Pharmaceutical composition for preventing or treating ophthalmic diseases by upregulation of EGR1

Abstract

The present invention provides a pharmaceutical composition for preventing or treating ophthalmic diseases, the pharmaceutical composition comprising an expression vector including: a polynucleotide encoding early growth response 1 (EGR1); and a promoter operably linked thereto.

Description

Pharmaceutical composition for preventing or treating ophthalmic diseases through upregulation of EGR1

[0001] The present invention relates to a pharmaceutical composition for preventing and treating ophthalmic diseases, and more particularly, to a pharmaceutical composition for preventing or treating ophthalmic diseases comprising a recombinant vector that induces EGR1 expression and upregulation.

[0002] Age-related macular degeneration (AMD) is the leading cause of blindness in people over 65 years of age in many developed countries. It is known that the most important cause of this disease is the functional decline and age-related atrophy of the retinal pigment epithelium (RPE), which plays a crucial role in maintaining the homeostasis and physiological function of the retina, which plays a key role in visual function in all species of animals. In addition, it is thought that abnormal changes due to age-related changes in Bruch's membrane, which acts as the basement membrane of the RPE, and degeneration of the choriocapillaris, which is located at the outermost layer of the RPE and the neural retina and supplies nutrients and oxygen to the photoreceptor cells where phototransduction occurs, may also play a role.

[0003] Depending on the phenotype exhibited by these changes, age-related macular degeneration is largely classified into two types: dry AMD, which is characterized by degeneration and functional decline of the RPE, Bruch's membrane, and choriocapillaris, and wet AMD, which has the characteristics of dry AMD but is accompanied by choroidal neovascularization (CNV). About 10% of dry macular degeneration progresses to wet macular degeneration, which causes neovascularization (due to an inflammatory reaction), edema, and hemorrhage, while the remaining patients do not develop neovascularization, but develop atrophy due to apoptosis of the RPE and photoreceptor cells, which induces atrophic macular degeneration.

[0004] Treatment for wet AMD has been available since around 2005, using intravitreal injections of anti-vascular endothelial growth factor (anti-VEGF) to inhibit neovascularization. Currently, new drugs with a long duration of effect and that can act on additional targets that can reduce neovascularization in addition to VEGF are being released, and the rate of blindness due to wet AMD is decreasing significantly.

[0005] However, atrophic macular degeneration has not yet had a clear treatment, and recommendations include antioxidant supplements, smoking cessation, exercise, and improved diet. Patients gradually lose their sight, but their lifespans are increasing, increasing the period of restricted daily activities and increasing the socioeconomic losses associated with the suffering of family members. Atrophic age-related macular degeneration, however, has no specific treatment beyond observation, even in the medical field. However, the number of patients is steadily increasing.

[0006] Atrophic macular degeneration was confirmed to be associated with mutations in complement, suggesting that excessive complement activity is the cause of the disease. In 2023, a drug that modulates C3 complement function (SYFOVRE™ [pegcetacoplan injection]) became the first FDA-approved drug for atrophic macular degeneration, and it was confirmed that the rate of atrophy due to the drug decreased by about 20% per year. However, there was no significant improvement in visual acuity, and instead, serious side effects such as choroidal neovascularization and ischemic optic neuropathy were observed. In addition, an antibody drug that modulates C5 complement function (IZERVAY™ [Avacincaptad pegol]) has the limitation of only inhibiting the progression of atrophy rather than improving visual function. Fundamental treatments or therapies such as inhibition or regeneration of retinal nerve degeneration have still not been developed. Therefore, the development of a fundamental treatment for atrophic macular degeneration different from the existing ones is urgently needed.

[0007] Recently, in anti-aging research, rejuvenation research has been conducted through overexpression of reprogramming transcription factors OCT4, SOX2, KLF-4, c-MYC (OSKM) or OSK. However, visual rejuvenation research, especially reverse aging of retina and retinal pigment epithelial cells, is relatively insufficient even among these companies due to limitations including various technical difficulties. In particular, in age-related ophthalmic diseases, the possibility of treating ophthalmic diseases by regulating the expression of EGR1 (Early growth response-1), a transcription factor essential for differentiation and proliferation in the development of vertebrates and responsible for cell growth, development, and stress response, is unknown. In addition, no treatment for retinal diseases using domestic or foreign reverse aging technology has been developed yet.

[0008] Accordingly, the present inventors confirmed the role of EGR1 in aging, confirmed the therapeutic effect of retinal degenerative disease through regulation of EGR1 expression by expressing the transcription factor EGR1 in retinal cells and reversed cell aging, and developed a treatment for ophthalmic diseases, particularly dry macular degeneration, that can induce EGR1 overexpression.

[0009] The present invention provides a pharmaceutical composition for preventing or treating an ophthalmic disease, comprising an expression vector comprising a polynucleotide encoding EGR1 (Early Growth Response 1); and a promoter operably linked thereto.

[0010] In addition, the present invention provides a method for treating an ophthalmic disease, comprising administering an expression vector comprising a polynucleotide encoding EGR1 (Early Growth Response 1) and a promoter operably linked thereto.

[0011] In addition, the present invention provides a method for treating an ophthalmic disease, comprising administering to a subject in need thereof an effective amount of an expression vector comprising a polynucleotide encoding EGR1 (Early Growth Response 1) and a promoter operably linked thereto, for the purpose of preventing or treating an ophthalmic disease.

[0012] The present invention also provides the use of the expression vector in the manufacture of a medicament for preventing or treating ophthalmic diseases.

[0013] Additionally, the present invention provides the expression vector for use in the prevention or treatment of ophthalmic diseases.

[0014] Also provided is an ophthalmic preparation comprising a pharmaceutical composition according to the present invention.

[0015] The present invention provides a pharmaceutical composition for preventing or treating an ophthalmic disease, comprising a polynucleotide encoding EGR1 (Early Growth Response 1) and an expression vector comprising a promoter operably linked thereto.

[0016] The expression vector according to the present invention can induce expression of the EGR1 gene or activity of the EGR1 protein.

[0017] The inventors of the present invention confirmed that a decrease in EGR1 expression is associated with cellular aging, and confirmed that overexpression of EGR1 can induce reverse aging and improve aging stress, thereby restoring visual function.

[0018] In particular, unlike wet macular degeneration, which causes retinal edema, hemorrhage, and fibrotic scarring due to choroidal neovascularization, dry macular degeneration (Dry AMD) does not cause neovascularization, but causes macular atrophy due to apoptosis of RPE and photoreceptor cells. The etiology of this atrophic macular degeneration (a progressive form of dry macular degeneration) is diverse and has not yet been clearly identified, but the occurrence and deterioration due to cellular senescence of the RPE has recently emerged as one of the etiologies. Therefore, from a regenerative medicine perspective, an anti-aging treatment that can suppress neurodegeneration could be a fundamental treatment, but none has been developed worldwide yet. Therefore, EGR1 overexpression through the expression vector according to the present invention induces RPE anti-aging and improves aging stress, thereby enabling a more fundamental treatment in dry / atrophic macular degeneration, thereby exhibiting excellent therapeutic efficacy.

[0019] The above-mentioned EGR1 (Early Growth Response 1) is rapidly and transiently induced in response to various extracellular stresses. By binding to GC-rich sequences within the promoters of target genes, it can regulate diverse cellular responses ranging from survival to apoptosis, and from differentiation to transformation. However, research and development of therapeutic agents capable of inducing reverse aging through increased EGR1 expression has not been conducted.

[0020] Any polynucleotide encoding the above EGR1 (Early Growth Response 1) can be used as long as it is a polynucleotide that transcribes the EGR1 protein of sequence number 20.

[0021] According to one embodiment of the present invention, the polynucleotide encoding EGR1 (Early Growth Response 1) may be composed of a base sequence represented by SEQ ID NO: 7 or SEQ ID NO: 19.

[0022] The above expression vector may be a recombinant expression vector into which the EGR1 (Early Growth Response 1) gene is inserted.

[0023] The above expression vector can express the EGR1 gene and increase the level of EGR1 protein in a cell or increase EGR1 protein activity.

[0024] In the present invention, “promoter” means a DNA sequence that controls the expression of a nucleic acid sequence operably linked to it in a specific host cell, and refers to an untranslated nucleic acid sequence upstream of a coding region that includes a binding site for a polymerase and has transcription initiation activity into mRNA of a gene downstream of the promoter.

