Oligonucleotides for the treatment of huntington's disease

Double-stranded oligonucleotide decoys targeting key transcription factors in Huntington's disease inhibit their activity, addressing the need for effective therapeutic agents to halt neuronal degradation and cell death, offering a promising treatment for the disease.

WO2025199242A1PCT designated stage Publication Date: 2025-09-25CORE BIOTHERAPEUTICS INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/020575
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-19
Filing Date
2025-03-19
Publication Date
2025-09-25

AI Technical Summary

Technical Problem

Current treatments for Huntington's disease are inadequate, and there is a need for therapeutic agents that can effectively inhibit multiple key transcription factors involved in the progression of the disease, such as HOX, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, and ZIC, to prevent neuronal degradation and cell death.

Method used

Development of double-stranded oligonucleotide decoys that bind to the endogenous transcription factor binding sites of these key factors, including HOXA1, HOXA2, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXA10, HOXA11, HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXC11, HOXC12, HOXC13, HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXD10, HOXD11, HOXD12, HOXD13, BCL, CXXC, GTFIRD, LHX, NEUROD, NKX, PBX, SOX, THAP, and ZIC, to modulate their activity and prevent cellular breakdown and death.

Benefits of technology

The oligonucleotide decoys effectively inhibit the target transcription factors, potentially halting cellular breakdown, preventing cell death, and restoring normal cellular function, providing a therapeutic approach for Huntington's disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025020575_25092025_PF_FP_ABST
    Figure US2025020575_25092025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are therapeutic agents such as double-stranded nucleic acids, termed oligonucleotide decoys, pharmaceutical compositions comprising the same, and related methods of modulating neurodegenerative signaling, for instance, to treat Huntington's disease.
Need to check novelty before this filing date? Find Prior Art

Description

OLIGONUCLEOTIDES FOR THE TREATMENT OF HUNTINGTON’S DISEASECROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. Provisional Application No. 63 / 567,114, filed March 19, 2024, the disclosure of which is incorporated by reference in its entirety for all purposes.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (NEBI_004_01WO_SeqList_ST26.xml; Size: 75,529 bytes; and Date of Creation: March 18, 2025) are herein incorporated by reference in its entirety.BACKGROUND OF THE INVENTION

[0003] Field of the Invention

[0004] The present invention relates to therapeutic agents such as double-stranded nucleic acids, termed oligonucleotide decoys, pharmaceutical compositions comprising the same, and related methods of treating Huntington’s disease.

[0005] Huntington's disease (HD) is an inherited disorder that causes nerve cells, called neurons, in parts of the brain to gradually break down and die. The disease attacks areas of the brain that help to control voluntary movement, as well as other areas. People living with HD develop uncontrollable dance-like movements (i.e., chorea) and abnormal body postures, as well as problems with behavior, emotion, thinking, and personality.

[0006] Symptoms of HD typically appear in middle-aged people. They can also appear in children, but this is rare. The disease gets worse over time and progresses over 15-25 years. The disease status is classified following 5 grades designated in ascending order of seventy (i.e., 0, 1, 2, 3 or 4).

[0007] HD is triggered by a mutation in the gene for a protein called huntingtin (HTT). The defect causes the building blocks of DNA called cytosine, adenine, and guanine (CAG) to repeat manymore times than they normally do. There is no treatment that can stop or reverse HD, but some of the symptoms can be treated.

[0008] Transcription factors are important biological mechanisms at the center of HD and its progression. HTT directly dysregulate transcription factor activity. Human HOX transcription factors include 39 members across four groups, A, B, C and D: H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, HOX A 7. H0XA9, HOXAIO, HOXA11, H0XA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXCT1, HOXC12, HOXC13, HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXDIO, HOXD11, HOXD12, HOXD13. HOX are master regulators of neuronal fate, including directly driving survival vs cell death decision, and regulating genes encoding proteins required for proper neuronal structure and function, which dysregulation can also lead to neuron death. HOX are required for a normal neuronal development during embryogenesis and known to drive diseases in adults.

[0009] Additional transcription factors may also be involved in Huntington’s disease including factors from the following families: BCL (e.g., BCL11 A, BCL1 IB, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOX10, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) andZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4.

[0010] The following transcription factors, HOX ( HOX A 1 , HOXA2, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXAIO, HOXA11, HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCI O, HOXCl l, HOXC12, HOXC13, HOXD1, HOXD3, HOXD4,H0XD8, H0XD9, HOXDIO, HOXD11, HOXD12, HOXD13), BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP 10, THAP11, THAP 12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) may also be involved in other neurodegenerative diseases, including but not limited to Alzheimer disease, Parkinson’s disease, Lewy Body Dementia or multiple sclerosis.

[0011] There may be significant therapeutic potential in simultaneously inhibiting multiple HOX transcription factors in order to treat HD or other neurodegenerative diseases, including but not limited to CAG-repeat diseases (e.g., Ataxia), Alzheimer disease, Parkinson’s disease, Lewy Body Dementia or multiple sclerosis. Specifically, what is needed to treat HD are readily available therapeutic agents capable of inhibiting simultaneously key HOX transcription factors or of inhibiting simultaneously key HOX transcription factors and / or one or more members from one or more of the following TF families: BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, and ZIC.BRIEF SUMMARY OF THE INVENTION

[0012] Embodiments of the present invention relate generally to therapeutic agents, such as oligonucleotides, which inhibit the binding of at least one of the HOX, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, and ZIC transcription factors and closely related factors to their endogenous transcription factor binding site(s); pharmaceutical compositions comprising such agents; and related methods of modulating signaling, for example, to block cellular break down, block cellular death, by apoptosis, necrosis, autophagy or other form of cell death, block tissue inflammation or immune response, restore normal cellular function and communication ina subject in need thereof. In some embodiments, the therapeutic agents are double-stranded oligonucleotides (e.g., oligonucleotide decoys), which comprise one or more transcription factor binding sites that bind to at least one of the following transcription factor: H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, H0XB13, H0XC4, H0XC5, H0XC6, H0XC8, H0XC9, HOXCI O, H0XC11, H0XC12, H0XC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXDIO, H0XD11, H0XD12, H0XD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUR0D2, NEUR0D4, NEUR0D6), NEUROG(e.g., NEUR0G1 , NEUR0G2, NEUR0G3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP 10, THAP11, THAP 12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4). In some embodiments, the present disclosure provides double-stranded oligonucleotides (e.g., oligonucleotide decoys) comprising one or more transcription factor binding sites that bind to at least one of the following transcription factor: HOX, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, or ZIC and closely related factors to its endogenous transcription factor binding site(s)

[0013] Embodiments of the present invention therefore include oligonucleotide decoys comprising one or more transcription factor binding sites, wherein the one or more transcription factor binding sites bind to a transcription factor selected from the group consisting of: HOXA1, HOXA2, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXAIO, HOXAl l, HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11 , HOXC12, HOXC13, HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXDIO, HOXD11, HOXD12,H0XD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e g., NEUROG1, NEUROG2, NEUROG3), NKX (e g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, TH API 2) and ZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4). In some embodiments, the present disclosure provides oligonucleotide decoys comprising one or more transcription factor binding sites, wherein the one or more transcription factor binding sites bind to a transcription factor: the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, or ZIC transcription factors, or closely related factors to its endogenous transcription factor binding site(s).In particular embodiments, the oligonucleotide decoys comprise a single transcription factor binding site that binds to one or more of the transcription factors selected from the group consisting of HOXA1, HOXA2, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXAIO, HOXA11, HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXDIO, HOXD11, HOXD12, HOXD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e g., NEUROG I , NEUROG2, NEUROG3), NKX (e g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP I , THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP 10,THAP11, THAP12) and ZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4). In some embodiments, the oligonucleotide decoys comprise a single transcription factor binding site that binds to one or more of the transcription factors selected from: the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, or ZIC transcription factors, or closely related factors to its endogenous transcription factor binding site(s).

[0014] In particular embodiments, the oligonucleotide decoys comprise a combination of at least two or at least three transcription factor binding sites, wherein each transcription factor binding site binds to a transcription factor selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, HOXA6, H0XA7, H0XA9, HOXAIO, HOXA11, H0XA13, HOXBl , HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, IIOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, H0XD1, H0XD3, H0XD4, HOXD8, H0XD9, HOXDIO, H0XD11, HOXD12, HOXD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG(e.g., NEUROG1 , NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4). In some embodiments, the oligonucleotide decoys comprise a combination of at least two or at least three transcription factor binding sites, wherein each transcription factor binding site binds to a transcription factor selected from: the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, or ZIC transcription factors, or closely related factors to its endogenous transcription factor binding site(s).

[0015] In particular embodiments, the oligonucleotide decoys comprise a combination of from one to 39 or more transcription factor binding sites, wherein each transcription factor binding sitebinds to a transcription factor selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, H0XB1, TIOXB2, H0XB3, H0XB4, H0XB5, HOXB6, H0XB7, H0XB8, H0XB9, H0XB13, HOXC4, H0XC5, HOXC6, H0XC8, H0XC9, HOXCIO, H0XC11, HOXCI2, HOXC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXDIO, HOXD1 L H0XD12, H0XD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG(e.g., NEUROG1 , NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4). In some embodiments, the oligonucleotide decoys comprise a combination of from one to 39 or more transcription factor binding sites, wherein each transcription factor binding site binds to a transcription factor selected from: the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, or ZIC transcription factors, or closely related factors.

[0016] In some embodiments, the oligonucleotide decoy is about 10 to about 200 base pairs in length.

[0017] In particular embodiments, the oligonucleotide decoy comprises transcription factor binding sites for different transcription factors that overlap. In particular embodiments, the oligonucleotide decoy comprises transcription factor binding sites that are in opposite direction.

[0018] In certain embodiments, the oligonucleotide decoy has a first transcription factor binding site, and up to two other transcription factor binding sites. In specific embodiments, the binding sites bind H0XA11, H0XA13, H0XA2, H0XA3, H0XA7, H0XA9, HOXB2, HOXB3, HOXB7, HOXC11, HOXC12, HOXC13, HOXC4, H0XD1, HOXDIO, HOXD11, HOXD13, HOXD3, HOXD8, HOXD9, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g.,CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e g., NEUROG1, NEUROG2, NEUROG3), NKX (e g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) andZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4. In specific embodiments, the binding sites bind to transcription factors selected from the group consisting of the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors, and closely related factors.

[0019] In certain embodiments, the oligonucleotide decoy has a first transcription factor binding site, and up to 1, 2, 3, 4 or 5 other transcription factor binding sites.

[0020] In certain embodiments, the oligonucleotide decoy has a first transcription factor binding site, and up to 1, 2, 3, 4, 5, 6 or 7 other transcription factor binding sites.

[0021] In certain embodiments, the oligonucleotide decoy has a first transcription factor binding site, and up to 1, 2, 3, 4, 5, 6, 7, 8, 9,10, 11, 12, 13, 14, 15, 16, 17 or 18 other transcription factor binding sites.

