SEQ ID NOs: 16, 17, 66, 74, and 76.
[0040] In another preferred embodiment, the targeting polypeptide targets skeletal muscle cells but not liver cells, and the targeting polypeptide sequence is shown in any one of SEQ ID NOs: 16-18, 22-33, and 37-39.
[0041] In another preferred embodiment, the targeting polypeptide targets cardiomyocytes but not liver cells, and the targeting polypeptide sequence is shown in any one of SEQ ID NOs: 41-65, 67-73, 75, and 77-83.
[0042] In another preferred embodiment, the targeting polypeptide is inserted into the region that determines the specificity of the AAV virus.
[0043] In another preferred embodiment, the region that determines the AAV virus specificity includes the AAV VP1 variable region.
[0044] In another preferred embodiment, the targeting polypeptide sequence can be covalently or non-covalently bound to the compound for specific targeting.
[0045] In another preferred embodiment, the compound is a protein or a small molecule compound.
[0046] In a second aspect of the present invention, a nucleic acid molecule is provided, wherein the nucleic acid molecule encodes the targeting polypeptide according to the first aspect of the present invention.
[0047] In another preferred embodiment, the nucleic acid molecule includes DNA, cDNA and RNA.
[0048] In the third aspect of the present invention, a delivery vector is provided, wherein the delivery vector is loaded with the targeting polypeptide according to the first aspect of the present invention.
[0049] In another preferred embodiment, the delivery vector is a viral delivery vector or a non-viral delivery vector.
[0050] In another preferred embodiment, the delivery vector is selected from the following group: adeno-associated virus (AAV), adenovirus, lentivirus, virus-like particles (VLP), liposome nanoparticles (LNP).
[0051] In another preferred embodiment, the delivery vector is adeno-associated virus (AAV).
[0052] In another preferred embodiment, the delivery vehicle is liposome nanoparticles (LNP).
[0053] In another preferred embodiment, the delivery vector carries one or more targeting polypeptides.
[0054] In another preferred embodiment, the delivery vector carries multiple targeting polypeptides with the same or different sequences.
[0055] In another preferred embodiment, the delivery vector carries multiple targeting polypeptides targeting the same or different cells.
[0056] In another preferred embodiment, the delivery vector is inserted with multiple targeting polypeptides at the same position or different positions.
[0057] In another preferred embodiment, the position is located in the specificity determining region of the delivery vector.
[0058] In the fourth aspect of the present invention, an AAV capsid protein mutant is provided, and the AAV capsid protein mutant is obtained by the following method: the targeting polypeptide described in the first aspect of the present invention is inserted into a specific position of the wild-type AAV capsid protein to obtain the AAV capsid protein mutant; or the nucleic acid molecule described in the second aspect of the present invention is inserted into the coding sequence of the wild-type AAV capsid protein; the AAV capsid protein mutant has the specificity of targeting one or more human cells.
[0059] In another preferred embodiment, the human cells are selected from the group consisting of skeletal muscle cells, cardiac muscle cells, pancreatic cells, neural cells, or a combination thereof.
[0060] In another preferred embodiment, the specific position is the AAV specificity determining region.
[0061] In another preferred embodiment, the AAV specificity determining region includes the variable region of the AAV capsid protein.
[0062] In another preferred embodiment, the AAV specificity determining region includes the AAV VP1 variable region.
[0063] In another preferred embodiment, the AAV specificity determining region is selected from the group consisting of AAV VP1 variable regions VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII and VR-IX.
[0064] In another preferred embodiment, the AAV specificity determining region is located in the AAV VP1 variable region VR-VIII.
[0065] In another preferred embodiment, the wild-type AAV capsid protein is derived from AAV9.
[0066] In another preferred embodiment, the insertion site is located in the VP1 variable region VR-VIII of the wild-type AAV9 capsid protein.
[0067] In another preferred embodiment, the insertion site of the targeting sequence is selected from the following group: VR-IV (G455 / Q456), VR-V (N497 / 498) and VR-VIII (A589 / Q590).
[0068] In another preferred example, the insertion site is located at position 589 and position 590 of the wild-type AAV9 capsid protein sequence SEQ ID NO: 104.
[0069] In the fifth aspect of the present invention, a packaging plasmid for producing recombinant AAV virus particles is provided, wherein the packaging plasmid comprises a nucleic acid molecule encoding the targeting polypeptide described in the first aspect of the present invention.
[0070] In the sixth aspect of the present invention, a recombinant AAV virus particle is provided, wherein the targeting polypeptide described in the first aspect of the present invention is inserted into the specificity determining region of the recombinant AAV virus vector; or the nucleic acid molecule described in the second aspect of the present invention is inserted into the gene of the recombinant AAV virus vector; or the recombinant AAV virus vector comprises the AAV capsid protein mutant described in the fourth aspect of the present invention; and the recombinant AAV virus vector has the specificity of targeting one or more human cells.
[0071] In another preferred embodiment, the human cells are selected from the group consisting of skeletal muscle cells, cardiomyocytes, or a combination thereof.
[0072] In another preferred embodiment, the AAV specificity determining region includes the AAV VP1 variable region.
[0073] In another preferred embodiment, the AAV specificity determining region is selected from the group consisting of AAV VP1 variable regions VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII and VR-IX.
[0074] In another preferred embodiment, the AAV specificity determining region is located in the AAV VP1 variable region VR-VIII.
[0075] In another preferred embodiment, the insertion site of the targeting sequence is selected from the following group: VR-IV (G455 / Q456), VR-V (N497 / 498) and VR-VIII (A589 / Q590).
[0076] In another preferred embodiment, the AAV vector is selected from the following group: AAV9, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV10, AAV-DJ, AAV-DJ / 8.
[0077] In another preferred embodiment, the AAV vector is AAV9.
[0078] In another preferred embodiment, the recombinant AAV virus particles are produced using the packaging plasmid described in the fifth aspect of the present invention.
[0079] In the seventh aspect of the present invention, an AAV product is provided, wherein the AAV product comprises the recombinant AAV virus particles described in the sixth aspect of the present invention.
[0080] In another preferred embodiment, the AAV product is used as a gene therapy drug for gene therapy.
[0081] In another preferred embodiment, the AAV product further comprises a pharmaceutically acceptable carrier.
