Engineered immune cells and methods of using the same

Abstract

Provided herein are engineered immune cells and methods of using the same. In embodiments, engineered immune cells bind mesothelin or other protein differentially expressed in cancer. In embodiments, the methods include methods of treating cancer.

Description

[0001] ENGINEERED IMMUNE CELLS AND METHODS OF USING THE SAME

[0002] RELATED APPLICATIONS

[0003] This application claims the benefit of the earlier filing date of 63 / 566,000, filed March 15, 2024, which is incorporated by reference in its entirety.

[0004] FIELD

[0005] The disclosure provided herein is related to engineered immune cells and methods of using the same, such as in treating cancer.

[0006] BACKGROUND

[0007] Mesothelin and other proteins differentially expressed on cancer cells is differentially expressed in a variety of tumors and cancers. However, gaps in therapeutic efficacy remain for previous mesothelin-directed therapies and therapies directed to other proteins differentially expressed on cancer cells (see, e.g., Faust et al., Mesothelin: An Immunotherapeutic Target beyond Solid Tumors, Cancers (Basel), 14(6): 1550 (2022)). Therefore, more effective mesothelin-directed therapies are desirable therapies directed to other proteins differentially expressed on cancer cells.

[0008] SUMMARY

[0009] Provided herein are engineered cells, comprising a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:

[0010] A - B - 1 - C (Formula I), wherein:

[0011] A is a mesothelin antibody means for binding a target antigen;

[0012] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;

[0013] I is interleukin 12 (IL- 12); and

[0014] C is a collagen binding domain.

[0015] Provided herein are engineered cells, comprising a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:

[0016] A - B - 1 (Formula II), wherein:

[0017] A is a mesothelin antibody means for binding a target antigen; B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; and I is interleukin 12 (IL- 12).

[0018] Provided herein are engineered cells, comprising a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:

[0019] A - B - 1 - C (Formula III), wherein:

[0020] A is an antibody or fragment thereof for binding a target antigen;

[0021] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;

[0022] I is interleukin 12 (IL- 12); and

[0023] C is a collagen binding domain.

[0024] Provided herein are engineered cells, comprising a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:

[0025] A - B - 1 (Formula IV), wherein:

[0026] A is an antibody or fragment thereof for binding a target antigen;

[0027] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; and

[0028] I is interleukin 12 (IL- 12).

[0029] Provided herein are nucleic acids encoding chimeric antigen receptors (CARs) of the formula:

[0030] A - B - 1 - C (Formula I), wherein:

[0031] A is a mesothelin antibody means for binding a target antigen;

[0032] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;

[0033] I is interleukin 12 (IL- 12); and

[0034] C is a collagen binding domain. Provided herein are nucleic acids encoding chimeric antigen receptors (CARs) of the formula:

[0035] A - B - 1 (Formula II), wherein:

[0036] A is a mesothelin antibody means for binding a target antigen;

[0037] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; and

[0038] I is interleukin 12 (IL- 12).

[0039] Provided herein are nucleic acids encoding chimeric antigen receptors (CARs) of the formula:

[0040] A - B - 1 - C (Formula III), wherein:

[0041] A is an antibody or fragment thereof for binding a target antigen;

[0042] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;

[0043] I is interleukin 12 (IL- 12); and

[0044] C is a collagen binding domain.

[0045] Provided herein are nucleic acids encoding chimeric antigen receptors (CARs) of the formula:

[0046] A - B - 1 (Formula IV), wherein:

[0047] A is an antibody or fragment thereof for binding a target antigen;

[0048] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; and

[0049] I is interleukin 12 (IL- 12).

[0050] Provided herein are vectors encoding the chimeric antigen receptors (CARs) provided herein.

[0051] Provided herein are pharmaceutical compositions comprising an engineered cell provided herein of any one of claims 1-30, and a pharmaceutically acceptable carrier. Provided herein are pharmaceutical compositions comprising an engineered cell provided herein, and one or more pharmaceutically acceptable carriers, diluents, or excipients.

[0052] Provided herein are methods of treating cancer, comprising administering to a subject with cancer: an engineered cell provided herein, or a pharmaceutical composition provided herein.

[0053] Provided herein are uses of a composition for treating cancer, comprising administering to a subject with cancer: an engineered cell provided herein, or a pharmaceutical composition provided herein.

[0054] Provided herein are compositions for use in treating cancer, comprising administering to a subject with cancer: an engineered cell provided herein, or a pharmaceutical composition provided herein.

[0055] SEQUENCE LISTING

[0056] The instant application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated by reference in its entirety. Said XML copy, created on March 14, 2025, is named ENGINEERED IMMUNE CELLS AND METHODS OF USING THE SAME and is 61 kilobytes in size.

[0057] SEQ ID NO: 1 is an amino acid sequence of an LCDR1 embodiment.

[0058] SEQ ID NO: 2 is an amino acid sequence of an LCDR2 embodiment.

[0059] SEQ ID NO: 3 is an amino acid sequence of an LCDR3 embodiment.

[0060] SEQ ID NO: 4 is an amino acid sequence of an LC embodiment.

[0061] SEQ ID NO: 5 is a nucleic acid sequence of an LC embodiment.

[0062] SEQ ID NO: 6 is an amino acid sequence of a linker embodiment.

[0063] SEQ ID NO: 7 is a nucleic acid sequence of a linker embodiment.

[0064] SEQ ID NO: 8 is an amino acid sequence of an HCDR1 embodiment.

[0065] SEQ ID NO: 9 is an amino acid sequence of an HCDR2 embodiment.

[0066] SEQ ID NO: 10 is an amino acid sequence of an HCDR3 embodiment.

[0067] SEQ ID NO: 11 is an amino acid sequence of an HC embodiment.

[0068] SEQ ID NO: 12 is a nucleic acid sequence of an HC embodiment.

[0069] SEQ ID NO: 13 is an amino acid sequence of a CD8 hinge embodiment.

[0070] SEQ ID NO: 14 is a nucleic acid sequence of a CD8 hinge embodiment.

[0071] SEQ ID NO: 15 is an amino acid sequence of a CD8 transmembrane domain embodiment.

[0072] SEQ ID NO: 16 is a nucleic acid sequence of a CD8 transmembrane domain embodiment. SEQ ID NO: 17 is an amino acid sequence of a 4-1BB cytoplasmic domain embodiment.

[0073] SEQ ID NO: 18 is a nucleic acid sequence of a 4- IBB cytoplasmic domain embodiment.

[0074] SEQ ID NO: 19 is an amino acid sequence of a CD3 cytoplasmic domain embodiment.

[0075] SEQ ID NO: 20 is a nucleic acid sequence of a CD3 cytoplasmic domain embodiment.

[0076] SEQ ID NO: 21 is an amino acid sequence of a P2A embodiment.

[0077] SEQ ID NO: 22 is a nucleic acid sequence of a P2A embodiment.

[0078] SEQ ID NO: 23 is an amino acid sequence of an IL-12 signal peptide embodiment.

[0079] SEQ ID NO: 24 is a nucleic acid sequence of an IL-12 signal peptide embodiment.

[0080] SEQ ID NO: 25 is an amino acid sequence of an IL-12 P40 subunit embodiment.

[0081] SEQ ID NO: 26 is a nucleic acid sequence of an IL-12 P40 subunit embodiment.

[0082] SEQ ID NO: 27 is an amino acid sequence of an elastin linker embodiment.

[0083] SEQ ID NO: 28 is a nucleic acid sequence of an elastin linker embodiment.

[0084] SEQ ID NO: 29 is an amino acid sequence of an IL-12 P35 subunit embodiment.

[0085] SEQ ID NO: 30 is a nucleic acid sequence of an IL-12 P35 subunit embodiment.

[0086] SEQ ID NO: 31 is an amino acid sequence of a GS linker embodiment.

[0087] SEQ ID NO: 32 is a nucleic acid sequence of a GS linker embodiment.

[0088] SEQ ID NO: 33 is an amino acid sequence of a collagen binding domain embodiment.

[0089] SEQ ID NO: 34 is a nucleic acid sequence of a collagen binding domain embodiment.

[0090] SEQ ID NO: 35 is an amino acid sequence of an IL-12 subunit embodiment.

[0091] SEQ ID NO: 36 is a nucleic acid sequence of an IL-12 subunit embodiment.

[0092] SEQ ID NO: 37 is a nucleic acid sequence of vector and pHIV-aMeso-CAR-IL-12-CBD- CBD-A embodiment.

[0093] SEQ ID NO: 38 is a nucleic acid sequence of a vector and pHIV-aMeso-CAR-CBD-IL-12- MC embodiment.

[0094] SEQ ID NO: 39 is an amino acid sequence of a GS linker embodiment.

[0095] BRIEF DESCRIPTION OF THE DRAWINGS

[0096] FIG. 1 shows an embodiment in which the secretome of CAR NK cells was compared with the secretome of CAR T cells.

[0097] FIGS. 2A-2F show an embodiment in which (FIG. 2A) CAR expression was assessed by HA-tag staining, and (FIG. 2B) IL 12 secretion was assessed from untransduced, MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 CIML NK cells using ELISA. (FIGS. 2C-2E) Collagen binding activity was assessed for IL12-A3 using a microfluidic device containing a 3- dimensional collagen gel and transduced CIML NK cells loaded into the side-channel. (FIG. 2F) Expression was assessed for key activation, inhibitory, and cytotoxic / killer ligands in untransduced, MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 CIML NK cells, as measured by flow cytometry and represented as percentage positive cells in the heat map.

[0098] FIGS. 3A-3D show an embodiment in which IL12-engineered MSLN-CAR CIML NK cells were characterized. The oxygen consumption rate (OCR; FIGS. 3A, 3C) and extracellular acidification rate (ECAR; FIGS. 3B, 3D) were evaluated in real time.

[0099] FIGS. 4A-4C show an embodiment in which IL12-engineering of MSLN-CAR CIML NK cells dramatically enhanced the anti-tumor response. (FIG. 4A) Cytotoxicity was assessed (as measured by CCK8 assay) for 0VCAR8, SK0V3, AsPCl, and Capan2 cell lines after 24-hour coculture with untransduced (top down triangle), MSLN-CAR (top up trangle), MSLN-CAR-IL12 (circle), and MSLN-CAR-IL12-A3 (square) CIML NK cells. (FIGS. 4B-4C) IFNg secretion was measured by ELISA from the untransduced, MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR- IL12-A3 CIML NK cells after a 24-hour co-culture with the cancer cell lines.

[0100] FIG. 5 shows an embodiment in which IL12-engineering of MSLN-CAR CIML NK cells dramatically enhanced the anti-tumor response. Apoptotic cell populations were assessed (double positive Apotracker and Live / dead staining gated on EpCAM+cells) after a 24-hour co-culture of 3 different patient centric models, including patient-derived organoids (top) and patient-derived xenograft cells (bottom) with untransduced (tip down triangle), MSLN-CAR (tip up triangle), MSLN-CAR-IL12 (circle), and MSLN-CAR-IL12-A3 (hexagon) CIML NK cells.

[0101] FIGS. 6A-6B show an embodiment in which a long-term re-challenge experiment assessed NK cell-mediated cytotoxicity against cancer cell lines 0VCAR8 and AsPCl at E:T ratio of 1 : 1. Changes in tumor cell viability across 3 successive challenges over 12 days for untransduced (tip down triangle), MSLN-CAR (tip up triangle), MSLN-CAR-IL12 (circle), and MSLN-CAR-IL12-A3 (hexagon) NK cells.

[0102] FIGS. 7A-7C show an embodiment in which (FIGS. 7A-7B) expression of key cytolytic mediators was assessed in IL12-engineered NK cells, including CD107a+, IFNg+, Granzyme B (GrB), Perforin (PRE) and TNFa NK cells after 24-hour incubation with cancer cells; 0VCAR8 or AsPCl; and (FIG. 7C) expression was assessed for key NK cell receptors in MSLN-CAR-IL12 and MSLN-CAR-IL12-A3 CIML NK cells compared to MSLN-CAR NK cells post 24-hour co-culture with tumor cells (0VCAR8). FIGS. 8A-8D show an embodiment in which transactivation was assessed for bystander NK (By-NK) cells by IL12-engineered CAR CIML NK cells. (FIGS. 8A-8B) Percentage of CD107a+and IFNg+was assessed among the CTV+By-NK cells co-cultured with MSLN-CAR, MSLN-CAR- IL12, and MSLN-CAR-IL12-A3 followed by their exposure to 0VCAR8 and AsPCl cells. (FIGS. 8C-8D) Proliferation was assessed for By-NK cells as measured by the CTV dilution after 48-hour co-culture with MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 cells.

[0103] FIGS. 9A-9D show an embodiment in which transactivation was assessed for bystander T (By-T) cells by IL12-engineered CAR CIML NK cells. Percentage of CD107a+and IFNg+among the CTV+By-T cells gated on CD4+T cells and CD8+T cells co-cultured with MSLN-CAR, MSLN- CAR-IL12, and MSLN-CAR-IL12-A3 followed by their exposure to 0VCAR8 and AsPCl cells.

[0104] FIGS. 10A-10B show an embodiment in which transactivation was assessed for bystander T (By-T) cells by IL12-engineered CAR CIML NK cells. Percentage of CD107a+and IFNg+among the CTV+By-T cells gated on CD4+T cells and CD8+T cells co-cultured with MSLN-CAR, MSLN- CAR-IL12, and MSLN-CAR-IL12-A3 followed by their exposure to 0VCAR8 and AsPCl cells.

[0105] FIG. 11 shows an embodiment in which transactivation was assessed for tumor-associated immune cells by IL12-engineered CAR CIML NK cells. Representative histograms are shown for DNAM1, NKp30, NKG2D, CD25 and CD69 in tumor associated NK (TA-NK) cells (gated on CTV CD45+CD3 CD56+cells).

[0106] FIGS. 12A-12B show an embodiment in which transactivation was assessed for tumor- associated immune cells by IL12-engineered CAR CIML NK cells. Representative histograms are shown for key surface receptors CD25, CD69, LAG3, Tim3, CTLA4 and PD1 in tumor associated T (TA-T) cells (gated on CD45 CD3 cells). Data is represented as Mean ± SD.