[0022] In certain embodiments, the oligonucleotide decoy has a first transcription factor binding site, more than 20 other transcription factor binding sites In specific embodiments, binding site binds to any of combination of transcription factors from the following list: HOXA1, HOXA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, HOXA9, HOXA10, H0XA11, H0XA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXCU, HOXC12, HOXC13, HOXD1, H0XD3, HOXD4, HOXD8, H0XD9, HOXD10, HOXD11, HOXD12, HOXD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e g., NEUROG1 , NEUROG2,NEUR0G3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP 10, THAP11, THAP 12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4), and closely related factors.

[0023] Certain embodiments relate to one or more population(s) of the oligonucleotide decoys described herein, wherein the population of oligonucleotide decoys provide transcription factor binding sites to address combinations of multiple transcription factors that present the potential to treat Huntington disease (e.g., stop cellular break down, stop cell death by apoptosis, necrosis, autophagy or other form of cell death).

[0024] In some embodiments, the therapeutic agent provides unique binding sites compositions and position that allow for binding more than one and up to 40 or more transcription factors at a time.

[0025] In some embodiments, the oligonucleotide decoy comprises a sequence represented inTable 1.TABLE 1.All sequences in the Table 1 are listed as the sense strand of the duplex decoys, oriented in the 5’ to 3’ direction. Although the formulas and sequences show a single strand, it should be understood that a complementary antisense strand is included as part of the structure of the oligonucleotide decoys. Letters legend: A = Adenine, C = Cytosine, G = Guanine, T = Thymine, R = Guanine / Adenine (purine), Y= Cytosine / Thymine (pyrimidine), K = Guanine / Thymine, M = Adenine / Cytosine, S = Guanine / Cytosine, W = Adenine / Thymine, B = Guanine / Thymine / Cytosine, D = Guanine / Adenine / Thymine, H = Adenine / Cytosine / Thymine, V = Guanine / Cytosine / Adenine, N = Guanine / Adenine / Thymine / Cytosine

[0026] Also included are pharmaceutical compositions comprising an oligonucleotide decoy or population of decoys described herein, and a pharmaceutically acceptable carrier. In certain embodiments, the oligonucleotide decoys are provided as salts, hydrates, solvates, or N-oxides derivatives.

[0027] Some embodiments include one or more kits comprising an oligonucleotide decoy or population of decoys described herein, optionally an instruction for using the oligonucleotide decoy(s).

[0028] Also included are methods for modulating the transcription of a gene present in a cell involved in neurodegenerative signaling comprising administering to the cell an effective amount of an oligonucleotide decoy or pharmaceutical composition described herein.

[0029] Also included are methods for modulating neuronal and / or glial and / or other brain cell or immune cell signaling in a cell comprising administering to the cell an effective amount of an oligonucleotide decoy or pharmaceutical composition described herein.

[0030] Certain embodiments include methods for preventing and for treating Huntington’s disease in a subject comprising administering to the subject a therapeutically effective amount of an oligonucleotide decoy or pharmaceutical composition described herein. In some embodiments, the subject is premanifest (i.e., asymptomatic) or manifest (i.e., symptomatic) at any grade (e.g., grade 0, 1, 2, 3 or 4).

[0031] Also included are methods for modulating cellular signaling in a cell comprising administering to the cell a therapeutically effective amount of a therapeutic agent, wherein the therapeutic agent inhibits binding of one or more transcription factors to corresponding endogenous transcription factor binding sites, wherein the transcription factor(s) is(are) selected from the group consisting of HOXA1, H0XA2, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXA10, H0XA11, H0XA13, HOXBl, HOXB2, HOXBl. HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXBl 3, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXC11, HOXC12, HOXC13, HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXD10, HOXD11, HOXD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOX10, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, TH API ! , THAP12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors.BRIEF DESCRIPTION OF THE DRAWINGSFIG. 1 shows the transcription factor network of a medium spiny neuron from normal subjects (left) and from grade 4 HD patients (right). Medium spiny neurons are the most vulnerable neurons that die during the course of HD. A transcription factor network is made of all the regulationsmade between Transcription factors. Each transcription factor-to-transcription factor regulation is illustrated as an edge, or line, in two-dimension networks as shown on the figure. Transcription factor networks have a structure and a hierarchy to control the expression of all genes in a cell and determine cell fate; when corrupted, as illustrated by the network from the HD patients, they cause aberrant gene expression, symptoms and disease progression.FIG. 2. Shows the functional analysis of transcription factor networks in HD at the transcription factor family level and at the individual transcription factor level. FIG. 2A. shows the functional analysis at the transcription factor family level of the networks of medium spiny neurons DI (vulnerable neurons in HD expressing the dopamine receptor DI) from the striatum inferred from post-mortem data of normal subjects and HD patients at grade 2, 3 and 4. Analysis of the largest family of transcription factors encoded in the human genome at each disease grade compared to normal shows that only the HOX family of transcription factors gains robust and clear functional dominance throughout the disease at all grades that were analyzed. Other transcription factor families in the analysis include: ATF, BCL, CEBP, CREB, CXXC, FOX, GATA, GLI, GTF2IRD, IKZF, KLF, LHX, NANOG, NEUROD / G, NKX, PBX, POU, SMAD, SOX, TCF, THAP, ZBTB and ZIC and represent more than 250 individual transcription factors. FIG. 2B. shows the functional analysis at the individual transcription factor level of the networks of the same medium spiny neurons analyzed in FIG. 2A. At the level of individual factors, family members of the BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC families can also gam functional importance depending on the type of cells affected by HD, brain location and / or disease grade and may be of therapeutic value as well the HOX factors. This is illustrated with the functional analysis of NKX2-2 and ZIC1 at different disease grade in networks inferred from medium spiny neurons DI from the striatum where the functional importance of those transcription factors increases or not as a function on the disease grade.FIG. 3A. shows HOX Transcription factors regulation of targets genes in medium spiny neurons. Based on this analysis, HOX Transcription factors exercise their network authority in HD by upregulating a high number Transcription factors to control networks and by inhibiting thousandsof genes required for neuron structural and functional integrity, which supports a significant neurodegenerative activity. FIG. 3B. shows the categories of the genes that are downregulated in medium spiny neurons of grade3 HD patients. Those genes are essential for the structural integrity of neurons membrane, cell body, axons, dendrites, synapses and for their proper function, including excitability, electrical conduction, regulation of cell body size, calcium signaling or communication.FIG. 4 shows the high binding affinity of Seq ID: 4 and 5 for HOX transcription factors using H0XC4 as a reference for HOX binding in an ELISA assay. There are 39 human HOX Transcription factors and at each HD grade, between 10 to 20 at least are involved in the disease as per transcription factor network analyses. Sequences are designed to bind to all of those involved in HD. HOXC4 is involved at each HD grade we analyzed and binds the same sequence as HOXA1 / 2 / 3 / 5 / 6 / 7 / B1 / 2 / 3 / 4 / 5 / 6 / 7 / 8 / C5 / 6 / 8 / D1 / 3 / 4 / 8. FIG. 4A. shows the linearity of the ELISA assay demonstrated by a linear correlation coefficient > 0.8 between the amount of nuclear protein used in the assay and absorbance measured as OD450 nm. The biotinylated probe in the assay is SEQ ID: 4 coupled to a biotin on the 5’ end of its sense strand. FIG. 4B. shows the specificity of the H0X4 ELISA assay by showing the reduction of binding to the SEQ ID: 4 biotinylated probe following the addition of free, non- biotinylated SEQ ID: 4 (competitor 1) or SEQ ID: 5 (competitor 2) at a 16 fold excess of concentration over the probe concentration.FIG. 5A shows the affinity of SEQ ID: 4 including 2’ -methoxy ethoxy (bold letters) modifications to protect against nucleases metabolism. Modifications are as follow (mirror modifications are present on the antisense strands): SEQ ID: 93.TTTTACGAGTAATTAGTAATTATAATTAATGACCAATAAAA, SEQ ID: 94.TTTTACGAGTAATTAGTAATTATAATTAATGACCAATAAAA, SEQ ID: 95.TTTTACGAGTAATTAGTAATTATAATTAATGACCAATAAAA. A decrease of affinity for HOXC4 is detected as a reduction in competition potency compared to the unmodified SEQ IDA. SEQ ID: 93 maintains the same affinity for HOXC4 compared to the unmodified sequence. FIG. 5B shows the stability of SEQ ID: 93-95 in human cells (cytosol extracts) measured by gelelectrophoresis. No degradation is observed over 72h, supporting an intracellular half-life several weeks- to several months-long. FIG. 5C shows the stability of SEQ ID: 93-95 in human serum also measured by gel electrophoresis. Data shows a half-life in the serum of 15, 16.8 and 21.6 hours respectively for SEQ ID: 93, 94, and 95. Those features of long half-life in human cells and shorter half-life in the serum are favorable for treating HD.DETAILD DESCRIPTION

[0032] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below.Definitions

[0033] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0034] By “about” is meant a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by as much as 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.

[0035] “Binding,” as used in the context of transcription factors binding to therapeutic agents such as oligonucleotide decoys, refers to a direct interaction (e.g., non-covalent bonding between the transcription factor and the oligonucleotide decoy, including hydrogen-bonding, van der Waals bonding, etc.) between a transcription factor and an oligonucleotide decoy. Accordingly, a therapeutic agent such as an oligonucleotide that does not bind to a transcription factor does not directly interact with said transcription factor, and vice versa.

[0036] Throughout this specification, unless the context requires otherwise, the words “comprise,” “comprises,” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

[0037] By “consisting of’ is meant including, and limited to, whatever follows the phrase “consisting of:” Thus, the phrase “consisting of’ indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of’ is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of’ indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending upon whether or not they materially affect the activity or action of the listed elements.

[0038] “Homology” refers to the percentage number of nucleotides that are identical or constitute conservative substitutions. Homology may be determined using sequence comparison programs such as EMBOSS Pairwise Alignment Algorithm (available from the European Bioinformatics Institute (EBI)), the ClustalW program (also available from the European Bioinformatics Institute (EBI)), or the BLAST program (BLAST Manual, Altschul et al., Natl Cent. Biotechnol. Inf, Natl Lib. Med. (NCIB NLM NIH), Bethesda, Md., and Altschul et al., (1997) NAR 25:3389 3402), or GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395). In this way sequences of a similar or substantially different length to those cited herein could be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.

[0039] By “isolated” is meant material that is substantially or essentially free from components that normally accompany it in its native state. For example, an “isolated polynucleotide” or “isolated oligonucleotide,” as used herein, may refer to a polynucleotide that has been purified or removed from the sequences that flank it in a naturally-occurring state, e.g., a DNA fragment that is removed from the sequences that are adjacent to the fragment in the genome. The term“isolating” as it relates to cells refers to the purification of cells (e.g., fibroblasts, lymphoblasts) from a source subject (e.g., a subject with a polynucleotide repeat disease). In the context of mRNA or protein, “isolating” refers to the recovery of mRNA or protein from a source, e.g., cells.

