Pharmaceutical composition for preventing or treating obesity comprising extracellular vesicle derived from bifidobacterium spp. strain as effective ingredient, and food for preventing or improving obesity

Extracellular vesicles from Bifidobacterium spp. strains provide a side-effect-free solution for obesity by reducing weight and fat accumulation, addressing the limitations of current treatments.

WO2025198350A1PCT designated stage Publication Date: 2025-09-25NVIENCE INC +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/003605
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-19
Filing Date
2025-03-20
Publication Date
2025-09-25

AI Technical Summary

Technical Problem

Existing treatments for obesity often have side effects and are not long-lasting, and there is a need for effective, side-effect-free interventions to address obesity and related metabolic disorders.

Method used

A pharmaceutical and food composition utilizing extracellular vesicles derived from Bifidobacterium spp. strains, which can be naturally or artificially produced, to reduce body weight, triglycerides, and fat accumulation, and inhibit fat synthesis gene expression.

Benefits of technology

The compositions effectively reduce body weight, liver triglycerides, and fat cell size without affecting appetite, exhibiting a powerful anti-obesity effect and improving metabolic health.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025003605_25092025_PF_FP_ABST
    Figure KR2025003605_25092025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating obesity, and a food composition for preventing or improving obesity, comprising an extracellular vesicle derived from a Bifidobacterium spp. strain as an active ingredient. The composition of the present invention has the effect of reducing body weight in an obese animal model, reducing the amount of neutral fat in the liver and total cholesterol in the blood and the weight of white fat that are increased in an obese animal model, and reducing fat accumulation in the liver and brown adipose tissue and the size of white adipose cells without causing a decrease in appetite. In addition, the extracellular vesicle of the present invention has the effect of inhibiting fat synthesis in adipocytes that have induced fat accumulation. As such, the extracellular vesicle derived from a Bifidobacterium spp. strain of the present invention exhibits an excellent anti-obesity effect, and may be effectively utilized as a pharmaceutical composition for preventing or treating obesity.
Need to check novelty before this filing date? Find Prior Art

Description

Pharmaceutical composition for preventing or treating obesity, containing extracellular vesicles derived from Bifidobacterium spp. strains as an active ingredient, and food for preventing or improving obesity

[0001] The present invention relates to a pharmaceutical composition for preventing or treating obesity, which comprises an extracellular vesicle derived from a Bifidobacterium spp. strain as an active ingredient, and a food composition for preventing or improving obesity.

[0002] This application claims priority to Korean Patent Application No. 10-2024-0039320, filed March 21, 2024, and Korean Patent Application No. 10-2025-0035393, filed March 19, 2025, the entire disclosures of which are incorporated herein by reference.

[0003] Lactic acid bacteria possess unique physiological properties and are generally regarded as safe (GRAS) bacteria. Lactic acid bacteria are used in the production of various fermented foods, as well as in dairy products and fermented fruit and vegetable products for their functional and probiotic properties. Recently, with increasing consumer demand for natural supplements that replace chemical additives, they have emerged as an alternative.

[0004] Probiotics are live microorganisms that have a significant health benefit for the host animal. They improve the balance of intestinal microorganisms and enhance nutrient absorption. Furthermore, probiotics exhibit antibacterial properties against pathogenic microorganisms in the intestinal environment. Probiotics encompass a wide range of microorganisms, but the most common genera are Lactobacillus and Bifidobacterium.

[0005] Obesity is known to be a major risk factor for heart disease, cancer, arthritis, and diabetes. Despite increasing public awareness of the risks of obesity, the number of obese patients continues to increase. Obesity is caused by an increase in the number of adipocytes and their lipid content as a result of adipogenesis. Adipocytes play a key role in synthesizing and storing excess calories as triglycerides. Adipogenesis increases the size and number of adipocytes and accelerates intracellular lipid accumulation. Furthermore, obesity induces lipotoxicity and oxidative stress, leading to insulin resistance, which can lead to hyperglycemia, contributing to various obesity-related diseases.

[0006] However, existing treatments have side effects such as heart disease, respiratory disease, and nervous system disease, and their efficacy is not long-lasting. There are few treatments that have been reported to have satisfactory therapeutic effects without side effects. Therefore, the development of new treatments for obesity and non-alcoholic fatty liver disease is required.

[0007] One object of the present invention is to provide a pharmaceutical composition for preventing or treating obesity, which comprises extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0008] Another object of the present invention is to provide a kit for preventing or treating obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain and an instruction manual.

[0009] Another object of the present invention is to provide a food composition for preventing or improving obesity, which comprises extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0010] Another object of the present invention is to provide a feed composition for preventing or improving obesity, which comprises extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0011]

[0012] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by a person having ordinary skill in the technical field to which the present invention belongs from the description below.

[0013] The present invention provides a pharmaceutical composition for preventing or treating obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0014] In one embodiment of the present invention, the Bifidobacterium genus strain may be at least one selected from the group consisting of Bifidobacterium longum, Bifidobacterium adolescentis, Bifidobacterium bifidum, Bifidobacterium breve, and Bifidobacterium lactis, but is not limited thereto.

[0015] In one embodiment of the present invention, the extracellular vesicles may be naturally secreted or artificially produced from a Bifidobacterium strain, but are not limited thereto.

[0016] In one embodiment of the present invention, the extracellular vesicles may be from 10 nm to 400 nm, but are not limited thereto.

[0017] In one embodiment of the present invention, the composition may be characterized by at least one selected from the group consisting of, but not limited to:

[0018] a) Weight loss;

[0019] b) Maintain food intake;

[0020] c) Reduction of triglycerides, low-density lipoprotein, high-density lipoprotein, and total cholesterol;

[0021] d) Fat accumulation and reduction in cell size in the liver, white fat, and brown fat; and

[0022] e) Decreased expression of fat synthesis genes.

[0023] In one embodiment of the present invention, the composition may be administered orally, but is not limited thereto.

[0024] The present invention provides a kit for preventing or treating obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain and an instruction manual.

[0025] The present invention provides a food composition for preventing or improving obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0026] In one embodiment of the present invention, the food may be a health functional food, but is not limited thereto.

[0027] The present invention provides a feed composition for preventing or improving obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0028]

[0029] In addition, the present invention provides a method for preventing, improving, or treating obesity, comprising a step of administering a pharmaceutically effective amount of a composition containing extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient to a subject in need thereof.

[0030] In addition, the present invention provides a composition comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient for use in preventing, improving, or treating obesity.