[0025] As used herein, “operably linked” refers to a functional linkage between a nucleotide expression regulatory sequence (e.g., a promoter, signal sequence, or an array of transcription factor binding sites) and another nucleotide. The regulatory sequence can regulate the transcription and / or translation of the other nucleic acid sequence.

[0026] The expression vector of the present invention can achieve expression of EGR1 (Early Growth Response 1) under the control of one or more promoters.

[0027] The above-mentioned expression vector can achieve the expression of the desired EGR1 through an operably linked sequence.

[0028] In the present invention, the promoter sequence may include a promoter sequence generally used in vector expression, a promoter sequence known to be specific to RPE cells, or a promoter sequence intended for overexpression. For example, as general promoter sequences, the EGR1 (Early Growth Response 1) promoter, BEST1 (VMD2) promoter, RPE65 promoter, RDH5 promoter, CMV (cytomegalovirus) promoter, RLBP1 (CRALBP) promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, HSV tk promoter, RSV U6 promoter, promoter, EF1 alpha promoter, metallothionine promoter, beta-actin promoter, promoter of human IL-2 gene, promoter of human IFN gene, promoter of human IL-4 gene, promoter of human lymphotoxin gene, promoter of human GM-CSF gene, etc. can be used.

[0029] Promoters that can be used specifically for RPE cells include, for example, the BEST1 (VMD2) promoter, the RPE65 promoter, the RDH5 promoter, and the RLBP1 (CRALBP) promoter.

[0030] In addition, the vector according to the present invention may contain one or more suitable transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals that stabilize mRNA in the cytoplasm, e.g., Kozak sequences; sequences that enhance translation efficiency or WPRE; sequences that enhance mRNA stability; Central polypyrimidine tract / central termination sequence (cPPT / CTS); Rev-responsive element (RRE) and, if desired, sequences that enhance secretion of the encoded product.

[0031] For example, the expression vector or genetic construct according to the present invention may also comprise an enhancer. Such enhancers are viral enhancers, including but not limited to the CMV enhancer, the WPRE enhancer, the HPRE enhancer, the CTE enhancer, or derivatives or hybrids thereof.

[0032] Additionally, the expression vector or genetic construct according to the present invention may comprise a Kozak sequence.

[0033] The packaging signal may be a 5' inverted terminal repeat (ITR) and a 3' ITR. For example, a recombinant expression vector or genetic construct comprises AAV ITR sequences for use in an AAV vector. In one embodiment, the ITR is derived from a different AAV than the one supplying the capsid. In a preferred embodiment, the ITR sequence is derived from AAV2, or a deleted version thereof (ITR), which may be used for convenience and to accelerate regulatory approval. However, ITRs from other AAV sources may also be selected. When the source of the ITR is AAV2 and the AAV capsid is derived from another AAV source, the resulting vector may be designated a pseudotype. Typically, an AAV vector genome comprises an AAV 5' ITR, any coding sequence according to the invention, any regulatory sequence, and an AAV 3' ITR. However, other arrangements of the elements may also be suitable. A shortened version of the 5' ITR, termed ITR, has been described, which lacks the D-sequence and terminal resolution site (trs). In other embodiments, full-length AAV 5' and 3' ITRs are used.

[0034] In some embodiments, the regulatory sequence comprises a polyadenylation (polyA) signal. In some embodiments, the polyA signal is a bovine growth hormone polyadenylation (bGH polyA) signal, a small polyA (SPA) signal, a human growth hormone polyadenylation (hGH polyA) signal, an SV40 polyA signal, an SV40 late polyA signal, or a derivative or hybrid thereof.

[0035] The expression vector or genetic construct according to the present invention may be modified to the extent that the identity of the expression vector or construct is maintained. That is, the term "identical" or percent "identity", in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or partial sequences that have a specified percentage (i.e., preferably 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity) of amino acid residues or nucleotides that are the same or identical over a specified region (e.g., any of the modified ORFs provided herein when compared and aligned for maximum match over a comparison window or a designated region) as measured using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection (see, e.g., the NCBI website).

[0036] Polynucleotides encoding Egr1 (Early Growth Response 1) can usually be synthesized by considering the known gene sequence in Gene Bank, etc. Retinal diseases such as macular degeneration require topical drug administration to the eye. However, commonly used anti-VEGF antibody drugs such as Lucentis and Eylea require dozens of repeated direct administrations to the eye in many patients, which patients usually feel great resistance to. In contrast, the expression vector according to the present invention can improve the method of existing therapeutic agents in that it can exhibit long-term therapeutic efficacy even with a single administration.

[0037] In addition, the expression vector according to the present invention as a treatment for retinal diseases has the advantage of being able to target and deliver therapeutic genes to retinal cells through subretinal or intraocular injection, can be stably expressed for a long period of time, and has a low risk of mutation because the potential risk of inserting new genetic material is rare as it is not integrated into the patient's genome. In addition, it is a vector with generally low immunogenicity, and in particular, the retina and RPE are immune privileged tissues, reducing the possibility of immune-mediated rejection or destruction of the therapeutic vector, which can potentially further improve the efficacy and longevity of the treatment.

[0038] In addition, in the present invention, a polynucleotide capable of increasing the expression of Egr1 is loaded onto an expression vector and applied, thereby not only increasing the therapeutic efficacy but also designing it in a form suitable for actual clinical applications.

[0039] The above expression vector may be a viral vector, a plasmid, or a non-viral vector.

[0040] The above viral vectors include adeno-associated virus (AAV) vectors, adenovirus vectors, lentivirus vectors, herpes simplex virus vectors, baculovirus vectors, Sendai virus vectors, retrovirus vectors, etc., and preferably, the expression vector may be a lentivirus or adeno-associated virus (AAV) vector.

[0041] In the present invention, it may be a recombinant AAV (rAAV) vector or lentiviral vector into which the Egr1 gene that overexpresses Egr1 is inserted. More specifically, it may be a recombinant AAV (rAAV) vector or lentiviral vector into which the EGR1 gene of SEQ ID NO: 7 or SEQ ID NO: 19 is inserted.

[0042] "rAAV" refers to a viral particle comprised of an encapsidated polynucleotide rAAV vector comprising at least one AAV capsid protein and a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, e.g., a transgene to be delivered into a mammalian cell). The rAAV particle can have any AAV serotype, including any modification, derivative, or pseudotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10 or derivatives / modifications / pseudotypes thereof). Such AAV serotypes and derivatives / modifications / pseudotypes and methods for producing such serotypes / derivatives / modifications / pseudotypes are known in the art (see, e.g., Asokan et al., Mol. Ther. 20(4):699-708 (2012)). In some embodiments, the rAAV particle comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, It may be any one selected from AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 and AAV.HSC16.

[0043] Additionally, rAAV particles include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, A capsid protein from an AAV capsid serotype selected from AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 and AAV.HSC16. In some embodiments, the rAAV particle comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, A capsid protein that is a derivative, variant, or pseudotype of the AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16 capsid protein.

[0044] The rAAV particles of the present disclosure can have any serotype or any combination of serotypes (e.g., a population of rAAV particles comprising two or more serotypes, e.g., two or more of rAAV2, rAAV8, and rAAV9 particles). In some embodiments, the rAAV particles are rAAV1, rAAV2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rAAV9, rAAV10, or other rAAV particles, or a combination of two or more thereof. In some embodiments, the rAAV particles are rAAV8 or rAAV9 particles. In some embodiments, the rAAV particle comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16. In some embodiments, the rAAV particle comprises capsid proteins from two or more serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.A capsid protein that is a derivative, variant or pseudotype of two or more serotypes selected from Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 and AAV.HSC16 capsid proteins.

[0045] In some embodiments, the rAAV particle has an AAV capsid protein of a serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, or a derivative, variant, or pseudotype thereof. In some embodiments, the rAAV particle has an AAV capsid protein of the serotype AAV8, AAV9, or a derivative, variant, or pseudotype thereof. In some embodiments, the rAAV particle has an AAV capsid protein of a serotype selected from the group consisting of AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.PHP.B, AAV.PHP.eB, and AAV.7m8.

