Prophylactic or therapeutic agent for disease or condition associated with angiogenesis, and VEGF production inhibitor
Patent Information
- Application Number
- PCT/JP2025/008457
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-07
- Filing Date
- 2025-03-07
- Publication Date
- 2025-10-02
AI Technical Summary
Current treatments for diseases or pathological conditions associated with angiogenesis, such as osteoarthritis, lack effectiveness and specificity, particularly in inhibiting VEGF production, which is crucial for angiogenesis regulation.
A combination of hsa-miR-140-5p and hsa-miR-126-3p is used as a prophylactic or therapeutic agent to inhibit VEGF production, targeting angiogenesis-related conditions, including osteoarthritis, by administering these microRNAs alone or in combination with pharmaceutically acceptable carriers.
The combination of hsa-miR-140-5p and hsa-miR-126-3p effectively suppresses VEGF production, providing therapeutic benefits for conditions like osteoarthritis, reducing angiogenesis and associated symptoms.
Smart Images

Figure JP2025008457_02102025_PF_FP_ABST
Abstract
Description
Preventive or therapeutic agent for diseases or pathological conditions involving angiogenesis and VEGF production inhibitor
[0001] The present invention relates to a preventive or therapeutic agent for diseases or pathological conditions accompanied by angiogenesis, and a VEGF production inhibitor.
[0002] Angiogenesis, the formation of new blood vessels, is a physiological function inherent in the body. Angiogenesis, as needed under a regulated mechanism, contributes to wound healing and other processes. However, unwanted angiogenesis due to problems in the regulated mechanism or other factors, is known to contribute to various diseases or pathologies. Such diseases or pathologies include joint disease, stiff shoulders, cancer, rheumatoid arthritis, cancer cell proliferation and metastasis, atherosclerosis, neovascular maculopathy, psoriasis, diabetic retinopathy, myopic choroidal neovascularization, age-related macular degeneration, enthesitis (e.g., lateral epicondylitis, Achilles tendonitis), baseball elbow, rotator cuff injury, and plantar tendonitis. Among these, osteoarthritis of the knee, for example, is a progressive and intractable degenerative joint disease with a high prevalence, yet no cure is currently available. Given concerns about an increase in the number of patients with osteoarthritis due to the aging of society, the development of a cure is urgently needed.
[0003] As described above, there are various diseases or pathological conditions accompanied by angiogenesis, and the development of methods for preventing or treating them is highly desired. Vascular endothelial growth factor (VEGF) is known to play a central role in angiogenesis, and the development of drugs targeting VEGF is underway in various places.
[0004] Re-table 2019 / 176901
[0005] Scientific Reports 7: 3584 (2017); miR-29a
[0006] In one embodiment, an objective of the present invention is to provide a novel agent for preventing or treating a disease or condition associated with angiogenesis, and a novel agent for suppressing VEGF production. In another embodiment, a primary object of the present invention is to provide a novel agent for suppressing VEGF production.
[0007] The present inventors investigated the inhibitory effect of a wide variety of miRNAs on VEGF production in synovial sarcoma cells, and found that only five types of miRNAs exhibited an inhibitory effect. The present inventors further investigated combinations of these five types of miRNAs, and found that only the combination of hsa-miR-140-5p and hsa-miR-126-3p exhibited a synergistic effect. The present invention is based on this novel finding.
[0008] Therefore, the present invention provides the following items: Item 1. A prophylactic or therapeutic agent for a disease or condition associated with angiogenesis, comprising hsa-miR-140-5p and hsa-miR-126-3p.
[0009] Item 2. An agent for preventing or treating a disease or condition accompanied by angiogenesis, comprising hsa-miR-140-5p in combination with hsa-miR-126-3p.
[0010] Item 3. An agent for preventing or treating a disease or condition accompanied by angiogenesis, comprising hsa-miR-126-3p in combination with hsa-miR-140-5p.
[0011] Item 4. A VEGF production inhibitor comprising hsa-miR-140-5p and hsa-miR-126-3p.
[0012] Item 5. An agent for suppressing VEGF production in combination with hsa-miR-126-3p, comprising hsa-miR-140-5p.
[0013] Item 6. An agent for suppressing VEGF production in combination with hsa-miR-140-5p, comprising hsa-miR-126-3p.
[0014] Item 7. The agent according to any one of Items 1 to 3, wherein the disease or condition accompanied by angiogenesis is at least one selected from the group consisting of joint disease, stiff shoulders, cancer, rheumatoid arthritis, cancer cell proliferation and metastasis, atherosclerosis, neovascular maculopathy, psoriasis, diabetic retinopathy, myopic choroidal neovascularization, age-related macular degeneration, enthesitis (such as lateral epicondylitis and Achilles tendinitis), baseball's elbow, rotator cuff injury, and plantar tendonitis.
[0015] Item 8. The agent according to Item 7, wherein the disease or condition involving angiogenesis is a joint disease.
[0016] Item 9. The agent according to Item 8, wherein the joint disease is knee osteoarthritis.
[0017] Item 10. The agent according to any one of Items 1 to 9, which is an injection.
[0018] Item 11. A pharmaceutical composition for use in the prevention or treatment of a disease or condition associated with angiogenesis, comprising hsa-miR-140-5p and hsa-miR-126-3p.
[0019] Item 12. A pharmaceutical composition comprising hsa-miR-140-5p for use in preventing or treating a disease or condition associated with angiogenesis in combination with hsa-miR-126-3p.
[0020] Item 13. A pharmaceutical composition for use in preventing or treating a disease or condition associated with angiogenesis, comprising hsa-miR-126-3p in combination with hsa-miR-140-5p.
[0021] Item 14. A pharmaceutical composition for inhibiting VEGF production, comprising hsa-miR-140-5p and hsa-miR-126-3p.
[0022] Item 15. A pharmaceutical composition for suppressing VEGF production in combination with hsa-miR-126-3p, comprising hsa-miR-140-5p.
[0023] Item 16. A pharmaceutical composition for suppressing VEGF production in combination with hsa-miR-140-5p, comprising hsa-miR-126-3p.
[0024] Item 17. The pharmaceutical composition according to any one of Items 11 to 13, wherein the disease or condition accompanied by angiogenesis is at least one selected from the group consisting of joint disease, stiff shoulders, cancer, rheumatoid arthritis, cancer cell proliferation and metastasis, atherosclerosis, neovascular maculopathy, psoriasis, diabetic retinopathy, myopic choroidal neovascularization, age-related macular degeneration, enthesitis (such as lateral epicondylitis and Achilles tendinitis), baseball's elbow, rotator cuff injury, and plantar tendonitis.
