Autophagy sensors

Abstract

The present invention relates to compounds of Formula (I) and their use in the detection and monitoring of autophagic activity, as well as their use in the identification, treatment, prevention, or amelioration of diseases associated with dysregulation of autophagy.

Description

AUTOPHAGY SENSORS Technical Field

[0001] The present invention relates to chemical compounds and their use in the detection and monitoring of autophagic activity. Background of Invention

[0002] Autophagy (“self-eating”) is a cellular housekeeping process in which unwanted components are identified, degraded, and recycled, greatly contributing to not only cell homeostasis and development but also the prevention of various diseases. Cells undergo autophagy to accomplish the lysosomal digestion of intracellular materials including redundant or damaged proteins, organelles, and foreign bodies.

[0003] Autophagy is a multi-step, dynamic process. Briefly, cellular autophagy is a highly dynamic process containing the following steps: stress-induced signal transduction (upstream machineries), membrane isolation from endoplasmic reticulum (ER)-Golgi to form phagophores, membrane elongation and closure to form autophagosomes, fusion of autophagosomes and lysosomes to form autolysosomes, and lysosomal degradation (quantified as autophagic flux). Several forms of autophagy have been identified including macroautophagy, microautophagy, and chaperone-mediated autophagy (CMA). Macroautophagy is the main pathway used to eradicate dysfunctional organelles or damaged proteins. Depending on the cargos, autophagy can also be divided into bulk (i.e. non- selective) and selective autophagy. Selective autophagy is the autophagy of specific cellular constituents such as organelles like lipophagy, mitophagy, ER-phagy, Golgiphagy, lysophagy, pexophagy, ribophagy, chlorophagy and others. Lipophagy is the degradation of lipid droplets (LDs) by autophagy. LDs are spheric organelles with a core of mainly triacylglycerols (TAGs) and a unilayer of phospholipids and membrane proteins. Mitophagy is the selective degradation of mitochondria by autophagy, which often occurs to defective mitochondria following damage or stress. ER-phagy is the selective autophagy‐mediated degradation of ER fragments.

[0004] Dysregulation of autophagy has been linked to many diseases, such as neurodegeneration, cancers, cardiovascular and infectious diseases, with different steps of the pathway being impaired.

[0005] It is important to understand how a disease-related mutant / condition impacts autophagy, the steps at which it acts, and the extent of the impact(s), to draw a clear mechanistic picture and develop corresponding therapeutic strategies. The multistep feature of autophagy represents a challenge in the dynamic analysis of cellular autophagic activities. Autophagy is therefore the focus of intense research efforts aiming to clarify its mechanism of action in physiological progressions, which raises the urgent needs of robust tools for monitoring autophagy.

[0006] However, tools that allow real-time monitoring of the dynamics of autophagy, especially with quantitative readout, are still scarce and highly desirable. Particularly, it is desirable for the techniques to have the capacity of real-time monitoring with spatiotemporal resolution and quantification in a high-throughput manner. Conventional methods involving the expression of fluorescent protein tagged autophagy markers require tedious and complexed transfection procedures and fail to be applicable in clinical settings.

[0007] Current fluorescence-based methods to monitor bulk autophagy are mostly based on microtubule-associated protein 1A / 1B-light chain 3 (LC3), a protein family well known as the autophagosome marker. In eukaryotic cells, upon induction of autophagy, nascent LC3-I is lipidated through a cascade of enzymes analogous to the ubiquitin E1 / E2 / E3 ligase mechanism to yield the covalent LC3-phosphatidylethanolamine (PE) conjugate, and the resultant LC3-II is then inserted on the membrane of phagophores serving as the cargo receptor. Expression of fluorescent protein tagged LC3 or immunofluorescence labelling of LC3 are accordingly exploited to determine the localization of autophagic vesicles (AVs). Targeting of other proteins involved in autophagy pathway can also be used to monitor the autophagic activities under certain circumstances. These monitoring methods based onprotein markers require either transfection, transduction or antibody labelling. However, transfection or viral delivery of the plasmid(s) to produce genetically modified models is not always feasible, especially in clinical samples and the expression efficiency of the target protein may differ in individual cells. Moreover, such genetic modification process may potentially disrupt or alter the basal autophagy of the original sample. On the other hand, antibody staining requires harsh fixation and permeabilization conditions that may disrupt protein molecules and certainly is inapplicable in live context. Besides, tedious sample preparation procedures involved in these methods may potentially increase the experimental bias, leading to the misinterpretation of autophagy. Developing new tools for autophagy visualisation is thus becoming imperative to further promote autophagy research.