[0046] A “lentiviral vector” is a type of retrovirus. The vector is also referred to interchangeably as a lentiviral transfer vector. The lentiviral vector is inserted into the genomic DNA of a cell to be infected and stably expresses a gene. In addition, the vector can transfer a gene to dividing cells and non-dividing cells. Since the vector does not induce an immune response in the human body, expression is continuous. In addition, compared to the adenovirus vector, which is a conventionally used viral vector, it has the advantage of being able to transfer genes of a large size.

[0047] Lentiviruses include members of the bovine lentivirus family, the equine lentivirus family, the feline lentivirus family, the ovine lentivirus family, the caprine lentivirus family, and the primate lentivirus family. The development of lentiviral vectors for gene therapy is reviewed in the literature [Klimatcheva et al. (1999) Frontiers in Bioscience 4:481-496]. The design and use of lentiviral vectors suitable for gene therapy are described, for example, in U.S. Patent No. 6,207,455 and U.S. Patent No. 6,615,782. Examples of lentiviruses include, but are not limited to, HIV-1, HIV-2, HIV-1 / HIV-2 pseudotypes, HIV-1 / SIV, FIV, caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus, and bovine immunodeficiency virus.

[0048] A recombinant lentivirus can be obtained through a step of transforming a host cell with the lentiviral vector, packaging plasmid, and envelope plasmid of the present invention; and a step of isolating the lentivirus from the transformed host cell.

[0049] The terms "packaging plasmid" and "envelope plasmid" as used herein refer to plasmids loaded with genes encoding proteins. In addition to lentiviral vectors, these plasmids may provide helper constructs (e.g., plasmids or isolated nucleic acids) necessary for lentivirus production. These constructs contain elements useful for producing and packaging lentiviral vectors in host cells. These elements may include structural proteins, such as GAG precursors; processing proteins, such as pol precursors; proteases, coat proteins, and expression and regulatory signals necessary for producing proteins and producing lentiviral particles in host cells.

[0050] For the production of recombinant lentiviruses, the Lenti-X Lentiviral Expression System from Clonetech Laboratories, packaging plasmids (e.g., pRSV-Rev, psPAX, pCl-VSVG, pNHP, etc.) or envelope plasmids (e.g., pMD2.G, pLTR-G, pHEF-VSVG, etc.) provided by Addgene can be used.

[0051] In the present invention, the pharmaceutical composition comprising the expression vector can suppress the expression of any one or more proteins selected from the group consisting of p16, p21, and p53. p16, p21, and p53 are aging markers, and when the expression of Egr1 decreases or aging progresses, the expression level of at least one or more proteins among p16, p21, and p53 increases. Accordingly, the expression vector for overexpressing Egr1 of the present invention suppresses the expression level of any one or more proteins among p16, p21, and p53.

[0052] The pharmaceutical composition according to the present invention may be an ophthalmic composition for topical administration to the eye.

[0053] In the present invention, the ophthalmic disease is age-related macular degeneration (AMD), diabetic retinopathy, macular edema, cystoid macular edema, retinitis pigmentosa (RP), Leber's congenital amaurosis (LCA), Stargardt's disease, Usher's syndrome, choroidal plexus atrophy, rod-cone or cone-rod dystrophy, ciliopathies, mitochondrial disorders, progressive retinal atrophy, degenerative retinal diseases, familial or acquired maculopathy, sickle cell retinopathy, retinal pigment epithelium-system diseases, uveitis, retinal detachment, traumatic retinal damage, iatrogenic retinal damage, macular hole, macular telangiectasia, ganglion cell disease, optic nerve disease, glaucoma, optic neuropathy, ischemic retinal disease, retinopathy of prematurity, retinal vascular occlusion, polypoid choroidal vasculopathy, retinal hypoxia, familial macroneuropathy, retinal vascular disease, ocular vascular disease, retinal neuron degeneration due to glaucoma, It may be ischemic optic neuropathy, and preferably age-related macular degeneration (AMD). The age-related macular degeneration may be wet macular degeneration or dry macular degeneration, and more preferably dry macular degeneration. Furthermore, this macular degeneration may exhibit characteristics of atrophic macular degeneration.

[0054] The term “prevention” used in the present invention means any act of preemptively suppressing or delaying the onset of an ophthalmic disease by administering a pharmaceutical composition according to the present invention before the onset of the ophthalmic disease.

[0055] The term “treatment” used in the present invention means any action by which the symptoms of an ophthalmic disease are improved or beneficially changed by administering a pharmaceutical composition according to the present invention after the onset of the ophthalmic disease.

[0056] The present invention provides a method for treating an ophthalmic disease, comprising administering an expression vector that increases expression of the Egr1 gene or increases protein activity.

[0057] In addition, the present invention provides a method for treating an ophthalmic disease, comprising administering to a subject in need thereof an expression vector comprising an effective amount of a polynucleotide encoding Egr1 (Early Growth Response 1); and a promoter operably linked thereto;

[0058] It will be appreciated that a recombinant vector that induces Egr1 expression can be used in pharmaceuticals, and can be used as a single treatment for treating, alleviating, or preventing ocular diseases, or for inhibiting the aging process. Alternatively, an expression vector that overexpresses Egr1 according to the present invention can be used in addition to or in combination with known treatments for treating, alleviating, or preventing ocular diseases, or for inhibiting the aging process.

[0059] In addition, the present invention provides an expression vector comprising a polynucleotide encoding Egr1 (Early Growth Response 1) for use in the treatment of ophthalmic diseases; and a promoter operably linked thereto.

[0060] The present invention also provides the use of an expression vector comprising a polynucleotide encoding Egr1 (Early Growth Response 1); and a promoter operably linked thereto; in the manufacture of a medicament for use as a therapeutic agent for ophthalmic diseases.

[0061] The expression vectors according to the present invention can be combined in compositions having various different forms, particularly depending on the manner in which the composition is to be used. Thus, for example, the composition may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micellar solution, transdermal patch, liposomal suspension, or any other suitable form that can be administered to a human or animal in need of treatment. It will be appreciated that the carrier for the pharmaceutical composition according to the present invention must be well tolerated by the subject to which it is administered.

[0062] In a preferred embodiment, the agent according to the present invention may be administered to a subject by injection into the bloodstream, nerves, or directly into the site requiring treatment. For example, this may be intraocular (subretinal injection and intravitreal injection), intravenous (bolus or infusion), subcutaneous (bolus or infusion), or intradermal (bolus or infusion).

[0063] It will be understood that the amount of expression vector required will be determined by its biological activity and bioavailability, which in turn will depend on the mode of administration, the physicochemical properties of the expression vector according to the present invention, and whether it is used as a monotherapy or in combination therapy. The frequency of administration will also be influenced by the half-life of the circulating polypeptide within the subject being treated. The optimal dosage to be administered can be determined by one of skill in the art and will vary with the particular Egr1-overexpressing expression vector being used, the strength of the pharmaceutical composition, the mode of administration, and the progression or stage of the disorder. Depending on the particular subject being treated, additional factors, including subject age, weight, sex, diet, and timing of administration, may necessitate dosage adjustment.

[0064] In general, depending on the Egr1 expression increasing agent used, the expression vector according to the present invention can be used to treat, alleviate, or prevent ophthalmic diseases by intravitreal injection at a daily dose of 0.05 to 0.1 mL, or subretinal injection at a dose of up to 0.3 mL, but the administration dose is not limited thereto.

[0065] The expression vector according to the present invention may be administered before, during, or after the onset of a disease and / or disorder.

[0066] Known procedures, such as those commonly employed in the pharmaceutical industry (e.g., in vivo experiments, clinical trials, etc.), can be used to formulate specific formulations of the expression vectors according to the present invention and to formulate precise treatment regimens (e.g., daily dosage and frequency of administration of the formulation).

[0067] In the present invention, the "subject" may be a vertebrate, mammal, or domestic animal. Therefore, the compositions and agents of the present invention may be used to treat any mammal, such as livestock (e.g., horses), pets, or in other veterinary applications. However, most preferably, the subject is a human.

[0068] A "therapeutically effective amount" of an expression vector or pharmaceutical composition according to the present invention is any of the aforementioned amounts necessary to treat an ophthalmic disease or produce a desired effect, such as promoting nerve regeneration and / or survival, when administered to a subject.

[0069] A "pharmaceutically acceptable carrier" as referred to herein is any known compound or combination of known compounds known to those skilled in the art to be useful in formulating pharmaceutical compositions.