[0025] Item 18. The pharmaceutical composition according to Item 17, wherein the disease or condition associated with angiogenesis is a joint disease.
[0026] Item 19. The pharmaceutical composition according to Item 18, wherein the joint disease is knee osteoarthritis.
[0027] Item 20. The pharmaceutical composition according to any one of Items 11 to 19, which is an injection.
[0028] Item 21. hsa-miR-140-5p and hsa-miR-126-3p for use in the prevention or treatment of a disease or condition associated with angiogenesis.
[0029] Item 22. hsa-miR-140-5p for use in the prevention or treatment of a disease or condition associated with angiogenesis in combination with hsa-miR-126-3p.
[0030] Item 23. hsa-miR-126-3p for use in the prevention or treatment of a disease or condition associated with angiogenesis in combination with hsa-miR-140-5p.
[0031] Item 24. hsa-miR-140-5p and hsa-miR-126-3p for inhibiting VEGF production.
[0032] Item 25. hsa-miR-140-5p for suppressing VEGF production in combination with hsa-miR-126-3p.
[0033] Item 26. hsa-miR-126-3p for suppressing VEGF production in combination with hsa-miR-140-5p.
[0034] Item 27. The compound according to any one of Items 21 to 23, wherein the disease or condition accompanied by angiogenesis is at least one selected from the group consisting of joint disease, stiff shoulders, cancer, rheumatoid arthritis, cancer cell proliferation and metastasis, atherosclerosis, neovascular maculopathy, psoriasis, diabetic retinopathy, myopic choroidal neovascularization, age-related macular degeneration, enthesitis (such as lateral epicondylitis and Achilles tendinitis), baseball's elbow, rotator cuff injury, and plantar tendonitis.
[0035] Item 28. The compound according to Item 27, wherein the disease or condition associated with angiogenesis is a joint disease.
[0036] Item 29. The compound according to Item 28, wherein the joint disease is knee osteoarthritis.
[0037] Item 30. The compound according to any one of items 21 to 29, which is administered by injection.
[0038] Item 31. Use of hsa-miR-140-5p and hsa-miR-126-3p for producing an agent for preventing or treating a disease or condition associated with angiogenesis.
[0039] Item 32. Use of hsa-miR-140-5p in the manufacture of an agent for preventing or treating a disease or condition associated with angiogenesis in combination with hsa-miR-126-3p.
[0040] Item 33. Use of hsa-miR-126-3p in the manufacture of an agent for preventing or treating a disease or condition associated with angiogenesis in combination with hsa-miR-140-5p.
[0041] Item 34. Use of hsa-miR-140-5p and hsa-miR-126-3p for producing a VEGF production inhibitor.
[0042] Item 35. Use of hsa-miR-140-5p for producing an agent for suppressing VEGF production in combination with hsa-miR-126-3p.
[0043] Item 36. Use of hsa-miR-126-3p for producing an agent for suppressing VEGF production in combination with hsa-miR-140-5p.
[0044] Item 37. The use according to any one of Items 31 to 33, wherein the disease or condition accompanied by angiogenesis is at least one selected from the group consisting of joint disease, stiff shoulders, cancer, rheumatoid arthritis, cancer cell proliferation and metastasis, atherosclerosis, neovascular maculopathy, psoriasis, diabetic retinopathy, myopic choroidal neovascularization, age-related macular degeneration, enthesitis (such as lateral epicondylitis and Achilles tendinitis), baseball's elbow, rotator cuff injury, and plantar tendonitis.
[0045] Item 38. The use according to Item 37, wherein the disease or condition involving angiogenesis is a joint disease.
[0046] Item 39. The use according to Item 38, wherein the joint disease is knee osteoarthritis.
[0047] Item 40. The use according to any one of Items 31 to 39, wherein the agent is an injection.
[0048] Item 41. A method for preventing or treating a disease or condition associated with angiogenesis, comprising administering effective amounts of hsa-miR-140-5p and hsa-miR-126-3p to a subject in need thereof.
[0049] Item 42. A method for suppressing VEGF production, comprising administering effective amounts of hsa-miR-140-5p and hsa-miR-126-3p to a subject in need thereof.
[0050] Item 43. The method according to Item 41, wherein the disease or condition accompanied by angiogenesis is at least one selected from the group consisting of joint disease, stiff shoulders, cancer, rheumatoid arthritis, cancer cell proliferation and metastasis, atherosclerosis, neovascular maculopathy, psoriasis, diabetic retinopathy, myopic choroidal neovascularization, age-related macular degeneration, enthesitis (such as lateral epicondylitis and Achilles tendonitis), baseball's elbow, rotator cuff injury, and plantar tendonitis.
[0051] Item 44. The method according to Item 43, wherein the disease or condition associated with angiogenesis is a joint disease.
[0052] Item 45. The method according to Item 44, wherein the joint disease is knee osteoarthritis.
[0053] Item 46. The method according to any one of Items 41 to 45, wherein hsa-miR-140-5p and hsa-miR-126-3p are administered by injection.
[0054] In one embodiment, the present invention can provide a novel agent for preventing or treating a disease or condition associated with angiogenesis, and a novel agent for suppressing VEGF production. In another embodiment, the present invention can provide a novel agent for suppressing VEGF production.
[0055] In contrast, Patent Document 1 discloses anti-inflammatory effects in osteoarthritis that contain as active ingredients miR-21 inhibitors or TLR7, 8, and 9 antagonists whose base sequences differ from those of hsa-miR-140-5p and hsa-miR-126-3p, but does not mention hsa-miR-126-3p. Furthermore, Patent Document 1 states in paragraph
[0088] that it is unclear whether miR-140 is involved in pain in osteoarthritis. Furthermore, Patent Document 1 does not disclose any therapeutic effects on knee osteoarthritis. Non-Patent Document 1 suggests that miR-29a, which has a different base sequence from hsa-miR-140-5p and hsa-miR-126-3p, has a protective effect against joint damage (anti-inflammatory effect) by inhibiting excessive synovial angiogenesis and fibrosis, but does not disclose hsa-miR-140-5p or hsa-miR-126-3p. Furthermore, Non-Patent Document 1 does not disclose a therapeutic effect on knee osteoarthritis. Therefore, such effects of the present invention could not be predicted from the prior art.
