Adeno-associated virus compositions for the treatment of duchenne muscular dystrophy

Abstract

The present invention provides novel gene therapy compositions for use in treatment of Duchenne Muscular Dystrophy (DMD).

Description

[0001] ADENO-ASSOCIATED VIRUS COMPOSITIONS FOR THE TREATMENT OF DUCHENNE MUSCULAR DYSTROPHY

[0002] CLAIM OF PRIORITY

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 561.130, filed March 4. 2024; U.S. Provisional Patent Application No. 63 / 666,899. filed July 2, 2024; U.S. Provisional Patent Application No. 63 / 676,780, filed July 29, 2024; and U.S. Provisional Patent Application No. 63 / 688,024, filed August 28, 2024; each of which is incorporated by reference herein in its entirety .

[0004] SEQUENCE LISTING

[0005] This instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. The XML copy, created on March 03, 2025, is named PAT059900-WO-PCT_SL.xml and is 2,260,685 bytes in size.

[0006] FIELD OF DISCLOSURE

[0007] This disclosure relates to compositions for the treatment of Duchenne Muscular Dystrophy (DMD).

[0008] BACKGROUND

[0009] Duchenne muscular dystrophy (DMD) is a severe type of muscular dystrophy, a group of rare genetic neuromuscular diseases, affecting approximately one in 3,600 to 9.200 live male births. DMD is the most common type of muscular dystrophy predominantly affecting men.

[0010] DMD causes progressive muscle weakness due to muscle fiber disarray, replacement with connective tissue or fat. and death. Voluntary muscles are affected first, especially those of the hips, pelvic area, thighs, calves, eventually progressing to the shoulders and neck, followed by arms, respiratory muscles, and other areas. Symptoms usually appear before age five, expressing as difficulty with motor skills including w alking. As a result, falls may be frequent with walking becoming increasingly difficult and frequently impossible before age 13. Most men affected with DMD become essentially paralyzed from the neck down by the age of 21. Cardiomyopathy, particularly dilated cardiomyopathy, is also commonly seen in half of 18-y ear-olds with DMD. In late stages of the disease, respiratory impairment and swallowing impairment can occur. As a result, median life expectancy for men suffering from DMD is just 28-30 years, however comprehensive care may allow those suffering to live into their 30s or 40s.

[0011] DMD is caused by mutations and / or deletions in any of the 79 exons encoding the large dystrophin protein. While mutations causing DMD can affect any exon, exons 2-20 and 45-55 are common hotspots for large deletion and duplication mutations. The disorder follows an X-linked recessive inheritance pattern, with approximately two-thirds of cases inherited from the mother and one-third resulting from a new mutation.

[0012] Typical therapies for DMD are limited to management strategies, such as physical therapy, braces, and corrective surgery' to alleviate symptoms. Assisted ventilation may be required in those with weakness of breathing muscles.

[0013] Gene therapies have been proposed for the treatment of DMD, including delandistrogene moxeparvovec-rokl, marketed under the brand name ELEVIDYS® by Sarepta Therapeutics. However, expression of the microdystrophin protein in skeletal muscles of patients injected with DMD gene therapies has been low and not uniform.

[0014] As a result, there exists a need for improved DMD gene therapies.

[0015] SUMMARY

[0016] The present disclosure is directed to compositions (e.g., adeno-associated viral (AAV) compositions) and methods of use thereof for treating Duchenne Muscular Dystrophy (DMD).

[0017] Accordingly, aspects of the invention provide a formulation comprising an AAV particle comprising (e.g., encapsidating) a nucleic acid comprising a promoter and a sequence encoding microdystrophin.

[0018] Aspects of the invention provide a composition comprising an adeno-associated virus (AAV) particle comprising an engineered capsid protein comprising the amino acid sequence RGDR (SEQ ID NO: 2440). The capsid protein encapsidates a nucleic acid molecule (e.g.. a cargo) comprising a promoter, a codon optimized microdystrophin sequence, for example a sequence having at least 95% sequence identity with a sequence selected from SEQ ID NO: 2405-2407. The nucleic acid may further comprise a dorsal root ganglia (DRG) de-targeting miRNA binding site. In aspects of the invention, the nucleic acid molecule may comprise a sequence having the having at least 95% sequence identity' with a sequence selected from SEQ ID NO: 2405-2407 that encodes a codon optimized microdystrophin sequence. The DRG de-targeting miRNA binding site may comprise a sequence selected from among SEQ ID NOs: 2399-2401.

[0019] The promoter may be a novel promoter that is exhibits specificity (e.g. high expression in) for muscle cells, for example myocytes. The promoter may comprise a sequence having at least 95% sequence identity a sequence selected from among SEQ ID NOs: 2402-2404.

[0020] For example, the nucleic acid molecule (e.g. cargo) may comprise, in order: a first inverted terminal repeats (ITR) region; a promoter; an intron; a sequence having at least 95% sequence identity with a sequence selected from any one of SEQ ID NO: 2405-2407; a first DRG de-targeting miRNA binding site and preferably, a second DRG de-targeting miRNA binding site; a poly-adenylation signal, preferably a shortened poly-adenylation signal; and a second ITR region.

[0021] The ITR regions may be AAV2 ITR regions derived from an AAV2.

[0022] For example, the full nucleic acid molecule may comprise a sequence selected from any one of SEQ ID NOs: 2412-2438.

[0023] Advantageously, when administered to a subject with a mutation in the DMD gene that results in low or a lack of dystrophin protein expression, the composition is effective at restoring a healthy phenotype.

[0024] The engineered capsid protein may advantageously exhibit decreased liver tropism and / or increased muscle tropism.

[0025] For example, the capsid protein may comprise an amino acid sequence selected from Tables la in hypervariable region IV (HVR IV) relative to wild type AAV9. The capsid protein may comprise substitutions at amino acids 451-455 relative to a wild type AAV9 vector capsid selected from column 1 of Table lb and a 7-mer insert selected from column 2 of Table lb inserted after amino acid 455 relative to a wild type AAV9 vector. The capsid protein may further comprise a deletion of G267 relative to wild type AAV9 capsid or equivalent position in another AAV capsid.

[0026] Accordingly, aspects of the invention further provide methods and uses of the compositions of the invention (for example in the preparation of a medicament) for treating a subject suffering from DMD. The methods and uses may comprise providing to a subject a composition of the invention as described above.

[0027] Aspects of the present disclosure provide a recombinant nucleic acid comprising a muscle specific promoter; a sequence encoding microdystrophin; and at least one dorsal root ganglia (DRG) de-targeting miRNA binding site.

[0028] In some embodiments, the muscle specific promoter comprises a CK8 promoter, a desmin promoter, a Mb promoter, a MCK promoter, a MHCK7 promoter, a skeletal muscle alpha actin promoter, or a TTNI2 promoter. In some embodiments, the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404. In some embodiments, the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404. In some embodiments, the promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402. In some embodiments, the promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 2403. In some embodiments, the promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 2404.

[0029] In some embodiments, the sequence encoding microdystrophin is a sequence encoding human microdystrophin. In some embodiments, the sequence encoding microdystrophin encodes a microdystrophin protein comprising or consisting of an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2439. In some embodiments, the sequence encoding microdystrophin encodes a microdystrophin protein comprising or consisting of the amino acid sequence of SEQ ID NO: 2439.

[0030] In some embodiments, the sequence encoding microdystrophin comprises or consists of a codon optimized sequence encoding microdystrophin. In some embodiments, the codon optimized sequence encoding microdystrophin comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407. In some embodiments, the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407. In some embodiments, the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2405. In some embodiments, the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2406. In some embodiments, the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2407.

[0031] In some embodiments, the at least one DRG de-targeting miRNA binding site comprises a binding site for miR-338. miR-138. or miR-9. In some embodiments, the at least one DRG de-targeting miRNA binding site comprises a binding site for miR-338-3p, miR- 138-5p, or miR-9-5p. In some embodiments, the at least one DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In some embodiments, the at least one DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.

[0032] In some embodiments, the at least one DRG de-targeting miRNA binding site comprises a first and a second DRG de-targeting miRNA binding site. In some embodiments, each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In some embodiments, each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In some embodiments, each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of SEQ ID NO: 2399. In some embodiments, each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of SEQ ID NO: 2400. In some embodiments, each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of SEQ ID NO: 2401.

[0033] In some embodiments, the recombinant nucleic acid comprises, optionally from 5' to 3', a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%. at least 93%. at least 94%. at least 95%. at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.

[0034] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0035] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0036] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0037] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0038] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0039] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0040] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401. In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0041] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0042] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0043] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403: a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0044] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404: a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0045] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0046] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0047] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0048] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0049] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0050] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0051] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0052] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399. In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0053] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0054] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0055] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404: a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0056] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402: a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0057] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0058] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0059] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0060] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399. In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0061] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0062] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0063] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0064] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0065] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0066] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0067] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0068] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0069] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0070] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0071] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0072] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0073] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0074] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0075] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0076] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0077] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0078] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0079] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400. In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0080] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0081] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0082] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0083] In some embodiments, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0084] In some embodiments, the recombinant nucleic acid further comprises an intron. In some embodiments, the intron comprises a simian virus 40 (SV40) intron sequence, a minute virus of mice (MVM) intron, a RK intron, a P-globin intron, and / or a chicken P-actin (CBA) intron, including functional variants or fragments thereof. In some embodiments, the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409. In some embodiments, the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409. In some embodiments, the recombinant nucleic acid further comprises a polyadenylation (Poly A) signal. In some embodiments, the PolyA signal comprises a bovine growth hormone polyadenylation (bgh-PolyA) signal, a synthetic PolyA signal, or an SV40 PolyA signal. In some embodiments, the PolyA signal comprises the bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410. In some embodiments, the PolyA signal comprises the bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of the nucleic acid sequence of SEQ ID NO: 2410.

[0085] In some embodiments, the recombinant nucleic acid further comprises a 5' inverted terminal repeat (ITR) and a 3' ITR. In some embodiments, the 5' ITR and / or the 3' ITR is an adeno-associated virus 2 (AAV2) ITR, or a variant or fragment thereof.