[0070] The pharmaceutical carrier may be liquid, and the pharmaceutical composition is in the form of a solution. Liquid carriers are used to prepare solutions, suspensions, emulsions, syrups, elixirs, and pressurized compositions. The genetic constructs or recombinant expression vectors according to the present invention may be dissolved or suspended in a pharmaceutically acceptable liquid carrier, such as water, an organic solvent, a mixture of both, or a pharmaceutically acceptable oil or fat. The liquid carrier may contain other suitable pharmaceutical additives, such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickeners, colors, viscosity modifiers, stabilizers, or tonicity modifiers. Suitable examples of liquid carriers for oral and parenteral administration include water (partially containing additives such as those described above, e.g., cellulose derivatives, preferably sodium carboxymethyl cellulose solution), alcohols (including monohydric and polyhydric alcohols, such as glycols) and their derivatives, and oils (e.g., fractionated coconut oil and arachis oil). For parenteral administration, the carrier may also be an oily ester, such as ethyl oleate and isopropyl myristate. Sterile liquid carriers are useful in sterile liquid form compositions for parenteral administration. Liquid carriers for pressurized compositions may be halogenated hydrocarbons or other pharmaceutically acceptable propellants.

[0071] Liquid pharmaceutical compositions, which are sterile solutions or suspensions, can be used, for example, by intraocular (subretinal and intravitreal injections), brainstem, intramuscular, intrathecal, epidural, intrathecal, intraperitoneal, intravenous, and subcutaneous injection. The genetic constructs or recombinant expression vectors can be prepared as sterile solid compositions that can be dissolved or suspended in sterile water, saline, or other suitable sterile injectable media for administration.

[0072] The expression vectors and pharmaceutical compositions of the present invention may be administered orally in the form of sterile solutions or suspensions containing other solutes or suspending agents (e.g., saline or glucose sufficient to render the solution isotonic), bile salts, acacia, gelatin, sorbitan monooleate, polysorbate 80 (the oleate ester of sorbitol and its anhydride copolymerized with ethylene oxide), etc. The expression vectors or pharmaceutical compositions according to the present invention may also be administered orally in the form of liquid or solid compositions. Compositions suitable for oral administration include solid forms such as pills, capsules, granules, tablets, and powders, and liquid forms such as solutions, syrups, elixirs, and suspensions. Forms useful for parenteral administration include sterile solutions, emulsions, and suspensions.

[0073] The present invention provides an ophthalmic preparation comprising a pharmaceutical composition according to the present invention.

[0074] The above ophthalmic preparation may be in the form of, for example, eye drops, eye ointments, intraocular injections, ointments, etc., and is preferably, but not limited to, eye drops or skin delivery preparations. Such preparations may be manufactured according to methods commonly used in the art. As an ophthalmic topical administration form, the preparation may be in the form of drops, sprays, or gels, and another method is to administer the preparation to the eye using liposomes. In addition, the preparation may be injected into the tear film through a pump-catheter system. As an additional embodiment, the preparation may be incorporated into, carried by, or attached to a contact lens placed on the eye. In another embodiment, the preparation may be contained in a sponge or cotton swab that can be applied to the ocular surface, and a liquid spray that can be applied to the ocular surface may also be used.

[0075] According to a preferred embodiment of the present invention, by overexpressing EGR1 using the expression vector and pharmaceutical composition, the cell aging of retinal pigment epithelial cells is reduced, thereby inducing reverse aging and improving visual function.

[0076] According to another preferred embodiment of the present invention, the expression vector and pharmaceutical composition can be used to strengthen cell-substrate junctions, alleviate aging stress, and improve the viability of retinal pigment epithelial cells by overexpressing EGR1, thereby being effective in treating ophthalmic diseases (e.g., dry macular degeneration).

[0077] Any feature described in this application (including all attached claims, abstract and drawings) and / or any step of any method or process so disclosed may be combined with any of the above embodiments in any combination, except combinations where at least some of such features and / or steps are mutually exclusive.

[0078] Any feature described in this application (including all attached claims, abstract and drawings) and / or any step of any method or process so disclosed may be combined with any of the above embodiments in any combination, except combinations where at least some of such features and / or steps are mutually exclusive.

[0079] The expression vector of the present invention has the effect of reducing cell aging of retinal pigment epithelial cells by inducing EGR1 overexpression and thereby reverse-aging retinal cells, and improving aging stress to increase the survival rate of retinal pigment epithelial cells, thereby restoring visual function.

[0080] For a better understanding of the present invention and to show how embodiments thereof may be carried out in practice, reference will now be made by way of example to the accompanying drawings, in which:

[0081] Figure 1 is a diagram showing an example of an AAV vector.

[0082] Figure 2 is a diagram showing an example of a recombinant AAV vector that induces Egr1 expression and upregulation of the present invention.

[0083] Figure 3 is a diagram showing an example of a lentiviral (LV) vector with Scramble inserted.

[0084] Figure 4 is a diagram showing an example of a lentiviral vector inserted with shEGR1 that knocks down Egr1 expression.

[0085] Figure 5 is a diagram showing an example of a lentiviral vector with a stuffer inserted.

[0086] Figure 6 is a diagram showing an example of a lentiviral vector inserted with hEGR1 that upregulates EGR1 expression.

[0087] Figure 7 shows the results of analyzing changes in the expression of cell proliferation markers and senescence-related markers following EGR1 gene knockdown in a retinal pigment epithelial cell line (ARPE-19) induced to age by doxorubicin (Dox).

[0088] Figure 8 shows the results of analyzing changes in the expression of aging-related markers according to EGR1 gene overexpression in a retinal pigment epithelial cell line (ARPE-19) induced to age by doxorubicin (Dox).

[0089] Figure 9 shows the results of analyzing the expression of EGR1 protein in retinal pigment epithelial cells (RPE) in mice of different ages.

[0090] Figure 10 shows the results of analyzing changes in the expression of aging-related markers in retinal pigment epithelial cells following EGR1 overexpression in a retinal degeneration mouse model induced by NaIO3.

[0091] Figure 11 shows the results of analyzing the effect of EGR1 overexpression on reducing cell senescence in retinal pigment epithelial cells in a dry macular degeneration mouse model induced by NaIO3.

[0092] Figure 12 shows the results of confirming the change in mouse visual function according to EGR1 overexpression in a dry macular degeneration mouse model induced by NaIO3 through electroretinography.

[0093] Figure 13 shows the results of analyzing the expression levels of Egr1 and aging-related markers in retinal pigment epithelial cells according to EGR1 overexpression in an aged mouse model using polymerase chain reaction analysis.

[0094] Figure 14 shows the results of analyzing the effect of EGR1 overexpression on reducing cell senescence in retinal pigment epithelial cells in an aged mouse model using immunofluorescence staining.

[0095] Figure 15 shows the results of analyzing the effect of EGR1 overexpression on reducing cell senescence in retinal pigment epithelial cells in an aged mouse model using hematoxylin-eosin (H&E) staining.

[0096] Figure 16 shows the results of confirming the effect of EGR1 overexpression on improving aging stress in in vitro and in vivo models.

[0097] The present invention will be described in more detail below through examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

[0098] The mice used in the following experimental examples or examples are C57BL / 6 mice, bred in a facility approved by the Institutional Animal Care and Use Committee (IACUC) of the Konkuk University Animal Research Institute, and managed and used in accordance with the protocol approved by the IACUC.

[0099] The adeno-associated virus (AAV) vector plasmid used in the examples below was purchased from VectorBuilder (USA).

[0100]

[0101] <Example>

[0102] Example 1. Preparation of a recombinant AAV vector that induces EGR1 expression and upregulation.

[0103] 1-1. AAV vector

[0104] An AAV vector consisting of the base sequence shown in Example 1 was prepared. The CMV promoter sequence and mcherry sequence used here are as shown in SEQ ID NOs: 2 and 3, respectively.