[0056] 1 shows the results of measuring the amount of VEGF produced per cell using a human synovial sarcoma-derived cell line in Example 2. MOC indicates the solvent-only treatment group. 1 shows the results of measuring the amount of VEGF produced when hsa-miRNA-126-3p, hsa-miR-140-5p, hsa-miR-107, and hsa-miR-100-5p were used alone or in combination in Example 2. 1 shows the results of measuring the amount of VEGF produced per cell using human synovial membrane-derived cells in Example 3. 1 shows the results of measuring the amount of VEGF in the synovial tissue and synovial fluid in anterior cruciate ligament transection (ACLT) model rats in Example 4(3). 1 shows the results of a pain test in ACLT model rats in Example 4(4). 1 shows the synovitis score in ACLT model rats in Example 4(5). 1 shows the results of measuring the amount of VEGF produced using a human chondrocyte cell line in Example 5. 1 shows the results of measuring the amount of VEGF produced using a chondrosarcoma cell line in Example 6.
[0057] Preferred embodiments for carrying out the present invention will be described below. The embodiments described below are representative embodiments of the present invention, and the scope of the present invention is not limited to these embodiments.
[0058] 1. Agent for preventing or treating diseases or conditions associated with angiogenesis In one embodiment, the present invention provides an agent for preventing or treating diseases or conditions associated with angiogenesis in combination with hsa-miR-126-3p, comprising hsa-miR-140-5p. This embodiment relates to an agent comprising hsa-miR-140-5p as an active ingredient, which is used in combination with hsa-miR-126-3p. In the present invention, "hsa-miR-140-5p" refers to a miRNA and / or a homolog thereof consisting of the nucleotide sequence shown in SEQ ID NO: 1: CAGUGGUUUUACCCUAUGGUAG. In addition, in the present invention, "hsa-miR-126-3p" refers to a miRNA and / or a homolog thereof consisting of the nucleotide sequence shown in SEQ ID NO: 2: UCGUACCGUGAGUAAUAAUGCG Unless otherwise specified, the left end of the base sequence described in this specification is the 5' end and the right end is the 3' end.
[0059] "MiRNA consisting of the base sequence shown in SEQ ID NO: 1" may also include miRNAs that have been modified to improve cellular introduction efficiency, stability, etc. For example, "miRNA consisting of the base sequence shown in SEQ ID NO: 1" may include miRNAs in which at least a portion of the nucleotides constituting the miRNA are substituted with a methoxy group, methyl group, amino group, thioxo group (=S), halogen, etc., miRNAs in which hydroxyl groups (-OH) in at least a portion of the nucleotides constituting the miRNA are substituted with hydrogen (-H), or combinations thereof. "MiRNA consisting of the base sequence shown in SEQ ID NO: 1" may also include miRNAs that do not have these modifications. "Homologues of miRNA consisting of the base sequence shown in SEQ ID NO: 1," "miRNA consisting of the base sequence shown in SEQ ID NO: 2," and "homologues of miRNA consisting of the base sequence shown in SEQ ID NO: 2" may similarly include miRNAs with and without the above modifications.
[0060] In one embodiment of the present invention, unless otherwise specified, "hsa-miR-140-5p" may also include miR-140-5p in which one or several (e.g., 1 to 3, 1 to 2, 1, etc.) bases have been substituted, added, and / or deleted relative to the base sequence shown in SEQ ID NO: 1. For example, when the inhibitory effect on VEGF production in synovial sarcoma cells is measured in the same manner as in Example 2 except that "hsa-miR-140-5p" is used instead of the miRNA consisting of the base sequence shown in SEQ ID NO: 1, "hsa-miR-140-5p" is preferably one that shows a synergistic effect when combined with the miRNA consisting of the base sequence shown in SEQ ID NO: 2 (showing a significantly higher inhibitory effect on VEGF production compared to when the miRNA consisting of the base sequence shown in SEQ ID NO: 1 and the miRNA consisting of the base sequence shown in SEQ ID NO: 2 are used alone).
[0061] In one embodiment of the present invention, unless otherwise specified, "hsa-miR-126-3p" may also include miR-126-3p in which one or several (e.g., 1 to 3, 1 to 2, 1, etc.) bases have been substituted, added, and / or deleted relative to the base sequence shown in SEQ ID NO: 2. For example, when the inhibitory effect on VEGF production in synovial sarcoma cells is measured in the same manner as in Example 2 except that "hsa-miR-126-3p" is used instead of the miRNA consisting of the base sequence shown in SEQ ID NO: 2, "hsa-miR-126-3p" is preferably one that shows a synergistic effect when combined with the miRNA consisting of the base sequence shown in SEQ ID NO: 1 (showing a significantly higher inhibitory effect on VEGF production compared to when the miRNA consisting of the base sequence shown in SEQ ID NO: 1 and the miRNA consisting of the base sequence shown in SEQ ID NO: 2 are used alone).
[0062] In the present invention, the ratio of hsa-miR-140-5p to hsa-miR-126-3p used is not limited, but for example, 0.01 to 100 mol of the latter per 1 mol of the former is preferred, 0.1 to 10 mol is more preferred, and 0.2 to 10 mol is even more preferred.
[0063] In the present invention, examples of diseases or pathological conditions involving angiogenesis include joint diseases, stiff shoulders, cancer (chondrosarcoma, colon cancer, rectal cancer, non-small cell lung cancer, renal cell carcinoma, hepatocellular carcinoma, breast cancer, pancreatic cancer, gastric cancer, ovarian cancer, cervical cancer, malignant glioma, etc.), rheumatoid arthritis, cancer cell proliferation and metastasis, atherosclerosis, neovascular maculopathy, psoriasis, diabetic retinopathy, myopic choroidal neovascularization, age-related macular degeneration, enthesitis (e.g., lateral epicondylitis, Achilles tendinitis), baseball elbow, rotator cuff injury, and plantar tendinitis, and preferably include joint diseases. As used herein, "joint disease" refers to a disease in which abnormalities such as deformation, injury, and inflammation occur in a joint. The joint is a mobile joint that connects bones and specifically includes cartilage, synovial membrane, meniscus, ligaments, etc. Examples of joint diseases include diseases of the knee joint, hip joint, finger joint, etc. Examples of knee joint diseases include osteoarthritis, anserine bursitis, meniscus injury, osteochondritis dissecans, quadriceps tendonitis, bursitis (prepatellar bursitis), patellofemoral arthropathy, patellar tendonitis (patellar tendonitis), Osgood-Schlatter disease, Baker's cyst, rheumatoid arthritis, osteonecrosis of the knee, heterotopic ossification, etc., and preferably includes osteoarthritis of the knee.
[0064] In the present invention, hsa-miR-140-5p, the active ingredient of the present invention, may be used itself as an agent for preventing or treating diseases or pathological conditions involving angiogenesis, or may be used as a composition in combination with various pharmaceutically acceptable carriers (e.g., isotonicity agents, chelating agents, stabilizers, pH adjusters, preservatives, antioxidants, solubilizing agents, thickening agents, etc.).
