Use of compound in preparing drug for treating hematologic malignancy
By using compounds with specific structures to act on the NUP214 gene, the problem of limited effectiveness of existing chemotherapy regimens in treating leukemia was solved, and the efficient inhibition of leukemia cells and the extension of mouse survival time were achieved.
Patent Information
- Application Number
- PCT/CN2024/141714
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-12
- Filing Date
- 2024-12-24
- Publication Date
- 2025-09-18
AI Technical Summary
Existing chemotherapy regimens have limited therapeutic effects on leukemia, especially AML, and are prone to relapse. The lack of efficient drug interventions limits patients' survival rates.
A compound with a specific structure is provided for preparing a drug for treating blood tumors, especially leukemia, which acts on the NUP214 gene, degrades the protein expressed or fused to the gene, and inhibits the proliferation and development of leukemia cells.
The compound showed a highly effective inhibitory effect on multiple leukemia cell lines, significantly increased the mortality rate of leukemia cells, and prolonged the survival time of mice in a xenograft model, while having no significant effect on the expression of the NUP214 gene.
Smart Images

Figure CN2024141714_18092025_PF_FP_ABST
Abstract
Description
Use of a compound in preparing a drug for treating blood tumors Technical Field
[0001] The present invention relates to the field of pharmaceutical applications, and in particular, to applications of a compound having a structure of formula (I) in the preparation of a drug for treating blood tumors. Background Art
[0002] Hematological malignancies refer to tumors that occur in blood cells and the hematopoietic system. The most common hematological malignancies include leukemia, lymphoma, multiple myeloma, myelodysplastic syndrome, and myelofibrosis.
[0003] Leukemia is a type of hematologic malignancy characterized by the accumulation and spread of immature cells in the bone marrow and peripheral blood, leading to the failure of normal hematopoietic function. Leukemia is primarily divided into four types, including acute / chronic lymphocytic leukemia (ALL / CLL) and acute / chronic myeloid leukemia (AML / CML). Hematopoietic stem cell transplantation offers the possibility of a cure for leukemia patients, but limited donor resources and high costs have limited its widespread adoption. Currently, chemotherapy remains the primary treatment for leukemia, but the treatment of leukemia (AML in particular) faces the dilemma of high relapse rates and difficult treatment. The 3+7 regimen (3 days of anthracycline plus 7 days of cytarabine) based on anthracycline plus cytarabine has long been the standard chemotherapy regimen for AML, but this regimen has limited effectiveness in improving overall survival after complete remission. Currently, the 5-year survival rate for young AML patients is only 40-50%, and for older AML patients, it is less than 10%. Therefore, identifying new and effective drugs to effectively eliminate leukemic cells is crucial for leukemia intervention.
[0004] The human nucleoporin (NUP) NUP214 gene is located at 9q34.13. Its encoded product consists of three domains: an N-terminal β-propeller domain, a central coiled-coil domain, and a C-terminal FG domain. NUP214 is primarily involved in the nucleocytoplasmic transport of proteins and RNA and also plays a crucial role in cell growth, proliferation, development, and the cell cycle. NUP214 binds to nuclear export protein 1 (XPO1) through its C-terminal FG domain, contributing to its mediated nucleocytoplasmic transport of proteins. The N-terminal region of NUP214 interacts with nuclear RNA export factor 1 (NXF1) and ATP-dependent DEAD helicase 19 (DDX19), thereby stabilizing the localization of DDX19 at the cytoplasmic periphery of the nuclear pore complex (NPC). Loss of NUP214 leads to cell cycle arrest in mouse embryos and ultimately to developmental failure. These studies indicate that NUP214 is essential for maintaining essential cellular functions. In addition, leukemia has been found to be associated with multiple NUP214 fusion genes, including SET-NUP214, DEK-NUP214, SQSTM1-NUP214, and NUP214-ABL1. These fusion genes have been reported to be important driver mutations in the development and progression of leukemia, suggesting that NUP214 plays a crucial regulatory role in leukemia cells. Summary of the Invention
[0005] The present invention provides use of a compound in the preparation of a medicament for treating blood tumors, wherein the compound has the structure of the following formula (I):
[0006] or a pharmaceutically acceptable salt thereof,
[0007] in,
[0008] R 1 Selected from hydrogen, acyl, C 1-6 Alkyl, C 3-10 Heterocyclic group, C 3-10 Heterocyclyl-C 1-4 Alkyl, wherein each acyl, alkyl and heterocyclyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0009] R 2 Selected from amino, cyano, nitro, hydroxyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0010] R 3 Selected from hydrogen, amino, cyano, nitro, hydroxyl, acyl and C 1-6Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0011] R 4 Selected from hydrogen, amino, cyano, hydroxyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0012] R 5 Selected from hydrogen, halogen, amino, cyano, hydroxy, acyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0013] R X Selected from hydroxy, halogen, amino, C 1-6 Alkyl, C 1-6 Alkoxy, C 3-10 Cycloalkyl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 3-10 Heterocyclic group, C 3-10 Heterocyclyl-C 1-4 Alkyl and -OC 3-10 Heterocyclyl, wherein each amino, alkyl, alkoxy, cycloalkyl and heterocyclyl is unsubstituted or substituted by at least one independently selected from R Y Substituents substituted;
[0014] R Y Selected from hydroxyl, halogen, C 1-6 Alkyl and C 1-6 Alkoxy groups, wherein each alkyl group and alkoxy group, respectively, is unsubstituted or substituted with at least one hydroxy group.