[0105] SEQ ID NO: 2 (CMV promoter): agctctgcttatatagacctcccaccgtacacgcctaccgcccatttgcgtcaatggggcggagttgttacgacattttggaaagtcccgttgattttggtg ccaaaacaaactcccattgacgtcaatggggtggagacttggaaatccccgtgagtcaaaccgctatccacgcccattgatgtactgccaaaaccgcatcac

[0106] SEQ ID NO: 3 (mcherry): ttacttgtacagctcgtccatgccgccggtggagtggcggccctcggcgcgttcgtactgttccacgatggtgtagtcctcgttgtgg gaggtgatgtccaacttgatgttgacgttgtaggcgccgggcagctgcacgggcttcttggccttgtaggtggtcttgacctcagcgtc gtagtggccgccgtccttcagcttcagcctctgcttgatctcgcccttcagggcgccgtcctcggggtacatccgctcggaggaggcctcccagcccatggtcttcttctgcattacggggccgtcggaggggaagttggtgccgcgcagcttcaccttgtagatgaactcgccgtcc tgcagggaggagtcctgggtcacggtcaccacgccgccgtcctcgaagttcatcacgcgctcccacttgaagccctcggggaaggacagcttcaagtagtcggggatgtcggcggggtgcttcacgtaggccttggagccgtacatgaactgaggggacaggatgtcccaggcgaagg gcaggggggccacccttggtcaccttcagcttggcggtctgggtgccctcgtaggggcggccctcgccctcgccctcgatctcgaactcgtggccgttcacggagccctccatgtgcaccttgaagcgcatgaactccttgatgatggccatgttatcctcctcgcccttgctcaccat

[0107] 1-2. EGR1 expression recombinant AAV vector

[0108] AAV-mcherry / Egr1 (AAV mcherry-Egr1 plasmid), a recombinant AAV vector that induces EGR1 expression and upregulation, consisting of the base sequence represented by sequence number 4, was prepared.

[0109] The CMV promoter sequence, mcherry sequence, and EGR1 sequence used here are shown in SEQ ID NOs: 5, 6, and 7, respectively.

[0110] SEQ ID NO: 5 (CMV promoter): gtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttgg caccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct

[0111] 서열번호 6(mcherry): atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaag

[0112] 서열번호 7(EGR1): agtcctgcgatcgccgcttttctcgctcggatgagcttacccgccatatccgcatccacacaggccagaagcccttccagtgtcgaatctgcatgcgtaacttcagtcgtagtgaccaccttaccacccacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtgggaggaagtttgccaggagtgatgaacgcaagaggcataccaaaatccatttaagacagaaggacaagaaagcagacaaaagtgtggtggcctccccggctgcctcttcactctcttcttacccatccccagtggctacctcctacccatcccctgccaccacctcattcccatcccctgtgcccacttcctactcctctcctggctcctccacctacccatctcctgcgcacagtggcttcccgtcgccgtcagtggccaccacctttgcctccgttccacctgctttccccacccaggtcagcagcttcccgtctgcgggcgtcagcagctccttcagcacctcaactggtctttcagacatgacagcgaccttttctcccaggacaattgaaatttgctaa

[0113]

[0114] 실시예 2. 실험 준비 및 실험 방법

[0115] 2-1. 웨스턴 블롯 분석

[0116] Harvested cells were lysed in RIPA buffer and centrifuged at 4°C and 13,000 rpm for 10 minutes to obtain highly pure proteins. Proteins were quantified using BCA assay and boiled at 100°C with sample buffer to prepare for experiments. SDS-PAGE was performed at 110 V for 90 minutes, and the SDS-PAGE gel was transferred at 100 V for 150 minutes. After transfer, the membrane was washed with TBS-T (0.05% Tween 20) and blocked with 5% skim milk for approximately 1 hour at room temperature. The blocked membrane was reacted with primary antibody overnight at 4°C, washed with TBS-T the next day, reacted with secondary antibody for 90 minutes, and specific protein bands were developed using an iBright imaging system.

[0117] 2-2. Real-time polymerase chain reaction (real-time PCR)

[0118] Harvested cells were treated with Trizol, and the lysed cells were treated with chloroform and centrifuged at 4°C and 13,000 rpm for 15 minutes to isolate RNA. Isopropanol was mixed with the isolated RNA and centrifuged at 4°C and 13,000 rpm for 10 minutes to extract RNA. The extracted RNA pellet was treated with 75% ethanol, centrifuged at 4°C and 7,500 rpm for 5 minutes, and dried for approximately 20 minutes. The formed transparent RNA pellet was reacted with 50 μl of RNase-free water in a 55°C heating block. The extracted RNA was mixed with Reverse Transcription supermix, 25xdNTP, oligo dT, and RNA template, and cDNA was synthesized through reverse transcription. The synthesized cDNA was mixed with the primer of the target gene using SYBR Green supermix solution, and the change in expression level was confirmed through real-time polymerase chain reaction. The gene expression level was normalized to the housekeeping gene (GAPDH), and the fold change of mRNA was calculated through relative quantification (2-ΔΔCt).

[0119] 2-3. Immunofluorescence

[0120] After enucleating the eyeball from the mouse, the fatty muscle tissue attached to the sclera was trimmed. The retina and retinal pigment epithelium were separated, and the separated mouse retinal pigment epithelium was reacted with 4% paraformaldehyde for 90 minutes at 4°C, washed with PBS, and permeabilized by reacting with 0.2% Triton X-100 for 5 minutes at 4°C. After washing with PBS, the cells were blocked with 5% BSA. The primary antibody was reacted overnight at 4°C, and the following day, it was washed and reacted with the secondary antibody for 2 hours at 4°C. For nuclear staining, Hoechst33342 was treated and reacted for 20 minutes, and the coverslip with the cells attached was mounted on a slide glass using a mounting solution.

[0121] 2-4. Electroretinogram (ERG)

[0122] Retinal function was measured in vivo using the Celeris mouse ERG system (Diagnosys, LLC, MA, USA).

[0123] Before the experiment, mice were conditioned in a dark place for at least 16 h. Mice were anesthetized by intraperitoneal injection of a mixture of Zoletil (Virbac, France) and xylazine (Rompun, Bayer HealthCare, Leverkusen, Germany) diluted with NaIO3 (ratio 4:1) at a dose of 10 μl per g of body weight. After administration of general anesthesia, the pupils were dilated with Tropherine (Hanmi, Korea) and the mice were anesthetized with a local anesthetic, alkyne. The eyes were protected with 2% hypromellose (Samil, Korea) before injection. After 16 h of dark conditioning, the mice were placed on a warming plate to maintain body temperature, with the electrodes of the Celeris mouse ERG system attached to each eye. Retinal function was measured under red light. For ERG, the electrodes were aligned with the center of the eye and in contact with the cornea, and the reference electrode was placed in the contralateral eye. Amplitude for a-wave and b-wave is from 0.001 to 10 cd*s / m 2 150 cd*s / m for single flash stimulus and c-wave in the range 2 The responses were induced by a flash. At least three responses were recorded for each flash intensity and averaged. The amplitudes of the a-wave and b-wave were measured at the maximum negative and positive peaks of the recording relative to the pre-stimulus baseline.

[0124] 2-5. Color fundus photography (FP) and autofluorescence imaging

[0125] Color fundus photographs and autofluorescence images of dilated mouse eyes were taken using a TRC-50DX camera (Topcon, Tokyo, Japan) connected to a digital imaging system (IMAGEnet version 6, Topcon).

[0126] 2-6.SA-β-gal analysis

[0127] Senescence was assessed using an SA-β-gal staining kit according to the manufacturer's protocol (#9860, Cell Signaling Technology, Danvers, MA, USA). RPE / choroid tissues were fixed in 1X fixative solution for 30 min, washed with 1X PBS, and incubated overnight with SA-β-gal staining solution at 37°C. To measure the stained SA-β-gal, the dark pigment in the RPE was bleached with 10% H2O2, incubated in a heat block at 55°C for 45 min, and then rinsed with PBS. RPE / choroid tissues were then flat-mounted under a light microscope (Olympus SZ51) using Aqua Poly / Mount (#18,606-20, Polysciences, Inc., Warrington, PA, USA). Images of stained RPE / choroid flat mounts were captured using an inverted microscope (Carl Zeiss Axio Scope A1, Göttingen, Germany).

[0128] For SA-β-gal staining of ARPE-19 cells, ARPE-19 cells were rinsed once with 1X PBS. APRE-19 cells were then fixed with 1X fixative solution for 10–15 min at RT and washed twice with 1X PBS. β-Galactosidase staining solution was then added to APRE-19 cells, and the cells were cultured overnight. The stained SA-β-gal was observed using an inverted fluorescence microscope (IX71, Olympus).