[0031] In addition, the present invention provides a use for manufacturing a preparation for preventing, improving, or treating obesity, comprising a composition comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0032] According to a pharmaceutical composition for preventing or treating obesity, and a food composition for preventing or improving obesity, which contains extracellular vesicles derived from a strain of the genus Bifidobacterium as an active ingredient, the composition of the present invention reduces the body weight of an obese animal model, reduces increased liver triglycerides and blood total cholesterol, and reduces the weight of white fat and the size of fat cells without causing a decrease in appetite, thereby exhibiting an excellent anti-obesity effect, and thus can be usefully utilized as a food and / or pharmaceutical composition for preventing or improving obesity.

[0033] Figure 1 shows the results of particle size measurement of extracellular vesicles derived from Bifidobacterium spp. strains.

[0034] Figure 2 is a schematic diagram of an experiment to confirm the anti-obesity effect of Bifidobacterium longum-derived extracellular endoplasmic reticulum (BL-EV) in an obese animal model produced by feeding a high-calorie diet.

[0035] Figure 3a is a drawing confirming changes in body shape after administering extracellular vesicles derived from Bifidobacterium longum to an obese animal model for 4 weeks.

[0036] Figure 3b is a graph showing the actual body weight (g) and body weight change rate (%) measured while administering Bifidobacterium longum-derived extracellular vesicles for 4 weeks to an obese animal model (in the actual body weight graph, from the top on the leftmost side of the x-axis (day 1), in that order: BL-EV, Vehicle, and Normal; in the top on the rightmost side of the x-axis (day 29), in that order: Vehicle, Nomal, and BL-EV) (in the body weight change rate graph, from the top on the rightmost side of the x-axis (day 29), in that order: Normal, Vehicle, and BL-EV).

[0037] Figure 3c is a graph showing the results of measuring food intake when Bifidobacterium longum-derived extracellular vesicles were administered to an obese animal model for 4 weeks (left bar graph - Vehicle, right bar graph - BL-EV).

[0038] Figure 3d is a graph showing the results of measuring the level of neutral fat per tissue weight (mg / g) in liver tissue and the level of neutral fat in the whole liver (mg / Liver) tissue after administering extracellular vesicles derived from Bifidobacterium longum to an obese animal model for 4 weeks.

[0039] Figure 3e shows the results of measuring neutral fat, low-density lipoprotein, high-density lipoprotein, and total cholesterol in the blood after administering extracellular vesicles derived from Bifidobacterium longum for 4 weeks to an obese animal model.

[0040] Figure 3f shows the results of measuring the weight of white fat, which is responsible for energy storage in the body, after administering extracellular vesicles derived from Bifidobacterium longum to the obese animal model of Figure 3e for 4 weeks.

[0041] Figure 3g shows the results of analyzing fat accumulation and fat cell size in the liver, white fat, and brown fat tissues after administering Bifidobacterium longum-derived extracellular vesicles for 4 weeks to the obese animal model of Figure 3e.

[0042] Figures 4a to 4d show the results of analyzing the expression of genes related to fat synthesis after treating 3T3-L1 mouse adipocytes with Bifidobacterium adolescentis-derived extracellular endoplasmic reticulum (BA-EV), Bifidobacterium bifidum-derived extracellular endoplasmic reticulum (BB-EV), Bifidobacterium breve-derived extracellular endoplasmic reticulum (BBR-EV), and Bifidobacterium lactis-derived extracellular endoplasmic reticulum (BLA-EV), respectively, and inducing fat accumulation with oleic acid.

[0043] The present invention provides a pharmaceutical composition for preventing or treating obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0044] The present invention relates to a pharmaceutical composition for preventing or treating obesity, comprising extracellular vesicles derived from Bifidobacterium spp. strains as an active ingredient, and was completed by confirming that various extracellular vesicles derived from Bifidobacterium spp. strains can exhibit a powerful anti-obesity effect. Therefore, the extracellular vesicles of the present invention can be used as a pharmaceutical composition for preventing or treating obesity.

[0045] In the present invention, “Bifidobacterium spp. or the genus Bifidobacterium strain” may include strains belonging to the genus Bifidobacterium that are already known in the art or that will be newly discovered in the future. Bifidobacterium is a Gram-positive anaerobic bacterium and is one of the main types of bacteria that constitute the gastrointestinal microflora of mammals, but some Bifidobacterium strains are known to be used as lactic acid bacteria. The Bifidobacterium strain according to the present invention is included without limitation as long as it falls under the genus Bifidobacterium and is not limited to a specific type.

[0046] In one embodiment of the present invention, it was confirmed that BL-EV (Bifidobacterium longum-derived extracellular vesicle) as an extracellular vesicle derived from the genus Bifidobacterium exhibits effects of reducing body weight, reducing lipids and proteins, reducing white fat weight, and reducing fat accumulation in the liver, white fat, and brown fat, as well as reducing fat cell size in an obese animal model. In addition, in addition to Bifidobacterium longum, various other Bifidobacterium-derived extracellular vesicles, such as BA-EV (Bifidobacterium adolescentis-derived extracellular vesicle), BB-EV (Bifidobacterium bifidum-derived extracellular vesicle), BBR-EV (Bifidobacterium breve-derived extracellular vesicle), and BLA-EV (Bifidobacterium lactis-derived extracellular vesicle), were confirmed to significantly reduce the expression of genes related to fat synthesis.

[0047] Therefore, in one embodiment of the present invention, the Bifidobacterium genus strain may be at least one selected from the group consisting of Bifidobacterium longum, Bifidobacterium adolescentis, Bifidobacterium bifidum, Bifidobacterium breve, and Bifidobacterium lactis, but is not limited thereto.

[0048] In one embodiment of the present invention, the particle sizes of BL-EV, BA-EV, BB-EV, BBR-EV, and BLA-EV were analyzed. Here, the particle size may refer to the diameter of the extracellular vesicles of the present invention.