[0040] The term “modulate” includes an “increase” or “decrease” one or more quantifiable parameters, optionally by a defined and / or statistically significant amount. By “increase” or “increasing,” “enhance” or “enhancing,” or “stimulate” or “stimulating,” refers generally to the ability of one or more agents such as oligonucleotide decoys to produce or cause a greater physiological or cellular response in a cell or a subject, such as the activity of a transcription factor (e.g., gene expression), relative to the response caused by either no agent or a control compound. Relevant physiological or cellular responses (in vivo or in vitro) will be apparent to persons skilled in the art. An “increased” or “enhanced” amount or response may be “statistically significant” relative to an amount or response produced by no agent or a control composition, and may include an increase that is 1.1, 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g., 500, 1000 times) (including all integers and ranges between and above 1, e.g., 1.5, 1.6, 1.7. 1.8) the amount or response produced by either no agent or a control compound. The term “reduce” or “inhibit” may relate generally to the ability of one or more agents such as oligonucleotide decoys to “decrease” a relevant pathological or physiological or cellular response in a cell or a subject, such as the activity of a transcription factor (e.g., gene expression), a pathological process (e.g., neurodegenerative signaling), or a symptom of a disease or condition described herein (e.g., AML), relative to the response caused by either no agent or a control compound. Relevant physiological or cellular responses (in vivo or in vitro) will be apparent to persons skilled in the art and can be measured according to routine techniques. A “decrease” in a response may be “statistically significant” as compared to the response produced by no agent or a control composition, and may include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease, including all integers and ranges in between.

[0041] The term “modulation of gene expression level” includes any change in gene expression level, including an induction or activation (e.g., an increase in gene expression), an inhibition or suppression (e.g., a decrease in gene expression), or a stabilization (e.g., prevention of the upregulation or down-regulation of a gene that ordinarily occurs in response to a stimulus, such as a neurodegenerative -inducing stimulus).

[0042] The term “neurodegenerative signaling” refers to any molecular and cellular mechanisms involved in the neurodegenerative process, including but not limited to the onset of neurodegeneration (e.g., alteration of cellular structure), the progression of neurodegeneration (e.g. neuro-inflammation, immune reaction, astrocyte proliferation) and neuronal death.

[0043] The term “neurodegeneration” refers to a generic term for a large group of diseases that can affect the integrity of nervous system. One defining feature of neurodegeneration is the loss of neurons in the brain and / or the spinal cord and / or the dorsal root ganglia and / or of nerves.

[0044] The term “preventing” or “prevention” includes (1) a reduction in the risk of acquiring a disease or disorder (e.g., causing at least one of the clinical symptoms of a disease not to develop in a patient that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease), and / or (2) a reduction in the likely severity of a symptom associated with a disease or disorder (e.g., reducing the likely severity of at least one of the clinical symptoms of a disease in a patient that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease).

[0045] The terms “sequence identity” or, for example, comprising a “sequence 50% identical to,” as used herein, refer to the extent that sequences are identical on a nucleotide-by-nucleotide basis over a window of comparison. Thus, a “percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, or G) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. In some embodiments, optimalalignment of sequences for aligning a comparison window may be conducted by using the EMBOSS Pairwise Alignment Algorithm (available from the European Bioinformatics Institute (EBI)), the ClustalW program (also available from the European Bioinformatics Institute (EBI)), or the BLAST program (BLAST Manual, Altschul et al., Natl Cent. Biotechnol. Inf, Natl Lib. Med. (NCIB NLMNIH), Bethesda, Md., and Altschul etal., (1997) NAR25:33893402). In certain embodiments, the alignment of sequences for aligning a comparison window is conducted against the entire length of the reference sequence (e.g., from the Sequence Listing). In some embodiments, the alignment of sequences for aligning a comparison window is conducted against a portion of the reference sequence, for example, about, at least about, or no more than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 contiguous nucleotides of the reference sequence.

[0046] A “subject” or a “subject in need thereof’ or a “patient” includes a mammalian subject such as a primate or human subject.

[0047] “Treating” or “treatment” of any disease or disorder refers, in some embodiments, to ameliorating the disease or disorder (e.g., arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In some embodiments, “treating” or “treatment” refers to ameliorating at least one physical and / or biological parameter, which may not be discernible by the patient. In certain embodiments, “treating” or “treatment” refers to inhibiting the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter) or both. In some embodiments, “treating” or “treatment” refers to delaying the onset of the disease or disorder. “Treatment” or “prophylaxis” does not necessarily indicate complete eradication, cure, or prevention of the disease or condition, or associated symptoms thereof.

[0048] “Therapeutically effective amount” means the amount of a compound that, when administered to a patient, is sufficient to effect such treatment of a particular disease or condition.The “therapeutically effective amount” will vary depending on the compound, the disease, the severity of the disease, and the age, weight, etc., of the patient to be treated.

[0049] “Transcription factor network” means the network of regulatory interactions between transcription factors.Oligonucleotide Decoys and other Therapeutic Agents

[0050] Embodiments of the present invention relate generally to therapeutic agents that inhibit binding of at least one transcription factor to at least one of its (endogenous) transcription binding site. Particular examples include oligonucleotide decoys that comprise one or more transcription binding sites that bind to at least one transcription factor, and thereby alter the ability of the transcription factor(s) to modulate gene expression. In certain embodiments, the transcription factor is one or more of the following: H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXA 10, HOXA11, HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, TIOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXC11, HOXCT2, HOXC13, H0XD1, HOXD3, H0XD4, HOXD8, HOXD9, HOXD10, H0XD11, HOXD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOX10, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., TH API , THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors. In certain embodiments, the transcription factor is one or more of the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related factors.

[0051] Thus, certain embodiments include an oligonucleotide decoy that comprises one or more (e.g., 1, 2, 3, 4, 5, etc.) transcription factor binding sites, where the one or more transcription factor binding site binds to a transcription factor selected from the group consisting of HOX Al , HOXA2, HOXA3, H0XA4, HOXA5, HOXA6, H0XA7, H0XA9, HOXAIO, HOXA11, HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCI O, HOXC11, HOXC12, HOXC13, HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXDIO, HOXD11, HOXD12, HOXD13 and closely related. In some embodiments, the present disclosure provides an oligonucleotide decoy that comprises one or more (e.g., 1, 2, 3, 4, 5, etc.) transcription factor binding sites, where the one or more transcription factor binding site binds to a transcription factor selected from the 39 HOX Transcription factors and closely related factors.

[0052] Thus, certain embodiments include an oligonucleotide decoy that comprises one or more (e.g., 1, 2, 3, 4, 5, etc.) individual transcription factor binding sites binding HOX transcription factors comprising one or more sequences extracted from formulas SEQ ID: 44 to 92.

[0053] Thus, certain embodiments include an oligonucleotide decoy that comprises one or more (e.g., 1, 2, 3, 4, 5, etc.) transcription factor binding sites binding any HOX factors.

[0054] Also included are oligonucleotide decoys that comprise a combination of at least two (e.g., 2, 3, 4, 5, etc.) transcription factor binding sites, wherein each transcription factor binding site binds to a transcription factor selected from the group consisting of HOXA1, HOXA2, HOXA3, HOXA4, HOXA5, HOX.A6, HOXA7, HOXA9, HOXAIO, HOXAl l, HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXBI3, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXDI O, HOXD11, HOXD12, HOXD13 and closely related factors. In some embodiments, the present disclosure provides oligonucleotide decoys that comprise a combination of at least two (e.g., 2, 3, 4, 5, etc.) transcription factor binding sites, wherein each transcription factor binding site binds to a transcription factor selected from the 39 HOX transcription factors and closely related factors. Particular examples of combinations of 1transcription factor binding sites include those that bind to H0XA11 and / or H0XA13 and / or H0XA2 and / or H0XA3 and / or H0XA7 and / or H0XA9 and / or H0XB2 and / or H0XB3 and / or H0XB7 and / or HOXC 11 and / or HOXC 12 and / or HOXC 13 and / or H0XC4 and / or HOXD 1 and / or HOXDIO and / or HOXD 11 and / or HOXD 13 and / or H0XD3 and / or H0XD8 and / or H0XD9 and / or transcription factors related to those.

[0055] The term “oligonucleotide” includes any double-stranded or substantially double-stranded, nucleic acid-containing polymer generally less than approximately 200 nucleotides (or 100 base pairs) and including, but not limited to, DNA, RNA and RNA-DNA hybrids with potential 5’ and / or 3’ overhangs.

[0056] In some embodiments, the oligonucleotide is about, at least about, or no more than about, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides in length (including all integers and ranges in between), and optionally comprises about, at least about, or no more than about, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 base-paired nucleotides (including all integers and ranges in between). In particular embodiments, the oligonucleotide decoy is about 15 to about 60 base pairs in length.

[0057] In some embodiments, the oligonucleotide decoy comprises a first transcription factor binding site and a second or a third binding site up to 40 or more binding sites, optionally wherein the first transcription binding site and the second transcription binding site overlap and / or are in reverse orientation. In specific embodiments, the first transcription factor binding site binds to a transcription factor selected from the group consisting of HOXA1 , HOXA2, HOXA3, HOXA4, HOXA5, H0XA6, H0XA7, HOXA9, HOXA10, HOXA11, H0XA13, HOXBl, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXBl 3, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXC11, HOXC12, HOXC13, H0XD1, H0XD3, HOXD4, HOXD8, HOXD9, HOXDIO, HOXD11, HOXD12, HOXD13, BCL (e.g., BCL11A,BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUR0D2, NEUR0D4, NEUR0D6), NEUROG (e.g., NEUR0G1, NEUR0G2, NEUR0G3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP 10, THAP11, THAP 12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors. In specific embodiments, the first transcription factor binding site binds to a transcription factor selected from the group consisting of the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related factors.

[0058] In some embodiments, the oligonucleotide decoy has flank sequences on its 5’ and / or 3 sides beyond transcription factor binding sites sequences. Flanks are short sequences, typically but not limited from 1 to 10 nucleotides that are added on the side of the sequences covered under this application. For instance, flanks to seq ID: 1 TTTTATTGCAATTAATTACTAATTACCATAAA (SEQ ID NO:1) could be ATAT and CCGC that could be added as follow to seq ID: 1 AE47TTTTATTGCAATTAATTACTAATTACCATAAACCGC (SEQ ID NO: 96).

[0059] In certain embodiments, the oligonucleotide decoy (e.g., the sense strand of the decoy) comprises, consists, or consists essentially of a sequence (e.g., double-stranded sequence) from Table 1.

[0060] Certain oligonucleotide decoys thus comprise, consist, or consist essentially of a sequence of variant of different size and complementary composition for the same transcription factor targets compared to sequences from Table 1.

[0061] For instance, certain oligonucleotide decoys comprise contiguous or non- contiguous nucleotides of any of the sequences that bind to one or more transcription factors from the group consisting of HOXA1, HOXA2, H0XA3, HOXA4, H0XA5, HOXA6, H0XA7, HOXA9,HOXAIO, HOXA11, HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, 1 IOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXCl l , HOXC12, HOXC13, HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXDIO, HOXD11, HOXD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) andZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors. In some embodiments, the oligonucleotide decoys comprise contiguous or non-contiguous nucleotides of any of the sequences that bind to one or more transcription factors from the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related factors. For non-contiguous portions, intervening nucleotides can be deleted or substituted with a different nucleotide, or intervening nucleotides can be added. Additional examples of variants include oligonucleotide decoys having at least about 70% sequence identity or homology (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity or homology) to the entire length or a contiguous portion of a sequence.

[0062] In some embodiments, the contiguous portion is about, at least about, or no more than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90, or 100 contiguous nucleotides of a sequence.