[0082] In another preferred embodiment, the AAV product is used to treat a disease selected from the group consisting of skeletal muscle-related diseases, heart-related diseases, liver-related diseases, or a combination thereof.
[0083] In another preferred embodiment, the AAV product is used to treat a disease selected from the group consisting of Duchenne muscular dystrophy, spinal muscular atrophy, β-thalassemia, hemophilia, sickle cell anemia, diabetes, hypercholesterolemia, hyperlipidemia, transthyretin amyloidosis (ATTR) diseases, and tumors.
[0084] In an eighth aspect of the present invention, a method for screening the targeting polypeptide according to the first aspect of the present invention is provided, comprising the steps of:
[0085] (1) Using the human cell genome as a template and primers for PCR, a targeted peptide sequence library was constructed;
[0086] (2) inserting the targeting sequence into the AAV specificity determining region to construct a screening viral plasmid library;
[0087] (3) packaging into a virus library;
[0088] (4) Screening through human cells in vitro or in vivo;
[0089] (5) Analyze and enrich the sequences using NGS technology to obtain targeted peptides specific to different cells.
[0090] In another preferred embodiment, the human-derived cells are selected from the group consisting of skeletal muscle cells, cardiomyocytes, liver cells, or a combination thereof.
[0091] In another preferred embodiment, the AAV specificity determining region includes the AAV VP1 variable region.
[0092] In another preferred embodiment, the AAV specificity determining region is selected from the group consisting of AAV VP1 variable regions VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII and VR-IX.
[0093] In another preferred embodiment, the AAV specificity determining region is located in the AAV VP1 variable region VR-VIII.
[0094] In another preferred embodiment, the insertion site of the targeting sequence is selected from the following group: VR-IV (G455 / Q456), VR-V (N497 / 498) and VR-VIII (A589 / Q590).
[0095] In another preferred embodiment, the animals include: rodents, non-human primates; preferably mice, cynomolgus monkeys.
[0096] In another preferred embodiment, the sequences of the primers are shown in SEQ ID NO: 1-10.
[0097] In the ninth aspect of the present invention, a targeting polypeptide obtained by the method according to the eighth aspect of the present invention is provided.
[0098] In another preferred embodiment, the targeting polypeptide is inserted into a delivery vector so that the delivery vector has the property of specifically targeting specific cells.
[0099] In the tenth aspect of the present invention, there is provided a use of the targeting polypeptide according to the first aspect of the present invention for constructing a delivery vector, so that the delivery vector has the property of specifically targeting human cells.
[0100] In another preferred embodiment, the delivery vector is a viral delivery vector or a non-viral delivery vector.
[0101] In another preferred embodiment, the delivery vector is selected from the following group: adeno-associated virus (AAV), adenovirus, lentivirus, virus-like particles (VLP), liposome nanoparticles (LNP).
[0102] In another preferred embodiment, the delivery vector is adeno-associated virus (AAV).
[0103] In the eleventh aspect of the present invention, there is provided a use of the delivery vector according to the third aspect of the present invention for preparing a targeted drug.
[0104] In another preferred embodiment, the targeted drug targets one or more human cells.
[0105] In another preferred embodiment, the specific cells are selected from the group consisting of skeletal muscle cells, cardiomyocytes, liver cells, or a combination thereof.
[0106] In another preferred embodiment, the targeted drug is used to treat a disease selected from the group consisting of skeletal muscle-related diseases, heart-related diseases, liver-related diseases, or a combination thereof.
[0107] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS
[0108] Figure 1 shows the capsid subunits and icosahedral structure of AAV9. A shows the AAV9 capsid VP1 subunit and the location of its variable region; B shows the icosahedral structure of the AAV9 capsid protein.
[0109] FIG2 shows a schematic diagram of the AAV9-cap inserted polypeptide plasmid backbone.
[0110] Figure 3 shows a schematic diagram of RC9-REP-AAP.
[0111] Figure 4 shows the RC9 wild-type plasmid map.
[0112] Figure 5 shows the ITR-CMV-CAP-library-ITR plasmid map.
[0113] Figure 6 shows the RC9 REP-AAP plasmid map.
[0114] Figure 7 shows the conserved amino acid motifs and corresponding enrichments after skeletal muscle cell screening, where the median value of the enrichment of the motif-containing sequence in each tissue is marked with a red line.
[0115] Figure 8 shows the conserved amino acid motifs and corresponding enrichments after screening in cardiomyocytes, where the median value of the enrichment of the motif-containing sequences in each tissue is marked with a red line.
[0116] FIG9 shows conserved polypeptide sequences enriched in mouse muscle tissue.
[0117] Figure 10 shows the distribution of peptide sequence abundance in various mouse muscle tissues. The median abundance of sequences containing the motif in each tissue is marked with a red line, and the median abundance of sequences without the motif in each tissue is marked with a black line.
[0118] FIG11 shows the conserved polypeptide sequences enriched in various muscle tissues of cynomolgus monkeys.
[0119] Figure 12 shows the distribution of peptide sequence abundance in various muscle tissues of cynomolgus macaques. The median abundance of sequences containing the motif in each tissue is marked with a red line, and the median abundance of sequences without the motif in each tissue is marked with a black line.
[0120] FIG13 shows the specific distribution of various AAV mutants in various muscle tissues of cynomolgus monkeys.
[0121] FIG14 shows the changes in targeting of mutants 4D and 8D relative to wild-type AAV9 in mouse muscle tissue, and the numerical values are shown in the corresponding bar graphs.
[0122] FIG15 shows the changes in targeting of mutants 4D and 8D relative to wild-type AAV9 in mouse liver tissue, and the numerical values are shown in the corresponding bar graphs. DETAILED DESCRIPTION
[0123] After extensive and in-depth research, the inventors have provided a method for establishing a high-throughput AAV capsid library using natural peptides from human cells, and in this high-throughput library, screened and obtained a variety of AAV mutants with different tissue specificities. Specifically, the inventors used the genome of human cells as a template, constructed a high-throughput peptide library using random polypeptide sequences, inserted them into specific positions of the AAV capsid, and packaged them into AAV viruses. The virus library was screened using different human-derived cells to obtain AAV mutants specific for different human cells. AAV viruses with different tissue specificity were screened out, the specificity for target tissues was improved, the effectiveness was improved, and the specificity for non-target tissues was reduced, the toxicity was reduced, and it has the potential to be applied to the treatment of various diseases. The present invention was completed on this basis.