[0107] FIGS. 13A-13B show an embodiment in which therapeutic efficacy was assessed for IL12- engineered MSLN-CAR CIML NK cells in an ovarian cancer xenograft model. (FIG. 13A) Tumor growth was assessed in an 0VCAR8 model measured by total flux (BLI) over a period of 40 days, and survival was assessed for (FIG. 13B) mice receiving PBS (bottom line), MSLN-CAR (second from bottom line), MSLN-CAR-IL12 (second to top line) or MSLN-CAR-IL12-A3 (top line) CIML NK cell treatment (n=8 or 9 mice per group). The arrow indicates the day of NK cell injection.

[0108] FIGS. 14A-14B show an embodiment in which therapeutic efficacy was assessed for IL12- engineered MSLN-CAR CIML NK cells in an ovarian cancer xenograft model. (FIG. 14A) IL12 levels were assessed in peripheral blood (serum) on 7-day after NK cell injections (n=4 mice per group). (FIG. 14B) The percentage of human NK cells (gated on mCD45‘ hCD45+) from various organs was assessed after 2 weeks of NK cells injections (n=4-5 mice per group).

[0109] DETAILED DESCRIPTION

[0110] Terms

[0111] The engineered cells and pharmaceutical compositions provided herein can be administered to subjects or patients. Herein, “administration” refers to the act of the attending physician or caregiver, prescribing the agent for administration and thereby causing the application of an agent to a subject, through ingestion, infusion, injection, or any other means, whether self-administered or administered by a clinician or other qualified caregiver. Herein, a “subject” includes both human patients and veterinary subjects, including human and non-human mammals. In embodiments, the subject or patient has or has a risk of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis.

[0112] Used herein, an "antibody" or fragment thereof is an immunoglobulin molecule (or fragment thereof) comprising two heavy chains (HCs) and two light chains (LCs) interconnected by disulfide bonds. The amino terminal portion of each LC and HC includes a variable region of about 100-120 amino acids primarily responsible for antigen recognition via the complementary determining region (CDRs) contained therein. The CDRs are interspersed with regions that are well-known and generally conserved among and between species (e.g., mouse and human), which are termed framework regions (FRs). In embodiments, the CDRs are interspersed with FRs. Antibodies disclosed herein have four FRs, termed FR1, FR2, FR3, and FR4. In embodiments, the FRs are human FRs (e.g., Antibody Engineering: Methods and Protocols (Damien Nevoltris and Patrick Chames eds., 3d ed. 2018)).

[0113] The three CDRs of the LC are referred to as "LCDR1, LCDR2, and LCDR3," and the three CDRs of the HC are referred to as "HCDR1, HCDR2, and HCDR3." The functional ability of an antibody to bind a particular antigen is largely determined by CDRs. Assignment of amino acids to CDR domains within the LCVR and HCVR regions of the antibodies of the present disclosure is based on the well-known Kabat numbering conventions (Andrew Martin, Protein Sequence and Structure Analysis of Antibody Variable Domains in Antibody Engineering (Roland Kontermann and Stefan Dtibel eds., 2d ed. 2010)). The term “mesothelin antibody means” refers to an antibody or fragment thereof that binds mesothelin, bringing the engineered cells and pharmaceutical compositions provided herein in proximity to mesothelin-expressing or mesothelin-overexpressing cells. Antibodies within the scope of mesothelin antibody means are the disclosed antibodies and functional equivalents thereto. Functional equivalent antibodies comprise different specific amino acid residues but bind mesothelin with a KD of less than 10’6molar, such as less than 10‘7molar, less than 10’8molar, less than 10‘9molar, or less than IO'10molar. Functional equivalent antibodies having KD of less than 10'6molar, such as less than 10’7molar, less than 10'8molar, less than 10'9molar, or less than IO'10molar would differ insubstantially to bind mesothelin, bringing the engineered cells and pharmaceutical compositions provided herein in proximity to mesothelin-expressing or mesothelin-overexpressing cell, and having a therapeutic effect.

[0114] The phrase “complementary determining means” as used herein describes complimentary determining regions (CDRs) that collectively form specific interactions with mesothelin. CDRs within the scope of complementary determining means are the disclosed CDRs and functional equivalents thereto. Functional equivalent CDRs comprise different specific amino acid residues but bind mesothelin within KD of less than 10’6molar, such as less than 10'7molar, less than 10'8molar, less than 10‘9molar, or less than 10‘10molar. Functional equivalent CDRs having KD of less than 10"6molar, such as less than 10'7molar, less than 10'8molar, less than IO"9molar, or less than ICT10molar would differ insubstantially to bind mesothelin, bringing the engineered cells and pharmaceutical compositions provided herein in proximity to mesothelin-expressing or mesothelin- overexpressing cell, and having a therapeutic effect.

[0115] The antibodies and fragments thereof herein are monoclonal antibodies ("mAbs") or fragments thereof, such as scFv. mAbs can be produced, for example, by hybridoma technologies, recombinant technologies, phage display technologies, synthetic technologies (e.g., CDR or specificity-determining residue, SDR, grafting), or combinations of such or other technologies known in the art. mAbs are antibodies derived from a single copy or clone including, for example, any eukaryotic, prokaryotic or phage clone. A variety of well-known methods and tools can be used for producing and purifying the mAbs disclosed herein, including vectors, for example, plasmids, virus, or other vehicles for polynucleotide insertion or expression, and hosts, for example, microbial, yeast, insect, and mammalian organisms (see, e.g., Process Scale Purification of Antibodies (Uwe Gottschalk, ed., 2d ed. 2017)). Further antibodies having a complementary binding means can be prepared and screened by well-known methods, such as hybridoma, transgenic animals, and phage or yeast display (see, e.g., Monoclonal Antibodies: Methods and Protocols (Vincent Ossipow and Nicolas Fischer, eds., 2d ed. 2014)). Antibodies having equivalent complementary binding means differ in their amino acid sequence but perform the same function of binding the target through CDR-target interaction acting as (inhibitor / agonist / antagonist) to achieve the same result (inhibiting tumor growth). Preferably, the complementary binding means functions through the same epitope as the disclosed antibodies.

[0116] Herein, “binding” (or “binds”) refers to the well-understood interaction between a protein, peptide, or polysaccharide and the cognate binding partner (e.g., an interleukin and an interleukin receptor, such as IL-12 and IL-12 receptor, or a collagen binding domain (CBD) and collagen). Binding can be measured in a variety of ways (see, e.g., The Immunoassay Handbook: Theory and applications of ligand binding, ELISA and related techniques (David Wild ed., 4th ed. 2013)). A particular protein, peptide, or polysaccharide binds to a cognate binding partner and does not bind in a significant amount to other proteins or polysaccharides present in a sample or subject disclosed herein. Binding occurs between the disclosed proteins or polysaccharides (e.g., IL-12 and / or CBD) and a cognate binding partner (e.g., IL- 12 receptor and collagen, respectively). Binding occurs when the interaction has a KD of less than 10‘6molar, such as less than 10'7molar, less than 10'8molar, less than 10'9molar, or less than IO'10molar.

[0117] Chimeric antigen receptors (CARs) are receptor proteins that have been engineered for expression on an immune cell and to target a specific antigen (“target antigen”) as well as activate an immune cell (e.g., memory-like NK cells). CARs are used in therapies, such as immune cell therapy, including memory-like NK cell therapy. CARs can be engineered into allogeneic immune cells (i.e., immune cells from a donor are engineered) or autologous immune cells (i.e., immune cells from a patient or subject that are re-introduced after engineering). CARs typically include (1) an extracellular antigen-binding motif (e.g., single-chain variable fragment (scFv) antibody), (2) linking / transmembrane motifs, and (3) an intracellular domain, including a costimulatory domain and an activity domain (e.g., CD137 (4-IBB)- and CD247 (CD3Q-derived costimulatory domain and an activity domain, respectively). In embodiments, the CAR expresses an anti-mesothelin antibody or fragment thereof, such as anti-mesothelin memory-like CAR-NK cells.

[0118] In embodiments, the target antigen is expressed or overexpressed on cancer cells, but not healthy cells. In examples, the target antigen is expressed or overexpressed on a cancer cells in a cancer selected from the list consisting of: solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis.

[0119] “Cytokines” are small proteins (~5-25 kDa) involved in cell signaling, typically through binding cognate cytokine receptors at the cell surface. Examples of cytokines include chemokines, interferons, interleukins, lymphokines, and tumor necrosis factors and are produced by various cell types, such as immune cells (e.g., NK cells, macrophages, B lymphocytes, T lymphocytes, and mast cells), endothelial cells, fibroblasts, and stromal cells. In embodiments, cells, such as memory-like NK cells, can be engineered to produce or secrete cytokines. Cytokines play a role in immune responses to infection, inflammation, trauma, sepsis, cancer, and reproduction. In embodiments, the cytokines of the present disclosure are interleukins, such as IL- 12.

[0120] Herein, an “effective amount” is a quantity sufficient to achieve a desired effect in a subject. For instance, this can be the amount necessary to prevent, treat, or ameliorate a disease, for example, inhibiting or suppressing cancer, such as solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis. In embodiments, an effective amount is the amount necessary to eliminate, reduce the size, or prevent metastasis of cancer or a tumor, such as in solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis. Efficacy is first evident in the cellular response, for which a variety of in vitro and cell-based assays are well-known to measure. Kristina V. Kitaeva et al., Cell Culture Based In vitro Test Systems for Anti cancer Drug Screening, 8 Front. Bioeng. Biotechnol. 322(2020)). In embodiments, an effective amount is the amount necessary to significantly inhibit or reduce cancer cell proliferation or migration, invasion, or adhesion. A cellular response manifests as significantly reduced tumor size, reduced or inhibited disease progression, and improvement in survival in a subject or patient. More particularly, an effective amount provides improvement in important cancer endpoints, Overall Survival (OS), Disease-Free Survival (DFS), Objective Response Rate, Complete Response Rate or Progression Free Survival (PFS). See Dept, of Health and Human Services, Food and Drug Admin, Clinical Trial Endpoints for the Approval of Cancer Drugs and Biologies: Guidance for Industry (2018); E.A. Eisenhauer et al., New Response Evaluation Criteria in Solid Tumours: Revised RECIST Guideline (Version 1.1), 45 Eur. J. Cancer 228 (2009). “Interleukins” (ILs) are a type of cytokine expressed and secreted by leukocytes as well as other cell types. Interleukins are involved in the immune system, such as facilitating T and B lymphocyte as well as hematopoietic cell development and differentiation, and they are generated endogenously by lymphocytes, monocytes, macrophages, and endothelial cells. In embodiments, cytokines are produced or secreted by an engineered cell, such as a memory -like NK cell. Examples of interleukins include IL-12.

[0121] Interleukin-12 (IL-12; e.g., OMIM ref. 601604) is a cytokine secreted a variety of lymphocytes and other cell types. IL-12 enhances cytotoxic activity in NK cells and CD8+ cytotoxic T cells, regulates the activation and proliferation of T and natural killer (NK) cells, and is linked to NK cell signal transduction. IL- 12 amino acid and nucleic acid sequences are well-known in the art. In embodiments, IL-12 comprises the amino acid sequences of SEQ ID NOs: 23, 25, 29, and 35; embodiments of nucleic acids that encode IL-12 include SEQ ID NOs: 24, 26, 30, and 36.

[0122] Natural Killer Cells (NK cells) are innate immune cells with anti-tumor, antiviral, and antimicrobial activity. Immune-based and CAR-based therapies include NK and CAR-NK cells, such as memory-like NK and memory-like CAR-NK cells. In embodiments, NK cells include memory-like NK cells (e.g., US Patent Pub. 20230149460, incorporated herein by reference in its entirety on March 15, 2024) and memory-like CAR-NK cells (e.g., US Patent Pub. 20230149460, incorporated herein by reference in its entirety on March 14, 2025).

[0123] The pharmaceutically acceptable carriers of use are conventional (e.g., as described in Remington, The Science and Practice of Pharmacy, 22nd Edition, Loyd V., ed., Pharmaceutical Press, 2012). In general, the nature of the carrier will depend on the mode of administration. For instance, parenteral formulations typically comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions or the like as a vehicle. Pharmaceutical compositions can additionally include minor amounts of nontoxic auxiliary substances for stability.

[0124] In embodiments, the carrier may be sterile and / or suspended or otherwise contained in a unit dosage form including one or more measured doses of the composition suitable for administration to a subject of an effective amount of the engineered cells disclosed herein. Medications for use in treatment may also be included in embodiments. In embodiments, the unit dosage form may be in a sealed vial that contains sterile contents or a syringe for injection into a subject, lyophilized for subsequent solubilization and administration, or in a solid or controlled release dosage. A pharmaceutical composition of the present disclosure contains an "effective" or "therapeutically effective" amount, as used interchangeably herein, of an engineered cell of the present disclosure. The dosages and dosage regimen to achieve the desired therapeutic result depending on the means of administration and may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the engineered cell to elicit a desired response in the individual. An effective amount is also one in which any toxic or detrimental effects of the engineered cell of the present disclosure are outweighed by the therapeutically beneficial effects.

[0125] Further contemplated are variants of the disclosed antibodies and fragments thereof. Herein, “sequence identity“ is referred to as the similarity between amino acid or nucleic acid sequences, which is expressed as the similarity between the sequences. Sequence identity is frequently measured as percent identity, in which two sequences are considered more similar the higher the percentage. Homologs or variants of a polypeptide or nucleic acid molecule possess a relatively high degree of sequence identity when aligned using standard methods, which are well-known. Ceslovas Venclovas, Methods for Sequence-Structure Alignment in Homology Modeling: Methods and Protocols 55-82 (Andrew Orry and Ruben Abagyan, eds., 2012)).

[0126] The term “therapeutic” in conjunction with engineered cells and pharmaceutical compositions disclosed herein refers to engineered cells suitable for use in human treatment of cancer, such as solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis. Such engineered cells or pharmaceutical compositions express IL-12 and CBD that bind their cognate binding partner (e.g., IL-12 receptor and collagen, respectively) with a KD of less than 10'6molar, such as less than 10’7molar, less than 10'8molar, less than 10'9molar, or less than IO'10molar and any toxic or detrimental effects of the engineered cells and pharmaceutical compositions disclosed herein are outweighed by the therapeutic beneficial effects.