[0063] An oligonucleotide decoy having a certain percent (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of sequence identity with another sequence means that, when aligned, thatpercentage determines the level of correspondence of bases arrangement in comparing the two sequences. This alignment and the percent homology or identity can be determined using any suitable software program known in the art that allows local alignment. In some embodiments, such programs include but are not limited to the EMBOSS Pairwise Alignment Algorithm (from the European Bioinformatics Institute), the ClustalW program, or the BLAST program (BLAST Manual, Altschul et al., Natl Cent. Biotechnol. Inf, Natl Lib. Med. (NCIB NLM NIH), Bethesda, Md., and Altschul et al., (1997) NAR 25:3389 3402).

[0064] One skilled in the art will recognize that the sequences encompassed by the invention include those that are fully or partially complementary to the sequences described herein, including those that hybridize under stringent hybridization conditions with an exemplified sequence. A nucleic acid is hybridizable to another nucleic acid when a single stranded form of the nucleic acid can anneal to the other single stranded nucleic acid under appropriate conditions of temperature and solution ionic strength. Hybridization conditions are well known in the art. In some embodiments, annealing may occur during a slow decrease of temperature from a denaturizing temperature (e.g., 100°C) to room temperature in a water and / or salt containing solvent (e.g., Tris- EDTA buffer).

[0065] The population of oligonucleotide decoys can be composed of one oligonucleotide decoy, or a combination of two or more (e.g., 2, 3, 4, 5, etc.) oligonucleotide decoys. In certain embodiments, the population of oligonucleotide decoys is composed of one oligonucleotide decoy with a single transcription factor binding site binding factors from the group consisting of HOXA1 , H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, HOXA7, HOXA9, HOXA10, H0XA11, H0XA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXCH, HOXC12, HOXC13, HOXD1, HOXD3, H0XD4, HOXD8, HOXD9, HOXD10, HOXD11, HOXD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g.,NEUR0G1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, TH API 2) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors. In certain embodiments, the population of oligonucleotide decoys is composed of one oligonucleotide decoy with a single transcription factor binding site binding factors from the group consisting of the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related factors.

[0066] In some embodiments, the population of oligonucleotide decoys is composed of one oligonucleotide decoy with combination of at least two (e.g., 2, 3, 4, 5, etc.) transcription factor binding sites, which bind to factors from the list of consisting of H0XA1, HOXA2, HOXA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, HOXB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, H0XB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, H0XD1, HOXD3, H0XD4, HOXD8, HOXD9, HOXDIO, H0XD11, H0XD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG(e.g., NEUROG1 , NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP 10, THAP11, THAP 12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors. In certain embodiments, the population of oligonucleotide decoys is composed of one oligonucleotide decoy with a single transcription factor binding site binding factors from thegroup consisting of the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related factors.

[0067] In some embodiments, the population of oligonucleotide decoys comprises one oligonucleotide decoy with combination of at least three (e.g., 3, 4, 5, etc.) transcription factor binding sites, which bind to the same or different (e.g., three or at least three different) factors from the from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, FIOXA7, HOXA9, HOXAIO, HOXA11, HOXA13, HOXBl , FIOXB2, HOXB3, HOXB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, HOXBl 3, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, HOXD1, HOXD3, H0XD4, HOXD8, HOXD9, HOXDIO, HOXD11, HOXD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., TH API , THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors. In certain embodiments, the population of oligonucleotide decoys is composed of one oligonucleotide decoy with a single transcription factor binding site binding factors from the group consisting of the the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related factors. Other combinations will be apparent to persons skilled in the art.

[0068] Generally, the oligonucleotide decoys disclosed herein may be used to bind and, e.g., thereby inhibit, transcription factors that modulate the expression of genes involved in one or more brain cell signaling. An oligonucleotide decoy that is designed to bind to a specific transcription factor has a nucleic acid sequence mimicking the endogenous genomic DNA sequence normallybound by the transcription factor. Accordingly, in some aspects the oligonucleotide decoys disclosed herein inhibit a necessary step for gene expression and regulation. Further, the oligonucleotide decoys disclosed herein may bind to one or a number of different transcription factors.

[0069] The term oligonucleotide encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 2,6-diaminopurine, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, uracil-5-oxyacetic acid, N6-isopentenyladenine, 1 -methyladenine, N-uracil-5-oxyacetic acid methylester, queosine, 2-thiocytosine, 5-bromouracil, methylphosphonate, phosphorodithioate, ormacetal, 3’-thioformacetal, nitroxide backbone, sulfone, sulfamate, morpholino derivatives, 2’0-methyl modification, 2’ -methoxy modification, 2’ -methoxy ethoxy modification, 2’ fluoro modification, locked nucleic acid (LNA) derivatives, and / or peptide nucleic acid (PNA) derivatives. In some embodiments, the oligonucleotide can be conjugated to another chemical entity, including but not limited to any lipid, various Polyethylene glycol molecules, glycerol, peptides, antibody or any other molecule.

[0070] In some embodiments, the oligonucleotide is composed of two complementary singlestranded oligonucleotides that are annealed together. In some embodiments, the oligonucleotide is composed of one single-stranded oligonucleotide that forms intramolecular base pairs to create a substantially double-stranded structure.

[0071] In some embodiments, the oligonucleotide decoys disclosed herein are chemically modified by methods well known to the skilled artisan (e.g., incorporation of phosphorothioate, methylphosphonate, phosphorodithioate, phosphoramidates, carbonate, thioether, siloxane, acetamidate or carboxymethyl ester linkages between nucleotides), for example, to prevent degradation by nucleases within cells and / or in extra- cellular fluids (e.g., serum, cerebrospinal fluid). In some embodiments, the oligonucleotide decoys are designed to form hairpin and dumbbell structures, which can also prevent or hinder nuclease degradation. In particular embodiments, the oligonucleotide decoys are inserted as a portion of a larger plasmid capable ofepisomal maintenance or constitutive replication in the target cell in order to provide longer-term, enhanced intracellular exposure to the decoy sequence and / or reduce its degradation. Accordingly, any chemical modification or structural alteration known in the art to enhance oligonucleotide stability is within the scope of the present disclosure. In some embodiments, the oligonucleotide decoys disclosed herein may be attached, for example, to polyethylene glycol polymers, peptides (e.g., a protein translocation domain) or proteins which improve the therapeutic effect of oligonucleotide decoys. Such modified oligonucleotide decoys may preferentially traverse the cell membrane.

[0072] The oligonucleotide decoys described herein may generally be utilized as the free acid or free base. Alternatively, the oligonucleotide decoys may be used in the form of acid or base addition salts. Acid addition salts of the free amino compounds of the present invention may be prepared by methods well known in the art, and may be formed from organic and inorganic acids. Suitable organic acids include maleic, fumaric, benzoic, ascorbic, succinic, methanesulfonic, acetic, trifluoroacetic, oxalic, propionic, tartaric, salicylic, citric, gluconic, lactic, mandelic, cinnamic, aspartic, stearic, palmitic, glycolic, glutamic, and benzenesulfonic acids.

[0073] Suitable inorganic acids include hydrochloric, hydrobromic, sulfuric, phosphoric, and nitric acids. Base addition salts included those salts that form with the carboxylate anion and include salts formed with organic and inorganic cations such as those chosen from the alkali and alkaline earth metals (for example, lithium, sodium, calcium, potassium, magnesium, barium and calcium), as well as the ammonium ion and substituted derivatives thereof (e.g., dibenzylammonium, benzylammonium, 2-hydroxy ethylammonium, and the like). Thus, the term “pharmaceutically acceptable salt” is intended to encompass any and all acceptable salt forms.

[0074] Prodrugs are also included. Prodrugs are any covalently bonded carriers that release a compound in vivo when such prodrug is administered to a patient. Prodrugs are generally prepared by modifying functional groups in a way such that the modification is cleaved, either by routine manipulation or in vivo, yielding the parent compound. Prodrugs include, for example, compounds of this invention wherein hydroxy, amine or sulfhydryl groups are bonded to any group that, whenadministered to a patient, cleaves to form the hydroxy, amine or sulfhydryl groups. Thus, representative examples of prodrugs include (but are not limited to) acetate, formate and benzoate derivatives of alcohol and amine functional groups of the oligonucleotide decoys described herein. Further, in the case of a carboxylic acid (-COOH), esters may be employed, such as methyl esters, ethyl esters, and the like.

[0075] In certain embodiments, the oligonucleotide decoys are provided as salts, hydrates, solvates, or N-oxide derivatives. In certain embodiments, the oligonucleotide decoys are provided in solution (e.g., a saline solution having a physiologic pH) or in lyophilized form. In some embodiments, the oligonucleotide decoys are provided in liposomes.

[0076] The oligonucleotide decoys described herein may be made by conventional methods known in the art and thus are well within the knowledge of the skilled artisan. The activity of oligonucleotide decoys and variants thereof can be assayed according to routine techniques in the art (see the Examples). In particular embodiments, the oligonucleotide decoy is a synthetic oligonucleotide (i.e., a chemically-synthesized, non-naturally-occurring oligonucleotide).

[0077] Also included are non-oligonucleotide-based therapeutic agents, including those that inhibit binding of a transcription factor to its endogenous transcription binding site, for instance, by specifically binding to an IRF transcription factor, or by specifically binding to its endogenous transcription factor binding site, by specifically binding to an IRF transcription factor binding site. Examples of therapeutic agents include binding agents such as antibodies, small molecules, peptides, adnectins, anticalins, DARPins, anaphones, and aptamers, which exhibit binding specificity for a transcription factor selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXA10, H0XA11, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, H0XB1 , HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXC11, HOXC12, HOXC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXD10, H0XD11, H0XD12, H0XD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8),NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG(e.g., NEUROG1 , NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP 10, THAP11, THAP 12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related transcription factor binding site domain. In certain embodiments, the population of oligonucleotide decoys is composed of one oligonucleotide decoy with a single transcription factor binding site binding factors from the group consisting of 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related transcription factor binding site domain.

[0078] A binding agent is said to “exhibit binding specificity for,” “specifically bind to,” a transcription factor polypeptide (e.g., a transcription factor binding domain thereof), or an endogenous transcription factor binding site (e.g., double-stranded DNA sequence), if it reacts at a detectable level (within, for example, an ELISA or multiplex assay or an equivalent binding assay) with the polypeptide or nucleic acid, and does not react detectably in a significant (e.g., statistically significant) manner with unrelated structures under similar conditions.

[0079] The term “antibody” relates to an immunoglobulin whether natural or partly or wholly synthetically produced. The term also covers any polypeptide or protein having a binding domain which is, or is homologous to, an antigen-binding domain. CDR grafted antibodies are also contemplated by this term. The term “antigen-binding portion of an antibody,” “antigen-binding fragment,” “antigen-binding domain,” “antibody fragment” or a “functional fragment of an antibody” are used interchangeably in the present invention to include one or more fragments of an antibody that retain the ability to specifically bind to an antigen (see, e.g., Holliger et al., Nature Biotech. 23 (9): 1126-1129 (2005)).