[0124] the term
[0125] In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.
[0126] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
[0127] As used herein, the terms "comprising" or "including" may be open, semi-closed, or closed. In other words, the terms also include "consisting essentially of" or "consisting of."
[0128] As used herein, unless otherwise indicated, any concentration range, percentage range, ratio range, or integer range should be understood to include the value of any integer within the range and, where appropriate, fractional values thereof (e.g., tenths and hundredths of an integer).
[0129] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items.
[0130] Adeno-associated virus (AAV)
[0131] Adeno-associated virus (AAV) is a member of the genus Dependovirus in the family Parvoviridae and is one of the smallest known viruses. AAV particles are non-vesicular, icosahedral structures with a diameter of 20-26 nm. They are composed of 60 copies of the three capsid proteins VP1, VP2, and VP3 in a 1:1:10 ratio. A schematic diagram is shown in Figure 1.
[0132] As used herein, the term "AAV" includes naturally occurring adeno-associated viruses and recombinant forms of adeno-associated viruses (rAAV), and includes mutant forms of AAV.
[0133] There are many AAV serotypes, including AAV9, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV10, AAV-DJ, AAV-DJ / 8, etc. The capsid proteins of AAV viruses of different serotypes have different sequences and spatial conformations, so they also have obvious differences in binding to cell surface receptors and tissue tropism. The tissue tropism and transduction efficiency of AAV virus depend on the specific amino acid sequence on its capsid, which can manipulate the initial receptor binding and the infection mechanism of the virus. At the same time, different variable regions of the same virus have different tissue tropisms and functional properties. In the present invention, the capsid protein of AAV virus is modified by genetic engineering to produce recombinant AAV vectors suitable for various clinical applications.
[0134] In the present invention, the term "AAV specificity determining region" refers to an amino acid sequence segment in the capsid protein of the AAV virus that affects tissue tropism, typically located in the variable region of the AAV capsid protein, preferably in the variable region of VP1. Changing the sequence of the AAV specificity determining region of the AAV capsid protein can affect the ability of AAV to specifically target cells.
[0135] Targeted peptides and screening methods thereof
[0136] In the present invention, the terms "targeting polypeptide", "specific insertion polypeptide" and "insertion polypeptide" are used interchangeably and all refer to polypeptide sequences that can be inserted into a delivery vector to enable the delivery vector to specifically target specific cells.
[0137] In the present invention, exemplary targeting polypeptides are 5-55 aa in length.
[0138] In the present invention, a high-throughput specific insertion polypeptide library was established and screened using human cells to obtain the specific targeting polypeptides of the present invention. The methods for establishing and screening the high-throughput specific insertion polypeptide library are as follows:
[0139] Using the human cell genome as a template, PCR is performed with primers of random length and sequence to construct a library of targeted peptide sequences; the targeting sequence is inserted into the AAV specificity determining region to construct a screening viral plasmid library; the viral library is packaged; screening is performed using human cells; and the sequences are analyzed and enriched using NGS technology to obtain targeted peptides specific to different cells.
[0140] In one embodiment of the present invention, a random peptide library is inserted into the variable region VIII of the VP1 gene of AAV9 to construct an AAV capsid mutant library plasmid.
[0141] In one embodiment of the present invention, cells are transfected by a three-plasmid transfection method to package the AAV mutant virus library.
[0142] In one embodiment of the present invention, the AAV mutant virus library is used to infect various types of human cells, and the enrichment of each round is analyzed by NGS sequencing. After multiple rounds of screening, insertion sequences with higher enrichment in specific tissue cells are selected.
[0143] In one embodiment of the present invention, the tissue specificity of the inserted sequence in vivo was further tested.
[0144] In one embodiment of the present invention, the tissue specificity of the insert sequence is tested in vivo by mixing AAV capsids containing different insert sequences, injecting them intravenously into mice or monkeys, and analyzing the distribution of AAVs with different insert sequences in the animals. NGS sequencing is then used to analyze the distribution of different barcodes in different tissues to verify the tissue specificity of each insert sequence.
[0145] AAV capsid protein mutants
[0146] In the present invention, the term "AAV capsid protein mutant" refers to a mutant having a mutation in the AAV specificity determining region, wherein the mutant has an altered ability to specifically target human cells or tissues compared to the wild-type AAV capsid protein, for example, the AAV capsid protein mutant has an enhanced ability to specifically target one or more human cells or tissues. The human cells or tissues include, but are not limited to, skeletal muscle, cardiac muscle, liver, or a combination thereof.
[0147] In the present invention, the targeting polypeptide of the present invention is inserted into a specific position of the wild-type AAV capsid protein to obtain the AAV capsid protein mutant; or a nucleic acid molecule encoding the targeting polypeptide of the present invention is inserted into the coding sequence of the wild-type AAV capsid protein.
[0148] In one embodiment of the present invention, the targeting polypeptide of the present invention is inserted into the VP1 variable region of the wild-type AAV9 capsid protein to obtain the AAV capsid protein mutant of the present invention.
[0149] Recombinant AAV viral vector
[0150] The present invention also provides a recombinant AAV viral vector with the specificity of targeting one or more human cells, wherein the specificity determining region of the recombinant AAV viral vector is inserted with the targeting polypeptide of the present invention; or the gene of the recombinant AAV viral vector is inserted with a nucleic acid molecule encoding the targeting polypeptide of the present invention; or the recombinant AAV viral vector comprises the AAV capsid protein mutant of the present invention.
[0151] The serotype of the recombinant AAV viral vector of the present invention is selected from the following group: In another preferred embodiment, the AAV vector is selected from the following group: AAV9, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV10, AAV-DJ, AAV-DJ / 8, but is not limited thereto.
[0152] The recombinant AAV viral vector of the present invention has good human tissue specificity and can be used to prepare gene therapy drugs for diseases selected from the following groups: muscle-related diseases, heart-related diseases, and liver-related diseases, but not limited thereto.
[0153] application
[0154] The present invention also provides the use of the targeting polypeptide of the present invention and the capsid protein mutant of the present invention for preparing a delivery vector, which is used to prepare a targeted drug having a variety of different human tissue specificities and can be used to target different tissues and parts of the human body.