[0129] 2-7. Immunofluorescence of RPE / choroid flat mount

[0130] Isolated RPE / choroid tissues were permeabilized with 0.1% Triton X-100 in PBS for 15 minutes and incubated with 1% BSA in PBS for 1 hour, followed by primary antibodies (1:500, BD Bioscience) for p16 (1:500, BD Bioscience), p21 (1:500, BD Bioscience), p53 (1:250, Santa Cruz Biotechnology, TX, USA), TOM20 (1:500, Santa Cruz Biotechnology), Ki67 (1:1000, Abcam), H3K9me3 (1:500, Abcam), γ-H2AX (1:500, Abcam), Cleaved caspase-3 (1:500, Abcam), APOE (1:250, Santa Cruz Biotechnology), Clusterin (1:250, Santa Cruz Biotechnology), and ZO-1 (1:1000, Invitrogen). The tissues were incubated overnight at 4°C with primary antibodies (PBS). After overnight incubation, the tissues were washed with PBS and incubated with Alexa Fluor 488 or 555-conjugated goat anti-mouse or anti-rabbit IgG (Thermo Fisher Scientific, Waltham, USA) for 2 h at room temperature. All secondary antibodies were used at a dilution of 1:250. After incubation with secondary antibodies, the tissues were stained with the nuclear dye Hoechst 33342 (1:1000, Thermo Fisher Scientific) in PBS for 15 min at room temperature. The tissues were then mounted using mounting medium (Polysciences). The stained cells were observed using an inverted microscope (Carl Zeiss, LSM900, Oberkochen, Germany).

[0131] 2-8 Hematoxylin-eosin (H&E) staining

[0132] Enucleated eyes were fixed in 4% paraformaldehyde for 12 hours at 4°C. After fixation, the eyes were placed in a 15% sucrose solution at 4°C for 12 hours and then transferred to a 30% sucrose solution for at least 3 hours until the eyes sank to the bottom of the tube. The eyes were then placed in cryosection compound (FSC 22 Clear Frozen Section Compound; Biosystems Inc., Wetzlar, Germany). The frozen blocks were then sectioned at 10-μm thickness using a cryosectioner (Leica CM1860, Leica Biosystems Inc.) and stained with hematoxylin and eosin (H&E). The thickness of the outer nuclear layer (ONL) was measured in the stained sections using ImageJ software (NIH, USA). The average ONL thickness was calculated for at least three different sections proximal to the optic nerve.

[0133]

[0134] Example 3. Analysis of the effects of EGR1 gene knockdown in senescence-induced ARPE-19 cells (in vitro)

[0135] We observed changes in the expression of cell proliferation markers and senescence-related phenotypes induced by knockdown (KD) of EGR1 in retinal pigment epithelial cell lines induced by doxorubicin (Dox).

[0136] 3-1. Lentivirus production

[0137] 2.5x10 HEK293T cells 6 100 cm in DMEM culture medium environment with cell count 2Cultured in a culture dish. On the first day, the medium was replaced with opti-MEM medium and cultured for 3 hours. After 3 hours, LV-shRNA-Scramble plasmid used as a control group and LV-shRNA-EGR1 plasmid used as an experimental group were transfected with pMD2.G and psPAX2 plasmids at a ratio of 12:4:3 using lipofectamin 3000 reagent with a total amount of plasmid DNA. After 6 hours, the medium was replaced with DMEM, and approximately 36 hours after replacing the medium with DMEM, the culture medium containing the produced lentivirus was filtered to isolate the lentivirus using a 0.45 μm Cellulose Acetate filter. The culture medium containing the isolated lentivirus was mixed with TaKaRa's Lenti-X Concentrator kit at a ratio of 3:1 and incubated overnight under refrigerated conditions. The following day, the lentivirus pellet was obtained by centrifugation at 1,500 xg for 45 minutes. The lentivirus pellet was dissolved in 100 μL of PBS, aliquoted, and stored in a deep freezer (-80°C).

[0138] The above LV-shRNA-Scramble plasmid is shown in SEQ ID NO: 8, and the U6 promoter and shRNA sequences used therein are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively.

[0139] SEQ ID NO: 9 (U6 promoter): gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaaagatattagtacaaaatacgtgacgtagaaagt aataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacacc

[0140] SEQ ID NO: 10 (shRNA): cctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttagg

[0141] In addition, the LV-shRNA-EGR1 plasmid is shown in SEQ ID NO: 11, and the U6 promoter and shRNA sequences used here are shown in SEQ ID NO: 12 and SEQ ID NO: 13, respectively.

[0142] SEQ ID NO: 12 (U6 promoter): gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaaagatattagtacaaaatacgtgacgtagaaagt aataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacacc

[0143] SEQ ID NO: 13 (shRNA): ccacgccgaacactgacatttctcgagaaatgtcagtgttcggcgtgg

[0144] 3-2. Cell culture and lentivirus introduction

[0145] 4.5x10 ARPE-19 cells 560 cm in DMEM / F12 culture medium environment with cell count 2 Cultures were performed on culture dishes. On the first day, ARPE-19 cells were transduced with lentivirus that knocks down the expression of the EGR1 transcription factor together with 8 μg / ml polybrene. From the next day, cell senescence was induced by treating with doxorubicin (250 nM) at the same time every day for 3 days. On the 5th day, the culture medium was replaced with fresh medium without doxorubicin treatment, and the medium was replaced every other day. On the 8th day, cells from all experimental groups were harvested.

[0146] 3-3. Analysis Results

[0147] The relative levels of cell proliferation markers and senescence-related markers were analyzed by Western blotting to determine the effects of EGR1 gene knockdown in retinal pigment epithelial cell lines (ARPE-19) induced by doxorubicin (Dox), and the results are shown in Figures 7A to 7C.

[0148] As can be seen in Figure 7, in the EGR1 gene knockdown group (shEGR1), the expression of cell proliferation markers PCNA and Ki67 was significantly decreased compared to the control group (shSC) (Figure 7B), and the aging-related markers p21, p16, and p53 were increased compared to the control group (Figure 7C).

[0149] Therefore, we confirmed that EGR1 knockdown promotes cellular senescence.

[0150]

[0151] Example 4. Analysis of the effects of EGR1 overexpression in senescence-induced ARPE-19 cells (in vitro)

[0152] 4-1. Lentivirus production

[0153] 2.5x10 HEK293T cells 6 100 cm in DMEM culture medium environment with cell count 2Cultured in a culture dish. On the first day, the culture medium was replaced with opti-MEM medium and cultured for 3 hours. After 3 hours, the LV-CMV-stuffer plasmid used as a control group and the LV-CMV-EGR1 plasmid used as an experimental group were transfected with a total of 24 μg of plasmid DNA at a ratio of 12:4:3 using lipofectamin 3000 reagent along with pMD2.G and psPAX2 plasmids, and the culture medium was replaced with DMEM after 6 hours. Approximately 36 hours after replacing the culture medium with DMEM, the produced lentivirus was separated using a 0.45 μm Cellulose Acetate filter. The culture medium containing the separated lentivirus was mixed with TaKaRa's Lenti-X Concentrator kit at a ratio of 3:1 and reacted overnight under refrigerated conditions. The next day, the lentivirus pellet was obtained by centrifugation at 1,500 xg for 45 minutes in a centrifuge, and the lentivirus pellet was dissolved in 100 μL PBS, aliquoted, and stored in a deep freezer (-80°C).

[0154] The above LV-CMV-stuffer plasmid is shown in SEQ ID NO: 14, and the CMV promoter and Stuffer sequences used therein are shown in SEQ ID NO: 15 and SEQ ID NO: 16, respectively.

[0155] 서열번호 15(CMV promoter): tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttagtgaaccgtcagatc

[0156] 서열번호 16(Stuffer): gtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaacggcgagtggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcag

[0157] In addition, the LV-CMV-EGR1 plasmid is shown in SEQ ID NO: 17, and the CMV promoter and hEGR1 sequences used here are shown in SEQ ID NO: 18 and SEQ ID NO: 19, respectively.