[0049] In one embodiment of the present invention, the size of the extracellular vesicles may be from 10 nm to 400 nm, but is not limited thereto. For example, 10 nm to 300 nm, 10 nm to 200 nm, 10 nm to 190 nm, 10 nm to 180 nm, 10 nm to 170 nm, 10 nm to 168 nm, 10 nm to 165 nm, 10 nm to 162 nm, 30 nm to 400 nm, 30 nm to 300 nm, 30 nm to 200 nm, 30 nm to 190 nm, 30 nm to 180 nm, 30 nm to 170 nm, 30 nm to 168 nm, 30 nm to 165 nm, 30 nm to 162 nm, 60 nm to 400 nm, 60 nm to 300 nm, 60 nm to 200 nm, 60 nm to 190 nm, 60 nm to It may be 180 nm, 60 nm to 170 nm, 60 nm to 168 nm, 60 nm to 165 nm, 60 nm to 162 nm, 90 nm to 400 nm, 90 nm to 300 nm, 90 nm to 200 nm, 90 nm to 190 nm, 90 nm to 180 nm, 90 nm to 170 nm, 90 nm to 168 nm, 90 nm to 165 nm, 90 nm to 162 nm, but is not limited thereto.

[0050] The composition of the present invention can exhibit an anti-obesity effect by using extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient. In this case, the active ingredient may additionally include, in addition to the extracellular vesicles derived from the Bifidobacterium spp. strain, a Bifidobacterium spp. strain capable of producing or containing the extracellular vesicles derived from the Bifidobacterium spp. strain, or a culture medium thereof, but is not limited thereto.

[0051] In the present invention, the term "strain" includes not only the live bacteria themselves obtained from a culture medium or the like, but also any processed form of the strain known to those skilled in the art, including, but not limited to, a lysate, dried product, frozen product, etc. In the present invention, the term "strain" may be used interchangeably with "bacteria," "bacterial cells," etc.

[0052] In the present invention, “crushed material” may mean a product obtained by crushing the cell wall of a strain by chemical treatment or applying physical force to the strain, but is not limited thereto.

[0053] In the present invention, the “culture medium” refers to the entire medium containing the strain, its metabolites, and extra nutrients, etc., obtained by culturing the strain for a certain period of time in a medium capable of supplying nutrients so that the strain can grow or survive in a test tube. In other words, the culture medium may refer to the culture medium itself obtained by culturing the strain. In addition, the culture medium may include a culture medium obtained by removing the bacterial cells from the bacterial cell culture obtained by culturing the strain. In this case, the liquid from the culture medium from which the bacterial cells have been removed may be referred to interchangeably as “supernatant,” “culture supernatant,” “conditioned culture medium,” or “conditioned medium.” The supernatant may be obtained by allowing the culture medium to stand still for a certain period of time and taking only the liquid in the upper layer excluding the portion that has settled to the lower layer, removing the bacterial cells through filtration, or centrifuging the culture medium to remove the sediment at the lower layer and taking only the liquid in the upper layer. In addition, the culture medium may include an extract of the culture medium, a concentrate thereof, or a lyophilized product thereof; Or, it may additionally include not only a culture supernatant obtained by removing the strain from the culture medium, but also an extract thereof, a concentrate thereof, or a lyophilized product thereof; but is not limited thereto. The culture medium may be obtained by culturing the strain of the present invention in an appropriate medium (e.g., RCM (reinforced clostridial medium) medium) at any temperature of 10°C to 50°C, 10°C to 40°C, 20°C to 50°C, 20°C to 40°C, or 30°C to 40°C for a certain period of time, for example, 4 to 50 hours, 4 to 40 hours, 4 to 30 hours, 4 to 20 hours, or 10 to 20 hours, but is not limited thereto. A person skilled in the art may appropriately select or modify the culture medium and culture conditions for culturing the strain of the present invention and use them.

[0054] In the present invention, the “concentrate” can be obtained by a step of concentrating the culture solution itself described above, or the supernatant obtained from the culture solution by centrifugation, filtration, or the like.

[0055] In the present invention, “extract” means an extract obtained from the aforementioned culture solution or a concentrate thereof, and may include an extract, a dilution or concentrate of the extract, a dried product or lyophilized product obtained by drying the extract, or a controlled or purified product thereof, or a fraction obtained by fractionating the extract.

[0056] In the present invention, "bacterial cells" refers to the strain itself, and may include the strain itself selected by separating from a biological sample or the like, or the strain isolated from the culture medium in which the strain is cultured. The bacterial cells may be obtained by centrifuging the culture medium and taking the portion that has settled to the lower layer, or by allowing the bacterial cells to settle to the lower layer of the culture medium by gravity and then removing the upper liquid after leaving them still for a certain period of time, but the present invention is not limited thereto, and may be obtained by a method commonly used in the art.

[0057] In the present invention, "extracellular vesicles (EVs)" are membrane-bound vesicles released from cells, which are structures responsible for intercellular signaling and material transport. They can be classified into exosomes, microvesicles, and apoptotic bodies depending on their size and origin. Exosomes are formed from polymorphic endosomes, fuse with the cell membrane, and are released, and mainly contain proteins, lipids, RNA, etc. Microvesicles are released by direct budding from the cell membrane and play an important role in interactions with the surrounding environment. Apoptotic bodies are formed by the fragmentation of cytoplasm during the apoptosis process and are associated with the immune response. These EVs are found in body fluids such as blood, saliva, and urine, and are involved in various physiological processes and disease progression.

[0058] Extracellular vesicles can reflect the state of the secreting source cell (donor cell), and exhibit various biological activities depending on which cell they are secreted from. They can also play an important role in cell-to-cell interactions by transferring genetic material and proteins between cells. In addition, cell-derived substances including extracellular vesicles stimulate immune cells to fight against diseases, and have the effect of helping humans break down and absorb substances that cannot be digested through the metabolic process of microorganisms. Extracellular vesicles are membrane-structured vesicles that are distinguished by an inside and an outside, and contain plasma membrane lipids, plasma membrane proteins, nucleic acids, and cytoplasmic components of the cell, and may be smaller than the cell from which they are derived.

[0059] In the present invention, “extracellular vesicles” may be used interchangeably with “extracellular vesicles” and may be referred to as “endoplasmic reticulum” or “vesicles”.

[0060] The extracellular vesicles according to the present invention can be produced during in vitro culture of the strain. Specifically, the vesicles according to the present invention can be naturally secreted from a Bifidobacterium strain or artificially produced (isolated) through heat treatment, pressure treatment, or the like, but are not limited thereto. Accordingly, in one embodiment of the present invention, the extracellular vesicles can be naturally secreted from a Bifidobacterium strain or artificially produced, but are not limited thereto.

[0061] In one embodiment of the present invention, the composition may be characterized by at least one selected from the group consisting of, but not limited to:

[0062] a) Weight loss;

[0063] b) Maintain food intake;

[0064] c) Reduction of triglycerides, low-density lipoprotein, high-density lipoprotein, and total cholesterol;

[0065] d) Fat accumulation and reduction in cell size in the liver, white fat, and brown fat; and

[0066] e) Decreased expression of fat synthesis genes.