[0127] The engineered cells disclosed herein can be used in therapy. In embodiments, the engineered cells disclosed herein can be used to treat, prevent (such as through prophylactic treatment), or ameliorate a cancer, such as solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis. Herein, "preventing" a disease refers to inhibiting the full development of a disease, such as cancer, such as solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis. "Treating" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop, such as a reduction in tumor burden or a decrease in the number of size of metastases. "Ameliorating" refers to the reduction in the number or severity of signs or symptoms of a disease, such as cancer, such as solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis. A "prophylactic" treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing a pathology, such as cancer, such as solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis.

[0128] Contemplated herein are conservative variants of the disclosed amino acid sequences herein. A protein is a conservative variant where it contains conservative amino acid substitutions that do not substantially affect or decrease the affinity of a protein. For example, a cytokine that binds its cognate receptor can include at least 1, 2, 5, 10, or 15 conservative substitutions, for example, and bind the cognate receptor. Conservative amino acid substitution tables providing functionally similar amino acids are well-known to one of ordinary skill in the art. The following groups are examples of amino acids that are considered conservative substitutions for one another: 1) serine (S), threonine (T); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); and 6) phenylalanine (F), tyrosine (Y), tryptophan (W).

[0129] Herein, a "degenerate variant" refers to a polynucleotide encoding a polypeptide (such as an antibody or fragment thereof) that includes a sequence that is degenerate based on the genetic code (i.e., the 20 natural amino acids can be specified by more than one codon). All degenerate nucleotide sequences encoding the disclosed antibody and fragment polypeptide sequences are included.

[0130] “Vector”, as used herein, is an entity containing a nucleic acid molecule (such as a DNA or RNA molecule) bearing a promoter(s) that is operationally linked to the coding sequence of a protein of interest and can express the coding sequence. Non-limiting examples include a naked or packaged (lipid and / or protein) DNA, a naked or packaged RNA, a subcomponent of a virus or bacterium or other microorganism that may be replication incompetent, or a virus or bacterium or other microorganism that may be replication-competent. A vector is sometimes referred to as a construct. Recombinant DNA vectors are vectors having recombinant DNA. A vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector can also include one or more selectable marker genes and other genetic elements. Viral vectors are recombinant nucleic acid vectors having at least some nucleic acid sequences derived from one or more viruses. In some embodiments, a viral vector comprises a lentivirus vector. In some embodiments, a viral vector comprises a nucleic acid molecule encoding a disclosed CAR.

[0131] COMPOSITIONS

[0132] Provided herein are engineered cells. In embodiments, the engineered cells comprise a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:

[0133] Formula I. A - B - I - C wherein:

[0134] A is a mesothelin antibody means for binding a target antigen;

[0135] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;

[0136] I is interleukin 12 (IL- 12); and C is a collagen binding domain.

[0137] In embodiments, the engineered cells comprise a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:

[0138] A - B - 1 (Formula II), wherein:

[0139] A is a mesothelin antibody means for binding a target antigen;

[0140] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; and I is interleukin 12 (IL- 12).

[0141] In embodiments, the engineered cells comprise a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:

[0142] A - B - I - C (Formula III), wherein: A is an antibody or fragment thereof for binding a target antigen;

[0143] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;

[0144] I is interleukin 12 (IL- 12); and

[0145] C is a collagen binding domain.

[0146] In embodiments, the engineered cells comprise a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:

[0147] A - B - 1 (Formula IV), wherein:

[0148] A is an antibody or fragment thereof for binding a target antigen;

[0149] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; and

[0150] I is interleukin 12 (IL- 12).

[0151] Various natural killer (NK) cells are contemplated for the engineered cells of the present disclosure. In embodiments, the engineered cells disclosed herein comprise NK cells. Particularly, in embodiments, engineered cells disclosed herein comprise memory-like NK cells. A person of ordinary skill in the art understands how to make memory-like NK cells (e.g., through activation and differentiation of NK cells) and identify memory-like NK cells (e.g.. enhanced cell proliferation and cytotoxicity as well as differential protein expression profiles). See, e.g., US Patent Pub. No. 20230149460, incorporated herein by reference in its entirety on March 14, 2025. In embodiments, memory-like NK cells of the present disclosure comprise an increased frequency of TRAIL+CD69+CD62L+NKG2A+NKp30+ NK cells. In embodiments, memory-like NK cells of the present disclosure comprise an decreased frequency of CD27+CD127+ NK cells, embodiments, memory -like NK cells of the present disclosure comprise an decreased frequency of CD 16 and / or CD1 lb NK cells. In embodiments, memory-like NK cells of the present disclosure comprise a CD 11 bhighC 1)2' / "" K L RG 1;’,ghCD43higjlphenotype. In embodiments, memory-like NK cells of the present disclosure comprise a CD25+NKG2A+NKp3(yrNKp44+ population.

[0152] In further embodiments, various immune cells are contemplated for the engineered cells of the present disclosure. In embodiments, the immune cell is selected from the group consisting of T cells, natural killer (NK) cells, macrophages, dendritic cells, hematopoietic stem cells (HSC), induced pluripotent stem cells, cord blood stem cells, and / or derivatives thereof. Particularly, in embodiments, the immune cell is a T cell. Particularly, in embodiments, the immune cell is selected from the list consisting of: a cytotoxic lymphocyte, T cell, cytotoxic T cell (CD8+T cell), T helper cell (CD4+T cell), a T cell and / or yd T cell, Thl7 T-cell, NK T (NKT) cell, and regulatory T (Treg) cell.

[0153] Provided herein are nucleic acids. In embodiments, the nucleic acids encode a chimeric antigen receptor (CAR) of the formula:

[0154] A - B - 1 - C (Formula I), wherein:

[0155] A is a mesothelin antibody means for binding a target antigen;

[0156] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;

[0157] I is interleukin 12 (IL- 12); and C is a collagen binding domain.

[0158] In embodiments, the nucleic acids encode a chimeric antigen receptor (CAR) of the formula:

[0159] A - B - 1 (Formula II), wherein:

[0160] A is a mesothelin antibody means for binding a target antigen;

[0161] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; and I is interleukin 12 (IL-12).

[0162] In embodiments, the nucleic acids encode a chimeric antigen receptor (CAR) of the formula:

[0163] A - B - 1 - C (Formula III), wherein:

[0164] A is an antibody or fragment thereof for binding a target antigen;

[0165] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;

[0166] I is interleukin 12 (IL- 12); and C is a collagen binding domain.

[0167] In embodiments, the nucleic acids encode a chimeric antigen receptor (CAR) of the formula: A B I (Formula IV), wherein:

[0168] A is an antibody or fragment thereof for binding a target antigen;

[0169] B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; and

[0170] I is interleukin 12 (IL- 12).

[0171] Various mesothelin antibody means are contemplated in Formulas I and II, and various antibodies or fragments thereof are contemplated in Formulas III and IV. In embodiments, the CAR of Formulas I-FV are specific for mesothelin, a glycosylphosphatidylinositol-anchored cell surface protein present in a variety of cancers. In embodiments, the mesothelin antibody means or antibodies or fragments thereof comprise a mesothelin-binding antibody fragment. In embodiments, the mesothelin antibody means or antibodies or fragments thereof comprise a mesothelin-binding scFv. A person of ordinary skill in the are understands that a mesothelin-binding scFvs comprise a light chain variable domain (LCVR) is linked to a heavy chain variable domain fragment (HCVR) that binds mesothelin. In embodiments, the linkage comprises a GGGGS (SEQ ID NO: 39) linker or other linker disclosed herein, such as a linker comprising GGGGS GGGGS GGGGS (SEQ ID NO: 6). In embodiments, A comprises the complementarity determining regions (CDRs) LCDR1, LCDR2 and LCDR3, wherein the amino acid sequence of LCDR1 is SEQ ID NO: 1, the amino acid sequence of LCDR2 is SEQ ID NO:2, the amino acid sequence of LCDR3 is SEQ ID NOG. In embodiments, A comprises the complementarity determining regions (CDRs) HCDR1, HCDR2 and HCDR3, wherein the amino acid sequence of HCDR1 is SEQ ID NO: 8, the amino acid sequence of HCDR2 is SEQ ID NO:9, the amino acid sequence of HCDR3 is SEQ ID NO: 10. Particularly, in embodiments, A comprises the complementarity determining regions (CDRs) LCDR1, LCDR2, LCDR3, HCDR1, HCDR2 and HCDR3, wherein the amino acid sequence of LCDR1 is SEQ ID NO: 1, the amino acid sequence of LCDR2 is SEQ ID NO:2, the amino acid sequence of LCDR3 is SEQ ID NOG, the amino acid sequence of HCDR1 is SEQ ID NO: 8, the amino acid sequence of HCDR2 is SEQ ID NOV, and the amino acid sequence of HCDR3 is SEQ ID NO: 10. In embodiments, A comprises a light chain variable region (LCVR), wherein the amino acid sequence of the LCVR is SEQ ID NO: 4, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 5. Particularly, in embodiments, A comprises a heavy chain variable region (HCVR), wherein the amino acid sequence of the HCVR is SEQ ID NO: 11, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 12. Particularly, in embodiments, A comprises a light chain variable region (LCVR) and a heavy chain variable region (HCVR), wherein the amino acid sequence of the LCVR is SEQ ID NO: 4, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 5; the amino acid sequence of the HCVR is SEQ ID NO: 11, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 12. In further embodiments, the antibodies and fragments thereof of formulas III and IV are directed to other differentially expressed proteins, peptides, and protein domains on tumor or cancer cells, such as anti-CD19 antibodies and fragments thereof and anti-CD17 antibodies and fragments thereof.

[0172] Various hinge regions (also known as spacers) are contemplated for Formulas I-IV. A person or ordinary skill in the art understands that hinge regions or spacers in a chimeric antigen receptor (CAR) typically sit between a target-binding region (e.g., A of Formulas I-IV, a mesothelin antibody means or antibody or fragment thereof, such as svFc) and the outer membrane of a cell in which the hinge region or spacer is expressed (e.g., a memory-like NK cell). Hinge regions or spacers typically vary in size and can be derived from a variety of extant proteins, such as extracellular proteins or protein domains (e.g., US Patent No. 10,597,456, incorporated herein by reference in its entirely on March 14, 2025). In embodiments, the hinge region comprises a hinge domain derived from CD3(^, CD4, CD8a, CD28, IgGl, IgG2, or IgG4. Particularly, in embodiments, the hinge region comprises a hinge domain derived from CD28. Particularly, in embodiments, the hinge region comprises the amino acid sequence of SEQ ID NO: 13. Particularly, in embodiments, the hinge region comprises the amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 14.

[0173] Various transmembrane domains are contemplated for Formulas I-IV. A person of ordinary skill in the art understands that transmembrane domains in a chimeric antigen receptor (CAR) typically sit between a hinge region or spacer and an intracellular domain. Transmembrane domains can vary in size and are often derived from extant transmembrane proteins or protein domains (e.g., US Patent No. 10,597,456, incorporated herein by reference in its entirely on March 14, 2025). In embodiments, the transmembrane domain of Formulas I-IV comprises a transmembrane domain derived from CD3 , CD4, CD8a, CD28, or CD137. Particularly, in embodiments, the transmembrane domain of Formulas I-IV comprises a transmembrane domain derived from CD28. Particularly, in embodiments, the transmembrane domain of Formulas I-IV comprises the amino acid sequence of SEQ ID NO: 15. Particularly, in embodiments, the transmembrane domain of Formulas I-IV comprises the amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 16. Various the cytoplasmic domains are contemplated for R3 of Formulas I and II. A person or ordinary skill in the art understands that cytoplasmic domains in a chimeric antigen receptor (CAR) are typically linked to a transmembrane domain and are within the intracellular compartment of a cell in which the cytoplasmic domain is expressed (e.g., memory -like NK cell). Cytoplasmic domains typically vary in size and and include a signaling domain and / or a costimulatory domain can be derived from a variety of extant proteins, such as intracellular signaling, and / or costimulatory proteins or protein domains (e.g., US Patent No. 10,597,456, incorporated herein by reference in its entirely on March 14, 2025). In embodiments, the cytoplasmic domain of Formulas I-IV comprises a signaling domain and a costimulatory domain. In embodiments, the cytoplasmic domain of Formulas I-IV is of the formula:

[0174] Formula V. Rl - R2 or R2 - Rl wherein R1 comprises a signaling domain, and

[0175] R2 comprises a costimulatory domain.

[0176] Particularly, in embodiments, the cytoplasmic domain of Formulas I-IV comprises R2 - Rl. Particularly, in embodiments, the cytoplasmic domain of Formulas I-IV comprises Rl - R2.

[0177] Particularly, in embodiments, Rl comprises a signaling domain derived from CD3(^, CD27, CD28, CD40, KIR2DS2, MyD88, or 0X40. Particularly, in embodiments, Rl comprises a costimulatory domain derived from CD3(^. Particularly, in embodiments, Rl comprises a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 19. Particularly, in embodiments, Rl comprises a costimulatory domain comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 20.

[0178] Particularly, in embodiments, R2 comprises a costimulatory domain derived from of CD3y, CD35, CD3s, CD3i CD27, CD40, CD28, CD72, CD80, CD86, CLEC-1, 4-1BB, TYROBP (DAP12), Dectin-1, FcaRI, FcyRI, FcyRII, FcyRIII, FceRI, IL-2RB, ICOS, KIR2DS2, MyD88, 0X40, or ZAP70. Particularly, in embodiments, R2 comprises a costimulatory domain derived from 4-1BB. Particularly, in embodiments, R2 comprises a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 17. Particularly, in embodiments, R2 comprises a costimulatory domain comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 18. Various collagen binding domains are contemplated for Formulas I and III. The collagen binding domains contemplated herein are linked to the cytoplasmic domain and are within the intracellular compartment of a cell (e.g., memory-like NK cell). Collagen binding domains typically vary in size, ranging from about 7 to 224 amino acids, and can be derived from a variety of extant proteins, such as proteins or protein domains (e.g., US Patent Pub. No. 20200331984, incorporated by reference herein in its entirely on March 14, 2025). Particularly, in embodiments, the collagen binding domain of Formulas I and III comprises a collagen binding domain derived from von Willebrand Factor (vWF or vWBF), fibronectin protein (FN), Clostridium histolyticum protein ColH, or collagenase-derived peptide (aCBD). Particularly, in embodiments, the collagen binding domain of Formulas I and III comprises a collagen binding domain derived from vWF. Particularly, in embodiments, the collagen binding domain of Formulas I and III comprises a collagen binding domain comprising the amino acid sequence of SEQ ID NO: 33. Particularly, in embodiments, the collagen binding domain of Formulas I and III comprises a collagen binding domain comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 34.