[0008] Small molecule reporters, on the other hand, do possess some advantages over protein-based biosensors, including fast cellular uptake, uniform staining efficiency between cells, and easy functionalization. By incorporating environment (pH, viscosity, ROS, etc.) sensitive moieties into fluorophores, a small number of probes have been successfully reported which can monitor changes between basal or induced autophagy. Despite this, small molecule reporters remain undesirable for biology frontline research due to the lack of specificity. Many of them can only indicate changes occurring during autophagy induction in whole cells but not components of interest, such as autophagosomes and autolysosomes. Also, information about these changes before autophagosome-lysosome fusion is likely to be missed out because lysosome-targeting probes / groups are often used as the autophagy reference in many cases.

[0009] Lipophagy is less studied than other organelle-selective autophagy that can be monitored by expression of fluorescence tagged marker proteins, possibly because the major composition of LDs is hydrophobic lipid esters. Although small molecule fluorophores for cellular LD imaging have been reported, chemical reporters for quantifying cellular lipophagy dynamics are limited.

[0010] LDs remain highly dynamic during their life cycles, and their number, size and composition varies widely with different cell metabolic states. Additionally, the total number of LDs in cells is the consequence of several pathways such as LD biogenesis, lipolysis, lipophagy, plus other unknown cellular LD regulation pathways. It is therefore not possible to determine cellular autophagy simply based on LD staining.

[0011] LDs, and their biogenesis, degradation and their diverse functions, are important for cells to cope with fluctuation of nutrient availability or exogenous stress. Precise regulation of lipophagy is therefore important for maintaining cellular metabolic homeostasis. Either stimulation or inhibition of lipophagy has been implicated in many physiological conditions, such as viral infection, metabolic liver diseases, obesity, insulin resistance, as well as neurodegenerative diseases.

[0012] Recently, targeted degradation through lipophagy have emerged as a novel therapeutic strategy for lipid disorder diseases. It is thus useful to understand how a modulator impacts lipophagy, the steps at which it acts, and the extent of the impact(s), to draw a clear mechanistic picture and avoid undesirable effects. To date, however, tools that allow in situ monitoring and quantification of lipophagy dynamics with minimal disruption in the living system are still limited.

[0013] Several imaging-based assays have been adopted by biologists for lipophagy analysis. Electron microscopy (EM) was used to visualize the lipophagy related structures. Nevertheless, EM observation is incompatible with live cells, thus limiting the application of dynamic monitoring. Fluorescence techniques can serve as an alternative to visualize lipophagy, with most of the existing protocols being fluorescence microscope based. The most common method for lipophagy quantification is the colocalization percentage between LD and lysosome markers. However, this requires counter staining of two organelles, which pose the risk of unwanted dye interference. Also, the acidic stability of most of commercially available LD dyes remain untested, and thus the signals of LD dyes in the lysosomal environment might be dramatically diminished, resulting in unreliable results. Colocalizationanalysis between BODIPY staining and the autophagosome marker protein, LC3, was also performed to quantify cellular macrolipophagy. This, however, required the blockage of autophagosome-lysosome fusion by the H+-ATPase inhibitor, bafilomycin A1. Hence, this method is not suitable for real-time visualization of lipophagy dynamics. In general, analysis based on colocalization percentage is hard to achieve high-content quantification on a single- cell level. For these reasons, the development of fluorescent reporters that can specifically measure cellular lipophagic flux is becoming increasingly needed.

[0014] There is therefore an ongoing need for improved tools for autophagy visualisation and monitoring, which at least partially addresses one or more of the above-mentioned short- comings or provides a useful alternative.