[0067] In one embodiment of the present invention, it was confirmed that when Bifidobacterium adolescentis, Bifidobacterium bifidum, Bifidobacterium breve, and Bifidobacterium lactis-derived extracellular vesicles BA-EV, BB-EV, BBR-EV, and BLA-EV were respectively treated, a significantly excellent anti-obesity effect was exhibited as the expression of fat synthesis genes was reduced. At this time, Fasn, Acc1, Scd1, and Pparg were analyzed as fat synthesis genes.

[0068] In the present invention, "Fasn (Fatty Acid Synthase)" is an enzyme responsible for fatty acid synthesis, primarily promoting palmitic acid (C16:0) synthesis. It is a multifunctional enzyme that synthesizes fatty acids using acetyl-CoA and malonyl-CoA in the cytoplasm. Its expression is known to increase in various diseases related to fat metabolism, particularly obesity and cancer.

[0069] In the present invention, "Acc1 (Acetyl-CoA Carboxylase 1)" is an enzyme that converts acetyl-CoA to malonyl-CoA, regulating the rate-determining step in fatty acid biosynthesis. It primarily regulates fatty acid synthesis in the liver and adipose tissue, and is associated with insulin signaling. Increased Acc1 activity promotes lipogenesis, while inhibition of Acc1 activity increases fatty acid oxidation.

[0070] In the present invention, "Scd1 (Stearoyl-CoA Desaturase 1)" is a Δ9-fatty acid desaturase that converts saturated fatty acids into unsaturated fatty acids. It converts palmitic acid and stearic acid into oleic acid, contributing to the regulation of membrane lipid composition and signal transduction. Increased expression of Scd1 may be associated with obesity, insulin resistance, and hepatic steatosis.

[0071] In the present invention, "Pparg (Peroxisome Proliferator-Activated Receptor Gamma)" is a nuclear receptor transcription factor that plays a key role in regulating adipocyte differentiation and lipid metabolism. It is primarily expressed in adipose tissue, increases insulin sensitivity, and has anti-inflammatory properties. Thiazolidinedione drugs, which are Pparg agonists, are used to treat type 2 diabetes.

[0072] The pharmaceutical composition according to the present invention may be formulated and used in the form of external preparations such as powders, granules, sustained-release granules, enteric-coated granules, liquids, eye drops, ellipsoids, emulsions, suspensions, alcohols, troches, aromatic waters, limonades, tablets, sustained-release tablets, enteric-coated tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, irrigation solutions, ointments, lotions, pastes, sprays, inhalants, patches, sterile injection solutions, or aerosols, according to a conventional method, and the external preparations may have formulations such as creams, gels, patches, sprays, ointments, ointments, lotions, liniments, pastes, or cataplasmas.

[0073] Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0074] When formulating, it is usually prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.

[0075] The additives of the tablets, powders, granules, capsules, pills, and troches according to the present invention include excipients such as corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, D-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, calcium hydrogen phosphate, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methylcellulose, sodium carboxymethylcellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methylcellulose (HPMC), HPMC 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose acetate phthalate, carboxymethylcellulose, calcium carboxymethylcellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethylcellulose, sodium methylcellulose, methylcellulose, microcrystalline cellulose, dextrin, hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, refined shellac, starch starch, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinyl alcohol, polyvinyl pyrrolidone, and binders such as hydroxypropyl methylcellulose, corn starch, agar powder, methylcellulose, bentonite, hydroxypropyl starch, sodium carboxymethylcellulose, sodium alginate, Disintegrants such as carboxymethylcellulose calcium, calcium citrate, sodium lauryl sulfate, anhydrous silicic acid, 1-hydroxypropyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, baking soda, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, amylopectin, pectin, sodium polyphosphate, ethylcellulose, sucrose, magnesium aluminum silicate, di-sorbitol solution, and light anhydrous silicic acid;Lubricants such as calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopodium dentata, kaolin, petrolatum, sodium stearate, cacao butter, sodium salicylate, magnesium salicylate, polyethylene glycol (PEG) 4000, PEG 6000, liquid paraffin, hydrogenated soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, anhydrous silicic acid, higher fatty acids, higher alcohols, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, and light anhydrous silicic acid can be used.;

[0076] As additives of the liquid formulation according to the present invention, water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (twin esters), polyoxyethylene monoalkyl ethers, lanolin ethers, lanolin esters, acetic acid, hydrochloric acid, ammonia water, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethylcellulose, sodium carboxymethylcellulose, etc. can be used.

[0077] The syrup according to the present invention may include a solution of white sugar, other sugars, or sweeteners, and may also include a fragrance, a coloring agent, a preservative, a stabilizer, a suspending agent, an emulsifier, a viscosity modifier, and the like, as needed.

[0078] Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.

[0079] The suspension according to the present invention may include suspending agents such as acacia, tragacanth, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, and HPMC 2910, and surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.

[0080] The injection according to the present invention includes a solvent such as distilled water for injection, 0.9% sodium chloride injection, Ringer's injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated Ringer's injection, ethanol, propylene glycol, non-volatile oils - sesame oil, cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; a solubilizing agent such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tween, nitrile acid amide, hexamine, and dimethylacetamide; a buffer such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, and gums; It may include isotonic agents such as sodium chloride; stabilizers such as sodium bisulfite (NaHSO3), carbon dioxide gas, sodium metabisulfite (Na2S2O5), sodium sulfite (Na2SO3), nitrogen gas (N2), and ethylenediaminetetraacetic acid; oxidizing agents such as sodium bisulfite 0.1%, sodium formaldehyde sulfoxylate, thiourea, disodium ethylenediaminetetraacetic acid, and acetone sodium bisulfite; analgesics such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; and suspending agents such as sodium cis-methylenediamine, sodium alginate, Tween 80, and aluminum monostearate.

[0081] The suppository according to the present invention comprises cocoa butter, lanolin, withepsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cocoa butter + cholesterol, lecithin, ranet wax, glycerol monostearate, Tween or Span, Imhausen, monolene (propylene glycol monostearate), glycerin, Adeps solidus, Buytyrum Tego-G, Cebes Pharma 16, hexalide base 95, Cotomar, Hydroxocote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Mechanisms such as Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), Suppository type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), Supostal (N, Es), Wecovi (W, R, S, M, Fs), and Tezester triglyceride basis (TG-95, MA, 57) can be used.