[0179] Various IL-12 amino acid sequences, such as amino acid sequences comprising various IL- 12 subunits and IL-12-derived peptides, are contemplated for Formulas I -IV. The IL-12 amino acid sequences contemplated herein are linked to the cytoplasmic domain and are within the intracellular compartment of a cell (e.g., memory-like NK cell). IL-12 amino acid sequences, such as amino acid sequences comprising various IL-12 subunits and IL-12-derived peptides typically vary in size (e.g., SEQ ID NOs: 23, 25, 29, and 35). Particularly, in embodiments, the IL-12 of Formulas I-IV comprises an IL-12 protein, protein domain, or peptide derived from human IL-12. Particularly, in embodiments, the IL-12 of Formulas I-IV comprises an IL-12 protein, protein domain, or peptide comprising the amino acid sequence of SEQ ID NOs: 23, 25, 29, and 35. Particularly, in embodiments, the IL-12 of Formulas I-IV comprises an IL-12 protein, protein domain, or peptide comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NOs: 24, 26, 30, and 36. Formulas I -IV can include one or more IL-12. Particularly, in embodiments, the IL-12 of Formulas I-IV comprises SEQ ID NOs: 23, 25, and 29. Particularly, in embodiments, the IL-12 of Formulas I-IV comprises SEQ ID NO: 35 and SEQ ID NO: 25.

[0180] Various peptide linkers are contemplated for linking the various elements of Formulas I-V. A person of ordinary skill in the art understands that peptide linkers are typically about one to 100 amino acids in length (e.g., 1, 2, 3, 4, 5, 10, 12, 1-10, 1-12, or 1-20, or more amino acids) containing various types of amino acids (e.g., US Patent No. 11,041,023, incorporated by reference herein in its entirety on March 14, 2025). In embodiments, the amino acids include a combination of one or more glycine(s) and / or serine(s). In embodiments, a peptide linker of Formulas I-V comprises the amino acid sequence comprising GGGGS (SEQ ID NO: 39). Particularly, in embodiments, a peptide linker of Formulas I-V consists of the amino acid sequence GGGGS (SEQ ID NO: 39). In embodiments, a peptide linker of Formulas I-V comprises or consists of 2, 3, 4, 5, 6, or 7 consecutive repeats of the amino acid sequence GGGGS (SEQ ID NO: 39). Particularly, in embodiments, a peptide linker of Formulas I-V comprises the amino acid sequence of SEQ ID NO: 6. Particularly, in embodiments, a peptide linker of Formulas I-V comprises an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 7. Particularly, in embodiments, a peptide linker of Formulas I-V comprises the amino acid sequence of SEQ ID NO: 31. Particularly, in embodiments, a peptide linker of Formulas I-V comprises an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 32. In embodiments, a peptide linker of Formulas I-V is a linker derived from elastin. Particularly, in embodiments, a peptide linker of Formulas I-V comprises the amino acid sequence of SEQ ID NO: 27. Particularly, in embodiments, a collagen binding domain of Formulas I-V comprises a costimulatory domain comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 28. In embodiments, a peptide linker of Formulas I-V is a cleavable linker. In embodiments, a peptide linker of Formulas I-V is a linker derived from P2A peptide (e.g., US Patent No. 11820819, incorporated herein by reference in its entirety on March 14, 2025).

[0181] Particularly, in embodiments, a peptide linker of Formulas I-V comprises the amino acid sequence of SEQ ID NO: 21. Particularly, in embodiments, a peptide linker of Formulas I-V comprises an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 22.

[0182] Engineered cells and pharmaceutical compositions made in a variety of ways understood by a person of ordinary skill in the art. Provided herein are vectors encoding the chimeric antigen receptor (CAR) for Formulas I-IV. In embodiments, a vector is transduced into an immune cell ex vivo, such as a viral or retroviral vector. Particularly, in embodiments, a lentiviral vector, is transduced ex vivo into a memory -like NK cell (see, e.g., Zhang et al., Engineering CAR-T cells, Biomark Res. 5:22 (2017); US Patent Pub. No. 20230149460, incorporated herein by reference in its entirety on March 14, 2025). In embodiments, vectors are provided herein are lentiviral vectors. Particularly, in embodiments, vectors provided herein comprise the nucleic acid sequence of SEQ ID NO: 37. Particularly, in embodiments, vectors provided herein comprise the nucleic acid sequence of SEQ ID NO: 38. Provided herein are pharmaceutical compositions comprising engineered cells provided herein. In embodiments, pharmaceutical compositions provided herein comprise engineered cells provided herein, and a pharmaceutically acceptable carrier. In embodiments, pharmaceutical compositions provided herein comprise engineered cells provided herein, and one or more pharmaceutically acceptable carriers, diluents, or excipients. A person of ordinary skill in the art understands that engineered cells or pharmaceutical compositions provided herein can be formulated and administered in a variety of ways. In embodiments, engineered cells and pharmaceutical compositions provided herein are formulated for administration by any suitable route, such as intramuscular, intravenous, intradermal, intralesional, intraperitoneal injection, subcutaneous, intratumoral, epidural, nasal, oral, vaginal, rectal, topical, local, systemic, otic, inhalational, buccal (e.g., sublingual), and transdermal and can include additional agents that are biologically active, can facilitate or enhance delivery, or can control release. Other biologically active agents can also be administered sequentially, intermittently or simultaneously, such as in the same composition. Controlled release formulations and devices are contemplated, such as by pump. Additional means of formulation, administration, storage, preparation, manufacturing are contemplated (e.g., US Patent Pub. No. 20230149460, incorporated herein by reference in its entirety on March 14, 2025).

[0183] Particularly, in embodiments, engineered cells or pharmaceutical compositions provided herein can be formulated into suitable pharmaceutical preparations, such as solutions, suspensions, tablets, dispersible tablets, pills, capsules, powders, patches, or sustained release formulations. Particularly, in embodiments, engineered cells or pharmaceutical compositions provided herein are formulated in a dried or liquid form. Particularly, in embodiments, engineered cells or pharmaceutical compositions provided herein are formulated in a liquid form, for example, as a suspension for injection (direct administration) or frozen suspension that is thawed prior to use, dried soluble form, and emulsion. Particularly, in embodiments, injection or infusion administration is contemplated, for example, subcutaneous, intramuscular, intratumoral, intravenous, or intradermal administration is contemplated. Particularly, in embodiments, excipients, such as water, saline, dextrose, or glycerol, and carriers, such as a diluents, adjuvants, anti-adherents, binders, coatings, fdlers, flavors, colors, lubricants, glidants, preservatives, detergents, sorbents or combinations thereof, are contemplated. Particularly, in embodiments, aqueous vehicles, non-aqueous vehicles, isotonic agents, buffers, antioxidants, local anesthetics, suspending agents, dispersing agents, emulsifying agents, sequestering agents, chelating agents, or combinations thereof are contemplated herein as excipients and carriers. Particularly, in embodiments, a therapeutically effective amount of engineered cells or pharmaceutical compositions provided herein are formulated, for example, as single-unit or multi-unit dosage formulations. Additional formulations and modes of administration are contemplated (e.g., US Patent Pub. No. 20230149460, incorporated herein by reference in its entirety on March 14, 2025).

[0184] SEQUENCES

[0185] SEQ ID NO: 37, vector embodiment (pHIV-aMeso-CAR-IL-12-CBD-CBD-A) gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgt gtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttag gcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcata gcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgt atgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcat atgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagt acatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtc tccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatggg cggtaggcgtgtacggtgggaggtctatataagcagcgcgttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctgg ctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatc cctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgac gcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaa ggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaa aaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaa atactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggat agagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccggccgctg atcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcaccc accaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcact atgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggc gcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctc ctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcac acgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatga acaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtagga ggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccc cgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcac tgcgtgcgccaattctgcagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatag tagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagagatcc agtttggttagtaccgggcccgctctagcgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttgggg ggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagg gtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggtt cccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggtt ggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgc gtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggca agatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcaca tgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgc gccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctg cagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgt cgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggg gttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgag tttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgagcggccgctgagttaactattctagatggc cctccctgtcaccgccctgctgcttccgctggctcttctgctccacgccgctcggccctacccatacgacgttccagactacgctgctagcGAC GTCGTGATGACCCAGACTCCAGCCTCCGTGTCTGAACCTGTGGGAGGCACAGTCACCAT CAAGTGCCAGGCCAGTCAGAGGATTAGTAGTTACTTATCCTGGTATCAGCAGAAACCAG GGCAGCGTCCCAAGCTCCTGATCTTTGGTGCATCCACTCTGGCATCTGGGGTCCCCTCGC GGTTCAAAGGCAGTGGATCTGGGACAGAATACACTCTCACCATCAGCGACCTGGAGTGT GCCGATGCTGCCACTTACTACTGTCAGAGTTATGCTTATTTTGATAGTAATAATTGGCAT GCTTTCGGCGGAGGGACCGAGGT GGT GGT Cggtggaggtggcagcggaggaggtgggtccggcggtggaggaa gcCAGCAGCAGCTGGAGGAGTCCGGGGGAGGCCTGGTCAAGCCTGAGGGATCCCTGAC ACTCACCTGCAAAGCCTCTGGATTCGACCTCGGTTTCTACTTTTACGCCTGTTGGGTCCG CCAGGCTCCAGGGAAGGGCCTGGAGTGGATCGCATGCATTTATACTGCTGGTAGTGGTA GCACGTACTACGCGAGCTGGGCGAAAGGCCGATTCACCATCTCCAAAGCCTCGTCGACC ACGGTGACTCTGCAAATGACCAGTCTGGCAGCCGCGGACACGGCCACCTATTTCTGTGC GAGATCTACTGCTAATACTAGAAGTACTTATTATCTTAACTTGTGGGGCCCAGGCACCC TGGTCACCGTCTCCTCAaccactaccccagcaccgaggccacccaccccggctcctaccatcgcctcccagcctctgtccctgc gtccggaggcatgtagacccgcagctggtggggccgtgcatacccggggtcttgacttcgcctgcgatatctacatttgggcccctctggctggt acttgcggggtcctgctgctttcactcgtgatcactctttactgtaagcgcggtcggaagaagctgctgtacatctttaagcaacccttcatgaggcct gtgcagactactcaagaggaggacggctgttcatgccggttcccagaggaggaggaaggcggctgcgaactgcgcgtgaaattcagccgcag cgcagatgctccagcctacaagcaggggcagaaccagctctacaacgaactcaatcttggtcggagagaggagtacgacgtgctggacaagc ggagaggacgggacccagaaatgggcgggaagccgcgcagaaagaatccccaagagggcctgtacaacgagctccaaaaggataagatg gcagaagcctatagcgagattggtatgaaaggggaacgcagaagaggcaaaggccacgacggactgtaccagggactcagcaccgccacc aaggacacctatgacgctcttcacatgcaggccctgccgcctcggGGATCCGGCGCAACAAACTTCTCTCTGCTGA AACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGATGTGTCACCAGCAGTTGGTCAT CTCTTGGTTTTCCCTGGTTTTTCTGGCATCTCCCCTCGTGGCCATATGGGAACTGAAGAA AGATGTTTATGTCGTAGAATTGGATTGGTATCCGGATGCCCCTGGAGAAATGGTGGTCC TCACCTGTGACACCCCTGAAGAAGATGGTATCACCTGGACCTTGGACCAGAGCAGTGA GGTCTTAGGCTCTGGCAAAACCCTGACCATCCAAGTCAAAGAGTTTGGAGATGCTGGCC AGTACACCTGTCACAAAGGAGGCGAGGTTCTAAGCCATTCGCTCCTGCTGCTTCACAAA AAGGAAGATGGAATTTGGTCCACTGATATTTTAAAGGACCAGAAAGAACCCAAAAATA AGACCTTTCTAAGATGCGAGGCCAAGAATTATTCTGGACGTTTCACCTGCTGGTGGCTG ACGACAATCAGTACTGATTTGACATTCAGTGTCAAAAGCAGCAGAGGCTCTTCTGACCC CCAAGGGGTGACGTGCGGAGCTGCTACACTCTCTGCAGAGAGAGTCAGAGGGGACAAC AAGGAGTATGAGTACTCAGTGGAGTGCCAGGAGGACAGTGCCTGCCCAGCTGCTGAGG AGAGTCTGCCCATTGAGGTCATGGTGGATGCCGTTCACAAGCTCAAGTATGAAAACTAC ACCAGCAGCTTCTTCATCAGGGACATCATCAAACCTGACCCACCCAAGAACTTGCAGCT GAAGCCATTAAAGAATTCTCGGCAGGTGGAGGTCAGCTGGGAGTACCCTGACACCTGG AGTACTCCACATTCCTACTTCTCCCTGACATTCTGCGTTCAGGTCCAGGGCAAGAGCAA GAGAGAAAAGAAAGATAGAGTCTTCACGGACAAGACCTCAGCCACGGTCATCTGCCGC AAAAATGCCAGCATTAGCGTGCGGGCCCAGGACCGCTACTATAGCTCATCTTGGAGCG