[0015] In one embodiment, the hematological tumor is selected from the group consisting of leukemia, lymphoma, multiple myeloma, myelodysplastic syndrome and myelofibrosis, preferably leukemia.
[0016] The present invention also provides a pharmaceutical composition comprising a compound having a structure of formula (I) or a pharmaceutically acceptable salt thereof according to the present invention, and at least one pharmaceutically acceptable carrier. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figures 1A-1B show the effect of compound 0449-0002 on cell death in the leukemia cell line THP-1 (human monocytic leukemia cell line). Figure 1A shows the results of cell death in the leukemia cell line THP-1 at concentrations of 50 nM and 100 nM of compound 0449-0002, as measured using Annexin V-FITC and PI staining, respectively. Figure 1B shows a bar graph analysis of the results in Figure 1A.
[0018] FIG2A shows the effect of compound 0449-0002 on the survival days of mice in a xenograft model constructed by transplantation of KG-1α (human acute myeloid leukemia cell line) cells.
[0019] FIG2B shows the effect of compound 0449-0002 on the survival days of mice in a xenograft model constructed by THP-1 cell transplantation.
[0020] FIG2C shows the effect of compound 0449-0002 on the survival days of mice in a xenograft model constructed by transplantation of U-937 (human histiocytic lymphoma cell line) cells.
[0021] FIG2D shows the effect of compound 0449-0002 on the percentage of human CD45-positive cells in the bone marrow of mice in a xenograft model constructed by KG-1α cell transplantation.
[0022] FIG2E shows the effect of compound 0449-0002 on the percentage of human CD45-positive cells in the spleen of mice in a xenograft model constructed by KG-1α cell transplantation.
[0023] FIG2F shows the results of staining of liver sections of mice in a xenograft model constructed by KG-1α cell transplantation with compound 0449-0002.
[0024] FIG3A shows the effect of compound 0449-0002 on NUP214 protein in THP-1 cells.
[0025] FIG3B shows the results of Image J software analysis of the results in FIG3A .
[0026] FIG3C shows the effect of compound 0449-0002 on the mRNA expression level of NUP214.
[0027] FIG3D shows a schematic diagram of the process for constructing the pCMV-hNUP214-EGFP expression plasmid.
[0028] FIG3E shows the effect of different concentrations of compound 0449-0002 on the expression level of the pCMV-hNUP214-EGFP expression plasmid constructed in FIG3D .
[0029] FIG4 shows a schematic diagram of the pCMV-hNUP214-EGFP plasmid map. DETAILED DESCRIPTION
[0030] The present invention will be described in further detail below. This description is for illustrative purposes only and is not intended to limit the present invention. Those skilled in the art will readily appreciate the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments. Those skilled in the art may make various modifications and alterations without departing from the spirit of the present invention.
[0031] General Terms and Definitions
[0032] Unless otherwise defined below, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art. In the event of a conflict, the definitions provided herein shall prevail. The technology used herein refers to technology generally understood in the art, including variants and equivalent replacements apparent to those skilled in the art. Although it is believed that the following terms are readily understood by those skilled in the art, the following definitions are set forth to better illustrate the present invention. When a trade name appears herein, it refers to the corresponding commodity or its active ingredient. All patents, published patent applications, and publications cited herein are incorporated herein by reference.
[0033] When a certain amount, concentration or other numerical value or parameter is described in the form of a range, a preferred range or a preferred upper limit or a preferred lower limit, it should be understood as being equivalent to specifically disclosing any range formed by combining any upper limit or preferred value with any lower limit or preferred value, regardless of whether the range is explicitly stated. Unless otherwise stated, the numerical ranges listed herein are intended to include the endpoints of the range and all integers and fractions (decimals) within the range.
[0034] Unless the context clearly dictates otherwise, singular forms such as "a", "an", and "the" include plural forms. The expression "one or more" or "at least one" may mean 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.
[0035] The terms "about" and "approximately" when used with a numerical variable generally mean that the value of the variable and all values of the variable are within the range of experimental error (e.g., within a 95% confidence interval about the mean) or within ±10% or more of the stated value.
[0036] The expressions "comprising," "including," "containing," and "having" are open ended and do not exclude additional unrecited elements, steps, or ingredients. The expression "consisting of excludes any elements, steps, or ingredients not specified. The expression "consisting essentially of means that the scope is limited to the specified elements, steps, or ingredients, as well as the optional presence of elements, steps, or ingredients that do not materially affect the basic and novel characteristics of the claimed subject matter. It should be understood that the expression "comprising" encompasses the expressions "consisting essentially of" and "consisting of."