[0086] In some embodiments, the 5' ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408. In some embodiments, the 5' ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408.

[0087] In some embodiments, the 3' ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411. In some embodiments, the 3' ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2411.

[0088] In some embodiments, the recombinant nucleic acid comprises, optionally from 5' to 3', a 5' ITR; a promoter; an intron; a sequence encoding microdystrophin; a first DRG detargeting miRNA binding site; a second DRG de-targeting miRNA binding site; a PolyA signal; and a 3' ITR.

[0089] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0090] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0091] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0092] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least

[0093] 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO:

[0094] 2402; an intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least

[0095] 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0096] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0097] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; an intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%. at least 89%. at least 90%. at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0098] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal compnsing or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0099] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0100] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least

[0101] 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO:

[0102] 2404; an intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least

[0103] 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0104] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least

[0105] 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO:

[0106] 2402; an intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least

[0107] 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%. at least 93%. at least 94%. at least 95%. at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0108] In some embodiments, the recombinant nucleic acid comprises a 5' comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0109] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410: and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0110] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal compnsing or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0111] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0112] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411. In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%. at least 93%. at least 94%. at least 95%. at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0113] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0114] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0115] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0116] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting rniRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal compnsing or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0117] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0118] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%. at least 93%. at least 94%. at least 95%. at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%. at least 95%. at least 96%. at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0119] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0120] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0121] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%. at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0122] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401 ; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0123] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0124] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0125] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0126] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0127] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de- targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 241 1.

[0128] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0129] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; an intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de- targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0130] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401 ; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0131] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0132] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; an intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de- targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0133] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first DRG detargeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0134] In some embodiments, the recombinant nucleic acid comprises a 5' comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0135] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0136] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0137] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0138] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0139] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411. In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0140] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0141] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0142] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0143] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0144] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0145] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence of SEQ ID NO: 2411.

[0146] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0147] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0148] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0149] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0150] In some embodiments, the recombinant nucleic acid comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2412-2438. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2412-2438.

[0151] In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2412. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2413. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2414. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2415. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2416. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2417. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2418. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2419. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2420. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2421. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2422. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2423. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2424. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2425. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2426. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2427. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2428. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2429. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2430. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2431. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2432. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2433. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2434. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2435. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2436. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2437. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2438.

[0152] Aspects of the present disclosure provide a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404. In some embodiments, the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404. In some embodiments, the promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402. In some embodiments, the promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 2403. In some embodiments, the promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 2404. In some embodiments, the recombinant nucleic acid comprising the promoter exhibits enhanced expression in skeletal muscle cells and / or cardiac muscle cells compared to non-skeletal muscle cells and / or non-cardiac muscle cells. Aspects of the present disclosure provide a recombinant nucleic acid comprising a codon optimized sequence encoding microdystrophin that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407. In some embodiments, the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407. In some embodiments, the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2405. In some embodiments, the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2406. In some embodiments, the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2407.

[0153] Aspects of the present disclosure provide an adeno-associated virus (AAV) particle comprising any one of the recombinant nucleic acids described herein and a capsid protein. In some embodiments, the capsid protein is derived from a serotype selected from AAV 1. AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV 13, AAVrh, AAVrhlO, AAVrh74, AAV-DJ, AAV-DJ / 8, Anc80, and AAV7m8, or a derivative, hybrid or chimeric seroty pe thereof.

[0154] In some embodiments, the AAV particle has increased muscle tropism compared to a wild type AAV9 particle. In some embodiments, the AAV particle has reduced liver tropism compared to a wild type AAV9 particle.

[0155] In some embodiments, the capsid protein comprises an amino acid sequence of formula (I): X1NX2X3X4RGDRX5X6L (formula I; SEQ ID NO: 1), wherein each of Xi-Xe is any amino acid.

[0156] In some embodiments, the amino acid sequence of formula (I) is in a hypervariable region IV (HVR IV) relative to a wild ty pe AAV9 capsid. In some embodiments, relative to a wild type AAV9 capsid, Xi is a substitution at amino acid 451, X2 is a substitution at amino acid 453, X3 is a substitution at amino acid 454, X4 is a substitution at amino acid 455, and RGDRXsXeL (SEQ ID NO: 2441) is inserted after amino acid 455. In some embodiments. Xi is A, I, F, G, H, L, M, Q, S, T, or V; X2is A, G, S, T, or Y; X3 is S, N, G, or P; X4is A, G, H, I, M, S, T, or V; Xs is A, G, or Q; and Xe is A, I, L, M, N, S, or Y. In some embodiments, the amino acid sequence of formula (I) comprises of any one of SEQ ID NOs: 801-1599. In some embodiments, the amino acid sequence of formula (I) comprises of any one of SEQ ID NOs: 1600-2398. In some embodiments, the amino acid sequence of formula (I) comprises or consists of any one of SEQ ID NOs: 2-800.

[0157] In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NOs: 191, 198, 199, 215, 256, 379, 544, 550, or 748. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 191. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 198. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 199. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 215. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 256. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 379. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 544. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 550. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 748.

[0158] In some embodiments, the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 191 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 198 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild ty pe AAV9 vector. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 199 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 215 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 256 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 379 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild ty pe AAV9 vector. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 544 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 550 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 748 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector.

[0159] Aspects of the present disclosure provide a pharmaceutical composition comprising any of the recombinant nucleic acids, the expression vectors (e.g., the AAV vectors), or the AAV particles described herein, and a pharmaceutically acceptable carrier.

[0160] Aspects of the present disclosure provide a method of treating DMD in a subject in need thereof, the method comprising administering to the subject an effective amount of any of the recombinant nucleic acids, the expression vectors (e.g.. the AAV vectors), the AAV particles, or the pharmaceutical compositions described herein.

[0161] In some embodiments, the subject is a human subject. In some embodiments, the subject has at least one mutation in the dystrophin gene.

[0162] In some embodiments, the administering comprises intramuscular administration, subcutaneous injection, intravenous injection, or intravenous (IV) administration.

[0163] Aspects of the present disclosure provide uses of any of the recombinant nucleic acids, the expression vectors (e.g., the AAV vectors), the AAV particles, or the pharmaceutical compositions described herein for the manufacture of a medicament for treating DMD.

[0164] Aspects of the present disclosure provide any of the recombinant nucleic acids, the expression vectors (e.g., the AAV vectors), the AAV particles, or the pharmaceutical compositions described herein for use in treating DMD.

[0165] Aspects of the present disclosure provide a kit comprising any of the recombinant nucleic acids, the expression vectors (e.g.. the AAV vectors), the AAV particles, or the pharmaceutical compositions described herein. In some embodiments, the kit further comprises instructions for use in treating Duchenne muscular dystrophy (DMD) in a subject in need thereof.

[0166] Aspects of the nucleic acid molecules (e.g., cargo) and capsid proteins are described in further detail below.

[0167] For sequences disclosed throughout this application, it is understood that nucleic acid molecules and peptides may comprise one or more substitutions, for example conservative substitutions, that allow sequences to continue to function. Accordingly, sequences may have at least 80%, 85%. 90%. 95%. 96%. 97%. 98%. or 99% sequence identity to the sequence disclosed. A conservative substitution refers to amino acid substitutions that do not significantly affect or alter binding characteristics of a particular protein. Generally, conservative substitutions are ones in which a substituted amino acid residue is replaced with an amino acid residue having a similar side chain. For example, conservative substitutions may include a substitution found in one of the following groups: Group 1: Alanine (Ala or A), Glycine (Gly or G). Serine (Ser or S), Threonine (Thr or T); Group 2: Aspartic acid (Asp or D), Glutamic acid (Glu or Z); Group 3: Asparagine (Asn or N). Glutamine (Gin or Q); Group 4: Arginine (Arg or R), Lysine (Lys or K), Histidine (His or H); Group 5: Isoleucine (He or I), Leucine (Leu or L), Methionine (Met or M), Valine (Vai or V); and Group 6: Phenylalanine (Phe or F), Tyrosine (Tyr or Y), Tryptophan (Trp or W). Additionally, or alternatively, amino acids can be grouped into conservative substitution groups by similar function, chemical structure, or composition (e.g, acidic, basic, aliphatic, aromatic, or sulfur- containing). For example, an aliphatic grouping may include, for purposes of substitution, Gly, Ala, Vai, Leu. and He. Other conservative substitutions groups include sulfur- containing: Met and Cysteine (Cys or C); acidic: Asp. Glu, Asn, and Gin; small aliphatic, nonpolar, or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gin; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, He, Vai, and Cys; and large aromatic residues: Phe, Tyr, and Trp.

[0168] Codon Optimized Microdystrophin

[0169] The present invention provides novel engineered nucleic acids encoding microdystrophin proteins for use in gene therapy. The microdystrophin proteins of the invention are optimized to provide increased expression in muscle cells. Advantageously, microdystrophin proteins of the invention are substantially shorter than dystrophin, allowing for optimized packaging in expressing cassettes, including viral vectors.

[0170] Microdystrophin refers to a biologically active fragment of dystrophin, e.g, AR4- R23 / ACT microdystrophin. Microdystrophin can be from any source, e.g., a human microdystrophin. The microdystrophin can comprise or consist of an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2439. In some embodiments, microdystrophin comprises or consists of the amino acid sequence of SEQ ID NO: 2439. Recombinant nucleic acids described herein can include a microdystrophin protein described herein or a variant thereof. For example, the recombinant nucleic acid comprises a microdystrophin comprising or consisting of an amino acid sequence of SEQ ID NO: 2439, or a variant thereof comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions.

[0171] Microdystrophin protein sequence

[0172] Aspects of the invention provide a composition comprising a nucleic acid molecule comprising a sequence having at least 95% sequence identity with a sequence selected from SEQ ID NOs: 2405-2407, provided below:

[0173] In aspects of the invention, the nucleic acid molecule comprises a sequence having the sequence identity of SEQ ID NO: 2405. SEQ ID NO: 2406. or SEQ ID NO: 2407. In aspects of the invention, the nucleic acid molecule may comprise a sequence having at least 85%, 86%, 87%, 88% 89%, 90%, 91%, 92%, 93%, 94%, or 95% of the sequence identity of SEQ ID NO: 2405, SEQ ID NO: 2406, or SEQ ID NO: 2407.