[0065] Examples of isotonic agents include sugars such as glucose, trehalose, lactose, fructose, mannitol, xylitol, and sorbitol; polyhydric alcohols such as glycerin, polyethylene glycol, and propylene glycol; and inorganic salts such as sodium chloride, potassium chloride, and calcium chloride.
[0066] Examples of chelating agents include edetate salts such as disodium edetate, calcium disodium edetate, trisodium edetate, tetrasodium edetate, and calcium edetate, ethylenediaminetetraacetate, nitrilotriacetic acid or a salt thereof, sodium hexametaphosphate, and citric acid.
[0067] Examples of stabilizers include sodium hydrogen sulfite, etc. Examples of pH adjusters include acids such as hydrochloric acid, carbonic acid, acetic acid, citric acid, etc., and further include alkali metal hydroxides such as sodium hydroxide and potassium hydroxide, alkali metal carbonates or hydrogen carbonates such as sodium carbonate, alkali metal acetates such as sodium acetate, alkali metal citrates such as sodium citrate, and bases such as trometamol.
[0068] Examples of preservatives include sorbic acid, potassium sorbate, parahydroxybenzoic acid esters such as methyl parahydroxybenzoate, ethyl parahydroxybenzoate, propyl parahydroxybenzoate, and butyl parahydroxybenzoate, quaternary ammonium salts such as chlorhexidine gluconate, benzalkonium chloride, benzethonium chloride, and cetylpyridinium chloride, alkylpolyaminoethylglycine, chlorobutanol, polyquad, polyhexamethylene biguanide, and chlorhexidine.
[0069] Antioxidants include, for example, sodium bisulfite, dry sodium sulfite, sodium pyrosulfite, concentrated mixed tocopherols, and the like.
[0070] Examples of solubilizing agents include sodium benzoate, glycerin, D-sorbitol, glucose, propylene glycol, hydroxypropylmethylcellulose, polyvinylpyrrolidone, macrogol, D-mannitol, and the like.
[0071] Examples of thickening agents include polyethylene glycol, methyl cellulose, ethyl cellulose, carmellose sodium, xanthan gum, sodium chondroitin sulfate, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, polyvinylpyrrolidone, and polyvinyl alcohol.
[0072] Furthermore, in the present invention, hsa-miR-140-5p and / or hsa-miR-140 may be contained in the agent of the present invention in a state where it is incorporated into a vehicle or together with a vehicle (for example, in a state where it is embedded in a vehicle). Examples of vehicles include vectors, polymers, and the like. Examples of vectors include viral vectors such as adenoviral vectors and retroviral vectors; and non-viral vectors such as plasmid vectors and bacterial vectors. Examples of polymers include cationic polymers (polyethyleneimine nanoparticles, etc.). Furthermore, the "agent for preventing or treating a disease or pathological condition associated with angiogenesis, which comprises hsa-miR-140-5p and hsa-miR-126-3p" according to the present invention also encompasses agents comprising cells modified to express hsa-miR-140-5p and / or hsa-miR-140; and exosomes, membrane vesicles (EVs), and the like prepared from such cells.
[0073] In an embodiment of the composition, the content of hsa-miR-140-5p in the composition is not particularly limited and can be appropriately set based on conditions such as, for example, 99% by mass or more, 95% by mass or more, 90% by mass or more, 70% by mass or more, 50% by mass or more, 30% by mass or more, 10% by mass or more, 5% by mass or more, or 1% by mass or more.
[0074] In an embodiment of the composition, the upper limit of the content of hsa-miR-140-5p in the composition is not particularly limited and can be set appropriately based on conditions such as 99% by mass or less, 95% by mass or less, 90% by mass or less, 70% by mass or less, 50% by mass or less, 30% by mass or less, 10% by mass or less, 5% by mass or less, or 1% by mass or less.
[0075] In the embodiment of the composition, the composition of the present invention may further contain a substance known to be effective in preventing or treating diseases or conditions associated with angiogenesis.For example, platinum preparations such as cisplatin and carboplatin, anticancer drugs such as irinotecan, fluorouracil, tegafur, uracil, gemcitabine, cyclophosphamide, methotrexate, and doxorubicin; analgesics such as acetaminophen, NSAIDs, neurotropin, and opioids (codeine phosphate, morphine, oxycodone, fentanyl, remifentanil, meperidine, tramadol, buprenorphine, and pentazocine); local anesthetics such as xylocaine and neovitacaine; and hyaluronic acid.These substances can be used alone or in combination of two or more.
[0076] The formulation form is not particularly limited, and examples thereof include various formulation forms such as orally administered agents such as tablets, pills, capsules, powders, granules, and syrups; and parenterally administered agents such as injections (intravenous injection, intramuscular injection, local injection, etc.), mouthwashes, infusions, topical agents (ointments, creams, patches, inhalants), and suppositories. Among the above formulation forms, preferred examples include orally administered agents and injections, and more preferred are injections. These formulations also include embodiments that utilize the aforementioned exosomes, membrane vesicles, and the like. The agent of the present invention may also be in the form of a syringe, in which the pharmaceutical composition is filled into the syringe barrel.
[0077] In this embodiment, the dosage of the preventive or therapeutic agent for diseases or conditions involving angiogenesis varies depending on the route of administration, the patient's age, weight, symptoms, etc., and cannot be generally defined, but can be set so that the daily dosage for an adult is typically 5000 mg or less, 1000 mg or less, 100 mg or less, 10 mg or less, etc., in terms of the amount of hsa-miR-140-5p. The lower limit of the dosage of the preventive or therapeutic agent for diseases or conditions involving angiogenesis is also not particularly limited, and can be set so that, for example, the daily dosage for an adult is typically 1000 mg or more, 100 mg or more, 10 mg or more, 5 mg or more, etc., in terms of the amount of hsa-miR-140-5p. When administered once daily, it is sufficient that this amount is contained in one formulation, and when administered three times daily, it is sufficient that one formulation contains one-third of this amount.
[0078] In this embodiment, the dosage of hsa-miR-140 varies depending on the route of administration, the patient's age, weight, symptoms, etc., and cannot be generally defined, but can be set so that the daily dosage for an adult is typically 5000 mg or less, 1000 mg or less, 100 mg or less, 10 mg or less, etc. The lower limit of the dosage of hsa-miR-140 is also not particularly limited, and can be set so that, for example, the daily dosage for an adult is typically 1000 mg or more, 100 mg or more, 10 mg or more, 5 mg or more, etc. When administered once daily, it is sufficient that this amount is contained in one formulation, and when administered three times daily, it is sufficient that one formulation contains one-third of this amount.