[0037] The term "alkyl" refers to a straight or branched chain saturated aliphatic hydrocarbon group consisting of carbon atoms and hydrogen atoms, which is connected to the rest of the molecule by a single bond. 1-20 Alkyl", such as C 1-6 Alkyl, C 1-4 Alkyl, C 1-2 Alkyl, C3 alkyl, C4 alkyl, C 3- 6 alkyl. "C 1-6 "Alkyl" is used to represent a straight or branched chain saturated hydrocarbon group consisting of 1 to 6 carbon atoms. 1-6 Alkyl groups include C 1-5 Alkyl, C 1-4 Alkyl, C 1-3 Alkyl, C 1-2 Alkyl, C 2-6 Alkyl, C 2-4 C6 alkyl, C5 alkyl, etc. Non-limiting examples of alkyl include, but are not limited to, methyl, ethyl, propyl, butyl, pentyl, hexyl, isopropyl, isobutyl, sec-butyl, tert-butyl, isopentyl, 2-methylbutyl, 1-methylbutyl, 1-ethylpropyl, 1,2-dimethylpropyl, neopentyl, 1,1-dimethylpropyl, 4-methylpentyl, 3-methylpentyl, 2-methylpentyl, 1-methylpentyl, 2-ethylbutyl, 1-ethylbutyl, 3,3-dimethylbutyl, 2,2-dimethylbutyl, 1,1-dimethylbutyl, 2,3-dimethylbutyl, 1,3-dimethylbutyl, or 1,2-dimethylbutyl, or isomers thereof.
[0038] The term "cycloalkyl" refers to a cyclic saturated aliphatic group composed of carbon atoms and hydrogen atoms, which is connected to the rest of the molecule by a single bond, including monocyclic, bicyclic or tricyclic ring systems, wherein bicyclic and tricyclic ring systems include spirocyclic, fused and bridged rings. Cycloalkyl can have 3-10 carbon atoms, i.e. "C 3- 10 "Cycloalkyl" refers to a divalent cycloalkyl radical, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl or cyclodecyl. "Cycloalkylene" refers to a divalent cycloalkyl radical.
[0039] The term "heterocyclyl" refers to a cycloalkyl group in which one or more carbon atoms are replaced by a heteroatom selected from nitrogen, oxygen, and sulfur, such as azepine, oxa-, or thiirane, azepine, oxa-, or thietanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, piperidinyl, piperazinyl, tetrahydropyranyl, or tetrahydrothiopyranyl. A heteroatom may occupy the position at which the heterocyclyl group is attached to the rest of the molecule. "Heterocyclylene" refers to a divalent cycloalkyl group.
[0040] The term "alkoxy" represents an alkyl group having a specific number of carbon atoms connected through an oxygen bridge. Non-limiting examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy. The term "C 1-6 "Alkoxy" means an alkyl group containing 1 to 6 carbon atoms attached to the rest of the molecule through an oxygen atom. The C 1-6 Alkoxy groups include C 1-4 、C 1-3 、C 1-2 、C 2-6 、C 2-4 , C6, C5, C4 and C3 alkoxy, etc. 1-6 Non-limiting examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (including n-propoxy and isopropoxy), butoxy (including n-butoxy, isobutoxy, s-butoxy and t-butoxy), pentoxy (including n-pentoxy, isopentoxy and neopentoxy), hexyloxy, and the like.
[0041] As used herein, the term "pharmaceutically acceptable salt" refers to a pharmaceutically acceptable organic or inorganic salt. Exemplary salts include, but are not limited to, sulfates, citrates, acetates, oxalates, chlorides, bromides, iodides, nitrates, bisulfates, phosphates, acid phosphates, isonicotinates, lactates, salicylates, acid citrates, tartrates, oleates, tannates, pantothenates, bitartrates, ascorbates, succinates, maleates, fumarates, gluconates, glucuronates, saccharates, formates, benzoates, glutamates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, and pamoates (i.e., 1-1-methylene-bis(2-hydroxy-3-naphthoate)). Suitable base salts include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, bismuth, and diethanolamine salts. Pharmaceutically acceptable salts are reviewed in Handbook of Pharmaceutical Salts: Properties, Selection, and Use (P. Heinrich Stahl and Camille G. Wermuth, ed., Wiley-VCH, 2002).
[0042] "Optional" or "optionally" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0043] The term "substituted" means that any one or more hydrogen atoms on a particular atom are replaced by a substituent, which may include deuterium and hydrogen variants, as long as the valence state of the particular atom is normal and the substituted compound is stable. When the substituent is oxygen (i.e., =O), it means that two hydrogen atoms are replaced. Oxygen substitution does not occur on aromatic groups. The term "optionally substituted" means that it may be substituted or not substituted, and unless otherwise specified, the type and number of substituents can be any on the basis of chemical achievable.
[0044] The compounds of the present invention may exist in specific geometric or stereoisomeric forms. The present invention contemplates all such compounds, including cis- and trans-isomers, (-)- and (+)-enantiomers, (R)- and (S)-enantiomers, diastereomers, (D)-isomers, (L)-isomers, and racemic mixtures and other mixtures thereof, such as enantiomerically or diastereomerically enriched mixtures, all of which are within the scope of the present invention. Additional asymmetric carbon atoms may be present in substituents such as alkyl groups. All such isomers and mixtures thereof are encompassed within the scope of the present invention.
[0045] Unless otherwise indicated, the term "enantiomer" or "optical isomer" refers to stereoisomers that are mirror images of one another.
[0046] Unless otherwise indicated, the term "cis-trans isomers" or "geometric isomers" arises from the inability to rotate freely about double bonds or single bonds forming ring carbon atoms.
[0047] Unless otherwise indicated, the term "diastereomer" refers to stereoisomers that have two or more chiral centers and that are not mirror images of each other.
[0048] Unless otherwise indicated, "(D)" or "(+)" indicates dextrorotatory, "(L)" or "(-)" indicates levorotatory, and "(DL)" or "(±)" indicates racemic.