[0080] Antibodies may be prepared by any of a variety of techniques known to those of ordinary skill in the art. See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring HarborLaboratory, 1988. Monoclonal antibodies specific for a polypeptide of interest may be prepared, for example, using the technique of Kohler and Milstein, Eur. J. Immunol. 6:511-519, 1976, and improvements thereto. Also included are methods that utilize transgenic animals such as mice to express human antibodies. See, e.g., Neuberger et al., Nature Biotechnology 14:826, 1996; Lonberg et al., Handbook of Experimental Pharmacology 113:49-101, 1994; and Lonberg et al., Internal Review of Immunology 13:65-93, 1995. Particular examples include the VELOCIMMUNE® platform by REGENEREX® (see, e.g., U.S. Patent No. 6,596,541). Antibodies can also be generated or identified by the use of phage display or yeast display libraries (see, e.g., U.S. Patent No. 7,244,592; Chao et al., Nature Protocols. 1:755-768, 2006).

[0081] As noted above, “peptides” that inhibit binding of a transcription factor to its transcription factor binding site are included as binding agents. The term peptide typically refers to a polymer of amino acid residues and to variants and synthetic analogues of the same. In certain embodiments, the term “peptide” refers to relatively short polypeptides, including peptides that consist of about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acids, including all integers and ranges (e.g., 5-10, 8-12, 10-15, 15-20, 20-25, 25-30, 30-40, 40-50) in between, and which, for example, bind to one or more regions of a KLF transcription factor, e.g., a transcription factor binding domain, or mimic the transcription factor by binding to at least one of its endogenous transcription factor binding sites. Peptides can be composed of naturally-occurring amino acids and / or non-naturally occurring amino acids.

[0082] As noted above, the present invention includes small molecules that inhibit binding of a transcription factor to its transcription factor binding site. A “small molecule” refers to an organic or inorganic compound that is of synthetic or biological origin, but is typically not a polymer. Organic compounds include a large class of chemical compounds whose molecules contain carbon, typically excluding those that contain only carbonates, simple oxides of carbon, or cyanides. A “polymer” refers generally to a large molecule or macromolecule composed of repeating structural units, which are typically connected by covalent chemical bond. In certain embodiments, a smallmolecule has a molecular weight of less than 1000-2000 Daltons, typically between about 300 and 700 Daltons, and including about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 500, 650, 600, 750, 700, 850, 800, 950, 1000 or 2000 Daltons.

[0083] Aptamers that inhibit binding of a transcription factor to its transcription factor binding site are also included as binding agents (see, e.g., Ellington et al., Nature. 346, 818-22, 1990; and Tuerk et al., Science. 249, 505-10, 1990). Examples of aptamers included nucleic acid aptamers (e.g., DNA aptamers, RNA aptamers) and peptide aptamers. Nucleic acid aptamers refer generally to nucleic acid species with secondary and tertiary structures that have been engineered through repeated rounds of in vitro selection or equivalent method, such as SELEX (systematic evolution of ligands by exponential enrichment), to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. See, e.g., U.S. Patent Nos. 6,376,190; and 6,387,620 Hence, included are nucleic acid aptamers that bind to one or more regions of a transcription factor, e.g., a transcription factor binding domain, or which bind to at least one of its endogenous transcription factor binding sites.

[0084] Peptide aptamers typically include a variable peptide loop attached at both ends to a protein scaffold, a double structural constraint that typically increases the binding affinity of the peptide aptamer to levels comparable to that of an antibody’s (e.g., in the nanomolar range). In certain embodiments, the variable loop length may be composed of about 10-20 amino acids (including all integers in between), and the scaffold may include any protein that has good solubility and compacity properties. Certain exemplary embodiments may utilize the bacterial protein Thioredoxin-A as a scaffold protein, the variable loop being inserted within the reducing active site (-Cys-Gly-Pro-Cys- (SEQ ID NO: 97) loop in the wild protein), with the two cysteine lateral chains being able to form a disulfide bridge. Methods for identifying peptide aptamers are described, for example, in U.S. Application No. 2003 / 0108532. Hence, included are peptide aptamers that bind to one or more regions of a transcription factor, e.g., a transcription factor binding domain, or which bind to at least one of its endogenous transcription factor binding sites.Peptide aptamer selection can be performed using different systems known in the art, including the yeast two-hybrid system.

[0085] Also included are ADNECTINS™, AVIMERS™, and ANTICALINS that specifically bind to KLF transcription factor. ADNECTINS™ refer to a class of targeted biologies derived from human fibronectin, an abundant extracellular protein that naturally binds to other proteins. See, e.g., U.S. Application Nos. 2007 / 0082365; 2008 / 0139791; and 2008 / 0220049. ADNECTINS™ typically consists of a natural fibronectin backbone, as well as the multiple targeting domains of a specific portion of human fibronectin. The targeting domains can be engineered to enable an Adnectin™ to specifically recognize a therapeutic target of interest, such as a transcription factor polypeptide, or a fragment thereof, e.g., a transcription factor binding domain, or at least one of its endogenous transcription factor binding sites.

[0086] AVIMERS™ refer to multimeric binding proteins or peptides engineered using in vitro exon shuffling and phage display. Multiple binding domains are linked, resulting in greater affinity and specificity compared to single epitope immunoglobulin domains. See, e.g., Silverman et al., Nature Biotechnology. 23: 1556-1561, 2005; U.S. PatentNo. 7,166,697; and U.S. Application Nos. 2004 / 0175756, 2005 / 0048512, 2005 / 0053973, 2005 / 0089932 and 2005 / 0221384.

[0087] Also included are designed ankyrin repeat proteins (DARPins), which include a class of non-immunoglobulin proteins that can offer advantages over antibodies for target binding in drug discovery and drug development. Among other uses, DARPins are ideally suited for in vivo imaging or delivery of toxins or other therapeutic payloads because of their favorable molecular properties, including small size and high stability. The low-cost production in bacteria and the rapid generation of many target-specific DARPins make the DARPin approach useful for drug discovery. Additionally, DARPins can be easily generated in multispecific formats, offering the potential to target an effector DARPin to a specific organ or to target multiple polypeptides / nucleic acids with one molecule composed of several DARPins. See, e.g., Stumpp et al., Curr Opin Drug Discov Devel. 10: 153-159, 2007; U.S. Application No. 2009 / 0082274; and PCT / EP2001 / 10454.

[0088] Certain embodiments include “monobodies,” which typically utilize the 10th fibronectin type III domain of human fibronectin (FNfnlO) as a scaffold to display multiple surface loops for target binding. FNfnlO is a small (94 residues) protein with a 0-sandwich structure similar to the immunoglobulin fold. It is highly stable without disulfide bonds or metal ions, and it can be expressed in the correctly folded form at a high level in bacteria. The FNfnlO scaffold is compatible with virtually any display technologies. See, e.g., Batori et al., Protein Eng. 15:1015- 20, 2002; and Wojcik et al., Nat Struct Mol Biol., 2010; and U.S. Patent No. 6,673,901.

[0089] Anticalins refer to a class of antibody mimetics, which are typically synthesized from human lipocalins, a family of binding proteins with a hypervariable loop region supported by a structurally rigid framework. See, e.g., U.S. Application No. 2006 / 0058510. Anticalins typically have a size of about 20 kDa. Anticalins can be characterized by a barrel structure formed by eight antiparallel 0-strands (a stable 0-barrel scaffold) that are pairwise connected by four peptide loops and an attached a-helix. In certain aspects, conformational deviations to achieve specific binding are made in the hypervariable loop region(s). See, e.g., Skerra, FEBS J. 275:2677-83, 2008, herein incorporated by reference.

[0090] The therapeutic agents, e.g., binding agents, described herein which inhibit the binding of one of more of the transcription factor selected from the group consisting of HOXA1, HOXA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXA10, H0XA11, H0XA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXCl l, HOXC12, FIOXC13, HOXD1, HOXD3, H0XD4, H0XD8, HOXD9, HOXD10, HOXD11, HOXD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG(e.g., NEUROG1 , NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOX10, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21,SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP 10, THAP11, THAP 12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related transcription factor binding sites. In some embodiments, the therapeutic agents, e.g., binding agents, described herein which inhibit the binding of one of more of the transcription factor selected from the group consisting of the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related transcription factor to its endogenous transcription factor binding site(s), can be used in any of the methods and compositions described herein.Methods for Use

[0091] Embodiments of the present invention include methods of using therapeutic agents described herein (e.g., oligonucleotide decoys, binding agents), which inhibit or otherwise reduce binding of one or more transcription factors involved in Huntington’s disease to its endogenous transcription binding site, and related compositions, to modulate the activity of one or more transcription factors involved in neurodegeneration and in particular in Huntington’s disease. In particular embodiments, the one or more transcription factors is selected from the group consisting of HOXA1, H0XA2, HOXA3, H0XA4, HOXA5, HOXA6, H0XA7, HOXA9, HOXAIO, H0XA1 1, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, H0XB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, H0XD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXDI O, HOXD11, H0XD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4,THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, TH API 2) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4). In particular embodiments, the one or more transcription factors is selected from the group consisting of the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related transcription factors.

[0092] The methods can be used, for example, to Huntington’s disease in a subject, to modulate transcription of a gene present in a brain cell or from the broader nervous system carrying the HTT mutation, to modulate transcription of a gene present in a brain cell or from the broader nervous system in a subject carrying the HTT mutation, and / or to modulate the effects of the HTT mutation in a cell, for example, in a subject. Such methods can be practiced in vitro, for instance, by contacting a cell with a therapeutic agent (e.g., oligonucleotide decoy) or related composition, or in vivo, for instance, by administering to a subject in need thereof a therapeutic agent (e.g., oligonucleotide decoy) or related composition. In particular embodiments, the therapeutic agent is an oligonucleotide decoy or population of oligonucleotide decoys, as described herein.

[0093] Thus, certain embodiments include methods for treating Huntington’s disease in a subject, comprising administering to the subject a therapeutically effective amount of a therapeutic agent, wherein the therapeutic agent inhibits binding of a transcription factor to its transcription binding site, and wherein the transcription factor is selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XAH, HOXA13, HOXB1, H0XB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, H0XB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXDIO, H0XD11, H0XD12, H0XD13, or the 39 HOX transcription factors and closely related factors. Also included are methods of treating or preventing Huntington disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more oligonucleotide decoys described herein. In some embodiments, methods of preventing Huntington disease in a subject are provided, for example, prophylactic methods of treating or managing Huntingtondisease. Such methods comprise administering to a subject in need thereof (e.g., a patient likely to develop Huntington disease) a therapeutically effective amount of an oligonucleotide decoy described herein.

[0094] The methods can be used also to treat other neurodegenerative disease, including but not limited to CAG-repeat diseases (e.g., Ataxia), Alzheimer disease, Parkinson Disease, Lewy Body Dementia or multiple sclerosis.

[0095] Thus, in certain embodiments, an oligonucleotide decoy and / or pharmaceutical composition comprising the same is administered to a subject in need thereof, for example, such as an animal (e.g., a bird, mammal, primate, human patient), suffering from or expected to suffer from Huntington disease. In certain embodiments, the oligonucleotide decoys and / or pharmaceutical compositions thereof are administered to a patient, such as an animal, as a preventative measure against Huntington disease. In some embodiments, Huntington disease has not developed yet, or is at grade 0, 1, 2, 3 or 4. In certain embodiments, the oligonucleotide decoys and / or pharmaceutical compositions thereof may be used for the prevention of one facet of Huntington disease while concurrently treating another aspect of Huntington disease.