[0174] Advantageously, microdystrophin proteins are substantially shorter than dystrophin, allowing for optimized packaging in expressing cassettes, including viral vectors.

[0175] Typical AAV vectors have a packaging capacity of ~4.7 kb. Nucleic acids are almost universally packaged with two terminal ITRs, each about 0.14 kb in length. Additionally regulatory elements, for example promoter, intron, and poly(A) elements, may be about 0.6-1 kb. As a result, the maximal allowable cDNA length must be less than 3.8 kb. Gene therapies are restricted by the packaging capacity limit of adeno-associated viral (AAV) vectors. As a consequence, the size of the native dystrophin coding sequence prevents packaging of the transgene into traditional AAV serotypes, including AAV9.

[0176] Accordingly, in aspects of the invention, the nucleic acid molecule of the present invention may be suitably packaged in a vector.

[0177] For example, the vector may be an adeno-associated viral (AAV) vector. The nucleic acid molecule may comprise in order an inverted terminal repeats (ITR) region, a promoter, an intron, the sequence having at least 95% sequence identity with a sequence selected from SEQ ID NOs: 2405-2407, a poly adenylation signal, and an ITR region.

[0178] The AAV vector may comprise a capsid protein having at least one modification that results in reduced liver-tropism of the AAV vector and / or preferential targeting of the AAV vector to muscle tissue.

[0179] Advantageously, when administered to a subject with a mutation in the DMD gene, resulting in lack of dystrophin protein expression, the composition is effective at restoring a healthy phenotype.

[0180] Further advantageously, the microdystrophin protein expressed by the nucleic acid molecule may be smaller than 137.5 kilodaltons (for example, 137.32 kilodaltons).

[0181] Aspects of the invention also provide methods of treating subjects suffering from DMD using compositions of the invention.

[0182] Methods of the invention comprise providing to the subject compositions of the invention described above, comprising a nucleic acid molecule comprising a sequence having at least 95% sequence identity with a sequence selected from SEQ ID NOs: 2405-2407.

[0183] DRG De-targeting miRNAs

[0184] The present invention provides recombinant nucleic acids and recombinant expression vectors (e.g., AAV vectors) that encode a transgene (e.g., a microdystrophin) and the binding site(s) for specific micro RNAs (miRs) that direct the miRs to selectively inhibit expression of the same transgene (e g., the microdystrophin). By the present invention, it was discovered that miR-338-3p. miR-138-5p. and miR-9-5p are highly expressed in dorsal root ganglial (DRG) cells and not expressed, or expressed at substantially low levels, in muscle cells (including skeletal and heart muscle cells).

[0185] Accordingly, aspects of the invention provide a recombinant nucleic acid and an engineered vector comprising a first nucleic acid sequence encoding a transgene (e.g. , sequence encoding a microdystrophin) and a second nucleic acid sequence encoding for the binding site(s) of one or more miRs selected from among miR-338-3p, miR-138-5p, or miR- 9-5p. In such instances, the second nucleic acid sequence can be referred to as DRG detargeting miRNA binding site. Thus, as used herein, the term “DRG de-targeting binding site” refers to a nucleic acid sequence encoding for a binding site of a miR (e.g, miR-338-3p, miR-138-5p, and miR-9-5p) that is highly expressed in DRG cells but not expressed, or expressed at significantly lower levels, in muscle cells. The nucleic acid sequence encoding a binding site of a miR is sufficiently complementary with the nucleic acid sequence encoding the miR to effect base pairing (binding) between the DRG de-targeting binding site and the miR. Advantageously, the second nucleic acid sequence directs the miR, when present, to repress expression of the transgene. As a result, the selected miRs (miR-338-3p, miR-138-5p, miR-9-5p) in cells transduced by the vectors of the invention will be directed to inhibit expression of the transgene.

[0186] For example, the transgene (e.g, microdystrophin) may provide a therapeutic effect when expressed in skeletal and / or heart muscle but provide a toxic effect when expressed in DRG cells. Without being bound to a mechanism of action, transduction of both muscle cells and DRG cells by vectors of the invention results in transcription of both transgene mRNA and the binding site(s) of the select miR. In DRG cells with substantial endogenous expression of miR-338-3p, miR-138-5p, and miR-9-5p, transgene expression (e g., microdystrophin expression) will be substantially repressed. In muscle cells with limited to no expression of miR-338-3p, miR-138-5p, miR-9-5p, transgene expression will not be substantially repressed. As a result, the therapeutic effect of the transgene will continue in muscle cells and the toxic effect in DRG cells will be abated.

[0187] In aspects of the invention, the second nucleic acid sequence may be operably linked to the first nucleic acid sequence, for example, the second nucleic acid sequence may be operably linked to the 3' or 5' end of the first nucleic acid sequence. Advantageously, this may result in increased transcription of both nucleic acid sequences.

[0188] The engineered vector may be a viral vector. For example, the vector may be an adeno-associated viral (AAV) vector. Further advantageously, the engineered vector may comprise a capsid protein with modified tropism for skeletal and / or heart muscle in comparison with the wild type AAV vector. For example, transduction and expression of the transgene may be increased in muscle tissue while limited expression of the transgene in off- target tissue types, for example, DRG may be observed.

[0189] The first nucleic acid sequence and second nucleic acid sequence may also be operably linked to tissue specific promoters. Advantageously, the first nucleic acid sequence may be operably linked to a muscle specific promoter. In aspects of the invention, the second nucleic acid is 3' or 5' of the first nucleic acid. For example, the second nucleic acid may be incorporated into a 3' or 5' untranslated region (UTR) of the transgene mRNA when transcribed.

[0190] In muscle tissue, where miR-338-3p, miR-138-5p, miR-9-5p expression is limited, the muscle specific promoter promotes transcription of the transgene and the miR binding site has limited to no effect due to the absence of the requisite miR. In cells expressing miR-338- 3p. miR-138-5p. miR-9-5p, for example DRG, the muscle specific promoter limits transcription of the transgene while the miR binding site is still present in the transcript, inhibiting translation of any transgene mRNA transcribed.

[0191] Aspects of the invention also provide methods and uses of the recombinant nucleic acids and the recombinant expression vectors of the invention, for example, in therapeutic compositions. Accordingly, aspects of the invention provide a method or use of a recombinant nucleic acid or a recombinant expression vector, the method or use comprising providing to a subject a recombinant nucleic acid or a recombinant expression vector (e.g, an engineered vector (e.g, an AAV vector)) comprising a first nucleic acid sequence encoding a transgene (e.g, sequence encoding a microdystrophin protein) and a second nucleic acid sequence expressing the binding site of a miR selected from among miR-338-3p, miR-138- 5p, or miR-9-5p. The second nucleic acid sequence thereby directs the miR, when present (for example endogenously), to repress expression of the transgene.

[0192] The transgene (e.g, microdystrophin) may be expressed in heart and / or skeletal muscle, thereby providing a therapeutic effect. The second nucleic acid sequence may be expressed in dorsal root ganglia cells and direct endogenous miR-338-3p, miR-138-5p, and / or miR-9-5p to repress expression of the transgene in dorsal root ganglia cells. For example, the transgene may provide a therapeutic effect when expressed in skeletal and / or heart muscle but provide a toxic effect when expressed in DRG cells.

[0193] Accordingly, in aspects of the invention, the DRG de-targeting miRNA may comprise a sequence have at least 90% or at least 95% of the sequence identity of one or more of: CAACAAAATCACTGATGCTGGA (SEQ ID NO: 2399; miR-338-3p); CGGCCTGATTCACAACACCAGCT (SEQ ID NO: 2400; mir-138-5p); or TCATACAGCTAGATAACCAAAGA (SEQ ID NO: 2401; miR-9-5p).

[0194] Novel Promoters

[0195] The present invention provides novel promoters, that can be linked to a nucleic acid sequence encoding microdystrophin so that the transcription preferably occurs within myocytes and cardiomyocytes. Promoter regions enable the host cells to replicate the AAV delivered nucleic acid only in those cell types and tissues or organs in which the desired protein should be created. Here, the muscle specific promoter is included because it is principally desired that the proteins only be translated in myocytes and cardiomyocytes. Specificity of the cell ty pe into which the nucleic acid is delivered and thus the protein translated is desired because of the adverse effects that may ensue from delivering the nucleic acid and having it translated in cells in which that nucleic acid and thus protein is not needed or not endogenously expressed.

[0196] Accordingly, aspects of the present invention provide a promoter having the sequence of any one of SEQ ID NOs: 2402-2404.

[0197] In some embodiments, the recombinant nucleic acid comprises a muscle specific promoter. Non-limiting examples of muscle specific promoters include a CK8 promoter, a desmin promotor, a Mb promoter, a MCK promoter, a MHCK7 promoter, a skeletal muscle alpha actin promoter, and a TTNI2 promoter.

[0198] In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404.

[0199] In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2403. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2404.

[0200] Engineered Capsid Proteins

[0201] The present invention also provides novel capsid protein variants for viral vectors that de-target liver tissue and target skeletal muscle and heart tissue at the same time. Aspects of the present invention provide adeno-associated vims (AAV) vectors comprising a capsid protein comprising an insert comprising the amino acid sequence RGDR (SEQ ID NO: 2440). In the capsid protein, RGDR (SEQ ID NO: 2440) can be inserted after amino acid 455 in reference to an AAV9 capsid or an equivalent position in another AAV capsid. AAV vectors can comprise the amino acid sequence X1NX2X3X4RGDRX5X6L (SEQ ID NO: 1), wherein each of X1.X2.X3, X4, Xs, and Xe is any amino acid.

[0202] In aspects of the invention. Xi is an amino acid selected from the group consisting of: A, I, F, G, H, L, M, Q, S, T, and V. In some aspects of the invention, Xi may be an amino acid selected from the group consisting of: A, I, L, M, S, and V.

[0203] In aspects of the invention, X2 is an amino acid selected from the group consisting of A, G. S, T, and Y.

[0204] In aspects of the invention. X3 is an amino acid selected from the group consisting of S, N, G, and P. In some aspects of the invention, X3 is S.