[0049] Unless otherwise specified, use a solid wedge key. and dotted wedge key To indicate the absolute configuration of a stereocenter, use a straight solid bond and straight dashed key Indicate the relative configuration of stereocenters with a wavy line Indicates a wedge-shaped solid key or dotted wedge key Or use a wavy line Indicates a straight solid bond and straight dashed key
[0050] As used herein, the term "Annexin V / PI method" refers to a method for detecting cell apoptosis. In normal cells, phosphotidylserine (PS) is located on the inner side of the cell membrane, but in early apoptotic cells, PS flips from the inner side of the cell membrane to the surface of the cell membrane and is exposed to the extracellular environment. Annexin-V is a Ca2+-binding protein with a molecular weight of 35-36 kDa. 2+ Annexin-V is a phospholipid-dependent binding protein that binds to PS with high affinity. Using fluorescein (e.g., FITC, Alexa Fluor 488, etc.) labeled Annexin-V as a probe, flow cytometry or fluorescence microscopy can be used to detect the occurrence of cell apoptosis. Propidium iodide (PI) is a nucleic acid dye that cannot penetrate intact cell membranes. However, in cells in the middle and late stages of apoptosis and necrotic cells, PI can penetrate the cell membrane and stain the cell nucleus red. Therefore, the combination of Annexin-V and PI can detect early and late apoptotic cells in a cell population.
[0051] The present invention provides use of a compound in the preparation of a medicament for treating blood tumors, wherein the compound has the structure of the following formula (I):
[0052] or a pharmaceutically acceptable salt thereof,
[0053] in,
[0054] R 1 Selected from hydrogen, acyl, C 1-6 Alkyl, C 3-10 Heterocyclic group, C 3-10 Heterocyclyl-C 1-4 Alkyl, wherein each acyl, alkyl and heterocyclyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0055] R 2 Selected from amino, cyano, nitro, hydroxyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0056] R 3 Selected from hydrogen, amino, cyano, nitro, hydroxyl, acyl and C 1-6Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0057] R 4 Selected from hydrogen, amino, cyano, hydroxyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0058] R 5 Selected from hydrogen, halogen, amino, cyano, hydroxy, acyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted;
[0059] R X Selected from hydroxy, halogen, amino, C 1-6 Alkyl, C 1-6 Alkoxy, C 3-10 Cycloalkyl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 3-10 Heterocyclic group, C 3-10 Heterocyclyl-C 1-4 Alkyl and -OC 3-10 Heterocyclyl, wherein each amino, alkyl, alkoxy, cycloalkyl and heterocyclyl is unsubstituted or substituted by at least one independently selected from R Y Substituents substituted;
[0060] R Y Selected from hydroxyl, halogen, C 1-6 Alkyl and C 1-6 Alkoxy groups, wherein each alkyl group and alkoxy group, respectively, is unsubstituted or substituted with at least one hydroxy group.
[0061] In one embodiment, R 1 Selected from hydrogen, acyl and C 3-10 Heterocyclyl, wherein each acyl and heterocyclyl is unsubstituted or substituted by at least one independently selected R X In a specific embodiment, R 1 Selected from hydrogen, acetyl,
[0062] In a specific embodiment, R 2 It is a hydroxyl group.
[0063] In one embodiment, R 3 In a specific embodiment, R 3 It is a formyl group.
[0064] In one embodiment, R 4 C 1-6 In a specific embodiment, R 4 It is a methyl group.
[0065] In a specific embodiment, R 5 It is a hydroxyl group.
[0066] In one embodiment, R X Selected from hydroxy, halogen, amino, C 1-6 Alkyl, C 1-6 Alkoxy and -OC 3-10 In a specific embodiment, R X Selected from hydroxy, chlorine, amino, methyl, methoxy,
[0067] In one embodiment, R Y Selected from hydroxyl and C 1-6 alkyl, wherein each alkyl group is unsubstituted or substituted with at least one hydroxyl group. In a specific embodiment, R Y Selected from hydroxyl, methyl and
[0068] In a specific embodiment, the compound of formula (I) is selected from the following structures:
[0069] or a pharmaceutically acceptable salt thereof.
[0070] In a preferred embodiment, the compound of formula (I) is selected from:
[0071] In one embodiment, the compound having the structure of formula (I) or a pharmaceutically acceptable salt thereof has a 50% inhibitory concentration of about 500 nM or less against different blood tumor cell lines. In a specific embodiment, the compound having the structure of formula (I) or a pharmaceutically acceptable salt thereof has a 50% inhibitory concentration of about 500 nM or less against different leukemia cell lines.
[0072] In one embodiment, the compound having the structure of Formula (I) or a pharmaceutically acceptable salt thereof has a 50% inhibitory concentration of about 50 nM or less, preferably about 30 nM or less, against different blood tumor cell lines. In a specific embodiment, the 50% inhibitory concentration of compound 0449-0002 against different leukocyte cell lines is about 50 nM or less, preferably about 30 nM or less. For example, the 50% inhibitory concentration of compound 0449-0002 against U-937 cell line, THP-1 cell line, KG-1α cell line, Jurkat cell line (human T lymphocyte leukemia cell line) and HEL cell line (human erythroleukemia cell line) is about 23.7 nM, 7.2 nM, 23.3 nM, 20.5 nM and 16.3 nM, respectively.