[0096] In some embodiments, the therapeutic agent (e.g., oligonucleotide decoy, population of oligonucleotide decoys, binding agent) or composition that is administered to treat, manage, and / or prevent Huntington disease binds to transcription factors selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXA10, HOXA1 1, HOXA13, H0XB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, H0XB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXC11, HOXC12, HOXC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXD10, H0XD11, H0XD12, H0XD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX(e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, TH API 2) and ZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4). In some embodiments, the therapeutic agent (e.g., oligonucleotide decoy, population of oligonucleotide decoys, binding agent) or composition that is administered to treat, manage, and / or prevent Huntington disease binds to transcription factors selected from the group consisting of the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related factors.

[0097] Also included are methods for modulating transcription of a gene present in a brain cell or a cell from the broader nervous system in a subject carrying the HTT mutation, comprising administering to the cell a therapeutically effective amount of a therapeutic agent, wherein the therapeutic agent inhibits binding of a transcription factor to its transcription factor binding site, wherein the transcription factor is selected from the group consisting of selected from the group consisting of H0XAl,H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOX 10, H0XA11, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, HOXB7, H0XB8, H0XB9, H0XB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCI O, HOXCl l , HOXC12, HOXC13, HOXD1, H0XD3, HOXD4, H0XD8, HOXD9, HOXDIO, H0XD11, H0XD12, H0XD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e g., NEUROG1, NEUROG2, NEUROG3), NKX (e g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) andZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4). In some embodiments, the transcription factor is selected from the group consisting of selected from the group consisting of the 39 HOX transcription factors, BCL,CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related factors.

[0098] In some embodiments, the therapeutic agent includes one or more oligonucleotide decoys described herein. In certain embodiments, modulation of transcription comprises suppressing or repressing gene expression. In some embodiments, modulation of transcription comprises stabilizing gene expression. In particular embodiments, modulation of transcription comprises activating or inducing gene expression. In certain embodiments, the gene is involved in the signaling associated with the mutated HTT protein. Gene is involved in mutated HTT signaling, but is not limited to, genes encoding DNA repair protein (e.g. nucleases), protein regulating gene expression (e.g., transcription factors, methylase), membrane proteins (e.g., ion channels, membrane receptors, etc.), soluble signaling molecules (e.g., intracellular signaling molecules or neurotransmitters), synthetic enzymes (e.g., neurotransmitter synthesis enzymes) or structural protein (e.g., actin), synaptic, dendritic, cell body or axonal protein.

[0099] Some embodiments include methods for signaling associated with a mutated huntingtin protein in a cell, comprising administering to the cell a therapeutically effective amount of a therapeutic agent, wherein the therapeutic agent inhibits binding of a transcription factor to its transcription factor binding site, wherein In some embodiments, the transcription factor is selected from the group consisting of H0XAl,H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, H0XB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXDIO, H0XD11, H0XD12, H0XD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9,SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, TH API ! , THAP12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors, the transcription factor is selected from the group consisting of the 39 HOX transcription factors, BCL, CXXC, GTF, LHX, NEUROD, NKX, PBX, SOX, THAP, ZIC transcription factors and closely related factors. In some embodiments, the therapeutic agent includes one or more oligonucleotide decoys described herein. In certain embodiments, modulation of neurodegenerative signaling comprises suppressing or repressing neurodegenerative signaling. In some embodiments, modulation of signaling associated with a mutated huntingtin protein comprises blocking the regulation of genes encoding proteins required for cell structure (e.g., synapse, dendrite, cell body, axon of a neuron) membrane or function. In particular embodiments, modulation of signaling associated with a mutated huntingtin protein comprises altering transcription factor networks.

[0100] In certain embodiments, the cell of the various methods is provided in vivo (e.g., in a subject suffering from Huntington disease or likely to suffer from Huntington disease). A cell provided in vivo can be located in different locations including the central nervous system (cerebrospinal fluid, brain, spinal cord, dorsal root ganglia) or in another tissue, including but not limited to skin, breast, trachea, diaphragm, central nervous system, gums, muscles or the lymphatic system (lymph nodes and spleen). The cell can be any cell typically affected by Huntington disease, a neuron, a glial cell, an astrocyte or another cell from the nervous system, a tissue supportive cell (e.g., fibroblast) or an immune cell.

[0101] In some embodiments, the oligonucleotide decoys and / or pharmaceutical compositions thereof are used in combination therapy with at least one other therapeutic agent. Examples of other therapeutic agents include but are not limited to one or more additional oligonucleotide decoys or a vesicular monoamine transporter 2 inhibitor, an antipsychotic drug or anxiolytic drugs.

[0102] The oligonucleotide decoy and / or pharmaceutical composition thereof and the therapeutic agent can act additively or, more preferably, synergistically. In some embodiments, an oligonucleotide decoy and / or a pharmaceutical composition thereof is administered concurrentlywith the administration of another therapeutic agent, including another oligonucleotide decoy. In other embodiments, an oligonucleotide decoy or a pharmaceutical composition thereof is administered prior or subsequent to administration of another therapeutic agent, including another oligonucleotide decoy.

[0103] For administration to a subject in need thereof, the oligonucleotide decoys and / or pharmaceutical compositions described herein may be administered by any convenient route. Particular examples include administration by intrathecal injection, intracerebral injection, an epidural / peridural injection or a nasal delivery. Other administration routes include but are not limited to intravenous infusion or bolus injection, subcutaneous injection, absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.), and oral administration. Administration can be systemic or local. Various delivery systems are known in the art, including, e.g., encapsulation in liposomes, microparticles, microcapsules, capsules, etc., which can be used to administer a compound and / or pharmaceutical composition thereof. Methods of administration include, but are not limited to, intrathecal, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural / peridural, oral, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation or topically, particularly to the ears, nose, eyes, or skin. In certain embodiments, more than one oligonucleotide decoy is administered to a patient. The preferred mode of administration is left to the discretion of the practitioner, and will depend in-part upon the site of the medical condition.

[0104] In specific embodiments, it may be desirable to administer one or more oligonucleotide decoys locally to the area in need of treatment. This may be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application (e.g., in conjunction with a wound dressing after surgery), by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. In some embodiments, administration can be by direct injection around the site (e.g., former, current, or expected site) of neurodegeneration.

[0105] In certain embodiments, it may be desirable to introduce one or more oligonucleotide decoys into the nervous system by any suitable route, including but not restricted to intraventricular, intrathecal, perineural and / or epidural / peridural injection. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.

[0106] Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant.

[0107] The amount of oligonucleotide decoy that will be effective in the treatment or prevention of Huntington disease in a patient will depend on the specific nature of the condition and can be determined by standard clinical techniques known in the art. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The amount of an oligonucleotide decoy administered will, of course, be dependent on, among other factors, the subject being treated, the weight of the subject, the severity of the affliction, the manner of administration, and the judgment of the prescribing physician. In certain embodiments, a single dose of oligonucleotide decoy may comprise, but is not limited to, about 0.1 pg to 10,000 mg, 5 pg to about 1000 mg, about 50 pg to about 500 mg, about 100 pg to about 100 mg of oligonucleotide decoy per kilogram (kg) of body weight or per tumor mm2(i.e., size) or cm3(i.e., volume). Frequency of administration can be once or multiple time daily, weekly, monthly or annually or any combination of those.

[0108] In some embodiments, the dosage forms are adapted to be administered to a patient as needed daily, once or more weekly, once or more monthly or once or more annually. Dosing may be provided alone or in combination with other drugs and may continue as long as required for effective treatment or prevention of Huntington’s disease.Compositions and Kits

[0109] Certain embodiments include compositions, for example, pharmaceutical or therapeutic compositions, comprising one or more therapeutic agents (e.g., oligonucleotide decoys, bindingagents) described herein, optionally in combination with one or more pharmaceutically-acceptable carriers (e.g., pharmaceutical-grade carriers).

[0110] The pharmaceutical compositions disclosed herein comprise a therapeutically effective amount of one or more therapeutic agents (e.g., oligonucleotide decoys), preferably, in purified form, together with a suitable amount of a pharmaceutically-acceptable carrier, so as to provide a form for proper administration to a patient. When administered to a patient, therapeutic agents such as oligonucleotide decoys and pharmaceutically-acceptable carriers are preferably sterile. Examples of pharmaceutically-acceptable carriers include, but are not limited to, saline, phosphate buffered saline (PBS), tris buffer, water, aqueous ethanol, emulsions, such as oil / water emulsions or triglyceride emulsions, tablets and capsules. Water is a preferred vehicle when oligonucleotide decoys are administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid vehicles, particularly for injectable solutions. Suitable pharmaceutically-acceptable carriers also include excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Pharmaceutical compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. In addition, auxiliary, stabilizing, thickening, lubricating and coloring agents may be used.[OHl] Pharmaceutical compositions may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries, which facilitate processing of compounds disclosed herein into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

[0112] Pharmaceutical compositions can take the form of solutions, suspensions, emulsions, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, aerosols, sprays, suspensions, or any other form suitable for use. Otherexamples of suitable pharmaceutical vehicles have been described in the art (see Remington’s Pharmaceutical Sciences, Philadelphia College of Pharmacy and Science, 19th Edition, 1995).

[0113] Pharmaceutical compositions for oral delivery may be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Orally administered compositions may contain one or more optional agents, for example, sweetening agents such as fructose, aspartame or saccharin, flavoring agents such as peppermint, oil of wintergreen, or cherry coloring agents and preserving agents, to provide a pharmaceutically palatable preparation. Moreover, when in tablet or pill form, the compositions may be coated to delay disintegration and absorption in the gastrointestinal tract, thereby providing a sustained action over an extended period of time. Oral compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Such vehicles are preferably of pharmaceutical grade.

[0114] For oral liquid preparations such as, for example, suspensions, elixirs and solutions, suitable carriers, excipients or diluents include water, saline, alkyleneglycols (e.g., propylene glycol), polyalkylene glycols (e.g., polyethylene glycol), oils, alcohols, slightly acidic buffers between pH 4 and pH 6 (e.g., acetate, citrate, or ascorbate at between about 5 mM to about 50 mM), etc. Additionally, flavoring agents, preservatives, coloring agents, bile salts, acylcarnitines and the like may be added.

[0115] For buccal administration, the compositions may take the form of tablets, lozenges, etc., formulated in conventional manner. Liquid drug formulations suitable for use with nebulizers and liquid spray devices and EHD aerosol devices will typically include a compound with a pharmaceutically acceptable vehicle. In some aspects, the pharmaceutically acceptable vehicle is a liquid such as alcohol, water, polyethylene glycol or a perfluorocarbon. Optionally, another material may be added to alter the aerosol properties of the solution or suspension of compounds. In some aspects, the material is liquid such as an alcohol, glycol, polyglycol or a fatty acid. Other methods of formulating liquid drug solutions or suspension suitable for use in aerosol devices are known to those of skill in the art (see, e.g., Biesalski, U.S. Pat. No. 5,112,598; Biesalski, U.S. Pat.No. 5,556,611). A compound may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. In addition to the formulations described previously, a compound may also be formulated as a depot preparation. Such long-acting formulations may be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, a compound may be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

[0116] An oligonucleotide decoy may be included in any of the herein-described formulations, or in any other suitable formulation, as a pharmaceutically acceptable salt, a solvate or hydrate. Pharmaceutically acceptable salts substantially retain the activity of the parent compound and may be prepared by reaction with appropriate bases or acids and tend to be more soluble in aqueous and other protic solvents than the corresponding parent form.