[0205] In aspects of the invention, X4 is an amino acid selected from the group consisting of A, G. H, I, M, S, T, and V.

[0206] In aspects of the invention. Xs is an amino acid selected from the group consisting of A, G, and Q. In aspects of the invention, Xe is an amino acid selected from the group consisting of A, I, L. M, N, Y. In some aspects of the invention, Xe is selected from the group consisting of A, S, and Y.

[0207] In aspects of the invention, Xi is located at amino acid 451 , X2 is located at amino acid 453, X3 is located at amino acid 454, X4 is located amino acid 455, and RGDRXsXeL (SEQ ID NO: 2441) is inserted after amino acid 455 in reference to an AAV9 capsid or an equivalent position in another AAV capsid.

[0208] In aspects of the invention, two amino acids from Xi, X2, X3, and X4 are wild type amino acids in reference to an AAV9 capsid or an equivalent position in another AAV capsid and two amino acids from Xi, X2, X3, and X4 are not wild type amino acids.

[0209] For example, capsid proteins variants of the invention can comprise a sequence as set forth in Table la, e.g., a capsid protein can comprise any one of SEQ ID NOs: 2-800. Notably, capsid protein variants on the invention comprise deletions, substitutions, and / or insertions relative to wild type viral vector capsids.

[0210] In aspects of the invention, the capsid protein comprises an amino acid sequence selected from Table la and the amino acid sequence is in hypervariable region IV (HVR IV) relative to wild type AAV9. The capsid protein variant can comprise substitutions at amino acids 451-455 relative to a wild type AAV9 capsid. For example, the substitutions at amino acids 451-455 relative to a wild type AAV9 capsid can be an amino acid sequence selected from column 1 of Table lb, e.g, the substitutions relative to a wild type AAV9 capsid can be an amino acid sequence selected from any one of SEQ ID NOs: 801 -1599. In aspects of the invention, the capsid protein variant can further comprise an insert. For example, the capsid protein can comprise a 7-mer insert selected from column 2 of Table lb, e.g., the capsid protein variant comprises a 7-mer insert comprising an amino acid sequence selected from any one of SEQ ID NOs: 1600-2398. The insert can be in the location after amino acid 455 relative to a wild type AAV9 vector.

[0211] Advantageously, viral vectors comprising an amino acid sequence of the invention exhibit muscle tropism as compared to a wild type AAV vector (e.g., a wild type AAV9 vector).

[0212] In aspects of the invention, the capsid protein further comprises a deletion of G267 in reference to an AAV9 capsid or an equivalent position in another AAV capsid. Advantageously, the capsid protein comprising a deletion of G267 may exhibit reduced liver tropism as compared to a wild type AAV capsid protein. As described, for the HVR IV variants, the 5 amino acids upstream are at positions 451-455, shown in column 1 of Table lb. The 7-mer insert for HVR IV variants starts with “RGDR” (SEQ ID NO: 2440) and is inserted after amino acid 455, shown in column 2 of Table lb

[0213] In some embodiments, the capsid protein comprises, relative to the wild ty pe AAV9 capsid protein, the amino acid sequence of LNASI (SEQ ID NO: 990) at positions 451-455, the amino acid sequence of RGDRQLL (SEQ ID NO: 1789) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9.

[0214] In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNASM (SEQ ID NO: 997) at positions 451-455, the amino acid sequence of RGDRQAL (SEQ ID NO: 1796) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9.

[0215] In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNASM (SEQ ID NO: 998) at positions 451-455, the amino acid sequence of RGDRQSL (SEQ ID NO: 1797) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9.

[0216] In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNAST (SEQ ID NO: 1014) at positions 451 -455, the amino acid sequence of RGDRQYL (SEQ ID NO: 1813) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9.

[0217] In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNGST (SEQ ID NO: 1055) at positions 451-455, the amino acid sequence of RGDRQYL (SEQ ID NO: 1854) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9.

[0218] In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNYST (SEQ ID NO: 1178) at positions 451-455, the amino acid sequence of RGDRQAL (SEQ ID NO: 1977) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of SNAST (SEQ ID NO: 1343) at positions 451-455, the amino acid sequence of RGDRQYL (SEQ ID NO: 2142) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9.

[0219] In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of SNASV (SEQ ID NO: 1349) at positions 451-455, the amino acid sequence of RGDRQAL (SEQ ID NO: 2148) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9.

[0220] In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of VNGST (SEQ ID NO: 1547) at positions 451-455, the amino acid sequence of RGDRQYL (SEQ ID NO: 2346) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9.

[0221] Table la: HVR IV Capsid Variants Table lb: Split Amino Acid Sequences from Table la

[0222] BRIEF DESCRIPTION OF THE DRAWINGS

[0223] FIGs. 1A-1B show results from analysis of microdystrophin expression in quadriceps from BlO-mdx mice dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 1A shows images of FLAG immunofluorescence of microdystrophin expression in BlO-mdx mouse quadriceps following administration of Composition 1 or Reference AAV composition. FIG. IB shows results from capillary electrophoresis quantifying microdystrophin expression in BlO-mdx mouse quadriceps following administration of Composition 1 or Reference AAV composition.

[0224] FIGs. 2A-2B show results from analysis of microdystrophin expression in triceps from BlO-mdx mice dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 2A shows images of FLAG immunofluorescence of microdystrophin expression in BlO-mdx mouse triceps following administration of Composition 1 or Reference AAV composition. FIG. 2B shows results from capillary electrophoresis quantifying microdystrophin expression in BlO-mdx mouse triceps following administration of Composition 1 or Reference AAV composition.

[0225] FIGs. 3A-3B show results from analysis of microdystrophin expression in heart tissue from BlO-mdx mice dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 3A shows images of FLAG immunofluorescence of microdystrophin expression in BlO-mdx mouse hearts following administration of Composition 1 or Reference AAV composition. FIG. 3B shows results from capillary electrophoresis quantifying microdystrophin expression in BlO-mouse hearts following administration of Composition 1 or Reference AAV composition.

[0226] FIGs. 4A-4C show results from analysis of microdystrophin expression and muscle physiology in BlO-mdx mice dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 4A shows a graph of specific force of muscles from BlO-mice following administration of Composition 1 or Reference AAV composition. FIG. 4B shows a graph of percent force drop after eccentric damage, which demonstrates protection against eccentric damage, in muscles from BlO-mice following administration of Composition 1 or Reference AAV composition. FIG. 4C shows results from capillary electrophoresis quantifying microdystrophin expression in mouse EDL muscle following administration of Composition 1 or Reference AAV composition.

[0227] FIGs. 5A-5B show results from analysis of microdystrophin expression in heart left ventricles from NHP dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 5A shows images of FLAG immunofluorescence of microdystrophin expression in NHP heart left ventricles following administration of Composition 1 or Reference AAV composition. FIG. 5B shows results from capillary electrophoresis quantifying microdystrophin expression in NHP heart left ventricles following administration of Composition 1 or Reference AAV composition.

[0228] FIGs. 6A-6B show results from analysis of microdystrophin expression in heart right ventricles from NHP dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 6A shows images of FLAG immunofluorescence of microdystrophin expression in NHP heart right ventricles following administration of Composition 1 or Reference AAV composition. FIG. 6B shows results from capillary electrophoresis quantifying microdystrophin expression in NHP heart right ventricles following administration of Composition 1 or Reference AAV composition.

[0229] FIGs. 7A-7B show results from analysis of microdystrophin expression in heart interventricular septum from NHP dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 7A shows images of FLAG immunofluorescence of microdystrophin expression in NHP heart interventricular septum following administration of Composition 1 or Reference AAV composition. FIG. 7B shows results from capillary electrophoresis quantifying microdystrophin expression in NHP heart interventricular septum following administration of Composition 1 or Reference AAV composition.

[0230] FIGs. 8A-8B show results from analysis of microdystrophin expression in gastrocnemius from NHP dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 8A shows images of FLAG immunofluorescence of microdystrophin expression in NHP gastrocnemius following administration of Composition 1 or Reference AAV composition. FIG. 8B shows results from capillary electrophoresis quantifying microdystrophin expression in NHP gastrocnemius following administration of Composition 1 or Reference AAV composition.

[0231] FIGs. 9A-9B show results from analysis of microdystrophin expression in pectoralis major from NHP dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 9A shows images of FLAG immunofluorescence of microdystrophin expression in NHP pectoralis major following administration of Composition 1 or Reference AAV composition. FIG. 9B shows results from capillary electrophoresis quantifying microdystrophin expression in NHP pectoralis major following administration of Composition 1 or Reference AAV composition. FIGs. 10A-10B show results from analysis of microdystrophin expression in diaphragm from NHP dosed with either Composition 1 (4E13 vg / kg) or Reference AAV composition (1.33E14 vg / kg). FIG. 10A shows images of FLAG immunofluorescence of microdystrophin expression in NHP diaphragm following administration of Composition 1 or Reference AAV composition. FIG. 10B shows results from capillary electrophoresis quantifying microdystrophin expression in NHP diaphragm following administration of Composition 1 or Reference AAV composition.

[0232] FIG. 11 shows a graph of vector genome detected in the liver of NHPs.

[0233] FIG. 12 shows representative images of FLAG immunofluorescence of diaphragm, quadriceps, heart, and extensor digitorum longus (EDL) tissue of D2-mdx mice treated with Composition 1. Mice were dosed with either a low (1E13 vg / kg), a mid (2E13 vg / kg), or high (4E13 vg / kg) dose of Composition 1. WT mice and D2-mdx mice were treated with vehicle as a control. Tissues were analyzed 7 weeks post-injection.

[0234] FIGs. 13A-13B show results from capillary electrophoresis analysis of microdystrophin expression in D2-mdx mouse heart at 7 weeks (FIG. 13A) and 22 weeks (FIG. 13B) post-injection of Composition 1. Mice were dosed with either a low (1E13 vg / kg), a mid (2E13 vg / kg), or high (4E13 vg / kg) dose of Composition 1. WT mice and D2- mdx mice were treated with vehicle as a control.