[0082] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms are prepared by mixing the extract with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

[0083] Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, flavoring agents, and preservatives. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

[0084] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level can be determined based on factors including the type and severity of the patient's disease, drug activity, drug sensitivity, administration time, administration route and excretion rate, treatment period, concurrently used drugs, and other factors well known in the medical field.

[0085] The pharmaceutical composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents. It can be administered sequentially or simultaneously with conventional therapeutic agents, or in single or multiple doses. Taking all of the above factors into account, it is important to administer an amount that achieves maximum efficacy with minimal side effects. This amount can be readily determined by those skilled in the art to which the present invention pertains.

[0086] The pharmaceutical composition of the present invention can be administered to a subject via various routes. All modes of administration are conceivable, including oral ingestion, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, intrathecal injection, sublingual administration, buccal mucosal administration, rectal insertion, vaginal insertion, ocular administration, otic administration, nasal administration, inhalation, oral or nasal spraying, dermal administration, and transdermal administration.

[0087] The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with various related factors such as the disease to be treated, route of administration, age, sex, weight, and severity of the disease of the patient.

[0088] In the present invention, “subject” means a subject requiring treatment for a disease, and more specifically, a mammal such as a human or non-human primate, mouse, rat, dog, cat, horse, and cow.

[0089] In the present invention, “administration” means providing a predetermined composition of the present invention to a subject by any appropriate method.

[0090] In the present invention, “prevention” means any action that suppresses or delays the onset of a target disease, “treatment” means any action that improves or beneficially changes a target disease and its metabolic abnormality symptoms by administering a pharmaceutical composition according to the present invention, and “improvement” means any action that reduces a parameter related to a target disease, for example, the severity of a symptom, by administering a composition according to the present invention.

[0091] The present invention provides a kit for preventing or treating obesity, comprising: extracellular vesicles derived from a Bifidobacterium spp. strain, or a composition comprising the same as an active ingredient; and an instruction manual.

[0092] In the present invention, the "kit" refers to a tool that can prevent or treat obesity using the extracellular vesicles derived from the Bifidobacterium spp. strain of the present invention. In addition to the above-mentioned substances, the kit of the present invention may include other components, compositions, solutions, devices, etc. that are typically required for the storage and processing methods thereof. As a specific example, each component may be applied at least once without limitation on the number of times, there is no limitation on the order in which each substance is applied, and the application of each substance may be performed simultaneously or microscopically.

[0093] In the present invention, the kit may include a container; instructions; and the like. The container may serve to package the substance, and may also serve to store and fix the substance. The material of the container may take the form of, for example, a bottle, a tub, a sachet, an envelope, a tube, an ampoule, and the like, and these may be formed partially or wholly from plastic, glass, paper, foil, wax, and the like. The container may be initially equipped with a completely or partially detachable stopper, which may be part of the container or may be attached to the container by mechanical, adhesive, or other means, and may also be equipped with a stopper for allowing access to the contents by means of a syringe needle. The kit may include an outer package, and the outer package may include instructions for the use of the components.

[0094] The present invention provides a food composition for preventing or improving obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0095] In one embodiment of the present invention, the food may be a health functional food, but is not limited thereto.

[0096] In the present invention, “food” means a natural product or processed product containing one or more nutrients, preferably a product that has gone through a certain degree of processing to become directly edible, and in its usual sense, includes all health functional foods, beverages, food additives, and beverage additives.

[0097] In the present invention, the term “functional food” is the same as food for special health use (FoSHU), and refers to a food with high medical or healthcare effects that is processed to efficiently exhibit a bioregulatory function in addition to providing nutrition, and can be manufactured in the form of tablets, capsules, pills, granules, powders, liquids, flakes, pastes, syrups, gels, jellies, bars, or films. Here, “functionality” means regulating nutrients for the structure and functions of the human body or obtaining a useful effect for health purposes such as physiological actions.

[0098] In the present invention, there is no particular limitation on the type of the health functional food. Specifically, examples of foods to which the composition of the present invention can be added include dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and particularly, all foods designed to sufficiently exert the body's regulatory functions, such as regulating the biological defense rhythm, disease prevention, and recovery, of the food group or food composition that has added value so that the function of the food in the conventional sense can be performed and expressed for a specific purpose.

[0099] In the present invention, “food additive” refers to a substance that is added to, mixed with, infiltrated into, or used in any other way in the manufacture, processing, or preservation of food, and must be harmless to the human body when consumed over a long period of time, such as a health functional food.

[0100] When the composition of the present invention is used as a food additive, the food additive may be added as is or used together with other foods or food ingredients, and may be used appropriately according to a conventional method.

[0101] The amount of active ingredients mixed can be appropriately determined depending on the intended use (prevention, health, or therapeutic treatment). Generally, when manufacturing a food or beverage, the composition of the present invention can be added in an amount of 15% by weight or less, or 10% by weight or less, based on the raw material. However, for long-term intake for health and hygiene purposes or health control purposes, the amount may be less than the above range, and since there are no safety issues, the active ingredients can also be used in amounts greater than the above range.

[0102] In the present invention, the composition may include various food additives that are food-related and acceptable, and may further include appropriate carriers, excipients, and diluents commonly used in the manufacture of foods.

[0103] In addition to the above, the composition of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These ingredients may be used independently or in combination. The ratio of these additives is not particularly important, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention, but is not limited thereto, and may be an optimal or arbitrary amount depending on the type, function, etc. of the product utilized.

[0104] In the present invention, there is no particular limitation on the type of the food. Examples of foods to which the substance can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and all health functional foods in the conventional sense can be included, but are not limited thereto.

[0105] In addition, the composition according to the present invention can be added to health drinks, and, like conventional beverages, can contain various flavoring agents or natural carbohydrates as additional ingredients. The natural carbohydrates mentioned above are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As sweeteners, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame can be used. The proportion of the above natural carbohydrates may be generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention, but is not limited thereto, and may be a general amount added in the art, or may include the maximum range to enhance the efficacy of the composition of the present invention, and may include an optimal, arbitrary amount considering the synergistic effect with other substances added together.