[0117] In some instances, liposomes may be employed to facilitate uptake of the oligonucleotide decoys into cells, for example, in vitro or in a subject (see, e.g., Williams, S.A., Leukemia 10(12): 1980-1989, 1996; Lappalainen et al., Antiviral Res. 23: 119, 1994; Uhlmann et al., Chemical Reviews, Volume 90, No. 4, 25 pages 544-584, 1990; Gregoriadis, G., Chapter 14, Liposomes, Drug Carriers in Biology and Medicine, pp. 287-341, Academic Press, 1979). Hydrogels may also be used as vehicles for oligonucleotide decoy administration, for example, as described in WO 93 / 01286. Alternatively, the oligonucleotide decoys may be administered in microspheres or microparticles. (See, e.g., Wu, GY. and Wu, C.H., J. Biol. Chem. 262:4429-4432, 30 1987). Alternatively, the use of gas-filled microbubbles complexed with the oligonucleotide decoys can enhance delivery to target tissues, as described in US Patent No. 6,245,747. Sustained release compositions may also be used. These may include semipermeable polymeric matrices in the form of shaped articles such as films or microcapsules.

[0118] Oligonucleotide decoys can be introduced into cells using art-recognized techniques (e.g., transfection, electroporation, fusion, liposomes, colloidal polymeric particles and viral and non-viral vectors as well as other means known in the art). The method of delivery selected will depend at least on the oligonucleotide chemistry, the cells to be treated and the location of the cells and will be apparent to the skilled artisan. For instance, localization can be achieved by liposomes with specific markers on the surface to direct the liposome, direct injection into tissue containing target cells, specific receptor-mediated uptake, or the like.

[0119] As known in the art, oligonucleotide decoys may be delivered using, e.g., methods involving liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle- mediated uptake, and receptor-mediated endocytosis, as well as additional non-endocytic modes of delivery, such as microinjection, permeabilization (e.g., streptolysin-0 permeabilization, anionic peptide permeabilization), electroporation, and various non-invasive non-endocytic methods of delivery that are known in the art (e. g., Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44:35-49, incorporated by reference in its entirety).

[0120] In certain embodiments, one or more oligonucleotide decoys are provided in a kit. In certain embodiments, the kit includes an instruction, e.g., for using said one or more oligonucleotide decoys. In certain embodiments, said instruction describes one or more of the methods of the present invention, e.g., a method for preventing or treating Huntington’s disease, a method of modulating gene expression in a cell, a method for modulating Huntington’s disease / neurodegenerative signaling in a cell, a method for altering transcription factor networks in a cell, etc. In certain embodiments, the oligonucleotide decoys provided in a kit are provided in lyophilized form. In certain related embodiments, a kit that comprises one or more lyophilized oligonucleotide decoys further comprises a solution (e.g., a pharmaceutically-acceptable saline solution) that can be used to resuspend one or more of the oligonucleotide decoys.Experimental Protocol and SEQ ID NOS

[0121] The invention may be further defined by reference to one or more of the following experimental protocols. It will be apparent to those skilled in the art that many modifications, both to materials and methods, may be practiced without departing from the scope of the invention.Oligonucleotides annealing

[0122] Each pair of complementary strands of the oligonucleotide, at equimolar concentration, is annealed in water. The standard procedure includes either annealing at room temperature and / or maintaining the solution of both strands at a high denaturizing temperature for a period of time which may vary depending on the oligonucleotide pair, followed by a slow decrease in temperature until the solution reaches a low temperature of annealing. The proper annealing of complementary strands may be verified by any suitable standard technique, including but not restricted to running samples of annealed oligonucleotides next to un-annealed ones on a non-denaturing polyacrylamide gel.Oligonucleotide binding

[0123] In one embodiment, the binding of the oligonucleotides to transcription factors may be measured. In one instance, a commercial ELISA assay or a tailored version may be used using biotin-oligonucleotide probes incubated with nuclear protein extracts containing target transcription factors from primary human cells, pluri-potent stem cells induced cells, cell lines, and / or recombinant human transcription factors.

[0124] The processing of the decoy probe-protein mix may be performed according to the ELISA kit supplier: typically, the mix is loaded on streptavidin-coated 96-well plates, and the quantity of captured transcription factor can be measured with an antibody-based colorimetric in a microplate reader (OD450 nm) following the protocol provided by the ELISA supplier.

[0125] In another embodiment, the binding of the oligonucleotides to transcription factors may be measured with a multiplex assay or mesoscale assay or an equivalent assay.In vitro experiments

[0126] In one embodiment, the effects of oligonucleotides binding to different combinations of the transcription factors from the group consisting of HOXA 1 ,1 I0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXA10, H0XA11, H0XA13, H0XB1 , H0XB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5,HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, HOXDl, HOXD3, HOXD4, HOXD8, HOXD9, HOXDIO, HOXD11, HOXD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP 10, THAP11, THAP 12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4). In one embodiment, the effects of oligonucleotides binding to different combinations of the transcription factors from any of the 39 HOX transcription factors and closely related factors may be tested in cellular model including a mutation of the huntingtin protein, including but not limited to cell lines with synthetically long CAG length allele, patient-derived fibroblasts or iPSC (Induced pluripotent stem cells) -neurons generated from patients. Some in vitro assays are conducted in cells with different mutations of the huntingtin protein may be tested. The experimental cell assays consist of testing the effects of oligonucleotides on fundamental properties of diseased cells in vitro like resistance to stress or to a lethal stimulus (e.g., depolarization, excitotoxicity), engagement in cellular death pathways (e.g., apoptosis, necrosis, autophagy) and / or on their transcription factor network and / or on their transcriptome.

[0127] Similar experiments may be done in in vitro cellular models of Alzheimer disease, Parkinson disease, Lewy body dementia or multiple sclerosis.

[0128] In one instance, oligonucleotide of SEQ ID: 1 to 8 bind to HOX factors, oligonucleotide of SEQ ID: 9 binds to HOX and LHX factors, oligonucleotide of SEQ ID: 10 binds to HOX and PBX factors, oligonucleotide of SEQ ID: 11 binds to HOX and BCL factors, oligonucleotide of SEQ ID: 12 binds to any HOX and NeuroD and NeuroG factors, oligonucleotide of SEQ ID: 13 binds to HOX and NKX factor, oligonucleotide of SEQ ID: 14 binds to HOX and SOX factors,oligonucleotide of SEQ ID: 15 binds to HOX and THAP factors, oligonucleotide of SEQ ID: 16 binds to HOX and ZIC factors, oligonucleotide of SEQ ID: 17 binds to HOX and CXXC factors, oligonucleotide of SEQ ID: 18 binds to HOX and GTFIR2 factors, oligonucleotide of SEQ ID: 19 binds to HOX, LHX and PBX factors, oligonucleotide of SEQ ID: 20 and SEQ ID:21 bind to HOX, LHX, PBX, BCL, ZIC and NKX factors, oligonucleotide of SEQ ID: 22 binds to HOX, LHX, PBX, BCL, ZIC, NKX and THAP factors, oligonucleotide of SEQ ID: 23 binds to HOX, SOX, NeuroD and neuro factors, oligonucleotide of SEQ ID: 24 binds to HOX, THAP and GTFIR factors, oligonucleotide of SEQ ID: 24 binds to HOX, LHX and BCL factors.

[0129] In other instance, additional oligonucleotide sequences targeting the same combination of transcription factors or different combination of transcription factors from the group consisting of HOXA1,HOXA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, HOXB13, HOXC4, HOXC5, HOXC6, TI0XC8, HOXC9, HOXCIO, HOXC11, H0XC12, HOXC13, H0XD1, H0XD3, H0XD4, H0XD8, HOXD9, HOXDIO, H0XD11, HOXD12, H0XD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e g., NEUROG1, NEUROG2, NEUROG3), NKX (e g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, TH API 2) and ZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors may be tested.

[0130] In one model, the effect of SEQ ID: 4 or 5 (or related sequences), modified or not, on the in vitro behavior of cells from a Huntington disease model(s) or from a patient is tested. SEQ ID: 1 - 3 and 6-43 modified or not, may also be tested. Additional oligonucleotide sequences targeting the same combination of transcription factors or different combination of transcription factors fromthe group described above may also be tested. In one iPSC model, stem cells from patients with a mutated huntingtin protein are induced into neurons in a media containing factors required to differentiate the cells into neurons, possibly medium spiny neurons. At one or more time point following induction of differentiation (e.g., 2, 3, 4 or more weeks), cells are treated with control vehicle or oligonucleotide sequences at up to 10 concentrations (e.g., 1, 10, 50, 100, 500, 1000, 2500, 5000, 10000 nM) using a standard in vitro transfection method (e.g., lipofectamine, DOTAP). The beneficial (e.g., neuroprotective) effects of oligonucleotide sequence(s) on the cells can be then measured after applying one or more stressor (e.g., oxidative stress) to the cell and quantifying the susceptibility to the stress and / or engagement in cell death process (e.g., apoptosis, necrosis) with or without treatment with one or more oligonucleotide sequence. In one assay, the effect of the oligonucleotides on elevated caspases (e.g., apoptotic enzymes) activity upon growth factor deprivation may also be measured. Additional assay measuring cellular break down or damage may be conducted (e.g., measuring the release of intracellular material in the media). In another cell, the number cell alive may be counted after application of a stressor with and without treatment with one or more oligonucleotide sequences.In vivo experiments

[0131] In one embodiment, the effect of oligonucleotides binding to different combinations of the transcription factors from the group consisting of HOXA LHOXA2, HOXA3, H0XA4, HOXA5, FIOXA6, HOXA7, HOXA9, HOXA10, HOXA11 , HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXC10, HOXCT1, HOXC12, HOXC13, H0XD1, H0XD3, H0XD4, HOXD8, HOXD9, HOXD10, H0XD11, H0XD12, H0XD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2,NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4). In one embodiment, the effect of oligonucleotides binding to different combinations of the transcription factors from any of the 39 HOX transcription factors and closely related factors may be tested in animal model of Huntington disease. Models include but are not limited to murine model such as the R2 / 6 transgenic mouse with CAG repeat expansion or the QI 75 Knock-In Mouse model containing the human mutated HTT allele with the expanded CAG repeat within the native mouse huntingtin gene.

[0132] In in vivo models, the effect of oligonucleotide sequences on animal motor and cognitive impairment due to the huntingtin mutation can be measured through behavioral assessment of motor performance or overall behavior at different age (e.g. 4, 6, 8, 10 or 12 weeks-old) including but not limited to an open field assay, a rotarod assay, swim test, gait analysis or of cognitive performance (e.g., ability to discriminate between complex visual stimuli) or a nesting assay. Additional endpoints and models can be used.

[0133] Similar experiments may be done in in vivo models of Alzheimer disease, Parkinson disease, Lewy body dementia or multiple sclerosis.