[0073] In one embodiment, the hematological malignancy of the present invention is selected from the group consisting of leukemia, lymphoma, multiple myeloma, myelodysplastic syndrome, and myelofibrosis. In a specific embodiment, the hematological malignancy of the present invention is a leukemia. In a preferred embodiment, the leukemia of the present invention is selected from the group consisting of acute lymphoblastic leukemia and acute myeloid leukemia.
[0074] In one embodiment, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to the present invention has no significant effect on the expression of the NUP214 gene. In one embodiment, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to the present invention has a degradative effect on the protein expressed by the NUP214 gene or a fusion gene comprising the same.
[0075] Pharmaceutically acceptable salts of compounds of formula (I)
[0076] Those skilled in the art will appreciate that the compound of formula (I) can exist in the form of a pharmaceutically acceptable salt. As a pharmaceutically acceptable salt, for example, the following example can be provided: metal salt, ammonium salt, the salt formed with an organic base, inorganic acid, organic acid, alkaline or acidic amino acid etc. The pharmaceutically acceptable salt of the compound of formula (I) of the present invention can be prepared by conventional chemical methods by a compound containing an acidic or basic group. Usually, the compound of the free acid or base form can be prepared with the reaction of a stoichiometrically suitable base or acid in water, an organic solvent or its mixture. Usually, preferred non-aqueous media are such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile etc.
[0077] Administration, pharmaceutical compositions and kits
[0078] The compound of formula (I) of the present invention will be administered alone or in combination with an additional therapeutic agent in an effective amount by any common and acceptable means known in the art. An effective amount can vary according to the severity of the disease, the age and relative health of the experimenter, the efficacy of the compound used, and other factors known to those skilled in the art.
[0079] As a general example, a daily dosage of about 0.001 to about 100 mg / kg body weight can be used, or more particularly about 0.03 to 2.5 mg / kg body weight. In larger mammals, such as humans, the daily dosage can be in the range of about 0.5 mg to about 2000 mg.
[0080] The compounds of formula (I) of the present invention are typically administered in the form of a pharmaceutical composition comprising a pharmaceutically active ingredient and various other pharmaceutically acceptable components, for example, see Remington's Pharmaceutical Science (15th ed., Mack Publishing Company, Easton, Pa., 1980). The preferred or desired form depends on the intended mode of administration and therapeutic application. Depending on the desired formulation, the composition may also include a pharmaceutically acceptable non-toxic carrier or diluent, which is defined as a carrier commonly used to formulate a pharmaceutical composition for administration to animals or humans. The choice of diluent does not affect the biological activity of the combination. Examples of diluents include, but are not limited to, distilled water, physiological phosphate-buffered saline, Ringer's solution, glucose solution, and Hank's solution. In addition, the pharmaceutical composition or formulation may also include other carriers, adjuvants, or non-toxic, non-therapeutic, non-immunogenic stabilizers, etc.
[0081] The compounds of formula (I) of the present invention can be administered in the form of pharmaceutical compositions by any conventional route; for example, enterally, such as orally, for example in the form of tablets or capsules; parenterally, for example in the form of injectable solutions or suspensions; or topically, for example, via the eyes or nasal cavity, for example in the form of emulsions, gels, ointments, creams or suppositories.
[0082] Therefore, the compound of formula (I) of the present invention can also exist in the form of a pharmaceutical composition, which comprises the compound of formula (I) of the present invention or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable carrier. The compound of formula (I) of the present invention can exist in the form of a free form or a pharmaceutically acceptable salt combined with at least one pharmaceutically acceptable carrier, and can be prepared in a conventional manner, for example, by mixing, granulating, coating, dissolving or lyophilizing processes.
[0083] In one embodiment, the pharmaceutical composition is a solution of the active ingredient, including a suspension or dispersion, such as an isotonic aqueous solution. For a lyophilized composition comprising only the active ingredient or comprising the active ingredient and a carrier (such as mannitol), a dispersion or suspension can be prepared before use.
[0084] The limiting examples of carriers include fillers, such as sugars, such as lactose, sucrose, mannitol or sorbitol, cellulose preparations and / or calcium phosphates, such as tricalcium phosphate or calcium hydrogen phosphate, and binders, such as starches, such as corn, wheat, rice or potato starch, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose and / or polyvinyl pyrrolidone, and / or if necessary, disintegrants, such as the above-mentioned starches, carboxymethyl starch, cross-linked polyvinyl pyrrolidones, alginic acid or its salts, such as sodium alginate. Other carriers include, but are not limited to, rheology modifiers and lubricants, such as silicic acid, talc, stearic acid or its salts, such as magnesium or calcium stearate, and / or polyethylene glycol or its derivatives.
[0085] The compounds of formula (I) of the present invention may also be present in the form of a pharmaceutical combination, such as a kit comprising a) a first agent, which is a compound of the structure of formula (I) of the present invention or a pharmaceutically acceptable salt thereof, and b) at least one additional agent. The kit may further comprise instructions for administration thereof. The kit may be used for the purposes or methods described herein.
[0086] Methods of treatment and uses of compounds of formula (I)
[0087] The present invention provides a method for treating, improving or preventing blood tumors, comprising administering a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt or pharmaceutical composition thereof to a subject in need.