[0106] The present invention provides a feed composition for preventing or improving obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

[0107] In the present invention, “feed” means food for animals to eat, ingest, and digest. The feed can provide organic or inorganic nutrients necessary to sustain the life of the animal. At this time, the feed may include a “feed additive,” and in the present invention, the feed additive may be a substance added to the feed and used for auxiliary purposes such as helping the animal grow healthily, improving productivity, or improving the quality of life of the animal. Accordingly, the present invention provides a feed additive composition for preventing or improving obesity, which comprises extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient. When the feed composition of the present invention is used as a feed additive, it can exhibit an anti-obesity effect by being added to general feed and fed.

[0108] In the present invention, the feed may be administered to an animal alone, or may further comprise carriers, diluents, excipients, additives, and antioxidants. In addition, the feed may further comprise antioxidants, preservatives, surfactants, seasonings, texturizing agents, stabilizers, colorants, or flavoring agents. In addition, when the feed in the present invention refers to a feed additive, it may be administered alone or together with feed according to a method generally applied in the art. In addition, when the feed in the present invention refers to a feed additive, the contents described in the present invention or generally applied in the art may be applied.

[0109] In the present invention, “carrier” means a material that can improve dispersibility by supporting an active ingredient and can be used in feed with excellent chemical stability and adsorption properties, and includes organic carriers and inorganic carriers. The organic carrier is a material containing a large amount of crude fiber, and may include corn flour, corncob flour, wheat bran, rice bran powder, defatted rice bran, bran, cornstalk flour, peanut shell powder, etc. Inorganic carriers are minerals mainly classified into calcium salts and silicon oxides, and are used in the production of trace element premixes, and may include calcium carbonate, silicate, vermiculite, zeolite, sepiolite, etc.

[0110] In the present invention, “diluent” means a substance that uniformly distributes additive raw materials in a material, diluting high-concentration additive raw materials into low-concentration premix or preliminary blend, separating trace components from each other and reducing interactions between active ingredients, thereby increasing the stability of the active ingredient without affecting the physicochemical properties of the related material, and includes organic diluents and inorganic diluents. Organic diluents may include corn flour, corn flour with the germ removed, dextrose, sucrose, semolina including wheat bran, roasted soybean flour, wheat middling, corn gluten meal, etc., and inorganic diluents may include limestone, calcium dihydrogen phosphate, shell powder, kaolin, salt, and sodium sulfate.

[0111] In the present invention, the “excipient” may include a wetting agent that induces the viscosity of the material itself, a binder that binds the material, a disintegrant that disintegrates the entire material into a large number of fine particles, a filtering aid that reduces friction between particles, or an anti-adhesive agent that prevents adhesion of materials, and may include magnesium stearate, talc, vegetable oil, magnesium lauryl sulfate, starch, starch slurry, water, inorganic salt, dextrin, powdered sugar, and the like.

[0112] In the present invention, "additive" may be a nutritional feed additive, a general feed additive, or a medicinal feed additive. The nutritional feed additive refers to a small or trace amount of a substance added to feed to balance feed nutrients, increase feed utilization, and directly exert a nutritional effect on animals. The additive may be an amino acid, amino acid salt and analog thereof, a vitamin and vitamin analog, a co-mineral component and a combination thereof (chelate), a microbial enzyme preparation, or a non-protein nitrogen.

[0113] General feed additives refer to non-nutritional substances added to feed to improve feed utilization, ensure feed mass and quality, and are beneficial to the health or metabolism of animals, and may include growth promoters, deworming health agents, seasonings and feeding stimulants, feed modifiers, feed mixers, feed preservatives, and herbal medicine additives, and the growth promoters may be butyric acid, calcium butyrate, sodium butyrate, tannic acid, p-thymol, p-thymol ester, p-thymol salt, 2-hydroxybenzoic acid, β-acid, β-acid ester, β-acid salt, hexahydro β-acid, hexahydro β-acid ester, hexahydro β-acid salt, benzoic acid, or calcium benzoate, zinc oxide, zinc sulfate, or zinc chloride.

[0114] In the present invention, the feed composition may include a feed additive or a medicinal feed additive. The medicinal feed additive has the function of preventing animal diseases and promoting animal growth, and may include a veterinary pharmaceutical premix material that can be mixed with a carrier or diluent and added to feed for long-term use. For example, the medicinal feed additive may be a feed antibiotic, and the feed antibiotic may be polymyxin, salinomycin, avilamycin, bacitracin, virginiamycin, nociheptide, flavomycin, enlamycin, leucomycin, olaquindox, oxytetracycline, or chlortetracycline.

[0115] In the present invention, “antioxidant” means a substance that can react with free radicals and neutralize them, and may be, but is not limited to, carotenoids (including beta-carotene, lycopene, and lutein), selenium, coenzyme Q10 (ubiquinone), tocotrienol, soy isoflavone, S-adenosylmethionine, glutathione, taurine, N-acetylcysteine, vitamin E, vitamin C, lipoic acid, L-carnitine, or arginine.

[0116] The feed may be a raw material containing water, or a dry material from which water has been removed. If the feed is a dry material, it may be in the form of pellets, which are particulate lumps or pieces, or may be in the form of powder. The pellets may have a spherical, cylindrical, or oval shape. In the present invention, the raw material or dry material may be provided according to a formulation commonly used in the art. For example, a powder may be provided as a solution formulation by dissolving it in a supplied solvent (e.g., water), but is not limited thereto.

[0117] In addition, in the present invention, the feed composition may be fed mixed with a conventionally known feed composition for preventing or improving obesity or a newly developed feed composition for preventing or improving obesity. When the feed composition of the present invention further includes a feed composition for preventing or improving obesity, it is important to mix in an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by those skilled in the art. When the feed composition is ingested in parallel with a known composition having an effect for preventing or improving obesity or another feed composition for preventing or improving obesity, these may be ingested simultaneously, separately, or sequentially, and may be ingested singly or in multiple doses. Taking all of the above factors into consideration, it is important to ingest in an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by those skilled in the art.

[0118] Hereinafter, preferred examples are presented to aid in understanding the present invention. However, the following examples are provided solely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the following examples.