[0155] In one embodiment of the present invention, the pharmaceutical composition has good muscle targeting, but weak liver targeting. Since AAV viruses are highly hepatotropic, after entering the body, especially after systemic administration, a large amount of AAV will be enriched by liver cells, leading to liver toxicity. In addition, because it cannot effectively reach the target tissue outside the liver cells, the efficacy of the drug is reduced. Since gene therapy drugs for muscle diseases, such as DMD, need to be administered systemically and bypass the enrichment effect of the liver, it is necessary to screen out AAV vectors with good muscle specificity and low hepatocyte specificity, which can reduce toxicity and improve drug effectiveness.
[0156] In one embodiment of the present invention, the pharmaceutical composition has good cardiac targeting but weak liver targeting. Gene therapy for heart disease, if administered systemically, can easily accumulate in the liver, leading to unwanted side effects. Therefore, the present invention uses iPSC-cardiomyocytes to screen an AAV viral library to identify recombinant AAV viral vectors with a single specificity for the myocardium.
[0157] In one embodiment of the present invention, the pharmaceutical composition has excellent targeting of both the liver and the heart. Gene therapy for ATTR-related diseases requires simultaneous targeting of both the heart and liver. If administered systemically, targeted enrichment of the gene to the liver and myocardium reduces unwanted side effects in other organs. Therefore, the present invention utilizes cardiomyocytes and hepatocytes to provide a recombinant AAV viral vector that is targeted to both the liver and the heart.
[0158] In one embodiment of the present invention, the pharmaceutical composition has excellent pancreatic targeting. The pancreas is a vital endocrine organ in humans, and common pancreatic diseases include diabetes and pancreatic tumors. Systemic administration or local pancreatic ductal administration can lead to viral accumulation in other non-target tissues, particularly the liver. Therefore, the present invention provides a recombinant AAV viral vector with singular specificity for the pancreas.
[0159] In one embodiment of the present invention, the pharmaceutical composition has good targeting of the nervous system. Gene drugs administered systemically to the nervous system, in addition to considering passage through the blood-brain barrier, also need to consider specificity for neural cells. Therefore, the present invention provides a recombinant AAV viral vector that is specific for neural cells.
[0160] In one embodiment of the present invention, the pharmaceutical composition has excellent liver targeting. The liver is an organ that has long been used for gene therapy. It is now clear that many liver diseases are caused by single gene defects, making it more suitable for clinical gene therapy than other complex diseases caused by multiple gene defects. Therefore, the present invention provides a recombinant AAV viral vector that is specific for the liver.
[0161] The main advantages of the present invention include:
[0162] 1. The targeting polypeptide of the present invention is derived from the human genome sequence, and therefore has low immunogenicity and higher safety.
[0163] 2. The present invention constructs a high-throughput polypeptide insertion library by obtaining PCR products of different lengths, thereby increasing the size and diversity of the fragment library.
[0164] 3. The present invention uses human cells to screen recombinant AAV vectors containing the targeting polypeptide of the present invention, which has greater transformation potential, and screens through multiple cells to obtain sequences with single specificity or multiple specificity requirements.
[0165] 4. The targeting polypeptide of the present invention improves the cell / tissue specificity of AAV, improves the distribution of gene drugs in target tissues, reduces the distribution to non-target tissues, and reduces the off-target risk of AAV.
[0166] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise indicated, percentages and fractions are by weight.
[0167] Example 1: Preparation of Insertion Peptide Library Sequences
[0168] The primer sequences required for library construction were synthesized (see Table 1 for details), and a random peptide library was constructed using human cell DNA as a template.
[0169] Table 1 Primers required for AAV peptide library
[0170] Fragments of varying sizes under 100 bp were collected as random insert peptide sequences for constructing AAV screening library plasmids. The insert sequence length ranged from 21 to 100 bp (all lengths were multiples of 3).
[0171] Example 2: Construction of AAV-inserted polypeptide plasmid library ITR-AAV-library-ITR
[0172] AAV9 was used as the prototype virus to construct an AAV insertion peptide plasmid library for screening. The backbone vector of the AAV insertion peptide plasmid library is shown in Figure 2 (plasmid map is shown in Figure 5) (synthesized by GenScript). Using the inverted terminal repeat sequence (ITR) of AAV2 and the CMV promoter, BsmBI restriction sites were designed at amino acid positions 589 and 590 of AAV9 (SEQ ID NO: 104) for insertion of random peptide libraries. The details are as follows:
[0173] The vector and the polypeptide library PCR fragment were treated with BsmBI enzyme respectively, and the inserted polypeptide sequence obtained in Example 1 was inserted into the enzyme-digested vector using the T4 ligation method. A sufficient amount of the ligation product was then electroporated into electrocompetent cells, and the plasmid was extracted. Primers were designed near the insertion site, and the plasmid of the random polypeptide library was used as a template for target-NGS sequencing (the first-round NGS primers were AAV-NGS-F1 and AAV-NGS-R1, see below for the specific sequences), and the actual library size was analyzed.
[0174] AAV_NGS_F1:
[0175] CACTCTTTCCCTACACGACGCTCTTCCGATCTccggtagcaacggagtcc(SEQ ID NO:11)
[0176] AAV_NGS_R1:
[0177] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcacatctctgtcctgcca(SEQ ID NO:12)
[0178] The results are as follows: Based on the sequencing results and the number of clones on the screening plate, the actual size of the library was 1.78E+10. As shown in Table 2, the length of the inserted polypeptide sequence was mainly a multiple of 3, and the length range was mainly 42-60 bp, that is, the number of amino acids was 14-20.
[0179] Table 2. Sequence richness data of AAV plasmid library
[0180] Example 3: Virus library packaging
[0181] 1) Preparation of RC9-REP-AAP plasmid
[0182] In order to improve the homozygosity rate of the viral library and the efficiency of packaging the insert sequence library, stop codons were simultaneously introduced at amino acids 6, 10, 142, 148, and 216 of the cap gene (based on SEQ ID NO: 105), and the RC9-REP-AAP plasmid was constructed (see Figure 6 for the plasmid map), as shown in Figure 3.