[0079] The agent for preventing or treating a disease or condition involving angiogenesis of the present invention is administered to a patient such as a mammal. Examples of mammals include humans, monkeys, mice, rats, rabbits, cats, dogs, pigs, cows, horses, sheep, etc., with humans being preferred.
[0080] In the present invention, "an agent containing hsa-miR-140-5p" includes not only an agent containing hsa-miR-140-5p itself, but also a precursor of hsa-miR-140-5p that forms hsa-miR-140-5p in vivo, inside cells, etc.
[0081] As used herein, a "precursor" refers to an RNA that can generate a mature miRNA by cleavage or cleavage of the double strand. Thus, examples of precursors include pre-miRNA, pre-miRNA, double-stranded miRNA consisting of a mature miRNA and its antisense strand (hereinafter sometimes simply referred to as "double-stranded miRNA"), and combinations of these. Therefore, in the present invention, precursors of hsa-miR-140-5p include pri-miRNA, pre-miRNA, double-stranded miRNA of hsa-miR-140-5p, and combinations of these.
[0082] Furthermore, in the present invention, the phrase "for the prevention or treatment of ... in combination with hsa-miR-126-3p" encompasses not only applications using hsa-miR-126-3p itself, but also applications using a precursor of hsa-miR-126-3p that forms hsa-miR-126-3p in vivo, inside cells, etc. In the present invention, examples of the precursor of hsa-miR-126-3p include pri-miRNA, pre-miRNA, double-stranded miRNA of hsa-miR-126-3p, and combinations thereof.
[0083] In another embodiment, the present invention provides an agent for preventing or treating a disease or condition associated with angiogenesis, comprising hsa-miR-126-3p in combination with hsa-miR-140-5p. This embodiment relates to an agent comprising hsa-miR-126-3p as an active ingredient, which is used in combination with hsa-miR-140-5p. In this embodiment, hsa-miR-126-3p, the active ingredient of the present invention, may be used itself as an agent for preventing or treating a disease or condition associated with angiogenesis, or it may be used as a composition in combination with various pharmaceutically acceptable carriers (e.g., isotonicity agents, chelating agents, stabilizers, pH adjusters, preservatives, antioxidants, solubilizers, thickeners, etc.). In this embodiment, the content of hsa-miR-126-3p in the composition is not particularly limited and can be appropriately set based on conditions such as 99% by mass or more, 95% by mass or more, 90% by mass or more, 70% by mass or more, 50% by mass or more, 30% by mass or more, 10% by mass or more, 5% by mass or more, or 1% by mass or more.
[0084] In this embodiment, the upper limit of the content of hsa-miR-126-3p in the composition is not particularly limited and can be set appropriately based on conditions such as 99% by mass or less, 95% by mass or less, 90% by mass or less, 70% by mass or less, 50% by mass or less, 30% by mass or less, 10% by mass or less, 5% by mass or less, or 1% by mass or less.
[0085] In this embodiment, the dosage of the preventive or therapeutic agent for diseases or conditions involving angiogenesis varies depending on the route of administration, the patient's age, weight, symptoms, etc., and cannot be generally defined, but can be set so that the daily dosage for an adult is typically 5000 mg or less, 1000 mg or less, 100 mg or less, 10 mg or less, etc., in terms of the amount of hsa-miR-126-3p. The lower limit of the dosage of the preventive or therapeutic agent for diseases or conditions involving angiogenesis is also not particularly limited, and can be set so that, for example, the daily dosage for an adult is typically 1000 mg or more, 100 mg or more, 10 mg or more, 5 mg or more, etc., in terms of the amount of hsa-miR-126-3p. When administered once daily, it is sufficient that this amount is contained in one formulation, and when administered three times daily, it is sufficient that one formulation contains one-third of this amount.
[0086] In this embodiment, the dosage of hsa-miR-140-5p varies depending on the route of administration, the patient's age, weight, symptoms, etc., and cannot be generally defined, but can be set so that the daily dosage for an adult is typically 5000 mg or less, 1000 mg or less, 100 mg or less, 10 mg or less, etc. The lower limit of the dosage of hsa-miR-140-5p is also not particularly limited, and can be set so that, for example, the daily dosage for an adult is typically 1000 mg or more, 100 mg or more, 10 mg or more, 5 mg or more, etc. When administered once daily, it is sufficient that this amount is contained in one formulation, and when administered three times daily, it is sufficient that one formulation contains one-third of this amount.
[0087] In this embodiment, the definitions of hsa-miR-126-3p and hsa-miR-140-5p, the usage ratio, the fact that precursors of hsa-miR-126-3p and / or hsa-miR-140-5p may be included, components other than hsa-miR-126-3p and hsa-miR-140-5p in the composition embodiment, the target disease or pathological condition, etc. are the same as those described above.
[0088] In another embodiment, the present invention provides an agent for preventing or treating a disease or condition associated with angiogenesis, comprising hsa-miR-140-5p and hsa-miR-126-3p. This embodiment relates to an agent comprising hsa-miR-140-5p and hsa-miR-126-3p as active ingredients. In this embodiment, the active ingredients of the present invention, hsa-miR-140-5p and hsa-miR-126-3p, may be used themselves as an agent for preventing or treating a disease or condition associated with angiogenesis, or they may be used as a composition in combination with various pharmaceutically acceptable carriers (e.g., isotonicity agents, chelating agents, stabilizers, pH adjusters, preservatives, antioxidants, solubilizers, thickeners, etc.). In this embodiment, the contents of hsa-miR-140-5p and hsa-miR-126-3p in the composition are not particularly limited, and the total amount thereof can be appropriately set based on conditions such as 99% by mass or more, 95% by mass or more, 90% by mass or more, 70% by mass or more, 50% by mass or more, 30% by mass or more, 10% by mass or more, 5% by mass or more, or 1% by mass or more.
[0089] In this embodiment, the upper limit of the content of hsa-miR-140-5p and hsa-miR-126-3p in the composition is not particularly limited, and the total amount thereof can be appropriately set based on conditions such as 99% by mass or less, 95% by mass or less, 90% by mass or less, 70% by mass or less, 50% by mass or less, 30% by mass or less, 10% by mass or less, 5% by mass or less, or 1% by mass or less.
[0090] In this embodiment, the "agent for the prophylaxis or treatment of a disease or condition associated with angiogenesis, comprising hsa-miR-140-5p and hsa-miR-126-3p" includes not only embodiments in which hsa-miR-140-5p and hsa-miR-126-3p are contained in a single dosage form, but also so-called combined preparations in which they are contained in separate dosage forms.