[0119]

[0120] [Example]

[0121]

[0122] Example 1. Extraction and size measurement analysis of extracellular vesicles derived from Bifidobacterium spp. strains

[0123] Example 1-1. Extraction of extracellular vesicles from Bifidobacterium strains

[0124] To extract extracellular vesicles (EV) from Bifidobacterium strains, strains were cultured in an anaerobic chamber at 37°C for 18–72 h using reinforced clostridial medium (RCM) medium (MB cell, MB-R1602). The culture medium was centrifuged at 2000×g for 20 min, and the supernatant was collected and filtered through a 0.22 μm filter to remove cell debris and waste in the culture medium. EVs were extracted from each culture medium using a 300 kDa molecular weight TFF (Tangential Flow Filtration) membrane filter-based TFF system, diluted and purified in phosphate-buffered saline (PBS), and finally, extracellular vesicles derived from Bifidobacterium strains dispersed in PBS were extracted. Extracellular vesicles derived from Bifidobacterium strains Bifidobacterium longum, Bifidobacterium adolescentis, Bifidobacterium bifidum, Bifidobacterium breve, and Bifidobacterium lactis were extracted, and named BL-EV, BA-EV, BB-EV, BBR-EV, and BLA-EV, respectively.

[0125]

[0126] Example 1-2. Size measurement analysis of extracellular vesicles derived from Bifidobacterium strains

[0127] The sizes of BL-EV, BA-EV, BB-EV, BBR-EV, and BLA-EV extracted in Example 1-1 were measured using a nanoparticle tracking analyzer (Zetaview, Particle Metrix GmbH) and confirmed as shown in Fig. 1.

[0128]

[0129] Example 2. Production of an obese animal model and establishment of experimental conditions for the anti-obesity activity of BL-EV.

[0130] In order to confirm the anti-obesity activity of the BL-EV of the present invention, an obese animal model was created, and a diet-induced obesity (DIO) animal model was used as the obese animal model. Specifically, a high-fat diet (60% fat) was fed to mice for 4 months to induce an obese animal model, and the BL-EV of the present invention was fed together with the high-fat diet to the obese animal model (Fig. 2). At this time, obese mice with an average body weight of 40 g were selected and BL-EV was administered to each mouse at a dose of 1x10 12 The particles were administered orally daily with a high-fat diet for 4 weeks, and the control group was administered orally with PBS.

[0131]

[0132] Example 3. Confirmation of the anti-obesity effect of extracellular vesicles derived from Bifidobacterium longum in an obese animal model.

[0133] Example 3-1. Weight loss effect

[0134] In order to confirm the effect of BL-EV on weight loss, when BL-EV was orally administered to the obese animal model prepared in Example 2, the final volume change of the mouse body shape and body weight were measured daily for 4 weeks and compared.

[0135]

[0136] As a result, it was visually observed that the body volume of the obese group (Vehicle) increased compared to the normal group (Normal), while the group administered BL-EV (hereinafter, BL-EV group) showed a body volume similar to that of the normal group (Fig. 3a).

[0137]

[0138] In addition, as a result of measuring body weight daily, the actual body weight (g) and body weight change rate (%) increased in the normal group, while the actual body weight (g) and body weight change rate (%) remained similar in the obese group. On the other hand, the BL-EV group showed a tendency for the actual body weight (g) and body weight change rate (%) to significantly decrease. Specifically, compared to the normal group, the obese group showed a 25% body weight increase, but compared to the obese group, the BL-EV group showed a 30% body weight decrease (Fig. 3b).

[0139]

[0140] In addition, when the food intake was checked at one-week intervals for the obese group and the BL-EV group, it was confirmed that the food intake of the obese group and the BL-EV group was at the same level as there was no statistically significant difference (Fig. 3c).

[0141]

[0142] Example 3-2. Lipid and protein reduction effect

[0143] To investigate the effects of BL-EV on lipids and proteins, BL-EV was orally administered to obese animal models for 4 weeks. Triglycerides in the liver tissue and triglycerides, low-density lipoprotein (LDL), high-density lipoprotein (HDL), and total cholesterol in the blood were measured. Triglycerides in the liver tissue were quantified using the Triglyceride Assay Kit (Fluorometric, Reducing Samples; ab65336) according to the manufacturer's procedure.

[0144]

[0145] As a result (Fig. 3d), the concentration of neutral fat per weight of liver tissue (mg / g) increased in the obese group (Vehicle) fed a high-fat diet compared to the normal group (Normal) that was not fed a high-fat diet.

[0146] In contrast, mice administered BL-EV showed a decrease in elevated triglyceride levels. Furthermore, the concentration of triglycerides in the entire liver of each individual was also found to decrease.

[0147]

[0148] Blood biochemical analysis was performed by TNP Bio Co., Ltd. To analyze changes in total cholesterol concentration in blood, triglyceride, low-density lipoprotein (LDL), and high-density lipoprotein (HDL) concentrations were measured. Total cholesterol was calculated as LDL + HDL + 20% TG.

[0149]

[0150] As a result (Fig. 3e), it was confirmed that total cholesterol increased in the obese group (Vehicle) fed a high-fat diet compared to the normal group (Normal) that was not fed a high-fat diet, whereas in the BL-EV group, it was confirmed that the increased concentration of total cholesterol decreased.

[0151]

[0152] Example 3-3. Effect of reducing white fat weight

[0153] To confirm the effect of BL-EV on white fat weight, BL-EV was orally administered to the obese animal model prepared in Example 2 for 4 weeks, and then the total amount of white fat (Subcutaneous + Visceral) in the mouse body was measured.

[0154]

[0155] As a result (Fig. 3f), it was confirmed that the weight of white fat increased in the obese group (Vehicle) fed a high-fat diet compared to the normal group (Normal) that was not fed a high-fat diet, whereas the weight of the increased white fat decreased in the BL-EV group.

[0156]

[0157] Example 3-4. Effects on fat accumulation and fat cell size reduction in the liver, white fat, and brown fat.

[0158] To determine the effects of BL-EV on fat accumulation in the liver, white adipose tissue, and brown adipose tissue, BL-EV was orally administered for 4 weeks to the obese animal model constructed in Example 2. The collected tissues were fixed in a 10% formalin solution, and then paraffin blocks were made and slides were prepared for hematoxylin-eosin staining. This process was performed by TNP Bio.

[0159]

[0160] As a result (Fig. 3g), compared to the normal group (Normal), the obese group (Vehicle) fed a high-fat diet showed increased fat accumulation in the liver and brown adipose tissue, and increased adipocyte size in white adipose tissue. However, in the BL-EV group, it was confirmed that this fat accumulation and increase in white adipose cell size were reduced.

[0161]

[0162] Example 4. Confirmation of the anti-obesity effect of extracellular vesicles derived from Bifidobacterium spp. other than Bifidobacterium longum.

[0163] In Example 3, it was confirmed that extracellular vesicles derived from Bifidobacterium longum, a strain of the genus Bifidobacterium, exhibit anti-obesity effects through various activities. In this Example 4, the anti-obesity activity of extracellular vesicles derived from Bifidobacterium strains other than Bifidobacterium longum was confirmed.