[0183] 2) Preparation of virus library
[0184] HEK293 cells (Thermo Fisher, Catalog No. A52021) were transfected with the helper plasmid (containing the adenoviral E4, E2A, and VA1 gene components), RC9-REP-AAP, and ITR-AAV-library-ITR (target gene library) at a molar ratio of 1:1:1 using PEIpro. Seven days later, the cell suspension was diluted to 1X with 20x lysis buffer (20% Tween 20, 40mM MgCl2, 400mM Tris-HCl, pH 9.0). Nuclease-500KU / ml was added and diluted to a concentration of 50U / ml. Lysis was performed on a shaker at 37°C, 115 rpm, for 2 hours. 5M NaCl was then added, diluted to 0.5M, and the cells were incubated for 30 minutes. The supernatant was collected, lysed, concentrated with PEG, and purified by ultracentrifugation using iodixanol. Titers were determined by qPCR.
[0185] qPCR primers:
[0186] CMV-F1:CCCACTTGGCAGTACATCAA(SEQ ID NO:13);
[0187] CMV-Probe1:FAM--CATAATGCCAGGCGGGCCATTTAC--BHQ1 (SEQ ID NO: 14);
[0188] CMV-R1:GCCAAGTAGGAAAGTCCCATAA (SEQ ID NO:15);
[0189] To obtain AAV with higher capsid purity, the virus packaged in the first round was packaged and purified in a second round: the virus packaged in the first round was once again infected with HEK293 cells at an MOI of 5, together with the helper and RC9-REP-AAP plasmids, to prepare a homozygous AAV capsid mutant virus library; after 5 days of culture, the cells were collected and the virus was purified again using the above method. The genome of the purified virus library was sequenced by NGS (AAV-NGS-F1 and AAV-NGS-R1) with a sequencing depth of 1.5 Gb to calculate the capacity of the virus library. After alignment with the inserted peptide plasmid library sequence, the analysis results are shown in Table 3. The richness of the actual virus library is 1.00×10 6 Most of them are prototype viruses AAV9. Considering that viruses with low read counts may be detrimental to the effective packaging of the virus, only viral sequences with read counts higher than 10 will be read in the subsequent screening process.
[0190] Table 3. Richness data of AAV virus library sequences
[0191] Through the second round of virus packaging and purification, a higher homozygous AAV capsid mutant virus library was successfully obtained, with a richness of 1.00×10 6 This provides a basis for subsequent screening of highly specific AAV variants. In addition, by screening sequences with high read counts, the quality of the viral library was further improved, eliminating inefficient sequences that may affect packaging efficiency.
[0192] Example 4: Screening of skeletal muscle-specific peptides
[0193] iPSC (Shouning Bio, Cat. No. RC1001-A)-derived skeletal muscle cells (Myotube, MT) were used as screening cells, while human hepatocytes (human hepatocytes, HH, Shanghai Weizhizhuo Biotechnology Co., Ltd.) were used as negative selection cells to screen for sequences with high muscle / liver specificity. Specifically, the prepared AAV capsid library was used to infect two iPSC-induced skeletal muscle cell lines and hepatocytes. After 72 hours, the cells were collected and the relevant DNA was obtained for NGS sequencing. The enrichment level of each sequence was analyzed based on the sequencing results. The AAV9 prototype virus was normalized to 1, and other sequences were compared with the prototype virus. The sequences with an enrichment level greater than 2 were selected for analysis.
[0194] The experimental results are shown in Table 4.1, which shows the enrichment of each AAV variant in muscle cells and hepatocytes.
[0195] Table 4.1 Enrichment data of peptide sequences in skeletal muscle cells (MT) Note: AAV9 wild-type virus was normalized to 1, and other sequences were compared with wild-type virus.
[0196] The results showed that a variety of polypeptide sequences with skeletal muscle and / or hepatocyte targeting were successfully obtained in this example, and the specific analysis is as follows:
[0197] 1. Muscle-specific targeting peptides:
[0198] The enrichment of SEQ ID NO: 16 and SEQ ID NO: 17 in muscle cells was significantly higher than that of the wild-type virus, reaching 13489.23 times and 2509.43 times, respectively. At the same time, their enrichment in hepatocytes was much lower than that in muscle cells, demonstrating extremely high muscle specificity.
[0199] Other sequences showing high muscle / liver specificity include SEQ ID NO:24, SEQ ID NO:26, and SEQ ID NO:28. The enrichment of these variants in muscle tissue is significantly higher than that in liver tissue, indicating that they have excellent muscle targeting.
[0200] 2. Liver-specific targeted peptides:
[0201] SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO: 34 showed higher enrichment in hepatocytes, demonstrating obvious liver specificity.
[0202] 3. Multifunctional specific targeting peptides:
[0203] In this example, we also screened out some sequences with high specificity for both muscle and liver, as well as variants with high muscle specificity but low liver specificity. These variants provide diverse options for different therapeutic needs.
[0204] After removing the primer backbone sequence, we performed conservation analysis on amino acid sequences with enrichment scores greater than 2. The results are shown in Figure 7 and Table 4.2. This analysis revealed that the core conserved motifs for targeting skeletal muscle cells are SSPIGTG (SEQ ID NO: 116), SSLAGAN (SEQ ID NO: 117), RNVIGGG (SEQ ID NO: 118), SSLG(V)Q(G)GS (SEQ ID NO: 119), and SSRLTGL (SEQ ID NO: 120). Sequences containing these conserved amino acid motifs all had enrichment scores greater than 5, indicating significant targeting.
[0205] Table 4.2 Conserved amino acid motifs and corresponding sequence enrichment medians in skeletal muscle cell screening Note: AAV9 wild-type virus was normalized to 1, and other sequences were compared with wild-type virus.
[0206] This experiment successfully screened a variety of AAV variants and amino acid conserved motifs with significant tissue specificity, including sequences with high muscle specificity, high liver specificity, and both muscle and liver specificity. These results provide a wealth of candidate sequences for AAV capsid engineering design, enabling customized construction based on different therapeutic needs. For example:
[0207] For muscle-related diseases (such as muscular dystrophy), targeted peptides with high muscle specificity and low liver specificity (such as SEQ ID NO: 16, SEQ ID NO: 17, etc.) can be used to accurately deliver therapeutic genes to the target tissue while reducing off-target effects on the liver.
[0208] For liver-related diseases (such as inherited metabolic diseases), variants with high liver specificity (such as SEQ ID NO: 19, SEQ ID NO: 20, etc.) can be used to achieve efficient and safe gene delivery.
[0209] For diseases requiring simultaneous targeting of muscle and liver, variants with specificity for both tissues can be used.