[0091] In this embodiment, the definitions of hsa-miR-126-3p and hsa-miR-140-5p, the usage ratios, dosages, the fact that precursors of hsa-miR-126-3p and / or hsa-miR-140-5p may be included, components other than hsa-miR-126-3p and hsa-miR-140-5p in the composition embodiment, the target diseases or pathological conditions, etc. are the same as those described above.
[0092] 2. VEGF Production Inhibitor According to the present invention, VEGF production can be inhibited, thereby inhibiting angiogenesis, by combining hsa-miR-140-5p and hsa-miR-126-3p. Thus, in one embodiment, the present invention provides an agent comprising hsa-miR-140-5p for inhibiting VEGF production in combination with hsa-miR-126-3p. This embodiment relates to an agent comprising hsa-miR-140-5p as an active ingredient, which is used in combination with hsa-miR-126-3p.
[0093] The definitions, usage ratios, dosages, the possibility of inclusion of precursors of hsa-miR-126-3p and / or hsa-miR-140-5p, and components other than hsa-miR-140-5p and hsa-miR-126-3p in the composition embodiments are the same as those described above for the "agent for preventing or treating a disease or condition associated with angiogenesis, comprising hsa-miR-140-5p in combination with hsa-miR-126-3p." The VEGF production inhibitor of the present invention can be used in vivo or in vitro.
[0094] In one embodiment, the present invention provides an agent for suppressing VEGF production in combination with hsa-miR-140-5p, comprising hsa-miR-126-3p. This embodiment relates to an agent comprising hsa-miR-126-3p as an active ingredient, which is used in combination with hsa-miR-140-5p.
[0095] The definitions, usage ratios, dosages, the possibility of inclusion of precursors of hsa-miR-126-3p and / or hsa-miR-140-5p, and components other than hsa-miR-140-5p and hsa-miR-126-3p in the composition embodiments are the same as those described above for the "agent for preventing or treating a disease or condition accompanied by angiogenesis in combination with hsa-miR-140-5p, comprising hsa-miR-126-3p." The VEGF production inhibitor of the present invention can be used in vivo or in vitro.
[0096] In one embodiment, the present invention provides an agent for suppressing VEGF production, comprising hsa-miR-140-5p and hsa-miR-126-3p. This embodiment relates to an agent comprising hsa-miR-140-5p and hsa-miR-126-3p as active ingredients.
[0097] The definitions, usage ratios, dosages, the possibility of inclusion of precursors of hsa-miR-126-3p and / or hsa-miR-140-5p, and components other than hsa-miR-140-5p and hsa-miR-126-3p in the composition embodiments are the same as those described above for the "agent for the prophylaxis or treatment of diseases or conditions associated with angiogenesis, comprising hsa-miR-140-5p and hsa-miR-126-3p." The VEGF production inhibitor of the present invention can be used in vivo or in vitro.
[0098] 3. Other Embodiments Although the present invention has been described above using specific embodiments of the present invention, the present invention is not limited to these embodiments. For example, the present invention may include various embodiments (such as kits for preventing or treating diseases or conditions involving angiogenesis, kits for inhibiting VEGF production, methods for preventing or treating diseases or conditions involving angiogenesis, methods for inhibiting VEGF production, use of hsa-miR-140-5p and / or hsa-miR-126-3p for preventing or treating diseases or conditions involving angiogenesis, and use of hsa-miR-140-5p and / or hsa-miR-126-3p for inhibiting VEGF production) as long as the combination of hsa-miR-140-5p and hsa-miR-126-3p is used, and the combination is used for preventing or treating diseases or conditions involving angiogenesis or for inhibiting VEGF production.
[0099] The definitions, usage ratios, dosages, and components other than hsa-miR-140-5p and hsa-miR-126-3p in the embodiments are the same as those described above. Other components may be included in the kit embodiments as needed. Examples of other components include, but are not limited to, tools for collecting specimens (e.g., syringes), positive control samples, and negative control samples.
[0100] Specific embodiments of the present invention will be described in more detail using examples, but the present invention is not limited to these examples.
[0101] Example 1. miRNA Selection Using miRTarBase 8.0 (Nucleic Acids Research 2020, 8; 48(D1):D148-D154.), candidate miRNAs reported to regulate VEGF mRNA were extracted. Furthermore, miRNA expression data for cartilage, synovium, and blood vessels was obtained from FANTOM (https: / / fantom.gsc.riken.jp / jp / ), and 20 miRNAs showing characteristic expression patterns for each tissue were randomly selected. miRIDIAN microRNA Mimic and Negative control #1 (hereinafter referred to as miRNA-mimic: Horizon Discovery Ltd.), which express the selected miRNAs intracellularly, were purchased and used in the experiment.The base sequences of the miRNAs used in the examples are as follows: NC (miRIDIAN Negative Control #1 cel-miR-67): UCACAACCUCCUAGAAAGAGUAGA miR-140-5p: CAGUGGUUUUACCCUAUGGUAG miR-107: AGCAGCAUUGUACAGGGCUAUCA miR-126-3p: UCGUACCGUGAGUAAUAAUGCG miR-27b-3p: UUCACAGUGGCUAAGUUCUGC miR-199a-3p: ACAGUAGUCUGCACAUUGGUUA miR-125a-5p: UCCCUGAGACCCUUUAACCUGUGA miR-199a-5p: CCCAGUGUUCAGACUACCUGUUC miR-101-3p: UACAGUACUGUGAUAACUGAA miR-320a: AAAAGCUGGGUUGAGAGGGGCGA miR-128-3p: UCACAGUGAACCGGUCUCUUU miR-145-5p: GUCCAGUUUUCCCAGGAAUCCCU miR-126-5p: CAUUAUUACUUUUGGUACGCG miR-100-5p: AACCCGUAGAUCCGAACUUGUG miR-146a-5p: UGAGAACUGAAUUCCAUGGGUU miR-146b-5p: UGAGAACUGAAUUCCAUAGGCU miR-140-3p: UACCACAGGGUAGAACCACGG miR-455-5p: UAUGUGCCUUUGGACUACAUCG miR-148a-3p: UCAGUGCACUACAGAACUUUGU miR-193b-3p: AACUGGCCCUCAAAGUCCCGCU miR-193b-5p: CGGGGUUUUGAGGGCGAGAUGA.