[0186] AATGGGCATCTGTGCCCTGCAGTGTTCCTGGAGTAGGGGTACCTGGGGTGGGCGCCAGA AACCTCCCCGTGGCCACTCCAGACCCAGGAATGTTCCCATGCCTTCACCACTCCCAAAA CCTGCTGAGGGCCGTCAGCAACATGCTCCAGAAGGCCAGACAAACTCTAGAATTTTACC CTTGCACTTCTGAAGAGATTGATCATGAAGATATCACAAAAGATAAAACCAGCACAGT GGAGGCCTGTTTACCATTGGAATTAACCAAGAATGAGAGTTGCCTAAATTCCAGAGAGA CCTCTTTCATAACTAATGGGAGTTGCCTGGCCTCCAGAAAGACCTCTTTTATGATGGCCC TGTGCCTTAGTAGTATTTATGAAGACTTGAAGATGTACCAGGTGGAGTTCAAGACCATG AATGCAAAGCTGCTGATGGATCCTAAGAGGCAGATCTTTCTAGATCAAAACATGCTGGC AGTTATTGATGAGCTGATGCAGGCCCTGAATTTCAACAGTGAGACTGTGCCACAAAAAT CCTCCCTTGAAGAACCGGATTTTTATAAAACTAAAATCAAGCTCTGCATACTTCTTCATG CTTTCAGAATTCGGGCAGTGACTATTGATAGAGTGATGAGCTATCTGAATGCTTCCGGG GGGGGGGGGTCTGGGGGGGGGGGGTCTGGGGGGGGGGGGTCTGGGGGGGGGGGGTCT GGGGGGGGGGGGTCTGGGGGGGGGGGGTCTTGCAGCCAGCCCCTGGACGTGATCCTGC TGCTGGACGGCAGCAGCAGCTTCCCCGCCAGCTACTTCGACGAGATGAAGAGCTTCGCC AAGGCCTTCATCAGCAAGGCCAACATCGGCCCCAGGCTGACCCAGGTGAGCGTGCTGC AGTACGGCAGCATCACCACCATCGACGTGCCCTGGAACGTGGTGCCCGAGAAGGCCCA CCTGCTGAGCCTGGTGGACGTGATGCAGAGGGAGGGCGGCCCCAGCCAGATCGGCGAC GCCCTGGGCTTCGCCGTGAGGTACCTGACCAGCGAGATGCACGGCGCCAGGCCCGGCG CCAGCAAGGCCGTGGTGATCCTGGTGACCGACGTGAGCGTGGACAGCGTGGACGCCGC CGCCGACGCCGCCAGGAGCAACAGGGTGACCGTGTTCCCCATCGGCATCGGCGACAGG TACGACGCCGCCCAGCTGAGGATCCTGGCCGGCCCCGCCGGCGACAGCAACGTGGTGA AGCTGCAGAGGATCGAGGACCTGCCCACCATGGTGACCCTGGGCAACAGCTTCCTGCA CAAGCTGTGCAGCGGCTTCGTGAGGATCTGCACCGGCCACCACCACCACCACCACtgaCC TAGGcctgcaggGCTAGCCTCGAGatcgataccgtcgacctcgatcgagacctagaaaaacatggagcaatcacaagtagcaat acagcagctaccaatgctgattgtgcctggctagaagcacaagaggaggaggaggtgggttttccagtcacacctcaggtacctttaagaccaat gacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatatccttga tctgtggatctaccacacacaaggctacttccctgattggcagaactacacaccagggccagggatcagatatccactgacctttggatggtgcta caagctagtaccagttgagcaagagaaggtagaagaagccaatgaaggagagaacacccgcttgttacaccctgtgagcctgcatgggatgga tgacccggagagagaagtattagagtggaggtttgacagccgcctagcatttcatcacatggcccgagagctgcatccggactgtactgggtctc tctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagt gtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagcatgtgagcaaaaggccag caaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtc agaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttacc ggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctg ggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcc actggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacact agaagaacagtattggtatctgcgctctgctgaagccagttacctcggaaaaagagttggtagctctgatccggcaaacaaaccaccgctggt agcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtg gaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaa agtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgact ccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagat ttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaa gctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattca gctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaa gttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaa ccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaag tgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactg atcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaat gttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaa ataggggttccgcgcacatttccccgaaaagtgccacctgac

[0187] SEQ ID NO: 38, vector embodiment (pHIV-aMeso-CAR-CBD-IL-12-MC) gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgcttgt gtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttag gcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcata gcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgt atgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcat atgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagt acatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtc tccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatggg cggtaggcgtgtacggtgggaggtctatataagcagcgcgttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctgg ctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatc cctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgac gcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaa ggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaa aaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaa atactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggat agagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccggccgctg atcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcaccc accaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcact atgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggc gcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctc ctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcac acgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatga acaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtagga ggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccc cgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcac tgcgtgcgccaattctgcagacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatag tagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagagatcc agtttggttagtaccgggcccgctctagcgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttgggg ggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagg gtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggtt cccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggtt ggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgc gtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggca agatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcaca tgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgc gccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctg cagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgt cgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggg gttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgag tttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgagcggccgctgagttaactattctagatggc cctccctgtcaccgccctgctgcttccgctggctcttctgctccacgccgctcggccctacccatacgacgttccagactacgctgctagcGAC GTCGTGATGACCCAGACTCCAGCCTCCGTGTCTGAACCTGTGGGAGGCACAGTCACCAT CAAGTGCCAGGCCAGTCAGAGGATTAGTAGTTACTTATCCTGGTATCAGCAGAAACCAG GGCAGCGTCCCAAGCTCCTGATCTTTGGTGCATCCACTCTGGCATCTGGGGTCCCCTCGC GGTTCAAAGGCAGTGGATCTGGGACAGAATACACTCTCACCATCAGCGACCTGGAGTGT GCCGATGCTGCCACTTACTACTGTCAGAGTTATGCTTATTTTGATAGTAATAATTGGCAT GCTTTCGGCGGAGGGACCGAGGTGGTGGTCggtggaggtggcagcggaggaggtgggtccggcggtggaggaa gcCAGCAGCAGCTGGAGGAGTCCGGGGGAGGCCTGGTCAAGCCTGAGGGATCCCTGAC ACTCACCTGCAAAGCCTCTGGATTCGACCTCGGTTTCTACTTTTACGCCTGTTGGGTCCG CCAGGCTCCAGGGAAGGGCCTGGAGTGGATCGCATGCATTTATACTGCTGGTAGTGGTA GCACGTACTACGCGAGCTGGGCGAAAGGCCGATTCACCATCTCCAAAGCCTCGTCGACC ACGGTGACTCTGCAAATGACCAGTCTGGCAGCCGCGGACACGGCCACCTATTTCTGTGC GAGATCTACTGCTAATACTAGAAGTACTTATTATCTTAACTTGTGGGGCCCAGGCACCC TGGTCACCGTCTCCTCAaccactaccccagcaccgaggccacccaccccggctcctaccatcgcctcccagcctctgtccctgc gtccggaggcatgtagacccgcagctggtggggccgtgcatacccggggtcttgacttcgcctgcgatatctacatttgggcccctctggctggt acttgcggggtcctgctgctttcactcgtgatcactctttactgtaagcgcggtcggaagaagctgctgtacatctttaagcaacccttcatgaggcct gtgcagactactcaagaggaggacggctgttcatgccggttcccagaggaggaggaaggcggctgcgaactgcgcgtgaaattcagccgcag cgcagatgctccagcctacaagcaggggcagaaccagctctacaacgaactcaatcttggtcggagagaggagtacgacgtgctggacaagc ggagaggacgggacccagaaatgggcgggaagccgcgcagaaagaatccccaagagggcctgtacaacgagctccaaaaggataagatg gcagaagcctatagcgagattggtatgaaaggggaacgcagaagaggcaaaggccacgacggactgtaccagggactcagcaccgccacc aaggacacctatgacgctcttcacatgcaggccctgccgcctcggGGATCCGGCGCAACAAACTTCTCTCTGCTGA AACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGTGCAGCCAGCCCCTGGACGTGAT CCTGCTGCTGGACGGCAGCAGCAGCTTCCCCGCCAGCTACTTCGACGAGATGAAGAGCT TCGCCAAGGCCTTCATCAGCAAGGCCAACATCGGCCCCAGGCTGACCCAGGTGAGCGT GCTGCAGTACGGCAGCATCACCACCATCGACGTGCCCTGGAACGTGGTGCCCGAGAAG GCCCACCTGCTGAGCCTGGTGGACGTGATGCAGAGGGAGGGCGGCCCCAGCCAGATCG GCGACGCCCTGGGCTTCGCCGTGAGGTACCTGACCAGCGAGATGCACGGCGCCAGGCC CGGCGCCAGCAAGGCCGTGGTGATCCTGGTGACCGACGTGAGCGTGGACAGCGTGGAC GCCGCCGCCGACGCCGCCAGGAGCAACAGGGTGACCGTGTTCCCCATCGGCATCGGCG ACAGGTACGACGCCGCCCAGCTGAGGATCCTGGCCGGCCCCGCCGGCGACAGCAACGT GGTGAAGCTGCAGAGGATCGAGGACCTGCCCACCATGGTGACCCTGGGCAACAGCTTC CTGCACAAGCTGTGCAGCGGCTTCGTGAGGATCTGCACCGGCGGGGGGGGGGGGTCTG GGGGGGGGGGGTCTGGGGGGGGGGGGTCTGGGGGGGGGGGGTCTGGGGGGGGGGGGT CTGGGGGGGGGGGGTCTATGTGTCACCAGCAGTTGGTCATCTCTTGGTTTTCCCTGGTTT TTCTGGCATCTCCCCTCGTGGCCATATGGGAACTGAAGAAAGATGTTTATGTCGTAGAA TTGGATTGGTATCCGGATGCCCCTGGAGAAATGGTGGTCCTCACCTGTGACACCCCTGA AGAAGATGGTATCACCTGGACCTTGGACCAGAGCAGTGAGGTCTTAGGCTCTGGCAAA ACCCTGACCATCCAAGTCAAAGAGTTTGGAGATGCTGGCCAGTACACCTGTCACAAAG GAGGCGAGGTTCTAAGCCATTCGCTCCTGCTGCTTCACAAAAAGGAAGATGGAATTTGG TCCACTGATATTTTAAAGGACCAGAAAGAACCCAAAAATAAGACCTTTCTAAGATGCGA GGCCAAGAATTATTCTGGACGTTTCACCTGCTGGTGGCTGACGACAATCAGTACTGATT TGACATTCAGTGTCAAAAGCAGCAGAGGCTCTTCTGACCCCCAAGGGGTGACGTGCGG AGCTGCTACACTCTCTGCAGAGAGAGTCAGAGGGGACAACAAGGAGTATGAGTACTCA GTGGAGTGCCAGGAGGACAGTGCCTGCCCAGCTGCTGAGGAGAGTCTGCCCATTGAGG TCATGGTGGATGCCGTTCACAAGCTCAAGTATGAAAACTACACCAGCAGCTTCTTCATC AGGGACATCATCAAACCTGACCCACCCAAGAACTTGCAGCTGAAGCCATTAAAGAATT CTCGGCAGGTGGAGGTCAGCTGGGAGTACCCTGACACCTGGAGTACTCCACATTCCTAC TTCTCCCTGACATTCTGCGTTCAGGTCCAGGGCAAGAGCAAGAGAGAAAAGAAAGATA GAGTCTTCACGGACAAGACCTCAGCCACGGTCATCTGCCGCAAAAATGCCAGCATTAGC GTGCGGGCCCAGGACCGCTACTATAGCTCATCTTGGAGCGAATGGGCATCTGTGCCCTG CAGTGTTCCTGGAGTAGGGGTACCTGGGGTGGGCGCCAGAAACCTCCCCGTGGCCACTC CAGACCCAGGAATGTTCCCATGCCTTCACCACTCCCAAAACCTGCTGAGGGCCGTCAGC AACATGCTCCAGAAGGCCAGACAAACTCTAGAATTTTACCCTTGCACTTCTGAAGAGAT TGATCATGAAGATATCACAAAAGATAAAACCAGCACAGTGGAGGCCTGTTTACCATTG GAATTAACCAAGAATGAGAGTTGCCTAAATTCCAGAGAGACCTCTTTCATAACTAATGG GAGTTGCCTGGCCTCCAGAAAGACCTCTTTTATGATGGCCCTGTGCCTTAGTAGTATTTA TGAAGACTTGAAGATGTACCAGGTGGAGTTCAAGACCATGAATGCAAAGCTGCTGATG GATCCTAAGAGGCAGATCTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGAT GCAGGCCCTGAATTTCAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCGGATTTTTATAAAACTAAAATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGGGCAGTGACTATTGATAGAGTGATGAGCTATCTGAATGCTTCCCACCACCACCACCACCACtgaC C T AGGcctgcaggGC T AGCC T C GAGatcgataccgtcgacctcgatcgagacctagaaaaacatggagcaatcacaagtagca atacagcagctaccaatgctgattgtgcctggctagaagcacaagaggaggaggaggtgggttttccagtcacacctcaggtacctttaagacca atgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatatcctt gatctgtggatctaccacacacaaggctacttccctgattggcagaactacacaccagggccagggatcagatatccactgacctttggatggtgc tacaagctagtaccagttgagcaagagaaggtagaagaagccaatgaaggagagaacacccgcttgttacaccctgtgagcctgcatgggatg gatgacccggagagagaagtattagagtggaggtttgacagccgcctagcatttcatcacatggcccgagagctgcatccggactgtactgggt ctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagta gtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagcatgtgagcaaaaggcca gcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagt cagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttac cggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagct gggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgc cactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacac tagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggt agcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtg gaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaa agtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgact ccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagat ttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaa gctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattca gctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaa gttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaa ccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaag tgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactg atcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaat gttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaa ataggggttccgcgcacatttccccgaaaagtgccacctgac METHODS

[0188] Provided herein are engineered cells and pharmaceutical compositions comprising the engineered cells disclosed herein and one or more acceptable carriers, diluents, or excipients. Further provided herein are methods of treating cancer, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of cancer, such as solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) a pharmaceutical composition provided herein. Further provided herein are methods of treating cancer, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of cancer, such as solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) an effective amount of an engineered cell provided herein. Particularly, provided herein are methods of treating cancer selected from the list consisting of: solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) an effective amount of a pharmaceutical composition comprising an engineered cell provided herein. Particularly, the provided herein are methods of treating cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of cancer selected from the list consisting of: solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) an effective amount of an engineered cell provided herein.

[0189] Further provided herein are pharmaceutical compositions provided herein for use in treating cancer, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) a pharmaceutical composition provided herein. Further provided herein are engineered cells provided herein for use in treating cancer, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) an effective amount of an engineered cell provided herein. Particularly, provided herein are pharmaceutical compositions provided herein for use in treating cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) an effective amount of a pharmaceutical composition comprising an engineered cell provided herein. Particularly, provided herein are pharmaceutical compositions provided herein for use in treating cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) an effective amount of an engineered cell provided herein.