[0210] Example 5: Screening of cardiomyocyte-specific polypeptides
[0211] The prepared AAV capsid library was used to infect hepatocytes and iPSC-derived cardiomyocytes (CMs) at a specific MOI. After 72 hours, the cells were harvested and DNA was extracted for NGS analysis. The enrichment of each sequence was analyzed based on the sequencing results. Based on the sequencing results, the enrichment of each sequence in hepatocytes and cardiomyocytes was calculated, with the AAV9 wild-type virus normalized to 1. The enrichment of other sequences was compared with the wild-type virus to assess tissue specificity.
[0212] The results are shown in Table 5.1.
[0213] Table 5.1 Enrichment data of peptide sequences in cardiomyocytes (CM) Note: AAV9 wild-type virus was normalized to 1, and other sequences were compared with wild-type virus.
[0214] The results showed that multiple sequences showed significant enrichment in cardiomyocytes, indicating potential cardiac tissue targeting. Because the number of reads in hepatocytes was low, and even in some samples, no valid data was detected, the enrichment in cardiomyocytes was primarily used to screen for insert sequences targeting cardiac tissue. Given cardiac tissue targeting, enrichment in cardiomyocytes can be used to screen for potentially effective sequences, providing candidate vectors for gene therapy of heart-related diseases.
[0215] Despite the low number of reads in hepatocytes, some sequences still showed significant liver specificity. For example, sequences SEQ ID NO:74 and SEQ ID NO:76 showed high enrichment in hepatocytes, indicating their potential as liver-targeting targets, providing important insights for gene therapy of liver-related diseases.
[0216] After removing the primer backbone sequence, we performed conservation analysis on amino acid sequences with enrichment scores greater than 2. The results are shown in Figure 8 and Table 5.2. The analysis revealed that the core conserved motifs targeting cardiomyocytes were SSPIGTG (SEQ ID NO:116), SSFNLVT (SEQ ID NO:121), RNVIGGG (SEQ ID NO:118), SSVGVGG (SEQ ID NO:123), and SSMKGDSG (SEQ ID NO:122). Except for the SSPIGTG conserved motif, sequences containing other conserved amino acid motifs all had enrichment scores greater than 5, indicating significant targeting.
[0217] Table 5.2 Conserved amino acid motifs and corresponding sequence enrichment medians in cardiomyocyte screening Note: AAV9 wild-type virus was normalized to 1, and other sequences were compared with wild-type virus.
[0218] Example 6: Muscle Tissue-Specific AAV Screening in Mice
[0219] In order to further evaluate the tissue targeting of the AAV capsid mutant library, in this example, the above-mentioned AAV capsid mutant virus library was injected into 4-week-old C57BL / 6J mice through the tail vein. Three weeks after the injection, various muscle tissues of the mice were collected, including the heart (HT), diaphragm (DIA), tibialis anterior (TA), gastrocnemius (GAS) and soleus (Sol). Subsequently, the genomic DNA of each tissue was extracted, and target-NGS was used to analyze the enrichment of polypeptide sequences in each muscle tissue. Taking the enrichment of the AAV9 wild type as the benchmark (normalized to 1), the top 30 polypeptide sequences in muscle tissue were compared to identify conserved amino acid motifs.
[0220] The results are shown in FIG9 . The screening results in mice were consistent with the experimental results in skeletal muscle cells. After removing the conserved backbone sequence of the primers, analysis revealed that the core conserved motif targeting muscle tissue was SSPIGTG (SEQ ID NO: 116).
[0221] As shown in Figure 10, the median enrichment of sequences containing the SSPIGTG motif in various mouse muscle tissues was significantly higher than that of sequences without the motif. This result suggests that the SSPIGTG motif plays a key role in muscle tissue targeting.
[0222] Table 6 Median enrichment of conserved sequences in mouse muscle tissue Note: AAV9 wild-type virus was normalized to 1, and other sequences were compared with wild-type virus.
[0223] Example 7: Screening of muscle-specific AAVs in cynomolgus monkeys
[0224] Since non-primates are highly similar to humans in terms of genetics and physiology, the results of AAV screening in non-primates are of great significance for clinical translation. Based on this, we injected the above-screened AAV capsid mutant library into cynomolgus monkeys intravenously to further evaluate its tissue targeting. Three weeks after injection, various muscle tissue samples were collected from the monkeys, including the heart (HT), biceps brachii (BB), quadriceps femoris (Qua), diaphragm (DIA), tibialis anterior (TA), gastrocnemius (GAS), and soleus (Sol). Subsequently, genomic DNA was extracted from each tissue, and target-NGS was used to analyze the enrichment of peptide sequences in each tissue. Using the enrichment of AAV9 wild type as the benchmark (normalized to 1), the top 30 peptide sequences enriched in muscle tissue were aligned to identify conserved amino acid motifs.
[0225] The results are shown in Figure 11. The screening results in cynomolgus monkeys were consistent with the mouse results. After removing the conserved backbone sequence of the primers, analysis revealed that the core conserved motif targeting muscle tissue was SSPIGTG (SEQ ID NO: 116).
[0226] As shown in Figure 12, across all muscle tissues tested, the median enrichment of sequences containing the SSPIGTG motif was significantly higher than that of sequences without the motif. This result suggests that the SSPIGTG motif plays a key role in targeting cynomolgus monkey muscle tissue.
[0227] Table 7 Median enrichment of conserved sequences in cynomolgus monkey muscle tissue Note: AAV9 wild-type virus was normalized to 1, and other sequences were compared with wild-type virus.
[0228] Example 8: Tissue distribution of preferred muscle-specific sequence AAV variants in cynomolgus monkeys
[0229] 8.1 Construction of Optimal Sequences
[0230] Nine insertion polypeptide sequences (Tables 8.1 and 8.2) were selected from skeletal muscle cells, cardiomyocytes, mice, and cynomolgus monkey muscle tissues and inserted into different positions such as VR-IV (G455 / Q456), VR-V (N497 / 498), and VR-VIII (A589 / Q590). The control groups were AAV9-WT and Myo4A (SEQ ID NO: 87 sequence inserted at the Q588 / A589 position), and were individually packaged into AAV viruses together with different barcode plasmids (barcode sequences are shown in Table 8.2).