[0088] The present invention also provides a compound of formula (I) or a pharmaceutically acceptable salt or pharmaceutical composition thereof for treating, improving or preventing blood tumors.
[0089] The present invention also provides use of the compound of formula (I) or a pharmaceutically acceptable salt or pharmaceutical composition thereof in the preparation of a drug for treating, improving or preventing blood tumors.
[0090] In one embodiment, the hematological tumor includes, but is not limited to, leukemia, lymphoma, multiple myeloma, myelodysplastic syndrome, and myelofibrosis. In a preferred embodiment, the hematological tumor is leukemia. Beneficial effects
[0091] The present invention provides the use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating hematological tumors. The compound of formula (I) or a pharmaceutically acceptable salt thereof has a favorable inhibitory effect on hematological tumor cells, particularly a favorable therapeutic effect on leukemia. Furthermore, the compound having the structure of formula (I) or a pharmaceutically acceptable salt thereof according to the present invention also degrades proteins expressed by the NUP214 gene or a fusion gene containing the same, thereby inhibiting the development of leukemia within the endosome.
[0092] Example
[0093] The solution of the present invention is further described in detail below with reference to specific embodiments.
[0094] It should be noted that the following examples are merely examples for clearly illustrating the technical solutions of the present invention, and are not intended to limit the present invention. For those skilled in the art, other variations or modifications may be made based on the description of the present invention. It is not necessary and is not possible to exhaustively enumerate all embodiments herein, and the obvious variations or modifications derived therefrom are still within the scope of protection of the present invention. Unless otherwise indicated, the instruments, equipment, and reagents used herein are all commercially available.
[0095] Experimental materials and sources:
[0096] Other reagents used in the experiments of this embodiment were commercially available analytical grade reagents.
[0097] Example 1: Effects of Compound 0449-0002 and Its Analogs on Leukemia Cell Proliferation
[0098] 1.1 Experimental methods
[0099] The leukemia cell lines selected were: U-937 (human histiocytic lymphoma cell line), THP-1 (human monocytic leukemia cell line), KG-1α (human acute myeloid leukemia cell line), Jurkat (human T lymphocytic leukemia cell line) and HEL (human erythroleukemia cell line).
[0100] Culture system: IMDM medium or RPMI medium + 20% fetal bovine serum + 1% double antibody, culture in an incubator (37°C, 5% CO2).
[0101] The leukemia cells were seeded into 48-well plates (200,000 cells per well). The experimental group was treated with different concentrations of compound 0449-0002 (10nM, 20nM, 50nM, 100nM, 200nM, 500nM, and 5000nM). The control group was treated with 0.1% DMSO and cultured in the above culture system for 48 hours. The inhibition rate of compound 0449-0002 on cell proliferation was then calculated by cell counting, and the half-maximal inhibitory concentration (IC) of compound 0449-0002 was calculated using Graphpad Prism software. 50 , the results are shown in Table 1 below.
[0102] Table 1 Inhibitory effect of compound 0449-0002 on different leukemia cell lines
[0103] Furthermore, leukemia cell lines THP-1 and KG-1α cells were selected, and the IC values of compounds 0449-0129, 0407-0016, 0449-0044, 0449-0054, 0449-0112, 0449-0122, 0449-0124, 0449-0127, 0449-0160, and N008-0011 were measured using the half-maximal inhibitory concentration method of compound 0449-0002. 50 The results are shown in Table 2 below.
[0104] Table 2 Inhibitory effects of different compounds on THP-1 cells and KG-1α cells
[0105] 1.2 Experimental Results Analysis
[0106] As shown in Table 1, the half-maximal inhibitory concentration of compound 0449-0002 against the five tested leukemia cell lines was less than 50 nM, indicating that it has a high efficiency in inhibiting the proliferation of various leukemia cells.
[0107] As shown in Table 2, the half-maximal inhibitory concentrations of compound 0449-0129, compound 0407-0016, compound 0449-0044, compound 0449-0054, compound 0449-0112, compound 0449-0122, compound 0449-0124, compound 0449-0127, compound 0449-0160 and compound N008-0011 against the leukemia cell lines THP-1 and KG-1α were all less than 500 nM, showing the effect of inhibiting the proliferation of THP-1 and KG-1α leukemia cells.
[0108] Example 2: Effect of Compound 0449-0002 on Leukemia Cell Death
[0109] 2.1 Experimental methods
[0110] Leukemia cell line THP-1 cells were selected, and RPMI medium + 20% fetal bovine serum + 1% double antibody was used as the culture system and cultured in an incubator (37°C, 5% CO2). The THP-1 cell line was inoculated into a 24-well plate, with 500,000 cells seeded per well. The experimental group was treated with 50nM and 100nM of compound 0449-0002, respectively, and the control group was treated with 0.1% DMSO. The cells were cultured in the above culture system and collected after 24 hours. Annexin V-FITC and PI staining were used (100μL staining system was prepared using Binding buffer, 1μL Annexin V-FITC and 1μL PI were added), and cell death was analyzed on a flow cytometer after 30 minutes of staining.
[0111] 2.2 Experimental Results
[0112] As shown in Figure 1A, both Annexin V and PI positive results indicate cell death. Compound 0449-0002 at a concentration of 50 nM increased the THP-1 cell death rate to approximately 16%, and at a concentration of 100 nM, increased the THP-1 cell death rate to approximately 26%. As shown in Figure 1B, treatment with compound 0449-0002 at both 50 nM and 100 nM concentrations significantly increased the THP-1 cell death rate after 24 hours compared to the control group (p<0.0001).