[0015] There is also an ongoing need for improved tools for specific lipophagy visualisation and monitoring, which at least partially addresses one or more of the above- mentioned short-comings or provides a useful alternative.

[0016] The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application. Summary of Invention

[0017] The present inventors determined that incorporating autophagy-targeting chimera enables the design and synthesis of fluorescent chemical probes that are highly specific to autophagy. The present inventors have surprisingly found that the introduction of a pH- sensitive fluorophore into the molecular design enables the discrimination between autophagosomes and acidic autolysosomes under fluorescence microscope. Compared to the conventional methods that only evaluate the average autophagic flux within certain period, these chemical autophagy reporters provide a robust tool to quantify the transient autophagic flux in situ and in real-time.

[0018] Additionally, the present inventors have determined that by incorporating a LD- anchoring moiety into the molecular design, they have manufactured a series of chemical lipophagy-specific reporters with pH and viscosity-dual sensitivity.

[0019] Described herein are synthetic methods for the manufacture of both the chemical LC3-mediated autophagy reporters and lipophagy / mitophagy / ER-phagy-specific reporters.

[0020] Additionally, some of these chemical reporters have been applied in clinical samples derived from patients with a variety of diseases and conditions, such as for example, neurological disorders, cancer, cardiovascular disease, infectious disease, lysosomal storage disorder diseases, obesity and metabolic diseases, including idiopathic Parkinson’s disease (PD), genetic PD, myalgic encephalomyelitis / chronic fatigue syndrome (ME / CFS), Niemann- Pick disease, liver cancer, long COVID, Charcot-Marie-Tooth disease, Batten disease, Gaucher disease, and Fabry disease.

[0021] Accordingly, the present disclosure provides a compound having the general structure of Formula (I) F* – L – X (I) wherein F* is a pH sensitive fluorophore; L is an optional linker group; and X is a targeting moiety.

[0022] In some aspects, the present disclosure also provides to a fluorescent labelling composition comprising the compounds of the present invention.

[0023] In some further aspects, the present disclosure provides to a method of measuring autophagic activity in a cell sample comprising: a) contacting the sample with the fluorescent labelling composition according to the invention; b) detecting fluorescence emitted by said composition and forming a readout therefrom.

[0024] In some aspects, the present disclosure further provides to a method of imaging body tissue comprising: a) applying an imaging composition to a subject, wherein said composition comprises a fluorescent composition according to the invention; b) detecting fluorescence emitted by said composition and forming a readout therefrom.

[0025] In other aspects, the present disclosure provides to a method of identifying, selecting, or diagnosing a disease state in a subject, comprising the steps of: a) applying a fluorescent labelling composition to a cell sample or a body tissue of the subject, wherein said composition comprises a compound according to the invention; b) detecting fluorescence emitted by said composition and forming a readout therefrom, wherein the readout indicates a level of autophagic activity present in the cell sample or body tissue; and optionally c) comparing the level with a reference level to determine an increased or decreased level of autophagic activity present in the cell sample or body tissue, wherein the increased or decreased level of autophagic activity present in the cell sample or body tissue compared to the reference level is indicative of a disease state or a stage of development of a disease state.

[0026] In some aspects, the disease state is associated with dysregulation of macroautophagy, lipophagy, mitophagy, or ER-phagy. In some further aspects, the disease state is selected from neurological disorders, cancer, cardiovascular disease, infectious disease, lysosomal storage disorder disease, obesity and metabolic diseases. In further aspects, the disease state is selected from idiopathic Parkinson’s disease (PD), genetic PD, myalgic encephalomyelitis / chronic fatigue syndrome (ME / CFS), Niemann-Pick disease, liver cancer, long COVID, Charcot-Marie-Tooth disease, Batten disease, Gaucher disease, and Fabry disease.

[0027] In further aspects, the present disclosure provides to a pharmaceutical composition comprising a pharmaceutically acceptable salt of the compound according to the invention, and a pharmaceutically acceptable excipient.

[0028] In other further aspects, the present disclosure provides to a compound according to the invention for use in the identification, treatment, prevention, or amelioration of a condition associated with dysregulation of autophagy.