[0134] The effect of SEQ ID: 4 or 5 (or related sequences), modified or not, may be tested in one or more in vivo models. The effects of SEQ ID: 1-3 and 6-43, modified or not, may also be tested in vivo. Additional oligonucleotide sequences targeting the same combination of transcription factors or different combination of transcription factors from the group described above may also be tested in vivo.

[0135] Oligonucleotides can be administered intrathecally, intracerebrally, intravenously or by any other suitable route in the animal model. Oligonucleotides can be administered once or multiple times during the course of the model. Additional endpoints can be used.Transcription factor network reverse engineering and analysis

[0136] In one instance, transcription factor networks and target gene regulation may be reverse engineered from gene expression data from samples of normal subjects and from Huntington disease patients or carrier of a mutated huntingtin protein. Transcription factor networks may be compared together and the importance of individual transcription factor in those networks quantified using network topology or centrality metrics to support the novel therapeutic potential of the transcription factors inhibited by oligonucleotides. Similar analysis may be done for other neurodegenerative diseases including but not CAG-repeat diseases (e.g., Ataxia), limited to Alzheimer disease, Parkinson’s disease, Lewy Body Dementia or multiple sclerosis.Example 1 to 3: Inference and analyses of transcription factor networks.

[0137] Transcription factor networks are inferred using gene expression data from publicly available microarray, bulk RNAseq and single-cell RNAseq data from patient biopsies or from post-mortem samples using algorithms for inferring networks based on the variations of transcription factor expression profiles. Networks are analyzed using an algorithm that quantifies the functional importance of each transcription factor in a network that was built by analyzing networks from healthy, diseased and treated tissues, and by another algorithm that infers transcription factor target genes and the direction of their regulation.

[0138] Example 4.A-B and 5.A: HOX transcription factor binding. The binding of the oligonucleotides to H0XC4 transcription factor. A commercial ELISA assay was tailored using a biotinylated conjugate of SEQ ID: 4 incubated with nuclear protein extracts from jurkat human cells (Active Motif) containing H0XC4. The processing of the probe -protein mix was performed according to the ELISA kit supplier at room temperature for 30 minutes: the mix was loaded on streptavidin-coated 96- well plates, and the quantity of H0XC4 captured by the SEQ ID: 4- biotinylated probe was measured with an antibody-based colorimetric assay in a microplate reader (OD450 nm) using a commercial HOXC4 antibody (Invitrogen) following the protocol provided by the ELISA supplier. The linearity of the assay was confirmed by adding increasing amount of Jurkat protein in the same final reaction volume. In certain experiments, competition experimentswere conducted by adding an excess (8, 16, 24 or 32-fold) of free, non-biotinylated sequence 4 or 5 over the concentration of the biotinylated SEQ ID: 4 probe at the same time the probe -protein mix was made.

[0139] Example 5. Sequences stability. The stability of oligonucleotides against nuclease metabolism was measured in vitro using commercial, non-heat inactivated human serum (Sigma) and cytosol extracts from human cells (Xenotech). A mix of oligonucleotide and serum or cytosol was incubated at 37C in a water bath for 24, 48 and 72h. Samples were analyzed using an agarose- gel electrophoresis and quantified using Image J (NTH).

Claims

CLAIMS1. An oligonucleotide decoy comprising a combination of at least two transcription factor binding sites, wherein each transcription factor binding site binds to a transcription factor selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, H0XB13, H0XC4, H0XC5, H0XC6, H0XC8, H0XC9, HOXCIO, H0XC11, H0XC12, H0XC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXDIO, H0XD11, H0XD12, H0XD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUR0D2, NEUR0D4, NEUR0D6), NEUROG (e g., NEUR0G1, NEUR0G2, NEUR0G3), NKX (e g., NKX1- 2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors.

2. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy is about 8 or 10 to about 100 base pairs in length.

3. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy binds two or more transcription factors.

4. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy comprises a first transcription factor binding site and a second transcription factor binding site, and wherein the first and the second transcription binding sites overlap.

5. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy comprises a first transcription factor binding site, a second transcription factor binding site, and a third transcription factor binding site, and wherein the first, second, and third transcription factor binding sites overlap.

6. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy comprises a first transcription factor binding site, a second transcription factor binding site, a third transcription factor binding site, and up to 30 or 40 or a higher number of transcription factor binding site binding sites that can overlap.

7. The oligonucleotide decoy of claim 1 , wherein the oligonucleotide decoy comprises transcription factor binding sites that do not overlap.

8. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy comprises a sequence identical to SEQ ID: 4.

9. The oligonucleotide decoy of claim 1 , wherein the oligonucleotide decoy comprises a sequence identical to SEQ ID: 93.

10. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy comprises a sequence identical to SEQ ID: 94.

11. The oligonucleotide decoy of claim 1 , wherein the oligonucleotide decoy comprises a sequence identical to SEQ ID: 95.

12. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy comprises a sequence identical to SEQ ID: 5.

13. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy comprises at least two HOX transcription factor binding sequences extracted from any of the sequences in Table 1.

14. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy has a sequence identical to any one of the sequences selected from SEQ ID: 1 to 43.

15. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy has a sequence that is related by 70% or higher homology to any of sequences 1 to 43.

16. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy has a sequence that is related by 80% or higher homology to any of sequences 1 to 43.

17. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy has a sequence that is related by 90% or higher homology to any of sequences 1 to 43.

18. The oligonucleotide decoy of claim 1, wherein the oligonucleotide decoy comprises any of the population of possible sequences that can bind to any combination of transcription factor from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, H0XB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXDIO, H0XD11, H0XD12,H0XD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e g., NEUROG1, NEUROG2, NEUROG3), NKX (e g., NKX1- 2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors.

19. A pharmaceutical composition comprising an oligonucleotide decoy or population of any one of claims 1-18 and a pharmaceutically acceptable carrier.

20. A kit comprising an oligonucleotide decoy or population of any one of claims 1-18, optionally an instruction for using said oligonucleotide decoy.

21. A method for modulating transcription of a gene present in a cell carrying a mutation for the huntingtin protein involved in Huntington’s disease comprising administering to the cell an effective amount of an oligonucleotide decoy or population of any one of claims 1-18.

22. A method for modulating transcription of a gene present in a cell carrying a mutation for the huntingtin protein involved in Huntington’s disease comprising administering to the cell an effective amount of an oligonucleotide decoy or population of any one of claims1-18.

23. A method for modulating the effect of a mutation for the huntingtin protein involved in Huntington’s disease in a cell comprising administering to the cell an effective amount of an oligonucleotide decoy or population of any one of claims 1-18.

24. A method for treating or preventing Huntington’s disease in a subject comprising administering to the subject a therapeutically effective amount of an oligonucleotide decoy or population of any one of claims 1-18.

25. A method for modulating signaling associated with a mutation in the huntingtin protein in a cell comprising administering to the cell a therapeutically effective amount of a therapeutic agent, wherein the therapeutic agent inhibits binding of one or more transcription factor to its transcription binding site, wherein the transcription factor(s) is(are) selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXDIO, H0XD11, H0XD12, H0XD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2-5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors.

26. A method for treating or preventing Huntington’s disease in a subject comprising administering to the subject a therapeutically effective amount of a therapeutic agent, wherein the therapeutic agent inhibits binding of one or more transcription factor to its transcription binding site, wherein the transcription factor is selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, H0XB13, H0XC4, H0XC5, H0XC6, H0XC8, H0XC9, HOXCIO, H0XC11, H0XC12, H0XC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXDIO, H0XD11, H0XD12, H0XD13, BCL (e g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e g., CXXC1, CXXC4, CXXC5), GTFIRD (e g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e g., NEUR0D2, NEUR0D4, NEUR0D6), NEUROG (e g., NEUR0G1, NEUR0G2, NEUR0G3), NKX (e g., NKX1-2, NKX2-1, NKX2-2, NKX2- 5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors.

27. A method for preventing or treating a neurodegenerative disease other than Huntington’s disease, including but not limited to CAG-repeat diseases, Alzheimer disease, Parkinson’s disease, Lewy Body Dementia or multiple sclerosis, in a subject comprising administering to the subject a therapeutically effective amount of a therapeutic agent, wherein the therapeutic agent inhibits binding of one or more transcription factor to its transcription binding site, wherein the transcription factor is selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7,H0XA9, HOXAIO, HOXA11, HOXA13, HOXB1, HOXB2, HOXB3, HOXB4, HOXB5, HOXB6, HOXB7, HOXB8, HOXB9, HOXB13, HOXC4, HOXC5, HOXC6, HOXC8, HOXC9, HOXCIO, HOXC11, HOXC12, HOXC13, HOXD1, HOXD3, HOXD4, HOXD8, HOXD9, HOXDIO, HOXD11, HOXD12, HOXD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4, LHX6, LHX8), NEUROD (e.g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e.g., NEUROG1, NEUROG2, NEUROG3), NKX (e.g., NKX1-2, NKX2-1, NKX2-2, NKX2- 5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e.g., PBX1, PBX2, PBX3, PBX4), SOX (e.g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e.g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4) and closely related factors.

28. A method for preventing or treating a neurodegenerative disease other than Huntington’s disease, including but not limited to CAG repeat diseases (e.g., Ataxia), Alzheimer disease, Parkinson’s disease, Lewy Body Dementia or multiple sclerosis, in a subject comprising administering to the subject a therapeutically effective amount of a therapeutic agent, wherein the therapeutic agent inhibits the activity and / or the expression level of one or more transcription factor, wherein the transcription factor is selected from the group consisting of H0XA1, H0XA2, H0XA3, H0XA4, H0XA5, H0XA6, H0XA7, H0XA9, HOXAIO, H0XA11, H0XA13, H0XB1, H0XB2, H0XB3, H0XB4, H0XB5, H0XB6, H0XB7, H0XB8, H0XB9, H0XB13, H0XC4, H0XC5, H0XC6, H0XC8, H0XC9, HOXCIO, H0XC11, H0XC12, H0XC13, H0XD1, H0XD3, H0XD4, H0XD8, H0XD9, HOXDIO, H0XD11, H0XD12, H0XD13, BCL (e.g., BCL11A, BCL11B, BCL6, BCL6B), CXXC (e.g., CXXC1, CXXC4, CXXC5), GTFIRD (e.g., GTF2IRD1, GTF2IRD2, GTF2IRD2B), LHX (e.g., LHX2, LHX3, LHX4,LHX6, LHX8), NEUROD (e g., NEUROD2, NEUROD4, NEUROD6), NEUROG (e g., NEUROG1, NEUROG2, NEUROG3), NKX (e g., NKX1-2, NKX2-1, NKX2-2, NKX2- 5, NKX2-6, NKX2-8, NKX3-1, NKX3-2, NKX6-2), PBX (e g., PBX1, PBX2, PBX3, PBX4), SOX (e g., SOX1, SOX2, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOXIO, SOX11, SOX12, SOX13, SOX15, SOX18, SOX21, SOX30), THAP (e g., THAP1, THAP2, THAP3, THAP4, THAP5, THAP6, THAP7, THAP8, THAP9, THAP10, THAP11, THAP12) and ZIC (e.g., ZIC1, ZIC2, ZIC3, ZIC4 and closely related factors.

Citation Information

Patent Citations

  • Microbubble Nucleic Acid Delivery Platform

    US20200214973A1