[0113] Example 3: Effect of Compound 0449-0002 on the Development of Leukemia
[0114] To explore the effect of 0449-0002 in intervening in the development of leukemia in vivo, the following experiments were performed.
[0115] 3.1.1 Effect of compound 0449-0002 on the survival of model mice
[0116] Leukemia cell lines KG-1α, THP-1, and U-937 were transplanted into NOD.Cg-Prkdc scid Il2rg em1Smoc Immunodeficient (NSG) mice were transplanted with 2×10 6 Xenograft models were constructed using 100 cells per 100 μg / mL xenograft. Two weeks after transplantation, mice were divided into two groups. The control group was injected with PBS (containing 0.1% DMSO), while the experimental group was injected with compound 0449-0002 (0.5 mg / kg) for 5 consecutive days, followed by a 2-day interval and another 5 consecutive days. The survival status of the mice was then recorded.
[0117] 3.1.2 Effect of compound 0449-0002 on the human CD45-positive cell population in the spleen or bone marrow of KG-1α transplanted mice
[0118] Some mice in the KG-1α transplantation model were selected and sacrificed 2 weeks after the injection of compound 0449-0002. The spleen and bone marrow were obtained, and the proportion of human CD45 cells in the bone marrow and spleen was analyzed by flow cytometry.
[0119] Specific steps: Collect 3×10 6 Resuspend each bone marrow or spleen cell in 300 μL of red blood cell lysis buffer. After lysis for 10 minutes, resuspend the cells in 100 μL of PBS and add 0.5 μL of anti-human CD45-PE antibody. Mix well and stain for 15 minutes. Then analyze the PE-positive cell population using a flow cytometer.
[0120] 3.1.3 Effects of compound 0449-0002 on leukemia cells in the liver of model mice
[0121] Some mice of the KG-1α transplant model were selected and killed 2 weeks after the injection of compound 0449-0002. The livers were removed and commissioned to Biostime Pathology Company for sectioning and HE staining.
[0122] 3.2 Experimental Results
[0123] As shown in Figures 2A-C, injection of compound 0449-0002 significantly prolonged the survival of xenograft mice. As shown in Figure 2A, in a xenograft model established with KG-1α cells, the median survival of control mice was 58 days, while injection of compound 0449-0002 increased the median survival to 98 days. As shown in Figure 2B, in a xenograft model established with THP-1 cells, the median survival of control mice was 58 days, while injection of compound 0449-0002 increased the median survival to 85 days. As shown in Figure 2C, in a xenograft model established with U-937 cells, the median survival of control mice was 52 days, while injection of compound 0449-0002 increased the median survival to 98 days.
[0124] As shown in Figures 2D and 2E, in the xenograft model constructed by KG-1α cell transplantation, the results of flow cytometer analysis showed that the human CD45-positive cell population was significantly reduced in the bone marrow and spleen of mice treated with compound 0449-0002.
[0125] As shown in Figure 2F, in a xenograft model established by KG-1α cell transplantation, HE staining of liver sections revealed a significant reduction in leukemia cell infiltration (dark cells indicated by black arrows) in the livers of mice treated with compound 0449-0002. These results demonstrate that compound 0449-0002 effectively inhibits leukemia progression in vivo.
[0126] Example 4: Effect of Compound 0449-0002 on NUP214 Protein Degradation
[0127] 4.1.1 Targeting study of compound 0449-0002 on NUP214 protein
[0128] THP-1 cells were seeded in 6-well plates and treated with various concentrations of compound 0449-0002 (10 nM, 50 nM, 100 nM, 500 nM, 1 μM, 2.5 μM, and 5 μM) for 12 hours. Total protein was then extracted, and Western blot analysis was performed to determine the expression of NUP214 protein and the internal control protein Tubulin. The main steps are as follows:
[0129] 1. Lysis of cell samples: Lyse cells using RIPA lysis buffer (radioimmunoprecipitation lysis buffer) and heat in boiling water for 5 minutes. Determine protein concentration using a BCA protein quantification kit.
[0130] 2. Sample electrophoresis: After adding 5× loading buffer to the sample, spot the sample and run it at 60V for 30 minutes, then at 110V for 90 minutes.
[0131] 3. Transfer: Transfer the sample in the gel to a PVDF membrane (polyvinylidene fluoride membrane, 200 mA, 2 hours) under electric field conditions.
[0132] 4. Blocking: After transfer, wash away the transfer solution and block with 5% skim milk powder for 1 hour;
[0133] 5. Primary antibody incubation: Aspirate the blocking solution, add primary antibody and incubate overnight at 4°C;
[0134] 6. Secondary antibody incubation: After washing the membrane, add secondary antibody and incubate at room temperature for 1 hour;
[0135] 7. Protein detection: After washing the membrane, add developer, expose and take pictures.