[0235] FIGs. 14A-14B show results from capillary electrophoresis analysis of microdystrophin expression in D2-mdx mouse skeletal muscle at 7 weeks (FIG. 13A) and 22 weeks (FIG. 13B) post-injection of Composition 1 or Reference AAV composition. Mice were dosed with either a low (1E13 vg / kg), a mid (2E13 vg / kg), or high (4E13 vg / kg) dose of Composition 1. WT mice and D2-mdx mice were treated with vehicle as a control.

[0236] FIGs. 15A-15B show a graph of body weight of D2-mdx mice dosed with either a low (1E13 vg / kg), a mid (2E13 vg / kg), or high (4E13 vg / kg) dose of Composition 1. Body weight was measured pre-dose and monitored twice weekly throughout the 7 weeks (FIG. 15A) and 22 weeks (FIG. 15B) study cohorts. WT mice and D2-mdx mice were treated with vehicle as a control. Error bars are mean ± standard deviation.

[0237] FIGs. 16A-16B show a graph of body weight and tibialis anterior (TA) muscle weight of D2-mdx mice dosed with either a low (1E13 vg / kg), a mid (2E1 vg / kg), or high (4E13 vg / kg) dose of Composition 1. Body weight and TA weight was measured pre-dose and monitored twice weekly throughout the 7 weeks (FIG. 16A) and 22 weeks (FIG. 16B) studycohorts. WT mice and D2-mdx mice were treated with vehicle as a control. Error bars are mean ± standard deviation. Asterisks indicate statistical differences from mdx-vehicle mice (*p<0.05; ** p<0.01; **** p<0.0001).

[0238] FIGs. 17A-17E show results from physiological analysis of D2-mdx mice dosed with either a low (1E13 vg / kg), a mid (2E13 vg / kg), or high (4E13 vg / kg) dose of Composition 1. WT mice and D2-mdx mice were treated with vehicle as a control. Tissues were analyzed 7 weeks post-injection. Error bars are mean ± standard deviation. Asterisks, indicate statistical differences from mdx-vehicle mice (*p<0.05; **P<0.01; ***p<0.001; **** pO.OOOl; lack of asterisks indicates non-significance). (#), indicate WT-vehicle statistical differences from mdx-vehicle mice, (f), indicate WT-vehicle and Composition 1 statistical differences from mdx-vehicle mice. FIG. 17A shows graphs of anatomical properties of EDL muscle, including EDL weight (left panel), optimal length (Lo; middle panel), and cross-sectional area (CSA; right panel). FIG. 17B shows graphs of quantitative measurements of muscle contractility in EDL muscle, including specific twitch force (sPt; left panel) and specific tetanic force (sPo; right panel). FIG. 17C shows a graph of eccentric contraction of EDL muscle. FIG. 17D shows a graph of the stress-strain relationship to evaluate the elastic properties of EDL muscle. FIG. 17E shows a graph of the stress relaxation rate to evaluate the viscous properties of EDL muscle.

[0239] FIGs. 18A-18E show results from physiological analysis of D2-mdx mice dosed with either a low (1E13 vg / kg), a mid (2E13 vg / kg), or high (4E13 vg / kg) dose of Composition 1. WT mice and D2-mdx mice were treated with vehicle as a control. Tissues were analyzed 22 weeks post-injection. Error bars are mean ± standard deviation. Asterisks, indicate statistical differences from mdx-vehicle mice (*p<0.05; **P<0.01; ***p<0.001; **** p<0.0001; lack of asterisks indicates non-significance). (#), indicate WT-vehicle statistical differences from mdx-vehicle mice. (f). indicate WT-vehicle and Composition 1 statistical differences from mdx-vehicle mice. FIG. 18A shows graphs of anatomical properties of EDL muscle, including EDL weight (left panel), optimal length (Lo; middle panel), and cross-sectional area (CSA; right panel). FIG. 18B shows graphs of quantitative measurements of muscle contractility in EDL muscle, including specific twitch force (sPt; left panel) and specific tetanic force (sPo; right panel). FIG. 18C shows a graph of eccentric contraction of EDL muscle. FIG. 18D shows a graph of the stress-strain relationship to evaluate the elastic properties of EDL muscle. FIG. 18E shows a graph of the stress relaxation rate to evaluate the viscous properties of EDL muscle.

[0240] FIGs. 19A-19C show graphs of mRNA levels of microdystrophin-FLAG in heart (FIG. 19A), skeletal muscle (FIG. 19B), and off-target tissues (FIG. 19C) from NHPs dosed with 4E13 vg / kg of Composition 1. Tissues were analyzed 28 days post-injection. The transcript copy was normalized to nhpRPL30 (n=3 / group). Error bars are mean ± standard deviation. Avg.: average value; Sk.: skeletal; DRG: dorsal root ganglion.

[0241] FIG. 20 shows representative images of FLAG immunofluorescence of heart and skeletal muscle from NHPs dosed with 4E13 vg / kg of Composition 1. Tissues were analyzed 28 days post-injection.

[0242] FIGs. 21A-21B show results from capillary electrophoresis analysis of microdystrophin expression in heart (FIG. 21A) and skeletal muscle (FIG. 21B) from NHPs dosed with 4E13 vg / kg of Composition 1. Tissues were analyzed at 28 days or 90-days postinjection. The amount of the microdystrophin expressed in tissues was calculated by interpolation to the full-length dystrophin standard curve derived from normal human heart or skeletal muscle samples.

[0243] FIGs. 22A-22B show results from capillary electrophoresis analysis of microdystrophin expression from an endogenous coding sequence or a codon optimized microdystrophin sequence (vl, v2, or v3) in C2C12 derived myotubes.

[0244] FIGs. 23A-23B show results from capillary electrophoresis analysis of microdystrophin expression from an endogenous coding sequence or a codon optimized microdystrophin sequence (vl, v2, or v3) in human primary' myotubes.

[0245] FIGs. 24A-24C show results from analysis of microdystrophin expression in gastrocnemius from NHP dosed with MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 24A shows images of FLAG immunofluorescence of microdystrophin expression in NHP gastrocnemius following administration of MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 24B shows results from capillary' electrophoresis quantifying microdystrophin expression in NHP gastrocnemius following administration of MyoAAV-LD A- or AAV9- CBh-uDys-FLAG. FIG. 24C shows a graph of mRNA levels of microdystrophin in gastrocnemius from NHP dosed with MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. ]

[0246] FIGs. 25A-25C show' results from analysis of microdystrophin expression in triceps from NHP dosed with MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 25A shows images of FLAG immunofluorescence of microdystrophin expression in NHP triceps following administration of MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 25B shows results from capillary' electrophoresis quantifying microdystrophin expression in NHP triceps following administration of MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 25C shows a graph of mRNA levels of microdystrophin in triceps from NHP dosed with MyoAAV-LD A- or AAV9-CBh-uDy s-FLAG. FIGs. 26A-26C show results from analysis of microdystrophin expression in biceps brachii from NHP dosed with MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 26A shows images of FLAG immunofluorescence of microdystrophin expression in NHP biceps brachii following administration of MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 26B shows results from capillary electrophoresis quantifying microdystrophin expression in NHP biceps brachii following administration of MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 26C shows a graph of mRNA levels of microdystrophin in biceps brachii from NHP dosed with MyoAAV-LD A- or AAV9-CBh-uDys-FLAG.

[0247] FIGs. 27A-27C show results from analysis of microdystrophin expression in pectoralis major from NHP dosed with MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 27A shows images of FLAG immunofluorescence of microdystrophin expression in NHP pectoralis major following administration of MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 27B shows results from capillary' electrophoresis quantifying microdystrophin expression in NHP pectoralis major brachii following administration of MyoAAV-LD A- or AAV9-CBh-uDys-FLAG. FIG. 27C shows a graph of mRNA levels of microdystrophin in pectoralis major from NHP dosed with MyoAAV-LD A- or AAV9-CBh-uDys-FLAG.

[0248] FIGs. 28A-28B show results from analysis of muscle physiology in BlO-mdx mice dosed with DMD tool compound (2E13 vg / kg). FIG. 28A shows a graph of specific force following administration of the DMD tool compound to WT and mdx mice. FIG. 28B shows a graph of protection against eccentric damage following administration of the DMD tool compound to WT and mdx mice. *: WT significantly different from mdx, # Mdx significantly different from mdx + tool compound, J: WT significantly different from mdx + tool compound.

[0249] DETAILED DESCRIPTION

[0250] The present invention provides novel engineered nucleic acids encoding microdystrophin proteins for use in gene therapy.

[0251] Specifically, aspects of the invention provide a formulation comprising an AAV particle comprising (e.g., encapsidating) a nucleic acid comprising a promoter and a sequence encoding microdystrophin.

[0252] Aspects of the invention provide a composition comprising an adeno-associated virus (AAV) particle comprising an engineered capsid protein comprising the amino acid sequence RGDR (SEQ ID NO: 2440). The capsid protein encapsidates a nucleic acid molecule (e.g.. a cargo) comprising a promoter, a codon optimized microdystrophin sequence, for example, a sequence having at least 95% sequence identity with a sequence selected from any one of SEQ ID NOs: 2405-2407. The nucleic acid may further comprise a dorsal root ganglia (DRG) de-targeting miRNA binding site.

[0253] DMD Gene

[0254] The DMD gene is the largest known human gene. The most common mutations that cause DMD are large deletion mutations of one or more exons (60-70%). however duplication mutations (5-10%), and single nucleotide variants (25-35%), can also cause pathogenic dystrophin variants. In DMD, mutations often lead to a frame shift resulting in a premature stop codon and a truncated, non-functional or unstable protein. Nonsense point mutations can also result in premature termination codons with the same result. While mutations causing DMD can affect any exon, exons 2-20 and 45-55 are common hotspots for large deletion and duplication mutations.