[0231] Table 8.1 Insertion sequences and codes of AAV variants
[0232] Table 8.2 Barcode sequences corresponding to each virus variant packaging Note: Letters represent different inserted amino acid sequences, and the numbers before the letters represent the insertion positions in the variable region. 4 represents insertion into VR-IV (G455 / Q456), 5 represents insertion into VR-V (N497 / 498), and 8 represents insertion into VR-VIII (A589 / Q590).
[0233] 8.2 Tissue Distribution of Different AAV Variants in Cynomolgus Monkeys
[0234] Each AAV variant was mixed at the same titer and injected intravenously into cynomolgus macaques. Three weeks after injection, liver and muscle tissues (including heart (HT), biceps brachii (BB), quadriceps femoris (Qua), diaphragm (DIA), tibialis anterior (TA), gastrocnemius (GAS), and soleus (Sol)) were collected and genomic DNA was extracted from each tissue. The specificity of the different variants in muscle tissues was subsequently analyzed using target-NGS and qPCR. The distribution specificity of wild-type AAV9 in each tissue relative to the liver was used as the benchmark (normalized to 1). The results are shown in Table 8.3 and Figure 13.
[0235] Table 8.3 Specificity of AAV mutants in various muscle tissues of cynomolgus monkeys Note: NA indicates below the limit of detection. The distribution specificity of wild-type AAV9 in each tissue relative to the liver was used as the benchmark (normalized to 1).
[0236] In this experiment, the tissue distribution of wild-type AAV9 was consistent with previous reports, primarily targeting the liver, with some distribution in other tissues. Although previous reports have shown that Myo4A has muscle tissue targeting, the results of this experiment showed that Myo4A exhibited stronger liver targeting and a more extensive distribution in muscle tissue.
[0237] Mutant 4D has a more significant distribution in muscle tissues such as the biceps, soleus, and quadriceps. While retaining the liver-de-targeting of 4D, mutants 5D and 8D show a wider distribution of muscle tissue targeting, with 5D mainly targeting the gastrocnemius muscle and 8D mainly targeting the soleus muscle, indicating that the same polypeptide has slightly different tissue distributions due to different insertion positions. Mutants 5B and 8B both have low liver tissue specificity. Both 8B and 5B show low liver targeting and tend to target the soleus muscle. The 8R variant has a lower distribution in the liver, while showing a wide distribution in the gastrocnemius muscle, soleus muscle, and heart. Other AAV virus variants did not show obvious tissue specificity.
[0238] The results of this study demonstrate that different AAV variants exhibit significant differences in tissue distribution in cynomolgus macaques. Mutants 4D, 5D, 8D, 5B, 8B, and 8R exhibit varying degrees of targeting in muscle tissue, while also exhibiting reduced liver targeting. These variants provide important candidate candidates for developing gene therapy vectors for muscle-related diseases. Furthermore, different insertion positions of the same peptide may lead to differences in tissue distribution.
[0239] Example 9: Distribution of mutants 4D and 8D in mouse muscle tissue
[0240] Mutants 4D and 8D, along with wild-type AAV9, were injected into four-week-old C57BL / 6J mice via the tail vein at a dose of 1E+14 vg / kg. Four weeks after injection, various muscle and liver tissues were harvested, including the heart (HT), diaphragm (DIA), tibialis anterior (TA), gastrocnemius (GAS), soleus (Sol), and liver (Liver). Genomic DNA was then extracted from each tissue, and the distribution of mutant 4D and wild-type AAV9 in the liver and various muscle tissues was assessed using qPCR.
[0241] Taking the targeting of wild-type AAV9 as a benchmark (normalized to 1), the fold increase in targeting of mutants 4D and 8D in various muscle tissues (as shown in Figure 14), as well as the fold decrease in targeting in the liver (as shown in Figure 15) were analyzed. The experimental results showed that compared with wild-type AAV9, the targeting of mutant 4D in the heart and gastrocnemius muscle was significantly improved, increasing by 7.5 times and 8.5 times, respectively. The targeting of mutant 8D in the heart and gastrocnemius muscle increased by 2.5 times and 2 times, respectively. At the same time, the targeting of mutant 4D in the liver decreased by 85.71%, which is only 1 / 7 of that of the wild type. The targeting of mutant 8D in the liver decreased by 16.67%, or 1.2 times.
[0242] The above results show that mutant 4D exhibits significantly enhanced targeting in muscle tissue (especially the heart and gastrocnemius muscles), while its targeting in the liver is significantly reduced. This characteristic gives mutant 4D a significant advantage in gene therapy for muscle-related diseases, enabling more precise delivery of therapeutic genes to target tissues while reducing off-target effects in the liver, thereby improving the safety and efficacy of treatment.
[0243] discuss
[0244] The capsid proteins of different AAV serotypes exhibit distinct sequences and spatial conformations, resulting in distinct differences in their binding to cell surface receptors and tissue tropism. AAV tissue tropism and transduction efficiency depend on specific amino acid sequences within the capsid, which control the initial receptor binding and viral infection mechanism. Furthermore, different variable regions within the same virus have distinct tissue tropisms and functional properties. Genetically engineering the AAV capsid to produce recombinant AAV vectors holds great promise for future clinical applications.
[0245] Current research shows that AAV vectors can be modified to further improve their drug efficacy and safety. Common ways to obtain more effective AAV capsids include natural discovery, as well as capsid design technologies such as rational design, directed evolution, and computational design.
[0246] Directed evolution techniques mainly include error-prone PCR, gene shuffling, targeted recombination of protein fragments, strategies combining rational design and directed evolution, AAV directed evolution based on Cre recombination, and in vivo directed evolution. These technologies have been used to develop new AAV vectors. However, these methods have certain limitations: gene shuffling and targeted recombination of protein fragments are limited by the sequence modification space, so the richness of the library is low; AAV directed evolution based on Cre recombination and in vivo directed evolution techniques can only be applied to animal models and require different promoters to detect the transcriptional specificity of different tissues; at the same time, the mutation libraries used in these evolutionary methods are basically random, rather than naturally occurring, and may have immunogenicity issues; because animals are used for screening, AAV receptors of different species may vary greatly, resulting in the screened AAV having different species specificity in humans and low conversion efficiency.