[0136] 4.1.2 Effect of compound 0449-000 on NUP214 gene transcription
[0137] THP-1 cells were seeded in 6-well plates and treated with different concentrations of compound 0449-0002 (50 nM, 100 nM) for 24 hours. RNA was then extracted and reverse transcribed, and the expression of the target gene was analyzed by fluorescence quantitative PCR (Actin was used as an internal reference). The quantitative primer sequences are as follows:
[0138] hNUP214-qPCR-F: AGTTTGTCTGGCTGATGGTAG (SEQ ID.NO:1)
[0139] hNup214-qPCR-R:CATTCTGTTTTCCCACTGCC (SEQ ID.NO:2)
[0140] hβ-Actin-F:ACCTTCTACAATGAGCTGCG (SEQ ID.NO:3)
[0141] hβ-Actin-R: CCTGGATAGCAACGTACATGG (SEQ ID.NO:4)
[0142] 4.1.3 Effect of Compound 0449-0002 on NUP214 Protein Degradation
[0143] The pCMV-hNUP214-EGFP expression plasmid was constructed to express the NUP214-EGFP fusion protein. 293T cells were inoculated and, 24 hours later, transfected with the plasmid using Lipo8000. 48 hours after transfection, the cells were treated with various concentrations of compound 0449-0002 (20 nM, 50 nM, and 100 nM) for 12 hours. The 293T cells were then harvested and analyzed for EGFP fluorescence intensity using flow cytometry. A map of the pCMV-hNUP214-EGFP plasmid is shown in Figure 4.
[0144] 4.2 Experimental Results
[0145] As shown in Figure 3A, Western blot results showed that compound 0449-0002 promoted the reduction of NUP214 protein in THP-1 cells, and the decrease was in a concentration gradient.
[0146] As shown in Figure 3B, Image J software was used to analyze the grayscale values of protein bands. Tubulin protein was used as an internal reference, and the half-maximal degradation concentration of compound 0449-0002 that caused a decrease in NUP214 protein was calculated to be 83 nM.
[0147] As shown in Figure 3C , the results of quantitative PCR showed that there was no significant difference in the expression level of NUP214 mRNA in the control sample and that treated with compound 0449-0002, indicating that the addition of compound 0449-0002 did not affect NUP214 gene transcription, indicating that this small molecule directly promoted the degradation of NUP214 protein.
[0148] As shown in Figure 3E, flow cytometric analysis of EGFP fluorescence revealed that compound 0449-0002 reduced EGFP fluorescence in 293T cells, with this decrease occurring over a concentration-dependent manner. EGFP is expressed as a fusion protein with NUP214. Therefore, the decrease in EGFP fluorescence indicates a decrease in EGFP protein, which in turn reflects a decrease in NUP214-EGFP protein. This further demonstrates that compound 0449-0002 is a NUP214 inhibitor, inducing its degradation.
Claims
1. Use of the compound in the preparation of a medicament for treating blood tumors, The compound has the structure of the following formula (I): or a pharmaceutically acceptable salt thereof, in, R 1 Selected from hydrogen, acyl, C 1-6 Alkyl, C 3-10 Heterocyclic group, C 3-10 Heterocyclyl-C 1-4 Alkyl, wherein each acyl, alkyl and heterocyclyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted; R 2 Selected from amino, cyano, nitro, hydroxyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted; R 3 Selected from hydrogen, amino, cyano, nitro, hydroxyl, acyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted; R 4 Selected from hydrogen, amino, cyano, hydroxyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted; R 5 Selected from hydrogen, halogen, amino, cyano, hydroxy, acyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one independently selected from R X Substituents substituted; R X Selected from hydroxy, halogen, amino, C 1-6 Alkyl, C 1-6 Alkoxy, C 3-10 Cycloalkyl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 3-10 Heterocyclic group, C 3-10 Heterocyclyl-C 1-4 Alkyl and -OC 3-10 Heterocyclyl, wherein each amino, alkyl, alkoxy, cycloalkyl and heterocyclyl is unsubstituted or substituted by at least one independently selected from R Y Substituents substituted; R Y Selected from hydroxyl, halogen, C 1-6 Alkyl and C 1-6 Alkoxy groups, wherein each alkyl group and alkoxy group, respectively, is unsubstituted or substituted with at least one hydroxy group.
2. The use according to claim 1, wherein The R 1 Selected from hydrogen, acyl and C 3-10 Heterocyclyl, wherein each acyl and heterocyclyl is unsubstituted or substituted by at least one independently selected R X substituted by a substituent.
3. The use according to claim 2, wherein The R 1 Selected from hydrogen, acetyl, 4. The use according to claim 1, wherein The R 2 It is a hydroxyl group.
5. The use according to claim 1, wherein The R 3 is an acyl group, preferably a formyl group.
6. The use according to claim 1, wherein The R 4 C 1-6 Alkyl, preferably methyl.
7. The use according to claim 1, wherein The R 5 It is a hydroxyl group.
8. The use according to claim 1, wherein The R X Selected from hydroxy, halogen, amino, C 1-6 Alkyl, C 1-6 Alkoxy and -OC 3-10 Heterocyclic groups, preferably hydroxy, chlorine, amino, methyl, methoxy, 9. The use according to claim 1, wherein The R Y Selected from hydroxyl and C 1-6 Alkyl, wherein each alkyl is unsubstituted or substituted by at least one hydroxyl group, preferably hydroxyl, methyl and 10. The use according to claim 1, wherein The compound is selected from the following structures: or a pharmaceutically acceptable salt thereof.
11. The use according to claim 1, wherein The blood tumor is selected from leukemia, lymphoma, multiple myeloma, myelodysplastic syndrome and myelofibrosis, preferably leukemia.