[0255] Full-length dystrophin is a large (427 kDa) protein comprising a number of subdomains that contribute to its function. These subdomains include, in order from the amino-terminus toward the carboxy-terminus, the N-terminal actin-binding domain, a central so-called “rod” domain, a cysteine-rich domain and lastly a carboxy -terminal domain or region. The rod domain is comprised of 4 proline-rich hinge domains (abbreviated H), and 24 spectrin-like repeats (abbreviated R) in the following order: a first hinge domain (Hl), 3 spectrin-like repeats (Rl, R2, R3). a second hinge domain (H2), 16 more spectrin-like repeats (R4, R5, R6, R7, R8, R9, R10, Rl 1, R12, R13, R14, R15, R16, R17, R18, Rl 9), a third hinge domain (H3), 5 more spectrin-like repeats (R20, R21, R22, R23, R24), and a fourth hinge domain (H4) (including the WW domain). Following the rod domain are the cysteine-rich domain, and the COOH (C)-terminal (CT) domain.

[0256] Optimized Nucleic Acid Sequences

[0257] Optimized nucleic acid sequences of the invention may include codon-optimization, which refers to a gene coding sequence that has been optimized to increase expression by substituting one or more codons normally present in a coding sequence with a codon for the same amino acid. In this manner, the protein encoded by the gene is identical, but the underlying nucleobase sequence of the gene or corresponding mRNA is different. In some embodiments, the optimization substitutes one or more rare codons (that is. codons for tRNA that occur relatively infrequently in cells from a particular species) with synonymous codons that occur more frequently to improve the efficiency of translation. For example, in human codon-optimization one or more codons in a coding sequence are replaced by codons that occur more frequently in human cells for the same amino acid. Codon optimization can also increase gene expression through other mechanisms that can improve efficiency of transcription and / or translation. Strategies include, without limitation, increasing total GC content (that is, the percent of guanines and cytosines in the entire coding sequence), decreasing CpG content (that is, the number of CG or GC dinucleotides in the coding sequence), removing cryptic splice donor or acceptor sites, and / or adding or removing ribosomal entry sites, such as Kozak sequences. Desirably, a codon-optimized gene exhibits improved protein expression, for example, the protein encoded thereby is expressed at a detectably greater level in a cell compared with the level of expression of the protein provided by the wild t pe gene in an otherwise similar cell.

[0258] Sequence identity for a nucleic acid or amino acid sequence, for example an optimized nucleic acid, refers has the standard meaning in the art.

[0259] A percent nucleic acid sequence identity refers to the percentage of nucleotide residues in the candidate sequence that are identical with the nucleotides in the polynucleotide specifically disclosed herein. The alignment may include the introduction of gaps in the sequences to be aligned. In addition, for sequences which contain either more or fewer nucleotides than the polynucleotides specifically disclosed herein, it is understood that in one embodiment, the percentage of sequence identity will be determined based on the number of identical nucleotides in relation to the total number of nucleotides. Thus, for example, sequence identity of sequences shorter than a sequence specifically disclosed herein, will be determined using the number of nucleotides in the shorter sequence, in one embodiment. In percent identity calculations relative weight is not assigned to various manifestations of sequence variation, such as insertions, deletions, substitutions, etc.

[0260] Aa number of different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity may be determined using standard techniques known in the art, including, but not limited to the BLAST algorithm, described in Altschul et al., J Mol. Biol. 215:403 (1990) and Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873 (1993).

[0261] Micro RNA

[0262] MicroRNAs are small, single-stranded, non-coding RNA molecules. miRNAs basepair to complementary sequences in mRNA molecules, thereby producing post- transcriptional regulation of gene expression. Typically, miRNA molecules silence messenger RNA (mRNA) translation by facilitating a process that leads to cleavage of mRNA strand into two pieces or destabilization of the mRNA by shortening its poly(A) tail. miRNAs are typically ~22 nt and are expressed in a cell and tissue type specific manner. miRNAs resemble small interfering RNAs (siRNAs), however miRNAs derive from regions of RNA transcripts that fold back on themselves to form short hairpins. Animal miRNAs are initially transcribed as part of one arm of an RNA stem-loop that in turn forms part of a several hundred nucleotide-long miRNA precursor termed a pri-miRNA. A single pri-miRNA may contain from one to six miRNA precursors. These hairpin loop structures are ty pically composed of about 70 nucleotides each. Each hairpin is flanked by sequences necessary' for efficient processing.

[0263] The pre-miRNA hairpin is typically cleaved by the RNase enzyme Dicer. The RNase interacts with 5' and 3' ends of the hairpin and cuts away the loop joining the 3' and 5' arms, resulting in a miRNA:miRNA duplex about 22 nucleotides in length. Overall hairpin length and loop size influence the efficiency of Dicer processing. Although either strand of the duplex may potentially act as a functional miRNA, only one strand is generally incorporated into the RNA-induced silencing complex (RISC) where the miRNA and its mRNA target interact.

[0264] The present invention provides miR-338-3p, miR-138-5p, and miR-9-5p functional sites that inhibit expression of a transgene to selectively inhibit expression of the transgene in the dorsal root ganglia (DRG).

[0265] I. Recombinant Nucleic Acids

[0266] Aspects of the present disclosure provide a recombinant nucleic acid comprising a muscle specific promoter, a sequence encoding microdystrophin, and at least one DRG detargeting miRNA binding site. In some embodiments, the recombinant nucleic acid can further comprise an intron and / or a PolyA signal. Alternatively, or in addition to, the recombinant nucleic acid can further comprise a 5' inverted terminal repeat (ITR) and a 3' ITR.

[0267] Various promoters, including inducible promoters and constitutive promoters, can be used to drive expression from the recombinant nucleic acids described herein. Non-limiting examples of promoters that can be used in the recombinant nucleic acids disclosed herein include a cytomegalovirus (CMV) promoter, a chicken P-actin (CB A) promoter, an alpha- 1 antitrypsin (hAAT) promoter, and any promoter derived from an immunoglobulin gene, SV40, or other tissue specific genes. In some embodiments, the promoter is tissue-specific such that, in a multi-cellular organism, the promoter drives expression only in a subset of specific cells. For example, the promoter is a muscle specific promoter. Non-limiting examples of muscle specific promoters include a CK8 promoter, a desmin promoter, a Mb promoter, a MCK promoter, a MHCK7 promoter, a skeletal muscle alpha actin promoter, or a TTNI2 promoter.

[0268] In some embodiments, the promoter is a novel promoter described herein. For example, the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404. In another example, the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2403. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2404.

[0269] Recombinant nucleic acids described herein comprise a sequence encoding microdystrophin (e.g, a sequence encoding human microdystrophin). Upon administration of any of the recombinant nucleic acids described herein, microdystrophin protein (e.g.. any biologically active fragment of dystrophin, e.g.. AR4-R23 / ACT microdystrophin) is expressed in muscle cells or muscle tissue to produce a therapeutic effect.

[0270] In some embodiments, the microdystrophin protein can comprise or consist of an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2439. In some embodiments, the microdystrophin protein comprises or consists of the amino acid sequence of SEQ ID NO: 2439.

[0271] The sequence encoding microdystrophin can be an endogenous sequence encoding micodystrophin or a codon optimized sequence encoding microdystrophin such as the codon optimized sequences encoding microdystrophin provided as SEQ ID NOs: 2405-2407.

[0272] In some embodiments, the sequence encoding microdystrophin comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405. In some embodiments, the sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2405.

[0273] In some embodiments, the sequence encoding microdystrophin comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406. In some embodiments, the sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2406.

[0274] In some embodiments, the sequence encoding microdystrophin comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407. In some embodiments, the sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2407.

[0275] Any of the sequences encoding microdystrophin described herein can produce a microdystrophin protein that retains its biological activity (e.g, muscle membrane stabilization).

[0276] For example, the sequence encoding microdystrophin comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%. at least 90%. at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405, and microdystrophin retains biological activity (e.g, muscle membrane stabilization). In another example, the sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2405, and microdystrophin retains biological activity (e.g, muscle membrane stabilization).

[0277] In another example, the sequence encoding microdystrophin comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406, and microdystrophin retains biological activity (e g, muscle membrane stabilization). In another example, the sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2406, and microdystrophin retains biological activity (e.g, muscle membrane stabilization). In yet another example, the sequence encoding microdystrophin comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407, and microdystrophin retains biological activity (e.g, muscle membrane stabilization). In another example, the sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2407. and microdystrophin retains biological activity (e.g, muscle membrane stabilization).

[0278] Recombinant nucleic acids described herein can comprise at least one DRG detargeting miRNA binding site, e.g., at least one, at least two, at least three, at least four, at least five, or more DRG de-targeting miRNA binding sites.

[0279] Any DRG de-targeting miRNA binding site suitable for binding a DRG de-targeting miRNA can be included in the recombinant nucleic acids described herein. In some embodiments, the DRG de-targeting miRNA binding site can comprise or consist of a binding site for miR-338 (e.g.. miR-338-3p), miR-138 (e.g., miR-138-5p), or miR-9 (e.g., miR-9-5p).

[0280] In some embodiments, the DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%. at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401 . In some embodiments, the DRG de- targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs : 2399-2401.

[0281] In some embodiments, the DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399. In some embodiments, the DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NOs: 2399.

[0282] In some embodiments, the DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400. In some embodiments, the DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NOs: 2400.

[0283] In some embodiments, the DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401. In some embodiments, the DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NOs: 2401.

[0284] In some embodiments, when the recombinant nucleic acid comprises more than one DRG de-targeting miRNA binding site, the more than one DRG de-targeting miRNA binding site can have the same sequence or a different sequence.

[0285] For example, when the recombinant nucleic acid comprises a first and a second DRG de-targeting miRNA binding site, each of the DRG de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.

[0286] Alternatively, the first and the second DRG de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2399 and SEQ ID NO: 2400, respectively, or vice versa; the first and the second DRG de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2399 and SEQ ID NO: 2401, respectively, or vice versa; or the first and the second DRG de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400 and SEQ ID NO: 2401, respectively , or vice versa.

[0287] The at least one DRG de-targeting miRNA binding site can be positioned in the recombinant nucleic acids described herein at any location suitable for binding a DRG de- targeting miRNA. For example, the DRG de-targeting miRNA binding site can be positioned upstream or downstream of the sequence encoding microdystrophin. In another example, when the recombinant nucleic acid comprises more than one DRG de-targeting miRNA binding site, each of the DRG de-targeting miRNA binding sites can be positioned upstream or downstream of the sequence encoding microdystrophin. Alternatively, one or more of the DRG de-targeting miRNA binding sites can be positioned upstream of the sequence encoding microdystrophin and one or more of the DRG de-targeting miRNA binding sites can be positioned downstream of the sequence encoding microdystrophin.