[0164] First, in addition to Bifidobacterium longum-derived extracellular vesicles (BL-EV), Bifidobacterium adolescentis-derived EVs (hereinafter, BA-EV), Bifidobacterium bifidum-derived EVs (hereinafter, BB-EV), Bifidobacterium breve-derived EVs (hereinafter, BBR-EV), and Bifidobacterium lactis-derived EVs (hereinafter, BLA-EV) were prepared using the same method as in Example 1.

[0165] To confirm the anti-obesity efficacy of each extracted extracellular vesicle, we performed an analysis experiment on the expression levels of genes related to lipogenesis using 3T3-L1 adipocytes induced to accumulate excessive fat. Specifically, cells were cultured in DMEM medium containing 10% bovine calf serum and 1% penicillin-streptomycin, and seeded into 6-well plates when the flasks were approximately 70% confluent. After culturing for an additional 2 days when the cells reached 100% confluence, the medium was replaced with differentiation medium (DMEM-based, containing 10% fetal bovine serum, 1% penicillin-streptomycin, 500 μM isobutyl-1-methylxanthine, 1 μM dexamethasone, 10 μg / ml insulin, and 0.5 μM rosiglitazone) (differentiation day 0). Afterwards, the culture was continued by replacing the DMEM medium containing 10 μg / ml insulin and 0.5 μM rosiglitazone every 2 days until the 4th day of differentiation. On the 4th day of differentiation, BA-EV, BB-EV, BBR-EV, and BLA-EV were seeded per well at a final concentration of 1 × 10 850 μl of each particle / 1.5 ml concentration was applied, and the control group (Vehicle) was treated with the same volume of PBS. After 2 hours of treatment, 500 μM oleic acid was added to induce fat accumulation for 72 hours. Afterwards, RNA was extracted, cDNA was synthesized, and real-time PCR was performed to analyze the expression of genes related to fat synthesis.

[0166]

[0167] NO.NAME.SEQUENCE1Fasn-FGCTGCGGAAACTTCAGGAAAT2Fasn-RAGAGACGTGTCACTCCTGGACTT3Acc1-FTGACAGACTGATCGCAGAGAAAG4Acc1-RTGGAGAGCCC CACACACA5Scd1-FCCCCTGCGGATTCTTCCTTAT6Scd1-RAGGGTCGGCGTGTGTTTCT7Pparg-FGTACTGTCGGTTTCAGAAGTGCC8Pparg-RATCTCCGCCAACAGCTTCTCCT

[0168]

[0169] As a result (Figs. 4a to 4d), it was confirmed that the expression of representative fat synthesis-related genes, Fasn, Acc1, Scd1, and Pparg, was significantly reduced in the Bifidobacterium-derived extracellular vesicle-treated group compared to the control group (Vehicle). In particular, the BA-EV-treated group showed a tendency for the expression of all fat synthesis-related genes to decrease to a statistically significant level.

[0170]

[0171] In conclusion, as an extracellular vesicle derived from the genus Bifidobacterium, BL-EV exhibited various anti-obesity activities in an obese animal model, and BA-EV, BB-EV, BBR-EV, and BLA-EV were proven to have excellent anti-obesity effects by reducing the expression of genes related to fat synthesis.

[0172]

[0173] The foregoing description of the present invention is provided for illustrative purposes only. Those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

[0174] The present invention relates to a pharmaceutical composition for preventing or treating obesity, and a food composition for preventing or improving obesity, comprising an extracellular vesicle derived from a Bifidobacterium spp. strain as an active ingredient. The composition of the present invention has the effect of reducing body weight in an obese animal model, reducing the amount of triglycerides in the liver and total cholesterol in the blood and the weight of white fat that are increased in an obese animal model, and reducing fat accumulation in the liver and brown adipose tissue and the size of white fat cells without causing a decrease in appetite. In addition, the extracellular vesicle of the present invention has the effect of inhibiting fat synthesis in adipocytes that have induced fat accumulation. As such, the extracellular vesicle derived from a Bifidobacterium spp. strain of the present invention exhibits an excellent anti-obesity effect, and thus its industrial applicability is recognized.

Claims

1. A pharmaceutical composition for preventing or treating obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

2. In paragraph 1, A pharmaceutical composition, wherein the Bifidobacterium genus strain is at least one selected from the group consisting of Bifidobacterium longum, Bifidobacterium adolescentis, Bifidobacterium bifidum, Bifidobacterium breve, and Bifidobacterium lactis.

3. In paragraph 1, A pharmaceutical composition wherein the extracellular vesicles have a size of 10 nm to 400 nm.

4. In paragraph 1, A pharmaceutical composition wherein the extracellular vesicles are naturally secreted or artificially produced from a strain of the genus Bifidobacterium.

5. In paragraph 1, A pharmaceutical composition characterized in that the composition comprises at least one selected from the group consisting of: a) Weight loss; b) Maintain food intake; c) Reduction of triglycerides, low-density lipoprotein, high-density lipoprotein, and total cholesterol; d) Fat accumulation and reduction in cell size in the liver, white fat, and brown fat; and e) Decreased expression of fat synthesis genes.

6. A kit for preventing or treating obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain and an instruction manual.

7. A food composition for preventing or improving obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

8. In paragraph 7, A food composition wherein the above food is a health functional food.

9. A feed composition for preventing or improving obesity, comprising extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

10. A method for improving or treating obesity, comprising administering to a subject in need thereof a pharmaceutically effective amount of a composition containing extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

11. Use of a composition containing extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient for preventing, improving, or treating obesity.

12. Use for manufacturing a preparation for preventing, improving, or treating obesity, comprising a composition containing extracellular vesicles derived from a Bifidobacterium spp. strain as an active ingredient.

Citation Information

Patent Citations

  • Use of bifidobacterium animalis subsp. lactis CBT bl3 in the prevention or treatment of obesity and obesity-related metabolic syndrome and composition comprising the same

    KR101611832B1

  • Extracellular Solute Binding Protein (ESBP) derived from Bifidobacterium longum KACC 91563 and Anti-allergy Composition using the Same

    KR101778734B1

  • Bifidobacterium CECT 7765 and use thereof in the prevention and / or treatment of excess weight, obesity and related pathologies

    KR1020140147656A

  • Semiconductor device

    KR102074104B1

  • P2P routing method and central apparatus in multihop wireless network

    KR102425504B1