[0247] In response to the above problems, the present invention adopts an innovative strategy: using the human cell genome as a template, a library of random sequences of varying lengths is constructed, and inserted into specific sites of the AAV capsid, thereby packaging in vitro to generate a large-capacity AAV mutant library. Subsequently, multiple rounds of screening are performed using a variety of human cells, mice, and monkeys to obtain highly specific insertion sequences for different cell types. The advantages of this method are: 1. The insertion sequence comes from human genetic information and potentially contains receptor information on the surface of all cells, making it easier to obtain new amino acid motifs specific to different tissues. 2. High transformation potential: Using human cells as a screening system can more accurately simulate the infection and transduction process in the human body, and the AAV variants screened out have higher transformation efficiency in the human body. 3. Extensive sequence diversity: The construction of a random sequence library breaks through the limitations of traditional methods, can cover a wider range of sequence space, and increase the probability of screening out efficient variants. 4. Low immunogenicity: Since the insertion sequence is derived from human cells, its immunogenicity is significantly reduced, making it more suitable for clinical applications.
[0248] In addition, in the examples, by screening the AAV capsid mutant library in mice, a core conserved motif SSPIGTG associated with muscle tissue targeting was successfully identified. This discovery provides an important molecular basis for the engineering design of AAV capsids, indicating that this motif plays a key role in enhancing the targeting of AAV to muscle tissue. In addition, the experimental results also suggest that the primer sequence also has a certain effect on tissue specificity, which provides a new research direction for the subsequent optimization of AAV vector design. It should be pointed out that the potential influence of the primer sequences on both sides (SEQ ID NO: 106-115) on muscle tissue specificity cannot be completely ruled out.
[0249] Furthermore, screening of an AAV capsid mutant library in cynomolgus macaques further validated the importance of the core conserved motif SSPIGTG in muscle tissue targeting. This result is consistent with the mouse data, suggesting that this motif may have conserved functions across species. Given that cynomolgus macaques are genetically and physiologically highly similar to humans, this finding provides important theoretical support for the application of AAV vectors in clinical gene therapy.
[0250] By improving the tissue specificity of AAV, we can enhance the distribution of gene therapy drugs to target tissues and reduce distribution to non-target tissues, thereby reducing the risk of off-target effects and improving the safety of AAV drugs. With improved targeting, the therapeutic dose can be effectively reduced, and the cost of treatment for patients will also be reduced accordingly. Gene therapy drugs can benefit more patients with rare diseases and have far-reaching social impacts.
[0251] In summary, the strategy of this invention provides a new approach for AAV capsid engineering with high throughput, high efficiency, low immunogenicity, and high translational potential, laying an important foundation for the clinical translation of gene therapy. In the future, with further optimization and application of this technology, AAV vectors are expected to play a significant role in the treatment of more diseases, bringing new hope to patients.
[0252] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.
[0253] sequence:
[0254] Wild-type AAV9 capsid protein sequence (SEQ ID NO: 104):
[0255] Rep-AAP amino acid sequence (SEQ ID NO: 105):
[0256] Note: * indicates the site where the stop codon is introduced
Claims
1. A targeting polypeptide, characterized in that: The targeting polypeptide is inserted into the delivery vector so that the delivery vector has the property of specifically targeting specific cells; the targeting of the delivery vector with the targeting polypeptide to the tissue / cell is T1, and the targeting of the same delivery vector without the targeting polypeptide to the same tissue / cell is T0, T1 / T0 ≥ 5, preferably T1 / T0 ≥ 10, and more preferably T1 / T0 ≥ 20.
2. The targeting polypeptide according to claim 1, wherein The targeting polypeptide comprises a motif selected from the group consisting of SSPIGTG (SEQ ID NO: 116), SSLAGAN (SEQ ID NO: 117), RNVIGGG (SEQ ID NO: 118), SSLX1X2GS (SEQ ID NO: 119), wherein X1 is selected from G or V, X2 is selected from Q or G, SSRLTGL (SEQ ID NO: 120), SSFNLVT (SEQ ID NO: 121), SSVGVGG (SEQ ID NO: 123) and SSMKGDSG (SEQ ID NO: 122).
3. The targeting polypeptide according to claim 1, wherein the sequence of the targeting polypeptide is shown in any one of SEQ ID NOs: 16-87.
4. The targeting polypeptide according to claim 1, wherein The targeting polypeptide targets cells selected from the group consisting of skeletal muscle cells, cardiac muscle cells, liver cells, or a combination thereof.
5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the targeting polypeptide according to claim 1.
6. An AAV capsid protein mutant, characterized in that The AAV capsid protein mutant is obtained by the following method: inserting the targeting polypeptide according to claim 1 into a specific position of the wild-type AAV capsid protein to obtain the AAV capsid protein mutant; or inserting the nucleic acid molecule according to claim 4 into the coding sequence of the wild-type AAV capsid protein; The AAV capsid protein mutant has the specificity of targeting one or more human cells.
7. The AAV capsid protein mutant according to claim 6, wherein The specific position is an AAV specificity determining region, and the AAV specificity determining region is selected from the following group: AAV VP1 variable region VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII and VR-IX.
8. A packaging plasmid for producing recombinant AAV virus particles, characterized in that The packaging plasmid comprises a nucleic acid molecule encoding the targeting polypeptide according to claim 1.
9. A recombinant AAV virus particle, characterized in that The specificity determining region of the recombinant AAV viral vector is inserted with the targeting polypeptide as described in claim 1; or the nucleic acid molecule as described in claim 5 is inserted into the gene of the recombinant AAV viral vector; or the recombinant AAV viral vector contains the AAV capsid protein mutant as described in claim 6; the recombinant AAV viral vector has the specificity of targeting one or more human cells.
10. An AAV product, characterized in that The AAV product comprises the recombinant AAV virus particles according to claim 9.
11. A method for screening the targeting polypeptide according to claim 1, characterized in that: Including steps: (1) Using the human cell genome as a template and primers for PCR, a targeted peptide sequence library was constructed; (2) inserting the targeting sequence into the AAV specificity determining region to construct a screening viral plasmid library; (3) packaging into a virus library; (4) Screening using human cells; (5) Analyze and enrich the sequences using NGS technology to obtain targeted peptides specific to different cells.
12. The method according to claim 11, wherein The sequences of the primers are shown in SEQ ID NOs: 1-10.
13. A use of the targeting polypeptide according to claim 1, characterized in that: It is used to construct a delivery vector so that the delivery vector has the property of specifically targeting human cells.
14. A use of the delivery vector according to claim 5, characterized in that: Used to prepare targeted drugs.