[0288] Recombinant nucleic acids described herein can further comprise an intron to increase overall efficiency and output of gene expression. Preferably, the intron is positioned between the promoter and transgene (e.g., microdystrophin transgene) in a 5' to 3' orientation. Nonlimiting examples of introns include a simian virus 40 (SV40) intron sequence, a minute virus of mice (MVM) intron, a RK intron, a P-globin intron, and / or a chicken P-actin (CBA) intron, including functional variants or fragments thereof.

[0289] In some embodiments, the intron is a SV40 intron, including functional variants or fragments thereof. In some embodiments, the SV40 intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409. In some embodiments, the SV40 intron comprises or consists of a nucleic acid sequence comprising at least one, two, or three, but no more than four, modifications, e.g., substitutions, relative to the nucleic acid sequence of SEQ ID NO: 2409. In some embodiments, the SV40 intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409.

[0290] Recombinant nucleic acids described herein can further comprise a polyadenylation (Poly A) signal sequence or functional fragment thereof, e.g., a fragment capable of measurably increasing expression as compared to expression in its absence. Non-limiting examples of Poly A signal sequences include a bovine growth hormone poly adenylation (bgh- PolyA) signal, a synthetic Poly A signal, and an SV40 Poly A signal.

[0291] In some embodiments, the PolyA signal comprises a bgh-PolyA signal, and the bgh- PolyA signal comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410. In some embodiments, the PolyA signal comprises a bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of the nucleic acid sequence of SEQ ID NO: 2410.

[0292] Recombinant nucleic acids described herein can comprise one or more PolyA signal sequences or functional fragments thereof. In some embodiments, the recombinant nucleic acid described herein comprises a polyA sequence between the 3' end of a sequence encoding the microdystrophin transgene and the 5' end of the 3' ITR.

[0293] Recombinant nucleic acids described herein can comprise one or more ITRs. e.g, two ITRs, with one upstream and the other downstream of a sequence encoding microdystrophin and / or the other elements discussed above (e.g. , a promoter, at least one DRG de-targeting miRNA binding site).

[0294] An ITR sequence may be wild type, or it may comprise one or more mutations, e.g., by the insertion, deletion, or substitution of nucleotides, as long as the sequences retain one or more function of a wild type ITR, such as providing for functional rescue, replication and packaging. In some embodiments, a recombinant nucleic acid as described herein can comprise two ITR sequences, each of which is wild type, variant, or modified ITR sequences. In some embodiments, a recombinant nucleic acid as described herein can comprise two ITR sequences, which are different (e.g., one wild type ITR sequence and one variant or modified ITR sequence). For example, the “left"’ or 5' ITR is a modified ITR sequence that allows for production of self-complementary genomes, and the ‘Tight” or 3' ITR is a wild type ITR sequence. In some embodiments, the “right” or 3' ITR is a modified ITR sequence that allows for the production of self-complementary genomes, and the “left” or 5' ITR is a wild type ITR sequence.

[0295] In some embodiments, a recombinant nucleic acid can comprise ITR sequences from any AAV serotype suitable for replication and packaging of the virus. Non-limiting examples AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh, AAVrhlO, AAVrh74, AAV-DJ, AAV-DJ / 8, Anc80, AAV7m8, or any derivative, hybrid or chimeric serotype thereof.

[0296] In some embodiments, the recombinant nucleic acid comprises one or more ITRs derived from AAV2. The nucleotides in an ITR sequence may be in a forward or reverse orientation. In some embodiments, the ITR sequences are both wild type, variant, or modified AAV2 ITR sequences. In some embodiments, the ITR sequences are different (e.g., one ITR is a wild type AAV2 sequence and one ITR is variant or modified AAV2 ITR sequence). In some embodiments, the “left” or 5' ITR is a modified AAV2 ITR sequence that allows for production of self-complementary genomes, and the “right” or 3' ITR is a wild type AAV2 ITR sequence. In some embodiments, the “right” or 3' ITR is a modified AAV2 ITR sequence that allows for the production of self-complementary genomes, and the “left” or 5' ITR is a wild type AAV2 ITR sequence. In some embodiments, the 5' ITR is an AAV2 5’ ITR as described in McCarty, D.M., et al., Gene Ther (2001), which is incorporated by reference in its entirety . In some embodiments, the 3' ITR is an AAV2 3' ITR as described in Rolling, F. & Samulski, R.J. Molecular biotechnology (1995), which is incorporated by reference in its entirety. In some embodiments, the 3’ ITR may comprise a deletion of the terminal resolution site (dTR), which inhibits Rep protein nicking of the single stranded viral genome. The presence of the dTR in the 3’ ITR increases self-complementary' binding of the viral genome to itself, which it may do because of its small size that allows for a doublestranded viral genome to be packaged within a viral capsid.

[0297] In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408. In some embodiments, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408.

[0298] In some embodiments, the recombinant nucleic acid comprises a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411. In some embodiments, the recombinant nucleic acid comprises a 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

[0299] Example Recombinant Nucleic Acids

[0300] Non-limiting examples of recombinant nucleic acids for use in methods described herein are provided below. In some examples, the recombinant nucleic acid comprises, optionally from 5' to 3', a muscle specific promoter; a sequence encoding microdystrophin; and at least one DRG de-targeting miRNA binding site.

[0301] For example, the recombinant nucleic acid comprises, optionally from 5' to 3’, a muscle specific promoter comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2405- 2407 ; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.

[0302] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0303] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0304] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0305] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0306] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0307] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0308] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401. In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0309] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0310] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0311] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0312] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0313] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0314] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0315] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0316] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0317] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0318] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0319] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0320] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399. In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399.

[0321] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0322] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0323] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400.

[0324] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%. at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0325] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0326] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

[0327] In some examples, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0328] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399. In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0329] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0330] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0331] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0332] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0333] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0334] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0335] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0336] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0337] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0338] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0339] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0340] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0341] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0342] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0343] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0344] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0345] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0346] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399.

[0347] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400. In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0348] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400.

[0349] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0350] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0351] In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

[0352] In some examples, the recombinant nucleic acid comprises, optionally from 5' to 3', a 5' ITR; a muscle specific promoter; an intron; a sequence encoding microdystrophin; a first DRG de-targeting miRNA binding site; a second DRG de-targeting miRNA binding site; a Poly A signal; and a 3' ITR.

[0353] For example, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407; a first DRG detargeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0354] In another example, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0355] In another example, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0356] In another example, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0357] In another example, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least

[0358] 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO:

[0359] 2402; an intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least

[0360] 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0361] In another example, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and a 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

[0362] In another example, the recombinant nucleic acid comprises a 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least

[0363] 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO:

[0364] 2404; an intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least

[0365] 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic aci...

Claims

CLAIMSWhat Is Claimed Is:

1. A recombinant nucleic acid comprising: a muscle specific promoter; a sequence encoding microdystrophin: and at least one dorsal root ganglia (DRG) de-targeting miRNA binding site.

2. The recombinant nucleic acid of claim 1, wherein the muscle specific promoter comprises a CK8 promoter, a desmin promoter, a Mb promoter, a MCK promoter, a MHCK7 promoter, a skeletal muscle alpha actin promoter, or a TTNI2 promoter.

3. The recombinant nucleic acid of claim 1 or claim 2, wherein the promoter comprises or consists of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%. at least 89%. at least 90%. at least 91%. at least 92%. at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404.

4. The recombinant nucleic acid of any one of claims 1-3, wherein the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404.

5. The recombinant nucleic acid of any one of claims 1-4, wherein the promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402.

6. The recombinant nucleic acid of any one of claims 1-5, wherein the sequence encoding microdystrophin is a sequence encoding human microdystrophin.

7. The recombinant nucleic acid of any one of claims 1-6, wherein the sequence encoding microdystrophin encodes a microdystrophin protein comprising or consisting of an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%. at least 98%, or at least 99% identical to SEQ ID NO: 2439.

8. The recombinant nucleic acid of any one of claims 1-7, wherein the sequence encoding microdystrophin comprises or consists of a codon optimized sequence encoding microdystrophin.

9. The recombinant nucleic acid of any one of claims 1-8, wherein the codon optimized sequence encoding microdystrophin comprises or consists of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407.

10. The recombinant nucleic acid of any one of claims 1-9, wherein the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407.

11. The recombinant nucleic acid of any one of claims 1-10, wherein the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2406.

12. The recombinant nucleic acid of any one of claims 1-11, wherein the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2407.

13. The recombinant nucleic acid of any one of claims 1-12, wherein the at least one DRG de-targeting miRNA binding site comprises a binding site for miR-338, miR-138, or miR-9.

14. The recombinant nucleic acid of any one of claims 1-13, wherein the at least one DRG de-targeting miRNA binding site comprises a binding site for miR-338-3p, miR-138- 5p. or miR-9-5p.

15. The recombinant nucleic acid of any one of claims 1-14, wherein the at least one DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%. at least 88%. at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399- 2401.

16. The recombinant nucleic acid of any one of claims 1-15, wherein the at least one DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.

17. The recombinant nucleic acid of any one of claims 1-16, wherein the at least one DRG de-targeting miRNA binding site comprises a first and a second DRG de-targeting miRNA binding site.

18. The recombinant nucleic acid of any one of claims 1-17, wherein each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.

19. The recombinant nucleic acid of any one of claims 1-18, wherein each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401 .

20. The recombinant nucleic acid of any one of claims 1-19, wherein each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of SEQ ID NO: 2399.

21. The recombinant nucleic acid of any one of claims 1-20, wherein the recombinant nucleic acid comprises, optionally from 5' to 3': the promoter comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404: the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%. at least 98%. or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.

22. The recombinant nucleic acid of any one of claims 1-21, wherein the recombinant nucleic acid is selected from:(a) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;(b) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO:the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;(c) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;(d) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of S EQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;(e) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;(f) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%,at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;(g) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401;(h) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; andthe at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401;(i) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401 ;(j) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, atleast 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;(k) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;(l) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;(m) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;(n) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;(o) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;(p) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401;(q) a recombinant nucleic acid comprising:the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401;(r) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401;(s) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;(t) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;(u) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%,at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;(v) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%. at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;(w) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403;the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;(x) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;(y ) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of S EQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401;(z) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; and(aa) a recombinant nucleic acid comprising: the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%,at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401.