[0158] SEQ ID NO: 18 (CMV promoter): tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccat agtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgc ccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccat tgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttagtgaaccgtcagatc

[0159] SEQ ID NO: 19 (hEGR1): cagtggagtcctgtgatcgccgcttctcccgctccgacgagctcacccgccacatccgcatccacacaggccagaagcccttccagtgccgcatctgcatgcgcaacttcagccgcagcgaccacctcaccacccacatccgcacccacaca ggcgaaaagcccttcgcctgcgacatctgtggaagaaagtttgccaggagcgatgaacgcaagaggcataccaagatccacttgcggcagaaggacaagaaagcagacaaaagtgttgtggcctcttcggccacctcctctctctcttcctac ccgtccccggttgctacctcttacccgtccccggttactacctcttatccatccccggccaccacctcatacccatcccctgtgcccacctccttctcctctcccggctcctcgacctacccatcccctgtgcacagtggcttcccctccccg tcggtggccaccacgtactcctctgttccccctgctttcccggcccaggtcagcagcttcccttcctcagctgtcaccaactccttcagcgcctccacagggctttcggacatgacagcaaccttttctcccaggacaattgaaatttgctaa

[0160] 4-2. Cell culture

[0161] 4.5x10 ARPE-19 cells 5 60 cm in DMEM / F12 culture medium environment with cell count 2 Cultured through culture dishes. On the first day, 1x10 lentivirus overexpressing EGR1 transcription factor was injected into ARPE-19 cells. 8 IU / μL, 2.5x10 8 IU / μL, 5x10 8 Transduction was performed by treating cells with 8 μg / ml polybrene at 1U / μL. The medium was replaced with fresh medium the following day. On the fourth day, cells from all experimental groups were harvested.

[0162] 4-3. Analysis Results

[0163] To determine the effects of doxycycline-induced overexpression of the EGR1 gene in aged ARPE-19 cells, we treated ARPE-19 cells with doxrubicin (250 nM) for 3 days to induce senescence. We then performed an experiment to examine changes in senescence-related genes through lentiviral overexpression of the EGR1 gene (Fig. 8A). Real-time polymerase chain reaction analysis was performed, and the results are presented in Figs. 8A to 8E.

[0164] As can be confirmed in Figure 8, it was confirmed that EGR1 gene overexpression occurred when Doxycycline, a derivative of Tetracycline, was treated (Figure 8B), and the levels of p21, p53, and p16 increased by doxorubicin were significantly reduced by EGR1 overexpression increased by Doxycycline treatment (Figures 8C, 8D, and 8E).

[0165] Therefore, we confirmed that EGR1 overexpression has the effect of alleviating the senescence of senescence-induced ARPE-19 cells.

[0166]

[0167] Example 5. Changes in Egr1 protein expression in retinal pigment epithelial cells (RPE) in mice at different ages (in vivo)

[0168] To determine the relationship between mouse growth and aging and Egr1 protein expression, RPE cells were collected from mice of different ages (3 weeks, 3 months, 6 months, 12 months, and 24 months) and the EGR1 protein expression level was determined through Western blotting, and the results are shown in Fig. 9.

[0169] As can be seen in Figure 9, the expression of Egr1 protein was found to decrease rapidly as the age of 24 months approached.

[0170] Through this, it was confirmed that the level of EGR1 protein expression in mouse RPE cells is related to the aging of mouse RPE.

[0171]

[0172] Example 6. Confirmation of the effect of EGR1 gene expression in a mouse model of dry macular degeneration.

[0173] 6-1. Confirmation of the anti-aging effect of retinal pigment epithelial cells by EGR1 overexpression in a mouse model of dry macular degeneration induced by NaIO3.

[0174] To determine the effects of EGR1 overexpression in vivo, AAV-Egr1 was injected into the subretinal space of a mouse model of dry macular degeneration induced by intraperitoneal injection of NaIO3, inducing EGR1 overexpression, and the relative levels of aging-related markers were then determined.

[0175] First, 1 μL of AAV-mCherry, AAV-Nr2f1, AAV-Egr1, and LV-OSKM were injected subretinally into the subretinal space of 8-week-old male C57BL / 6J mice. Four weeks later, 200 μL of NaIO3 at a concentration of 25 mg / Kg was injected intraperitoneally to induce RPE senescence for 6 weeks. After 6 weeks, the retinas were collected. The relative levels of senescence-related markers in each group were analyzed through Western blotting analysis, and the results are shown in Fig. 10.

[0176] As can be seen in Fig. 10, the AAV-mCherry group, which is the retinal pigment epithelium of mice induced to age by NaIO3, showed an increase in the expression of p53, p16, and p21 proteins, which are aging-related markers, compared to the Normal group, and a significant decrease in the expression of EGR1 protein. In the retinal pigment epithelium cells of the NaIO3-induced dry macular degeneration mouse model group, the EGR1 overexpression treatment group (AAV-Egr1) through AAV showed a significant decrease in the expression of p53, p21, and p16, which are aging markers increased by NaIO3, to the level of the Normal group.

[0177] Through this, it was confirmed that overexpression of EGR1 in aged mice induces reverse aging by reducing cell senescence of retinal pigment epithelial cells.

[0178] 6-2. Confirmation of the effect of EGR1 overexpression on reducing cellular senescence in retinal pigment epithelial cells in a mouse model of dry macular degeneration induced by NaIO3.

[0179] To determine the effects of EGR1 overexpression in vivo, AAV-mCherry / Egr1 was injected into the subretinal space of a mouse model of dry macular degeneration induced by intraperitoneal injection of NaIO3 to induce EGR1 overexpression. The relative levels of aging-related markers and the effect of reducing retinal aging were then determined.

[0180] First, to overexpress EGR1, 1 μL of AAV-mCherry and AAV-mCherry / Egr1 were injected subretinally into the subretinal space of 8-week-old male C57BL / 6J mice. Four weeks later, 200 μL of NaIO3 at a concentration of 25 mg / Kg was injected intraperitoneally to induce RPE senescence for 2 weeks. The retinas were harvested after 2 weeks. The relative levels of senescence-related markers were analyzed through Western blotting analysis, and the proportion of senescent cells in the retinas of each group was analyzed through color fundus photography, β-galactosidase (SA-β-gal) staining, and immunofluorescence staining. These results are shown in Figures 11A to 11D, respectively.

[0181] Referring to Figures 11A to 11D, it was confirmed that the protein level of EGR1 increased in the group in which EGR1 was overexpressed by subretinal injection of AAV-mCherry / Egr1 compared to the control group (Vehicle). After overexpressing EGR1 by subretinal injection of AAV-mCherry / Egr1, NaIO3 was intraperitoneally injected, and the protein levels of p16, p21, and p53, which are senescence markers increased by NaIO3 in retinal pigment epithelial cells of the dry macular degeneration mouse model group (AAV-mCherry / Egr1), were significantly decreased, and it was confirmed that overexpression of EGR1 reduces cell senescence (Figure 11A).

[0182] In addition, the color fundus photography results confirmed that retinal degeneration was recovered in the group injected with NaIO3 and AAV-mCherry / Egr1 together (NaIO3 / AAV-mCherry / Egr1) compared to the group injected with NaIO3 intraperitoneally (Vehicle / AAV-mCherry) (Fig. 11B).

[0183] When SA-β-gal staining was performed on RPE / choroid flatmounts, EGR1 overexpression significantly reduced the SA-β-gal-stained aged RPE area (Fig. 11C).

[0184] In addition, the results of immunofluorescence staining analysis of RPE showed that p21 expression was significantly reduced in the subretinal injection group of AAV-mCherry / Egr1, confirming that EGR1 overexpression reduces cellular senescence of retinal pigment epithelial cells (Fig. 11D).

[0185] From these results, it was confirmed that overexpression of EGR1 reduces cell senescence in RPE in a mouse animal model of dry macular degeneration by intraperitoneal injection of NaIO3.

[0186] 6-3. Confirmation of the visual function improvement effect of EGR1 overexpression in a mouse model of dry macular degeneration.

[0187] To determine the effects of EGR1 overexpression in vivo, AAV-mcherry / Egr1 was injected into the subretinal space of a mouse model of dry macular degeneration induced by intraperitoneal injection of NaIO3, thereby overexpressing EGR1. Changes in visual function in the mice were analyzed using electroretinography (ERG), and the results are shown in Figure 12.

[0188] As shown in Figure 12, the AAV-mcherry / Egr1 injection group showed significant improvements in measured a-wave and b-wave amplitudes compared to the control group, confirming the recovery of mouse visual function. This suggests that EGR1 overexpression has the effect of improving visual function in a mouse model of dry macular degeneration.

[0189] Example 7. Confirmation of the anti-aging effect of retinal pigment epithelial cells by EGR1 overexpression in an aged mouse model.