[0190] Further provided herein are uses of a pharmaceutical composition provided herein for treating cancer, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) a pharmaceutical composition provided herein. Further provided herein are uses of an engineered cell provided herein for treating cancer, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) an effective amount of an engineered cell provided herein. Particularly, provided herein are uses of a pharmaceutical composition provided herein for treating cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) an effective amount of a pharmaceutical composition comprising an engineered cell provided herein. Particularly, provided herein are uses of an engineered cell provided herein for treating cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis, comprising administering to a patient or subject in need thereof (e.g., a patient or subject with or at risk of cancer selected from the list consisting of solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis) an effective amount of an engineered cell provided herein.

[0191] EXAMPLES

[0192] In embodiments, tumor cells were targeted with an MSLN-CAR along with the incorporation of a secreted IL12 fused with a collagen binding domain (A3) for trapping the CAR in a collagen- rich TME in order to enhance activity while limiting systemic IL 12 exposure and side effects.

[0193] Example 1

[0194] Secretome analysis of NK and T cells (FIG. 1). In embodiments, NK and T cells were extracted from the same donor leukapheresis collars. NK cells were differentiated into CIML and transduced. T cells were activated using CD3 / CD28 beads (TransAct, Miltenyi Biotec®) for 3 days and then transduced. Both NK and T cells were transduced with the following constructs: MSLN- CAR and MSLN-CAR-IL12 and then cultured for 10-12 days. The same donor untransduced and transduced cells were co-cultured with and without tumor target cells (OVCAR8) at E:T ratio of 1 : 1 (250,000 cells in a 24-well plate) for 24 hours, and then the supernatant was collected and stored at - 80 °C. At a later time point, this supernatant was thawed and then evaluated for cytokine / chemokines using a 48-plex panel by Eve Technologies. The cytokine / chemokine are reported as pg / mL, <OOR values are reported as 0, and the values >OOR were extrapolated from the calibration curve, per manufacturer directions.

[0195] Example 2

[0196] Transduction of CIML NK cells (FIGS. 2A-2F), In embodiments, a MSLN-CAR gene construct was designed with the following components: signal peptide (CD8), MSLN scFv derived from the YP218 antibody, transmembrane (CD8), followed by intracellular signaling domains, 4- 1BB and CD3z. The CAR construct was linked to eGFP via P2A self-cleaving peptide that allowed for assessment of the transduction efficiency. IL12 or IL12-A3 (IL12-A3) were cloned by replacing GFP in a MSLN-CAR construct. The IL12 sequence consisted of p35 followed by p40 with an elastin linker. Collagen binding A3 domain from human vWF factor was linked to the to the N- terminus of p35 subunit using a flexible linker (G4S)e. In these constructs, HA tag on the CAR protein was used to determine the transduction efficiency. Lentiviral supernatants were produced using a Baboon lentiviral (BaLV) system and titrated using Jurkat cells.

[0197] For transduction, CIML NK cells were rested for ~24 hours after CIML activation. 12-well plates were coated with RetroNectin (20 pg / mL) for 2 hours at room temperature or overnight at 4 °C. The surface was then blocked with 2% BSA solution for 30 minutes, and the wells washed once with PBS. Vectofusion-1 (10 pg / mL) and CIML NK cells (IxlO6per well) were added to the coated plates followed by the addition of lentivirus at MO 1=0.5 - 1 (titrated using Jurkat cells). Spinfection was carried out for 90 mins at 4000 rpm (37 °C). After spinfection, NK MACS media (Miltenyi Biotec®) supplemented with 5% human serum and 1% Pen / Strep (complete NK MACS media) was added to the transduced cells in the presence of IL2 (500 U / mL). The cells were washed after 3 days and cultured in NK MACS in the presence of low dose IL15 (1 ng / mL).

[0198] Characterization of IL12-engineered CAR NK cells. In embodiments, the transduced cells were evaluated for transduction efficiency by gating on HA-tag+cells and by intracellular staining for IL12 using flow cytometry. The supernatant from the engineered NK cells was collected and evaluated for secreted IL12 using ELISA (Human IL12 p70, Abeam® AB213791).

[0199] Collagen binding ability of IL 12- A3. In embodiments, collagen binding activity was evaluated using a 3D microfluidic chip consisting of 3 chambers each with a central gel channel flanked by two media channels (idenTx®, AimBiotech). A central gel channel was fdled with collagen hydrogel prepared by dissolving rat tail collagen I into 1 OX PBS with phenol red (Sigma- Aldrich®, 114537-5G) followed by pH adjustment by NaOH solution. A pH of 7.0 to 7.5 was confirmed using Panpeha Whatman paper (Sigma- Aldrich®). Before injection, collagen hydrogel was kept on ice. After incubation for 40 minutes at 37°C in sterile humidity chamber, 250,000 CAR- NK cells were injected in one side channel. After 40 minutes incubation, devices were hydrated with culture media (NK MACS media + 1 ng / mL IL 15). After 72-96 hours, microfluidic chips were stained with IL12 antibody incubated at room temperature for 30 minutes, washed twice with PBS and imaged. Image capture and analysis were performed using a Nikon® Eclipse 80i fluorescence microscope equipped with Z-stack (Prior®), motorized stage (ProScan®) and ZYLA5.5 sCMOS camera (Andor®) and NIS-Elements® AR software package.

[0200] Protein and gene expression analysis of IL12-engineered CAR NK cells. In embodiments, for the proteomic analysis, IL12-engineered CAR-NK cells were cultured for 8-10 days in NK MACS media supplemented with 1 ng / mL of IL-15. The cells were then stained using our flow panels to evaluate the following activating and inhibitory receptors on NK cells: CD56, CD16, NKp30, NKp44, DNAM1, KLRG1, NKG2D, NKG2A, Siglec7, CD39, CD69, NKG2C, CD2, TRAIL, CD158 (KIR2DL1 / S1 / S3 / S5), FasL, TIGIT and Tim3 distributed across 4 panels using flow cytometry. For the gene expression analysis, IL12-engineered CAR-NK cells were cultured for 6 days. The cells were then collected, washed once with PBS, and dry pellets were frozen in -80 °C. Bulk RNA sequencing analysis was performed by MedGenome Inc. (California, USA) and analyzed using Partek® Flow® Genomic analysis software.

[0201] Metabolic analysis of IL12-engneered NK cells. In embodiments, untransduced, MSLN- CAR, MSLN-CAR-IL12 and MSLN-CAR-IL12-A3 cells were rested in media and then plated at a density of 300,000 cells per well in Agilent® Seahorse® XFe96 cell culture microplate. The Mito stress test and Glycolysis test was performed using the Agilent® Seahorse® XF T cell metabolic profding kit and XF Glycolysis stress test kit following the manufacturer’s instructions. The data was analyzed using the Agilent® wave software.

[0202] CAR construct design, transduction and characterization of IL12-engineered MSLN-CAR CIML NK cells. In embodiments, CAR expression was assessed by HA-tag staining. Quantification of IL12 secretion from untransduced, MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 CIML NK cells was assessed using ELISA. Collagen binding activity of IL12-A3 was assessed using a microfluidic device containing a 3-Dimensinal collagen gel and transduced CIML NK cells loaded into the side-channel. After 96-hour incubation, the devices were washed and stained for IL12 cytokine. The data is represented as mean fluorescence intensity (MFI) measured over the area of the device. Expression of key activation, inhibitory and cytotoxic / killer ligands in untransduced, MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 CIML NK cells was measured by flow cytometry and represented as percentage positive cells in the heat map. The data are represented as mean ± SD.

[0203] Example 3

[0204] Characterization of IL12-engineered MSLN-CAR CIML NK cells (FIGS 3A-3D), In embodiments, The oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were evaluated in real time using XFe96 analyzer after the injection of oligomycin, BAMP15, and Rot / AA, and glucose, oligomycin and 2DG, respectively. The data are represented as mean ± SD or mean ± SEM.

[0205] Example 4

[0206] IL12-engineering of MSLN-CAR CIML NK cells dramatically enhances their anti-tumor responses (FIGS. 4A-4C) In embodiments, cis-activation of the CAR CIML NK cells by secreted IL12 or IL12-A3 molecules was used. Cytotoxicity (as measured by CCK8 assay) of 0VCAR8, SKOV3, AsPCl, and Capan2 cell lines after 24-hour co-culture with untransduced, MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 CIML NK cells. IFNg secretion as measured by ELISA from the untransduced, MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 CIML NK cells after 24-hour co-culture with the cancer cell lines. The data are is represented as mean ± SD.

[0207] Cytotoxicity by IL12-engineered NK cells against EOC and PDAC cells. In embodiments, for NK cell cytotoxicity, EOC cells (0VCAR8, SK0V3) and PDAC cells (AsPCl, Capan2) were plated in a 96 flat bottom plate (10,000 cells per well) and allowed to adhere overnight. Untransduced (UNT), MSLN-CAR, MSLN-CAR-IL12, or MSLN-CAR-IL12-A3 NK cells were added to the cancer cells at E:T ratios of 1 :2, 1 : 1, and 2: 1 and co-cultured for 24 hours in the presence of IL15 (1 ng / mL). Cell viability of cancer cells was evaluated via CCK8 / WST-8 assay (Abeam® or SelleckChem® B34304) per manufacturer’s directions. WST-8 solution (10 uL per well) was added and incubated for 3-5 hours. Post-incubation, the absorbance was measured at 460 nm using a microplate reader. The specific cytotoxicity was calculated as 100-[(Abs of cancer cells co-cultured with NK / Abs of cancer cells only) x 100], NK cells alone and media were used as the baseline. The conditioned media from E:T of 2: 1 condition after 24 hours of co-cultures was used for the IFNg secretion using ELISA (Abeam®, ab46025). Assessment of cytotoxicity in patient-derived models. In embodiments, the PDX cells from all the models (DF83, DF14, and DF118) exhibited 3D-spheroidal architecture, and hence, the spheroid count was used to set up the co-culture experiments using 500 spheroids per condition. Untransduced, MSLN-CAR, or MSLN-CAR-IL12-A3 CIML NK cells were added at E:T ratio of 5: 1 and 2: 1. After 48 hours of co-culture, the cells were dissociated with TrypLE dissociation solution (Gibco®) for 8-10 min and then washed once with FACS buffer. The single cells were stained for EpCAM, Apotracker green (Biolegend®), and Zombie NIR for 25 minutes at room temperature. Cells were washed twice after staining and evaluated using flow cytometry. The data are reported as the percentage of apoptotic cells (early plus late apoptotic cells) gating on EpCAM+cell population. Patient-derived organoids (PDOs) were also used. The same procedure was used for the co-culture and staining as described above using PDX cells except for using 24-hour co-culture with the organoids.

[0208] Example 5

[0209] IL12-engineering of MSLN-CAR CIML NK cells dramatically enhances their anti -turn or responses (FIG. 5) In embodiments, apoptotic cell population (double positive Apotracker and live / dead staining gated on EpCAM+cells) after 24-hour co-culture of 3 different patient centric models including patient-derived organoids (top panel) and patient-derived xenograft cells (bottom panel) with untransduced, MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 CIML NK cells. The data are represented as mean ± SD and mean ± SEM.

[0210] Example 6

[0211] Evaluation of longterm cytotoxicity of IL12-engineered NK cells (FIGS. 6A-6B). In embodiments, OVCAR8-mcLuc or AsPCl-mcLuc were plated in a 96 flat bottom plate (10,000 cells per well) and allowed to adhere overnight. Untransduced (UNT), MSLN-CAR, MSLN-CAR-IL12, or MSLN-CAR-IL12-A3 NK cells were added to the cancer cells at E:T ratios of 1 :2 and 1 :1. The viability of cancer cells was measured using mCherry every 3 hours. Cancer cells (10,000 cells per well) were rechallenged every 3 days for a total of 3 rechallenges across 12 days in the presence of IL15 (1 ng / mL).

[0212] Long-term re-challenge experiment assessing NK cell-mediated cytotoxicity against cancer cell lines OVCAR8 and AsPC 1 at E:T ratio of 1 : 1. Changes in tumor cell viability were measured using mCherry signal across 3 successive challenges over 12 days using Incucyte live imaging system. The data are represented as total integrated intensity (red, mCherry) using NK cells from four independent healthy donors and three technical replicates. Example 7

[0213] Assessment of degranulation (CD 107a) and cytolytic mediators (FIGS. 7A-7C). In embodiments, to evaluate degranulation (CD 107a) and cytolytic mediators including IFNg, Granzyme B (GrB), Perforin (PRF) and TNFa NK cells after 24-hour incubation with cancer cells; 0VCAR8 or AsPC 1 a E:T ratio of 2: 1. GolgiPlug® and GolgiStop® (Brefeldin A and Monensin, BD biosciences®) were added after 1 hour of co-culture and then further incubated for 18 hours. Cells were then collected and stained for 30 mins on ice for surface proteins (CD56, CD3, and CD107a) (antibody details in Table SI) as well as live / dead dye (Invitrogen®). The cells were washed once with staining buffer before fixation (BD Cytofix / perm). Post fixation, cells were washed twice with Perm wash (IX), and intracellular staining performed (IFNg, GrB, PRF, and TNFa for 30 minutes on ice, then washed once with FACs buffer and data acquired using BD LSR Fortessa® Cell Analyzer. Data was reported as percentage of CD107a, IFNg, GrB, PRF, and TNFa positive NK cells calculated by gating on CD3 CD56+NK cells.

[0214] Expression of key cytolytic mediators in IL12-engineered NK cells including CD107a+, IFNg+, Granzyme B (GrB), Perforin (PRF) and TNFa NK cells after 24-hour incubation with cancer cells; OVCAR8 or AsPCl. The data are represented as mean + SD from four independent NK donors. Expression of key NK cell receptors in MSLN-CAR-IL12 and MSLN-CAR-IL12-A3 CIML NK cells compared to MSLN-CAR NK cells post 24-hour co-culture with tumor cells (OVCAR8) as assessed by flow cytometry.