23. The recombinant nucleic acid of any one of claims 1-21, wherein the recombinant nucleic acid is selected from:(a) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;(b) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;(c) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;(d) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ IDNO: 2402;the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400;(e) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400;(f) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400;(g) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401;(h) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401;(i) a recombinant nucleic acid comprising:the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401;(j) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;(k) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;(l) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;(m) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400;(n) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400;(o) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400;(p) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401 ;(q) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401;(r) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; andthe at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401;(s) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;(t) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;(u) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;(v) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400;(w) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ IDNO: 2403;the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400;(x) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400;(y) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401;(z) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; and (aa) a recombinant nucleic acid comprising: the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; and the at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401.

24. The recombinant nucleic acid of any one of claims 1-23, further comprising an intron.

25. The recombinant nucleic acid of claim 24. wherein the intron comprises a simian virus 40 (SV40) intron sequence, a minute virus of mice (MVM) intron, a RK intron, a P- globin intron, and / or a chicken -actin (CBA) intron, including functional variants or fragments thereof.

26. The recombinant nucleic acid of claim 24 or claim 25, wherein the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409.

27. The recombinant nucleic acid of any one of claims 24-26, wherein the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409.

28. The recombinant nucleic acid of any one of claims 1-27, further comprising a polyadenylation (Poly A) signal.

29. The recombinant nucleic acid of claim 28, wherein the PolyA signal comprises a bovine growth hormone polyadenylation (bgh-PolyA) signal, a synthetic PolyA signal, or an SV40 PolyA signal.

30. The recombinant nucleic acid of claim 28 or claim 29. wherein the PolyA signal comprises the bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410.

31. The recombinant nucleic acid of any one of claims 28-30, wherein the PolyA signal comprises the bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of the nucleic acid sequence of SEQ ID NO: 2410.

32. The recombinant nucleic acid of any one of claims 1-31, further comprising a 5' inverted terminal repeat (ITR) and a 3' ITR.

33. The recombinant nucleic acid of claim 32, wherein the 5' ITR and / or the 3' ITR is an adeno-associated virus 2 (AAV2) ITR, or a variant or fragment thereof.

34. The recombinant nucleic acid of claim 32 or claim 33, wherein the 5' ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408.

35. The recombinant nucleic acid of any one of claims 32-34, wherein the 5' ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408.

36. The recombinant nucleic acid of any one of claims 32-35. wherein the 3' ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

37. The recombinant nucleic acid of any one of claims 32-36, wherein the 3' ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2411.

38. The recombinant nucleic acid of any one of claims 1-37, wherein the recombinant nucleic acid comprises, optionally from 5' to 3': a 5' ITR; a promoter; an intron; a sequence encoding microdystrophin; a first DRG de-targeting miRNA binding site; a second DRG de-targeting miRNA binding site; a PolyA signal; and a 3' ITR.

39. The recombinant nucleic acid of claim 38, wherein: the 5' ITR comprises or consists of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404; the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%. at least 87%. at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%. at least 91%. at least 92%. at least 93%. at least 94%. at least 95%. at least 96%. at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407; the first DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; the second DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; the PolyA signal comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprises or consists of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, atleast 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

40. The recombinant nucleic acid of claim 38 or claim 39, wherein the recombinant nucleic acid is selected from:(a) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; and the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (b) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (c) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405;the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (d) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409;the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (e) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403;the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (I) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408;the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (g) a recombinant nucleic acid comprising:the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; andthe 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (h) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401;the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411;(i) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401;the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (j) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406;the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (k) a recombinant nucleic acid comprising: the 5' comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409;the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (1) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404;the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411;(m) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408;the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (n) a recombinant nucleic acid comprising:the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; andthe 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (o) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (p) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401;the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (q) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406;the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (r) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409;the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (s) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402;the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (t) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408;the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (u) a recombinant nucleic acid comprising:the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%. at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; andthe 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (v) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%. at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (w) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (x) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407;the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (y) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409;the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; (z) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403;the intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and(aa) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408;the promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%. at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.

41. The recombinant nucleic acid of any one of claims 38-40, wherein the recombinant nucleic acid is selected from:(a) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(b) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(c) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(d) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(e) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(I) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(g) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(h) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(i) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(j) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(k) a recombinant nucleic acid comprising: the 5' comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(l) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(m) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(n) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(o) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(p) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(q) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(r) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(s) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(t) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(u) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(v) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(w) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(x) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(y) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411;(z) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQID NO: 2410; andthe 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and(aa) a recombinant nucleic acid comprising: the 5' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; the promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; the intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; the sequence encoding microdystrophin comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; the first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; the PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; and the 3' ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411.

42. The recombinant nucleic acid of any one of claims 1-41 , wherein the recombinant nucleic acid comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2412-2438.

43. The recombinant nucleic acid of any one of claims 1-42, wherein the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2412-2438.

44. A recombinant nucleic acid comprising a promoter, wherein the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%. at least 89%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404.

45. The recombinant nucleic acid of claim 44, wherein the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404.

46. The recombinant nucleic acid of claim 44 or claim 45, wherein the recombinant nucleic acid comprising the promoter exhibits enhanced expression in skeletal muscle cells and / or cardiac muscle cells compared to non-skeletal muscle cells and / or non-cardiac muscle cells.

47. A recombinant nucleic acid comprising a codon optimized sequence encoding microdystrophin that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407.

48. The recombinant nucleic acid of claim 47, wherein the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2405-2407.

49. The recombinant nucleic acid of claim 47 or claim 48, wherein the codon optimized sequence encoding microdystrophin comprises or consists of the nucleic acid sequence of SEQ ID NO: 2407.

50. An adeno-associated virus (AAV) particle comprising the recombinant nucleic acid of any one of claims 1 -49 and a capsid protein.

51. The AAV particle of claim 50, wherein the capsid protein is derived from a serot pe selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV 10, AAV 11, AAV 12, AAV 13, AAVrh, AAVrhlO, AAVrh74, AAV-DJ, AAV-DJ / 8, Anc80, and AAV7m8, or a derivative, hybrid or chimeric serotype thereof.

52. The AAV particle of claim 50 or claim 51, wherein the AAV particle has increased muscle tropism compared to a wild type AAV9 particle.

53. The AAV particle of any one of claims 50-52, wherein the AAV particle has reduced liver tropism compared to a wild type AAV9 particle.

54. The AAV particle of any one of claims 50-53, wherein the capsid protein comprises an amino acid sequence of formula (I):(I) X1NX2X3X4RGDRX5X6L (SEQ ID NO: 1), wherein each of Xi-Xe is any amino acid.

55. The AAV particle of claim 54, wherein the amino acid sequence of formula (I) is in a hypervariable region IV (HVR IV) relative to a wild type AAV9 capsid.

56. The AAV particle of claim 54 or claim 55, wherein, relative to a wild type AAV9 capsid. Xi is a substitution at amino acid 451, X2 is a substitution at amino acid 453, X3 is a substitution at amino acid 454, X4 is a substitution at amino acid 455, and RGDRXsXeL (SEQ ID NO: 2441) is inserted after amino acid 455.

57. The AAV particle of any one of claims 54-56. wherein:X1 is A, I, F, G, H, L, M, Q, S, T, or V;X2 1S A, G, S, T, or Y;X3 is S, N, G, or P;X4is A, G, H, I, M, S, T. or V;X5 is A, G, or Q; andX6 is A, I, L, M, N, S, or Y.

58. The AAV particle of any one of claims 54-57, wherein the amino acid sequence of formula (I) comprises of any one of SEQ ID NOs: 801-1599.

59. The AAV particle of any one of claims 54-58, wherein the amino acid sequence of formula (I) comprises of any one of SEQ ID NOs: 1600-2398.

60. The AAV particle of any one of claims 54-59, wherein the amino acid sequence of formula (I) comprises or consists of any one of SEQ ID NOs: 2-800.

61. The AAV particle of any one of claims 54-60, wherein the amino acid sequence of formula (I) comprises or consists of SEQ ID NOs: 191, 198, 199, 215, 256, 379, 544, 550, or 748.

62. The AAV particle of any one of claims 54-61, wherein the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector.

63. The AAV particle of any one of claims 54-62, wherein the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 215, the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector, and the remainder of the capsid is otherwise identical to the wild type AAV9.

64. A pharmaceutical composition comprising the recombinant nucleic acid of any one of claims 1-49 or the adeno-associated virus (AAV) particle of any one of claims 50-63, and a pharmaceutically acceptable carrier.

65. A method of treating Duchenne muscular dystrophy (DMD) in a subject in need thereof, the method comprising administering to the subject an effective amount of the recombinant nucleic acid of any one of claims 1-49, the adeno-associated virus (AAV) particle of any one of claims 50-63, or the pharmaceutical composition of claim 64.

66. The method of claim 65, wherein the subject is a human subject.

67. The method of claim 65 or claim 66, wherein the subject has at least one mutation in the dystrophin gene.

68. The method of any one of claims 65-67, wherein the administering comprises intramuscular administration, subcutaneous injection, intravenous injection, or intravenous (IV) administration.

69. The use of the recombinant nucleic acid of any one of claims 1-49, the adeno- associated virus (AAV) particle of any one of claims 50-63. or the pharmaceutical composition of claim 64 for the manufacture of a medicament for treating Duchenne muscular dystrophy (DMD).

70. The recombinant nucleic acid of any one of claims 1-49, the adeno-associated virus (AAV) particle of any one of claims 50-63, or the pharmaceutical composition of claim 64 for use in treating Duchenne muscular dystrophy (DMD).

71. A kit comprising the recombinant nucleic acid of any one of claims 1 -49, the adeno- associated virus (AAV) particle of any one of claims 50-63. or the pharmaceutical composition of claim 64.

72. The kit of claim 71, further comprising instructions for use in treating Duchenne muscular dystrophy (DMD) in a subject in need thereof.