[0102] Example 2. miRNA effects and combined effects in human synovial sarcoma-derived cell line HS-SY-II. Human synovial cell line HS-SY-II (RIKEN Cell Research, #RCB2231) was plated at 2 x 10 5Cells were seeded at 1000 cells / well and cultured in DMEM low glucose, pyruvic acid-containing medium (Gibco #11885) containing 10% FBS (NICHIREI BIOSCIENCES INC.) and Antibiotic-Antimycotic Solution (Fujifilm, 161-23181). The miRIDIAN microRNA mimic (hereafter referred to as miRNA-mimic: Horizon Discovery Ltd.) corresponding to the selected miRNA was introduced into HS-SY-II cells at a final concentration of 10 nM using Lipofectamin RNAiMax (Thermo Fisher) and cultured at 37°C in a 5% CO2 incubator. The medium was replaced the next day, and the cells were cultured for an additional 24 hours under hypoxia (hypoxia) or normoxia (normoxia). The supernatant was then collected, and VEGF levels were measured using a Human VEGF SimpleStep ELISA kit (abcam). The cell counts in the 24-well plates were analyzed using the CellTiter-Glo® 2.0 Cell Viability Assay (Promega), and the amount of VEGF produced per cell was calculated. MiRNA mimics that significantly suppressed VEGF production compared to the negative control miRNA mimic treatment group were identified. The results are shown in Figure 1. Of the 20 miRNA mimics, five miRNAs, hsa-miRNA-126-3p, hsa-miR-140-5p, hsa-miR-107, hsa-miR-100-5p, and hsa-miR-140-3p, tended to suppress VEGF production.
[0103] These miRNA combinations were examined under conditions in which VEGF production was induced by hypoxia. The results are shown in Figure 2. As shown in Figure 2, the combination of hsa-miR-126-3p and hsa-miR-140-5p demonstrated a stronger inhibitory effect than either miR alone.
[0104] Example 3. Combined effect of miRNA on human synovial membrane-derived cells (VEGF production suppression test) Synovial cells were isolated from synovial tissue extracted during total knee arthroplasty using 20% FBS DMEM / F12 medium (Gibco #11320) containing 5 mg / ml Collagenase Type I (Worthington #CLS-1) and cryopreserved using CELLBANKER 1 (Zenoac). For the experiment, cells passaged three times in α-MEM GluMAX (Gibco, #32561) containing 10% FBS and Antibiotic-Antimycotic Solution (hereinafter referred to as 10% FBS-MEM medium) were used. The third passage synovium-derived cells were cultured in 10% FBS-MEM medium until subconfluent, and then 2 × 10 5 The cells were seeded at 12-well Falcon plates at 100 cells / well, and at the time of seeding, 10 nM hsa-miRNA-126-3p mimic (miR-126-3p), 10 nM miRNA-140-5p mimic alone (miR-140-5p), or 10 nM each of miRNA-126-3p mimic and miRNA-140-5p mimic (Mix), or 20 nM negative control miRNA mimic (NC) were introduced using Lipofectamin RNAiMax, and the cells were cultured at 37°C in a 5% CO2 incubator. The medium was changed the day after seeding, and the medium cultured for 24 to 48 hours after miRNA introduction was used as the Day 2 culture supernatant. Similarly, the culture supernatant was collected on Day 3, Day 4, and Day 8. VEGF levels were measured using a Human VEGF SimpleStep ELISA kit (abcam). The number of cells in the 12-well plate was analyzed using Cell titer Glo (Promega), and the amount of VEGF produced per cell was calculated. The results are shown in Figure 3. Compared to the negative control miRNA-mimic treatment group, the combination of hsa-miR-126-3p and has-miR-140-5p exhibited a stronger inhibitory effect than either miR alone.
[0105] Example 4. Effect of miRNA mimics on anterior cruciate ligament transection model (ACLT) (1) Preparation of ACLT model 13-week-old male Wistar rats were acclimated for two weeks prior to treatment. Under anesthesia with isoflurane and oxygen inhalation, a 1-cm incision was made in the skin using a parapatellar approach to aseptically expose the patellar tendon. The knee joint was flexed 90° to expose the patellar tendon, and the patella was then laterally dislocated. The anterior cruciate ligament within the knee joint was then cut with scissors, and the medial meniscus was then resected with tweezers (ACLT procedure). The patellar tendon was repositioned, and the joint capsule and skin were sutured. Similarly, a group in which only the joint cavity was incised was designated the sham operation group.
[0106] (2) Intra-articular administration of miRNA mimic One week after ACLT treatment, the affected limb weight distribution ratio was measured using an INCAPACITANCE METER (LINTON). The patients were divided into four groups (n = 5) to avoid bias in body weight and affected limb weight distribution ratio: negative control group (NC), mmu-miR-126-3p mimic single agent group (miR-126-3p), mmu-miR-140-5p single agent group (miR-140-5p), and mmu-miR-126-3p & mmu-miR-140-5 combined group (Mix). The miRNA mimic was prepared at 2 nmol / 30 μL using in vivo jetPEI (Polyplus transfection) according to the manufacturer's instructions. The miR-126-3p & miR-140-5p Mix group received 1 nmol / 30 μL of each. A 1-cm incision was made on the medial side of the knee joint, and the patellar tendon was approached using a parapatellar approach. With the knee joint flexed at 90°, a 29G needle was used to administer the miRNA mimic solution directly above the patellar tendon into the joint. The knee joint was then slowly returned to an extended position, and the incised skin was sutured. The miRNA mimic solution was administered intra-articularly at 30 μL once a week from 1 to 4 weeks after ACLT treatment. Five weeks after ACLT treatment, the rats were euthanized, and joint tissue (synovial tissue and cartilage tissue) was collected. For Western blotting, 30 μL of miRNA mimic solution was administered intra-articularly twice, at 2 and 4 weeks after ACLT treatment, and the rats were euthanized at 5 weeks after ACLT treatment and the joint tissues were collected.
[0107] (3) VEGF Production Inhibition Test (Western Blot) Synovial tissue was lysed in RIPA solution using a bead-type homogenizer and centrifuged at 10,000 rpm for 5 minutes. The supernatant was used as a tissue lysate sample. Synovial fluid samples were prepared by injecting 30 μL of saline into the synovial cavity, as in the case of intra-articular administration. The knee was flexed and extended while the needle tip was maintained within the synovial cavity, and all saline and body fluids within the synovial cavity that could be recovered were then collected. The protein concentration of the samples was measured using the Lowry method, and the synovial fluid proteins were concentrated by acetone precipitation. 300 ng of protein per lane was analyzed by immunoreaction using WES (Protein Simple Japan). VEGF was detected using an anti-VEGF rabbit monoclonal antibody (EPR20705: abcam, ab214424), and correction was performed using a Total Protein Detection Module (Protein Simple Japan). The amounts of VEGF in the synovial tissue and synovial fluid were compared. The results are shown in Figure 4. Among rats treated with ACLT, the level of VEGF in the synovial tissue of the negative control group was increased compared to the sham group, but the increase was significantly suppressed in the miRNA mimic-administered group.