[0215] Example 8

[0216] Assessment of degranulation (CD 107a) and IFNg production in the bystander NK cells and T cells (FIGS. 8A-8D), In embodiments, to evaluate the trans-activation of naive NK cells upon exposure to IL12-engineered CAR NK cells, naive NK cells (25,000 cells) were co-cultured with MSLN-CAR or IL12-engineered MSLN-CAR NK cells (25,000 cells) for 48 hours. The naive NK cells were pre-stained with CTV (CellTraceViolet) to differentiate them from the IL12-engineered CARNK cells. The CAR-NK plus naive NK cells were then cultured with the cancer cells (OVCAR8 or AsPCl, 25,000 cells per well). GolgiPlug® and GolgiStop® (Brefeldin A and Monensin, BD biosciences®) were added after 1 hour of co-culture and then further incubated for 5 hours. The cells were then stained using the same method as described above to assess degranulation (CD 107a) and IFNg production. The data are reported as percentage of CD 107a and IFNg positive NK cells calculated by gating on CTV+CD3 CD56+NK cells. To evaluate the transactivation of the bystander T cells, the T cells were first transduced with an MSLN-CAR as T cells need a tumor specific CAR or a TCR for their optimal activation by the target cells. The CAR T cells were also pre-stained with CTV to differentiate them from the IL12- engineered CAR NK cells. CD3+MSLN-CAR T cells (25,000 cells) were co-cultured with IL12- engineered NK cells (25,000 cells) for 96 hours. The CAR-T cells plus engineered CAR-NK cells were then exposed to the cancer cells (OVCAR8 or AsPCl, 25,000 cells per well) for additional 24 hours. The cells were then stained using the same method as described above to assess degranulation (CD 107a) and IFNg production by the T cells. The data are reported as percentage of CD 107a and IFNg positive T cells calculated by gating on CTV+CD3+T cells.

[0217] Proliferation assessment of the bystander NK or T cells. In embodiments, the CTV+bystander NK or T cells in the trans-activation experiment was used to evaluate their proliferation. Briefly, the CTV-labeled Bystander NK or MSLN-CAR T cells were co-cultured with IL 12- engineered CAR NK cells for 48 and 96 hours, respectively. The proliferation was evaluated by the cell divisions. The intensity of the CTV signal and percentage of CTV-negative T cells were also quantified using FlowJo® and the proliferative index was defined as the total number of divisions divided by the number of cells that went into divisions.

[0218] Transactivation of the bystander NK (By-NK) cells by IL12-engineered CAR CIML NK cells. In embodiments, co-culture of IL12-engineered MSLN-CAR CIML NK cells with the same donor (bystander) NK cells (CTV+) for 48 hours followed by their exposure to the cancer cells for 6 hours was used. Percentage of CD107a+and IFNg+among the CTV+By-NK cells co-cultured with MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 followed by their exposure to OVCAR8 and AsPCl cells was determined. Proliferation of By-NK cells was measured by the CTV dilution after 48-hour co-culture with MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 cells. The data are represented as mean ± SD.

[0219] Example 9

[0220] Transactivation of the bystander T (By-T) cells by IL12-engineered CAR CIML NK cells (FIGS. 9A-9D), In embodiments, co-culture of IL12-engineered MSLN-CAR CIML NK cells with the same donor bystander CAR-T cells (CTV+) for 96 hours followed by their exposure to the cancer cells for 24 hours was used. Percentage of CD I 07a and IFNg+among the CTV+By-T cells gated on CD4+T cells and CD8+T cells co-cultured with MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR- IL12-A3 followed by their exposure to OVCAR8 and AsPCl cells was determined. The data are represented as mean ± SD. Example 10

[0221] Transactivation of the bystander T (By-T) cells by IL12-engineered CAR CIML NK cells (FIGS. 10A-10B), In embodiments, co-culture of IL12-engineered MSLN-CAR CIML NK cells with the same donor bystander CAR-T cells (CTV+) for 96 hours followed by their exposure to the cancer cells for 24 hours was used. Percentage of CD107a+and IFNg+among the CTV+By-T cells gated on CD41T cells and CD81T cells co-cultured with MSLN-CAR, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 followed by their exposure to OVCAR8 and AsPCl cells was determined. The data are represented as mean ± SD.

[0222] Example 11

[0223] Transactivation of the bystander patient derived immune cells upon co-culture with the engineered CIML NK cells (FIG. 11). In embodiments, the fluid was processed by centrifugation at 1500 rpm, and the cell pellets were filtered through 100 pm filter. The cells were washed once with PBS and then RBC lysis was performed. The cells were washed again and frozen at -80° C for future use. The ascites cells were screened from each patient to determine the percentage of immune cells including NK and T cells.

[0224] For the evaluation of tumor-associated NK cells, ascites cells (100,000) were co-cultured with IL12-engineered CAR-CIML NK cells (100,000 cells per well and pre-stained with CTV to differentiate from the ascites cells) for 48 hours in a 96-well plate. The co-cultured cells were then exposed to tumor cells (OVCAR8, 7000 cells per well) for additional 48 hours. After a total of 96 hours, the cells were collected, stained for CD45, CD3, CD56, DNAM1, NKp30, CD25 and CD69 for 30 minutes on ice, fixed using 1% PF A, washed with FACs buffer, and acquired using BD LSR Fortessa® Cell Analyzer. The data is represented as mean Fluorescence intensity (MFI) and percentage positive cells for DNAM1, NKp30, CD25 and CD69 gated on the hCD45+, CTV, CD3', and CD56+ascites cells, and the CAR-NK cells were excluded by pre-staining with CTV.

[0225] For the evaluation of tumor-associated T cells, ascites cells (100,000) were incubated with CD3 / CD28 beads (1 uL per well, TransAct, Miltenyi®) and low IL2 (20 U / mL) for 48 hours. The ascites cells were then co-cultured with IL12-engineered CAR-CIML NK cells (100,000 cells per well) for additional 96 hours. The cells were then collected, stained for CD45, CD3, CD56, CD25, CD69, LAG3, Tim3, CTLA4 and PD1 for 30 mins on ice, fixed using 1% PF A, washed with FACs buffer, and acquired using BD LSR Fortessa® Cell Analyzer (antibody details in Table SI). The data is represented as mean fluorescence intensity (MFI) and percentage positive cells for CD25, CD69, LAG3, Tim3, CTLA4 and PD1 gated on the hCD45+, and CD3+ascites cells, and the CAR-NK cells were excluded by pre-staining with CTV.

[0226] Transactivation of tumor-associated immune cells by IL12-engineered CAR CIML NK cells. In embodiments, trans-activation of tumor-associated immune cells (NK and T cells) derived from the ascitic fluid of patients with advanced ovarian cancer upon co-culture with IL12-engineered MSLN-CAR CIML NK cells was used. Representative histograms are shown of DNAM1, NKp30, NKG2D, CD25 and CD69 in tumor associated NK (TA-NK) cells (gated on CTV CD45 CD3' CD56+cells). Representative histograms are shown of key surface receptors CD25, CD69, LAG3, Tim3, CTLA4 and PD1 in tumor associated T (TA-T) cells (gated on CD45+CD3+cells). The data are represented as mean ± SD.

[0227] Example 12

[0228] Transactivation of the bystander patient derived immune cells upon co-culture with the engineered CIML NK cells (FIGS. 12A-12B). In embodiments, fluid was processed by centrifugation at 1500 rpm, and the cell pellets were filtered through 100 um filter. The cells were washed once with PBS and then RBC lysis was performed. The cells were washed again and frozen at -80° C for future use. The ascites cells were screened from each patient to determine the percentage of immune cells including NK and T cells.

[0229] For the evaluation of tumor-associated NK cells, ascites cells (100,000) were co-cultured with IL12-engineered CAR-CIML NK cells (100,000 cells per well, pre-stained with CTV to differentiate from the ascites cells) for 48 hours in a 96-well plate. The co-cultured cells were then exposed to tumor cells (OVCAR8, 7000 cells per well) for additional 48 hours. After a total of 96 hours, the cells were collected, stained for CD45, CD3, CD56, DNAM1, NKp30, CD25 and CD69 for 30 minutes on ice, fixed using 1% PF A, washed with FACs buffer and acquired using BD LSR Fortessa® Cell Analyzer. The data is represented as mean fluorescence intensity (MFI) and percentage positive cells for DNAM1, NKp30, CD25 and CD69 gated on the hCD45+, CTV, CD3', and CD56+ascites cells, and the CAR-NK cells were excluded by pre-staining with CTV.

[0230] For the evaluation of tumor-associated T cells, ascites cells (100,000) were incubated with CD3 / CD28 beads (1 uL per well, TransAct, Miltenyi®) and low ZL2 (20 U / mL) for 48 hours. The ascites cells were then co-cultured with IL12-engineered CAR-CIML NK cells (100,000 cells per well) for additional 96 hours. The cells were then collected, stained for CD45, CD3, CD56, CD25, CD69, LAG3, Tim3, CTLA4 and PD1 for 30 mins on ice, fixed using 1% PF A, washed with FACs buffer, and acquired using BD LSR Fortessa® Cell Analyzer. The data is represented as mean fluorescence intensity (MFI) and percentage positive cells for CD25, CD69, LAG3, Tim3, CTLA4 and PD1 gated on the hCD45+and CD3+ascites cells, and the CAR-NK cells were excluded by prestaining with CTV.

[0231] Transactivation of tumor-associated immune cells by IL12-engineered CAR CIML NK cells. In embodiments, trans-activation of tumor-associated immune cells (NK and T cells) derived from the ascitic fluid of patients with advanced ovarian cancer upon co-culture with IL12-engineered MSLN-CAR CIML NK cells was used. Representative histograms of DNAM1, NKp30, NKG2D, CD25 and CD69 in tumor associated NK (TA-NK) cells (gated on CTV CD45+CD3 CD56+cells). Representative histograms of key surface receptors CD25, CD69, LAG3, Tim3, CTLA4 and PD1 in tumor associated T (TA-T) cells (gated on CD45+CD3+cells). The data are represented as mean ± SD.

[0232] Example 13

[0233] Therapeutic efficacy of IL12-engineered MSLN-CAR CIML NK cells in an ovarian cancer xenograft model (FIGS. 13A-13B). In embodiments, a tumor model and NK cell therapy were used; Tg-IL15 NSG mice received 0VCAR8-mcLuc (5xl0?, IP) followed by PBS (control), MSLN-CAR- IL12, MSLN-CAR-IL12-A3 CIML NK cells (IxlO6, IP) on day 15 after tumor cell injection. Representative BLI images are shown of xenograft mice pre-NK cell infusions and on days 21, 28, 37 after tumor implantation in different treatment groups (n=5 mice per group). Tumor growth is shown for 0VCAR8 model measured by total flux (BLI) over a period of 40 days and survival of mice receiving PBS, MSLN-CAR, MSLN-CAR-IL12, or MSLN-CAR-IL12-A3 CIML NK cell treatment (n=8 or 9 mice per group). The arrow indicates the day of NK cell injection. The data are represented as mean ± SD or mean ± SEM.

[0234] Example 14

[0235] In vivo therapeutic efficacy of IL12-engineered CAR CIML NK cells (FIGS. 14A-14B). In embodiments, NOG-IL15 mice (6-8 weeks old) were purchased from The Jackson Laboratory®. OVCAR8 or AsPCl cells were transduced with mCherry-luciferase(mcLuc) using lentivirus and followed by puromycin selection. OVCAR8-mcLuc cells (5xlO5cells) were injected intraperitoneally in PBS:Matrigel mixture (1 : 1, 100 uL, Coming® GFR phenol red-free). Two weeks after the cancer cell implantation, mice were randomized into 4 groups: Control (no NK cells), MSLN-CAR cells, MSLN-CAR-IL12, and MSLN-CAR-IL12-A3 CIML NK cells (n=9 mice per group). The mice in the treatment group received a single injection of 1 million NK cells intraperitoneally (i.p.). The NK cells were cultured ex vivo in NK MACS media supplemented with low dose IL15 (1 ng / mL) for 8-10 days after transduction prior to being injected into the mice. The tumor progression was monitored with weekly BLI imaging. Mice were monitored for survival and euthanized upon disease progression, over-distended abdomen (due to the growth of solid tumors and / or ascites), 15% loss in body weight, or poor body condition (BSC).

[0236] A separate cohort of mice (n=5) was used to determine the persistence and distribution of NK cells. For this, OVCAR8 model was used with same the tumor cell and NK cell numbers as reported in the previous section. Mice were euthanized after 2 weeks after NK cell injections (total 4 weeks after tumor cell implantation). At the endpoint, blood, peritoneal wash, and major organs including liver, lungs, and spleen were collected. Tumor cells and NK cell distribution were evaluated in each organ.

[0237] IL12 levels in the peripheral blood (serum) on 7-day after the NK cell injections (n=4 mice per group). Percentage of the human NK cells (gated on mCD45‘ hCD45+) in various organs after 2 weeks of NK cells injections (n=4-5 mice per group). The data are represented as mean ± SD or mean ± SEM.

[0238] EQUIVALENTS

[0239] Various aspects of the present disclosure may be used alone, in combination, or in a variety of arrangements not specifically discussed in the embodiments described in the foregoing and is, therefore, not limited in its application to the details and arrangement of components set forth in the foregoing description or illustrated in the drawings. For example, aspects described in one embodiment may be combined in any manner with aspects described in other embodiments.

Claims

CLAIMSWhat is claimed:

1. An engineered cell, comprising a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:A - B - 1 - C (Formula I), wherein:A is a mesothelin antibody means for binding a target antigen;B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;I is interleukin 12 (IL- 12); andC is a collagen binding domain.

2. An engineered cell, comprising a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:A - B - 1 (Formula II), wherein:A is a mesothelin antibody means for binding a target antigen;B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; andI is interleukin 12 (IL- 12).

3. An engineered cell, comprising a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:A - B - 1 - C (Formula III), wherein:A is an antibody or fragment thereof for binding a target antigen;B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;I is interleukin 12 (IL- 12); andC is a collagen binding domain.

4. An engineered cell, comprising a natural killer cell (an NK cell), comprising a chimeric antigen receptor (CAR) of the formula:A - B - 1 (Formula IV), wherein:A is an antibody or fragment thereof for binding a target antigen;B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; andI is interleukin 12 (IL- 12).

5. The engineered cell of any one of claims 1-4, wherein the NK cell is a memory -like NK cell.

6. The engineered cell of any one of claims 1-5, wherein the hinge region comprises a hinge region derived from CD3^, CD4, CD8a, CD28, IgGl, IgG2, or IgG4.