[0190] To investigate the effects of EGR1 overexpression in vivo in aged mice, AAV-mcherry / Egr1 was injected into the subretinal space of 3-month-old and 24-month-old C57BL / 6J mouse models to overexpress EGR1, and the alleviation of retinal aging was observed 4 weeks later. The RPE layer was isolated, and EGR1 gene overexpression was confirmed through real-time polymerase chain reaction analysis, and the results are shown in Fig. 13. Senescent cells in the RPE layer were analyzed through immunofluorescence staining, and the results are shown in Fig. 14. In addition, the thickness of the outer nuclear layer (ONL), which is the photoreceptor cell nuclear layer, was measured using an optical microscope after hematoxylin-eosin (H&E) staining, and the imaging and quantification results are shown in Fig. 15A and Fig. 15B, respectively.

[0191] Referring to Figure 13, it was confirmed that the expression of the aging marker gene p16 decreased in 24-month-old aged mice due to overexpression of the EGR1 gene.

[0192] Referring to Figure 14, in the subretinal injection group of AAV-mcherry / Egr1 (AAV-mcherry / Egr1) in 24-month-old aged mice, the expression of p21, a senescence marker, in the retinal pigment epithelial cell layer was significantly reduced, thereby confirming that EGR1 overexpression alleviates cellular senescence of retinal pigment epithelial cells in aged mice.

[0193] In addition, as shown in Figure 15, in 24-month-old aged mice, the subretinal injection group of AAV-mcherry / Egr1 (AAV-mcherry / Egr1) showed a significant increase in the thickness of the outer nuclear layer, which is the photoreceptor cell nuclear layer, compared to the AAV-mcherry treatment group.

[0194] Through this, we confirmed that EGR1 overexpression has the effect of alleviating retinal aging in an aged mouse model.

[0195]

[0196] Example 8. Confirmation of the effect of EGR1 overexpression on improving aging stress.

[0197] 8-1. Confirmation of the effect of improving aging stress in an in vitro model

[0198] To determine whether aging stress is improved by EGR1, EGR1 was overexpressed in ARPE-19 cells, which are used as a retinal pigment epithelial (RPE) cell line, and doxorubicin (Dox), a drug that induces aging stress, was treated.

[0199] As a result, it was confirmed that when EGR1 was overexpressed in a Dox-treated environment, the expression level of FAK (Focal adhesion kinase), one of the major cell-matrix adhesion markers, increased, and the expression level of p21, known as a senescence marker, decreased (Fig. 16A).

[0200] The above experimental results demonstrate that overexpression of EGR1 can alleviate aging stress. Furthermore, these changes are specific to aging conditions, not general conditions.

[0201] 8-2. Confirmation of the effect of improving aging stress in an in vivo model

[0202] To confirm the aging stress-improving effects of EGR1 in vivo, a mouse model was used. Specifically, EGR1 was overexpressed in mouse retinal pigment epithelial cells via subretinal injection via adeno-associated virus (AAV). The mice were then treated with NaIO3, known to induce dry macular degeneration, to observe changes.

[0203] As a result, it was confirmed that the expression level of phosphorylated FAK (p-FAK), which is an activated form of FAK, increased in the mouse model, and that APOE, one of the dry macular degeneration markers, and p16, known as an aging marker, decreased (Figure 16B).

[0204] That is, it was verified that overexpression of EGR1 induced a positive effect in a mouse model that induced dry macular degeneration.

[0205] Next, to determine whether overexpression of EGR1 using AAV was specific to retinal pigment epithelial cells, tissue sections from the mouse model were analyzed. As a result, increased expression levels of EGR1 and p-FAK were observed in retinal pigment epithelial cells (Fig. 16C).

[0206] Furthermore, to determine whether EGR1 overexpression strengthens cell-matrix junctions and thereby enhances the viability of retinal pigment epithelial cells, we performed cleaved caspase-3 staining. As a result, we observed a decrease in cleaved caspase-3 staining in retinal pigment epithelial cells overexpressing EGR1 (Fig. 16D). These results imply that EGR1 plays a role in enhancing the survival of retinal pigment epithelial cells in a mouse model of dry macular degeneration.

[0207] Therefore, the above experiments confirmed that overexpression of EGR1, which occurs specifically in retinal pigment epithelial cells, can be used to treat ophthalmic diseases such as dry macular degeneration by strengthening cell-matrix junctions, alleviating aging stress, and improving the viability of retinal pigment epithelial cells.

[0208]

[0209] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering the technical spirit or essential characteristics of the present invention. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A pharmaceutical composition for preventing or treating an ophthalmic disease, comprising an expression vector comprising a polynucleotide encoding EGR1 (Early Growth Response 1); and a promoter operably linked thereto.

2. A pharmaceutical composition according to claim 1, wherein the polynucleotide encoding EGR1 (Early Growth Response 1) transcribes a protein represented by SEQ ID NO:

20.

3. A pharmaceutical composition according to claim 1, wherein the polynucleotide encoding EGR1 (Early Growth Response 1) is composed of a base sequence represented by SEQ ID NO: 7 or SEQ ID NO:

19.

4. A pharmaceutical composition according to claim 1, wherein the expression vector is a recombinant expression vector into which an EGR1 (Early Growth Response 1) gene is inserted.

5. A pharmaceutical composition according to claim 1, wherein the expression vector expresses the EGR1 gene.

6. A pharmaceutical composition according to claim 1, wherein the promoter is any one selected from the group consisting of an EGR1 (Early Growth Response 1) promoter, a BEST1 (VMD2) promoter, an RPE65 promoter, an RDH5 promoter, a CMV (cytomegalovirus) promoter, an RLBP1 (CRALBP) promoter, an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a HSV tk promoter, an RSV U6 promoter, a promoter, an EF1 alpha promoter, a metallothionine promoter, a beta-actin promoter, a promoter of a human IL-2 gene, a promoter of a human IFN gene, a promoter of a human IL-4 gene, a promoter of a human lymphotoxin gene, and a promoter of a human GM-CSF gene.

7. A pharmaceutical composition according to claim 1, wherein the expression vector comprises at least one selected from the group consisting of a viral vector, a plasmid, and a non-viral vector.

8. A pharmaceutical composition according to claim 7, wherein the viral vector comprises any one selected from the group consisting of an adeno-associated virus (AAV) vector, an adenovirus vector, a lentivirus vector, a herpes simplex virus vector, a baculovirus vector, a Sendai virus vector, and a retrovirus vector.

9. A pharmaceutical composition according to claim 7, wherein the expression vector is an adeno-associated virus (AAV) vector or a lentivirus.

10. In the 9th paragraph, the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, A pharmaceutical composition, wherein the composition is any one selected from the group consisting of AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 and AAV.HSC16.

11. A pharmaceutical composition according to claim 1, wherein the composition inhibits the expression of at least one protein selected from the group consisting of p16, p21, and p53.

12. A pharmaceutical composition according to claim 1, wherein the pharmaceutical composition is an ophthalmic composition for topical administration to the eye.

13. In paragraph 1, the ophthalmic disease is age-related macular degeneration (AMD), diabetic retinopathy, macular edema, cystoid macular edema, retinitis pigmentosa (RP), Leber's congenital amaurosis (LCA), Stargardt's disease, Usher's syndrome, choroidal plexus atrophy, rod-cone or cone-rod dystrophy, ciliopathies, mitochondrial disorders, progressive retinal atrophy, degenerative retinal diseases, familial or acquired maculopathy, sickle cell retinopathy, retinal pigment epithelium-system diseases, uveitis, retinal detachment, traumatic retinal damage, iatrogenic retinal damage, macular hole, macular telangiectasia, ganglion cell disease, optic nerve disease, glaucoma, optic neuropathy, ischemic retinal disease, retinopathy of prematurity, retinal vascular occlusion, polypoid choroidal vasculopathy, retinal hypoxia, familial macroneuropathy, retinal vascular disease, ocular vascular disease, glaucoma-induced A pharmaceutical composition comprising at least one selected from the group consisting of retinal neuron degeneration and ischemic optic neuropathy.

14. A pharmaceutical composition according to claim 13, wherein the ophthalmic disease is age-related macular degeneration (AMD).

15. A pharmaceutical composition according to claim 14, wherein the age-related macular degeneration includes wet macular degeneration or dry macular degeneration.

16. An ophthalmic preparation comprising a pharmaceutical composition according to any one of claims 1 to 15.

Images