[0108] (4) Pain test The affected limb weight distribution ratio was measured twice a week from 1 week to 5 weeks after ACLT treatment using an INCAPACITANCE METER (LINTON). The results are shown in Figure 5. The affected limb weight distribution ratio remained around 30% until 5 weeks after ACLT in the NC group, but in the single-administration group, the weight distribution ratio gradually improved after the start of administration, reaching 42% at 5 weeks. In the MIX group, the weight distribution ratio further improved to 47%.
[0109] (5) Synovitis Score Evaluation After tissue fixation with 10% buffered formalin, the tissue was decalcified at 4°C, embedded in paraffin, and sliced. Hematoxylin-eosin staining was performed, and the synovial tissue was examined microscopically. OA-induced cartilage degeneration was evaluated using the inflammation score classification by Krenn et al. The results are shown in Figure 6. ACLT treatment increased the synovitis score, but intra-articular administration of miRNA-mimic suppressed synovitis.
[0110] Example 5. Inhibition of VEGF production in C28 / I2 (chondrocyte cell line) Human chondrocyte cell line C28 / I2 (Merck) was plated in a Corning 96-well plate at 3 x 10 3 Cells were seeded at 1000 cells / well in DMEM medium (Gibco #11320) containing 10% FBS (NICHIREI BIOSCIENCES INC.) and Antibiotic-Antimycotic Solution (Fujifilm, 161-23181). At the time of seeding, 10 nM hsa-miRNA-126-3p mimic (miR-126-3p), 10 nM miRNA-140-5p mimic alone (miR-140-5p), or 10 nM each of miRNA-126-3p mimic and miRNA-140-5p mimic, or 20 nM negative control miRNA mimic (NC) were introduced into C28 / I2 cells using Lipofectamin RNAiMax and cultured at 37°C in a 5% CO2 incubator. After two days, the medium was removed and replaced with medium containing or not containing 10 ng / mL human recombinant IL-1β (R&D). After further culturing for 24 hours, the supernatant was collected. The VEGF content in the supernatant was measured using a Human VEGF ELISA kit (Abcam). The cell count in the 96-well plate at the time of collection of the culture supernatant was analyzed using the CellTiter-Glo® 2.0 Cell Viability Assay (Promega), and the amount of VEGF produced per cell was calculated. The results are shown in Figure 7. As shown in Figure 7, under conditions in which IL-1β was added and not added, the amount of VEGF produced in the hsa-miRNA-126-3p or hsa-miR-140-5p treatment group was significantly reduced compared to the negative control miRNA-mimic treatment group, and the amount produced in the combination group was significantly reduced compared to the single treatment groups, indicating that the inhibitory effect on VEGF production was also enhanced by the combination of miRNAs in human chondrocyte cell lines.
[0111] Example 6. Inhibition of VEGF production in SW1353 (chondrosarcoma cell line) Human chondrosarcoma cell line SW1353 (Cell Lines Service) was plated in a Corning 96-well plate at 3 x 10 3Cells were seeded at 1000 cells / well in DMEM:F12 (1:1) (Gibco #11320) containing 5% FBS (NICHIREI BIOSCIENCES INC.) and Antibiotic-Antimycotic Solution (Fujifilm, 161-23181). At the time of seeding, 10 nM hsa-miRNA-126-3p mimic (miR-126-3p), 10 nM miRNA-140-5p mimic alone (miR-140-5p), or 10 nM each of miRNA-126-3p mimic and miRNA-140-5p mimic, or 20 nM negative control miRNA mimic (NC) were introduced into SW-1353 cells using Lipofectamin RNAiMax and cultured at 37°C in a 5% CO2 incubator. After two days, the medium was removed and replaced with medium containing or not containing 10 ng / mL human recombinant IL-1β (R&D). After an additional 24 hours of culture, the supernatant was collected. The VEGF content in the supernatant was measured using a Human VEGF ELISA kit (Abcam). The cell count in the 96-well plate at the time of collection of the culture supernatant was analyzed using the CellTiter-Glo® 2.0 Cell Viability Assay (Promega), and the amount of VEGF produced per cell was calculated. The results are shown in Figure 8. As shown in Figure 8, without the addition of IL-1β, VEGF production levels in the miRNAhsa-miRNA-126-3p and hsa-miR-140-5p treatment groups and the combination group were reduced to below the detection limit compared to the negative control miRNA-mimic treatment group. Treatment with IL-1β, a cytokine that promotes inflammation, increased VEGF production in SW1353 by more than threefold. Even under these conditions, VEGF production levels in the miRNAhsa-miRNA-126-3p and hsa-miR-140-5p treatment groups were significantly reduced compared to the negative control miRNA-mimic treatment group, and further decreased to below the detection limit in the combination group, indicating that the combination enhanced the inhibitory effect of VEGF production in human chondrosarcoma cell lines.
Claims
1. A preventive or therapeutic agent for a disease or condition involving angiogenesis, comprising hsa-miR-140-5p and hsa-miR-126-3p.
2. An agent for preventing or treating a disease or condition accompanied by angiogenesis, comprising hsa-miR-140-5p, in combination with hsa-miR-126-3p.
3. An agent for preventing or treating a disease or condition accompanied by angiogenesis, comprising hsa-miR-126-3p, in combination with hsa-miR-140-5p.
4. A VEGF production inhibitor comprising hsa-miR-140-5p and hsa-miR-126-3p.
5. An agent for suppressing VEGF production in combination with hsa-miR-126-3p, including hsa-miR-140-5p.
6. An agent for suppressing VEGF production in combination with hsa-miR-140-5p, including hsa-miR-126-3p.
7. The agent according to any one of claims 1 to 6, wherein the disease or condition accompanied by angiogenesis is at least one selected from the group consisting of joint disease, stiff shoulders, cancer, rheumatoid arthritis, cancer cell proliferation and metastasis, atherosclerosis, neovascular maculopathy, psoriasis, diabetic retinopathy, myopic choroidal neovascularization, age-related macular degeneration, enthesitis, baseball's elbow, rotator cuff injury, and plantar tendonitis.
8. The agent according to claim 7, wherein the disease or pathological condition involving angiogenesis is a joint disease.
9. The agent according to claim 8, wherein the joint disease is knee osteoarthritis.
10. The agent according to any one of claims 1 to 6, which is an injectable agent.