7. The engineered cell of any one of claims 1-6, wherein the hinge region comprises a hinge region derived from CD28.

8. The engineered cell of any one of claims 1-7, wherein the hinge region comprises an amino acid sequence of SEQ ID NO: 13.

9. The engineered cell of any one of claims 1-8, wherein the hinge region comprises an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 14.

10. The engineered cell of any one of claims 1-9, wherein the transmembrane domain comprises a transmembrane domain derived from CD3(^, CD4, CD8a, CD28, or CD137.

11. The engineered cell of any one of claims 1-10, wherein the transmembrane domain comprises a transmembrane domain derived from CD28.

12. The engineered cell of any one of claims 1-11, wherein the transmembrane domain comprises the amino acid sequence of SEQ ID NO: 15.

13. The engineered cell of any one of claims 1-12, wherein the transmembrane domain comprises an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 16.

14. The engineered cell of any one of claims 1-13, wherein the cytoplasmic domain comprises a signaling domain and / or a costimulatory domain.

15. The engineered cell of any one of claims 1-14, wherein the signaling domain comprises a signaling domain derived from CD3i CD27, CD28, CD40, KIR2DS2, MyD88, or 0X40.

16. The engineered cell of any one of claims 1-15, wherein the signaling domain comprises a signaling domain derived from CD3(^.

17. The engineered cell of any one of claims 1-16, wherein the signaling domain comprises the amino acid sequence of SEQ ID NO: 19.

18. The engineered cell of any one of claims 1-17, wherein the signaling domain comprises an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 20.

19. The engineered cell of any one of claims 1-18, wherein the costimulatory domain comprises a costimulatory domain derived from CD3y, CD35, CD3s, CD3(^, CD27, CD40, CD28, CD72, CD80, CD86, CLEC-1, 4-1BB, TYROBP (DAP12), Dectin-1, FcaRI, FcyRI, FcyRII, FcyRIII, FcsRI, IL-2RB, ICOS, KIR2DS2, MyD88, 0X40, or ZAP70.

20. The engineered cell of any one of claims 1-19, wherein the costimulatory domain comprises a costimulatory domain derived from 4-1BB.

21. The engineered cell of any one of claims 1-20, wherein the costimulatory domain comprises the amino acid sequence of SEQ ID NO: 17.

22. The engineered cell of any one of claims 1-21, wherein the costimulatory domain comprises the amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 18.

23. The engineered cell of any one of claims 1-22, wherein the collagen binding domain comprises a collagen binding domain derived from von Willebrand Factor (vWF or vWBF), fibronectin protein (FN), Clostridium histolyticum protein ColH, or collagenase-derived peptide (aCBD).

24. The engineered cell of any one of claims 1-23, wherein the collagen binding domain comprises collagen binding domain derived from vWF.

25. The engineered cell of any one of claims 1-24, wherein the collagen binding domain comprises comprising the amino acid sequence of SEQ ID NO: 33.

26. The engineered cell of any one of claims 1-25, wherein the collagen binding domain comprises comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 34.

27. The engineered cell of any one of claims 1-26, wherein A comprises the complementarity determining regions (CDRs) LCDR1, LCDR2 and LCDR3, or determining regions (CDRs) HCDR1, HCDR2 and HCDR3, wherein: a. the amino acid sequence of LCDR1 is SEQ ID NO: 1, the amino acid sequence of LCDR2 is SEQ ID NO:2, the amino acid sequence of LCDR3 is SEQ ID NO:3; or b. the amino acid sequence of HCDR1 is SEQ ID NO: 8, the amino acid sequence of HCDR2 is SEQ ID NO:9, the amino acid sequence of HCDR3 is SEQ ID NO: 10.

28. The engineered cell of any one of claims 1-27, wherein A comprises the complementarity determining regions (CDRs) LCDR1, LCDR2 and LCDR3; and determining regions (CDRs) HCDR1, HCDR2 and HCDR3, wherein: a. the amino acid sequence of LCDR1 is SEQ ID NO: 1, the amino acid sequence of LCDR2 is SEQ ID NO:2, the amino acid sequence of LCDR3 is SEQ ID NO:3; and b. the amino acid sequence of HCDR1 is SEQ ID NO: 8, the amino acid sequence of HCDR2 is SEQ ID NO:9, the amino acid sequence of HCDR3 is SEQ ID NO: 10.

29. The engineered cell of any one of claims 1-28, wherein the A comprises a light chain variable region (LCVR), or a heavy chain variable region (HCVR), wherein: a. the amino acid sequence of the LCVR is SEQ ID NO: 4, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 5; or b. the amino acid sequence of the HCVR is SEQ ID NO: 11, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 12.

30. The engineered cell of any one of claims 1-29, wherein the A comprises a light chain variable region (LCVR), and a heavy chain variable region (HCVR), wherein: a. the amino acid sequence of the LCVR is SEQ ID NO: 4, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 5; and b. the amino acid sequence of the HCVR is SEQ ID NO: 11, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 12.

31. The engineered cell of any one of claims 1-30, wherein the I comprises an IL-12 peptide, protein, or protein domain.

32. The engineered cell of any one of claims 1-31, wherein the I comprises one or more of SEQ ID NOs: 23, 25, 29, and 35.

33. The engineered cell of any one of claims 1-32, wherein the I comprises one or more of SEQ ID NOs: 23, 25, and 29.

34. The engineered cell of any one of claims 1-33, wherein the I comprises one or more of SEQ ID NOs: 25 and 35.

35. The engineered cell of any one of claims 1-34, wherein the I comprises one or more amino acids encoded by the nucleic acid sequences of of SEQ ID NOs: 24, 26, 30, and 36.

36. An engineered cell as described herein.

37. A nucleic acid encoding a chimeric antigen receptor (CAR) of the formula:A - B - 1 - C (Formula I), wherein:A is a mesothelin antibody means for binding a target antigen;B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;I is interleukin 12 (IL- 12); andC is a collagen binding domain.

38. A nucleic acid encoding a chimeric antigen receptor (CAR) of the formula:A - B I (Formula II),wherein:A is a mesothelin antibody means for binding a target antigen;B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; andI is interleukin 12 (IL-12).

39. A nucleic acid encoding a chimeric antigen receptor (CAR) of the formula:A - B - 1 - C (Formula III), wherein:A is an antibody or fragment thereof for binding a target antigen;B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain;I is interleukin 12 (IL- 12); andC is a collagen binding domain.

40. A nucleic acid encoding a chimeric antigen receptor (CAR) of the formula:A - B - 1 (Formula IV), wherein:A is an antibody or fragment thereof for binding a target antigen;B comprises a hinge region, a transmembrane domain, and a cytoplasmic domain; andI is interleukin 12 (IL- 12).

41. The nucleic acid of any one of claims 37-40, wherein the hinge region comprises a hinge region derived from CD3(^, CD4, CD8a, CD28, IgGl, IgG2, or IgG4.

42. The nucleic acid of any one of claims 37-41, wherein the hinge region comprises a hinge region derived from CD28.

43. The nucleic acid of any one of claims 37-42, wherein the hinge region comprises an amino acid sequence of SEQ ID NO: 13.

44. The nucleic acid of any one of claims 37-43, wherein the hinge region comprises an amino acid sequence encoded by the nucleic acid of SEQ ID NO: 14.

45. The nucleic acid of any one of claims 37-44, wherein the transmembrane domain comprises a transmembrane domain derived from CD3(^, CD4, CD8a, CD28, or CD137.

46. The nucleic acid of any one of claims 37-45, wherein the transmembrane domain comprises a transmembrane domain derived from CD28.

47. The nucleic acid of any one of claims 37-46, wherein the transmembrane domain comprises the amino acid sequence of SEQ ID NO: 15.

48. The nucleic acid of any one of claims 37-47, wherein the transmembrane domain comprises an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 16.

49. The nucleic acid of any one of claims 37-48, wherein the cytoplasmic domain comprises a signaling domain and / or a costimulatory domain.

50. The nucleic acid of any one of claims 37-49, wherein the signaling domain comprises a signaling domain derived from CD3i CD27, CD28, CD40, KIR2DS2, MyD88, or 0X40.

51. The nucleic acid of any one of claims 37-50, wherein the signaling domain comprises a signaling domain derived from CD3(^.

52. The nucleic acid of any one of claims 37-51, wherein the signaling domain comprises the amino acid sequence of SEQ ID NO: 19.

53. The nucleic acid of any one of claims 37-52, wherein the signaling domain comprises an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 20.

54. The nucleic acid of any one of claims 37-53, wherein the costimulatory domain comprises a costimulatory domain derived from CD3y, CD38, CD3s, CD3(^, CD27, CD40, CD28, CD72, CD80, CD86, CLEC-1, 4- IBB, TYROBP (DAP 12), Dectin- 1, FcaRI, FcyRI, FcyRII, FcyRIII, FcsRI, IL-2RB, ICOS, KIR2DS2, MyD88, 0X40, or ZAP70.

55. The nucleic acid of any one of claims 37-54, wherein the costimulatory domain comprises a costimulatory domain derived from 4- IBB.

56. The nucleic acid of any one of claims 37-55, wherein the costimulatory domain comprises the amino acid sequence of SEQ ID NO: 17.

57. The nucleic acid of any one of claims 37-56, wherein the costimulatory domain comprises the amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 18.

58. The nucleic acid of any one of claims 37-57, wherein the collagen binding domain comprises a collagen binding domain derived from von Willebrand Factor (vWF or vWBF), fibronectin protein (FN), Clostridium histolyticum protein ColH, or collagenase-derived peptide (aCBD).

59. The nucleic acid of any one of claims 37-58, wherein the collagen binding domain comprises collagen binding domain derived from vWF.

60. The nucleic acid of any one of claims 37-59, wherein the collagen binding domain comprises comprising the amino acid sequence of SEQ ID NO: 33.

61. The nucleic acid of any one of claims 37-60, wherein the collagen binding domain comprises comprising an amino acid sequence encoded by the nucleic acid sequence of SEQ ID NO: 34.

62. The nucleic acid of any one of claims 37-61, wherein A comprises the complementarity determining regions (CDRs) LCDR1, LCDR2 and LCDR3, or determining regions (CDRs) HCDR1, HCDR2 and HCDR3, wherein: a. the amino acid sequence of LCDR1 is SEQ ID NO: 1, the amino acid sequence of LCDR2 is SEQ ID NO:2, the amino acid sequence of LCDR3 is SEQ ID NO:3; or b. the amino acid sequence of HCDR1 is SEQ ID NO: 8, the amino acid sequence of HCDR2 is SEQ ID NO:9, the amino acid sequence of HCDR3 is SEQ ID NO: 10.

63. The nucleic acid of any one of claims 37-62, wherein A comprises the complementarity determining regions (CDRs) LCDR1, LCDR2 and LCDR3; and determining regions (CDRs) HCDR1, HCDR2 and HCDR3, wherein: a. the amino acid sequence of LCDR1 is SEQ ID NO: 1, the amino acid sequence of LCDR2 is SEQ ID NO:2, the amino acid sequence of LCDR3 is SEQ ID NO:3; and b. the amino acid sequence of HCDR1 is SEQ ID NO: 8, the amino acid sequence of HCDR2 is SEQ ID NO:9, the amino acid sequence of HCDR3 is SEQ ID NO: 10.

64. The nucleic acid of any one of claims 37-63, wherein the A comprises a light chain variable region (LCVR), or a heavy chain variable region (HCVR), wherein: a. the amino acid sequence of the LCVR is SEQ ID NO: 4, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 5; or b. the amino acid sequence of the HCVR is SEQ ID NO: 11, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 12.

65. The nucleic acid of any one of claims 37-64, wherein the A comprises a light chain variable region (LCVR), and a heavy chain variable region (HCVR), wherein: a. the amino acid sequence of the LCVR is SEQ ID NO: 4, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 5; and b. the amino acid sequence of the HCVR is SEQ ID NO: 11, or an amino acid sequence encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 12.

66. The nucleic acid of any one of claims 37-65, wherein the I comprises an IL-12 peptide, protein, or protein domain.

67. The nucleic acid of any one of claims 37-66, wherein the I comprises one or more of SEQ ID NOs: 23, 25, 29, and 35.

68. The nucleic acid of any one of claims 37-67, wherein the I comprises one or more of SEQ ID NOs: 23, 25, and 29.

69. The nucleic acid of any one of claims 37-68, wherein the I comprises one or more of SEQ ID NOs: 25 and 35.

70. The nucleic acid of any one of claims 37-69, wherein the I comprises one or more amino acids encoded by the nucleic acid sequences of of SEQ ID NOs: 24, 26, 30, and 36.

71. A nucleic acid as described herein.

72. A vector encoding the chimeric antigen receptor (CAR) of any one of claims 1-30.

73. A vector comprising the nucleic acid of any one of claims 32-60.

74. The vector of claim 62 or claim 63, wherein the vector is a lentiviral vector.

75. A vector as described herein.

76. A pharmaceutical composition comprising an engineered cell of any one of claims 1-30, and a pharmaceutically acceptable carrier.

77. A pharmaceutical composition comprising the engineered cell of any one of claims 1-30, and one or more pharmaceutically acceptable carriers, diluents, or excipients.

78. A method of treating cancer, comprising administering to a subject with cancer: a. the engineered cell of any one of claims 1-35; or b. the pharmaceutical composition of claim 76 or claim 77.

79. The method of claim 30, wherein the cancer is selected from the list consisting of: solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis.

80. A composition for use in treating cancer, comprising administering to a subject with cancer: a. the engineered cell of any one of claims 1-35; or b. the pharmaceutical composition of any one of claims 76-77.

81. The method of claim 30, wherein the cancer is selected from the list consisting of: solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematological malignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis.

82. Use of a composition for treating cancer, comprising administering to a subject with cancer: a. the engineered cell of any one of claims 1-35; or b. the pharmaceutical composition of any one of claims 76-77.

83. The method of claim 30, wherein the cancer is selected from the list consisting of: solid cancers, collagen containing tumors, cancers overexpressing mesothelin, hematologicalmalignancies, lung adenocarcinomas, ovarian carcinomas, acute myeloid leukemia, pancreatic cancer, and myelofibrosis.

Images