[0029] In other aspects, the present disclosure further provides to a method of identifying, preventing, treating, or ameliorating a condition associated with dysregulation of autophagy, said method comprising administering to a patient in need thereof a therapeutically effective amount of a compound according to the invention.

[0030] In some aspects, the present disclosure also provides to a use of a compound according to the invention in the manufacture of a medicament for the identification, treatment, prevention, or amelioration of a condition associated with dysregulation of autophagy.

[0031] In some aspects, the condition is associated with dysregulation of macroautophagy, lipophagy, mitophagy, or ER-phagy. In some further aspects, the condition is selected from neurological disorders, cancer, cardiovascular disease, infectious disease, lysosomal storage disorder disease, obesity and metabolic diseases. In some preferred aspects, the condition is selected from idiopathic Parkinson’s disease (PD), genetic PD, myalgic encephalomyelitis / chronic fatigue syndrome (ME / CFS), Niemann-Pick disease, liver cancer, long COVID, Charcot-Marie-Tooth disease, Batten disease, Gaucher disease, and Fabry disease.

[0032] Further aspects of the invention appear below in the detailed description of the invention.

[0033] The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally equivalent products, compositions and methods are clearly within the scope of the present disclosure.

[0034] Any example / embodiment of the present disclosure herein shall be taken to apply mutatis mutandis to any other example / embodiment of the disclosure unless specifically stated otherwise. Description of Drawings

[0035] Embodiments of the invention will herein be illustrated by way of example only with reference to the accompanying drawings in which:

[0036] Figure 1 shows that AUTag1 selectively lights up in vitro in the presence of lipidated human LC3B. (A) Scheme of the recombinant LC3B wide type (WT), LC3B G120C, and LC3B G120C-DSPE. The reaction scheme illustrating the maleimide–thiol reaction between cysteine (Cys) on the protein and DSPE-MI to form the protein-DSPE conjugate. (B) Fluorescence intensity of AUTag1 in the indicated analytes measured by a plate reader. λex = 415 nm, λem= 525 nm.

[0037] Figure 2 shows that AUTag1 can specifically target LC3 in cells. (A) Confocal images of mouse embryonic fibroblasts (MEFs) with or without the treatment of an autophagy inducer, rapamycin (1 µM, 2 h), stained by AUTag1 containing the autophagy-targeting chimera or the reference dye that does not contain the autophagy-targeting chimera. (B) Confocal images of LC3-GFP expressing MEFs with rapamycin (1 µM, 2 h) treatment counter-stained by AUTag1. Scale bar, 10 µm. Lower panel: zoom-in images of regions of interest (ROIs). Scale bar, 5 µm.

[0038] Figure 3 shows that AUTag1 is capable for differentiating various conditions under autophagy modulation and quantifying autophagic dynamics. (A) Confocal images of AUTag1 stained WT MEFs treated by different autophagy modulators. Scale bar, 10 µm. Results show increased AUTag1 signals in both green (AUTag1) channel and red (AUTag1- H+) channel upon autophagy induction by rapamycin (500 nM, 5 h) and EBSS (2 h). Also, cells with autophagy inhibition by wortmannin (50 nM, 2 h) show dimmer signals in both channels; cells with lysosomal inhibition by chloroquine (CQ) (25 µm, 2 h) show increased number of AVs in green channel but dimmer signals in red channels compared to the EBSS only (“None”) group. (B) Confocal images of AUTag1 stained WT MEFs treated by the autophagy inducer torin2 (1 µM, 5 h). Scale bar, 10 µm. Right panel: zoom-in images of ROIs. Scale bar, 3 µm. AP: autophagosome (AUTag1 signal only); AL: autolysosome (AUTag1 + AUTag1-H+); Lyso: lysosome (AUTag1-H+only). By colocalizing the two channels of AUTag1, different types of AVs are distinguishable. (C) Quantification of normalized autophagy index in AUTag1 stained MEFs treated by various autophagy modulators, measured by using a plate reader. n = 4 biological replicates. mean ± SEM. The autophagy index is calculated by the percentage of normalized intensity in red channel in the sum of normalized intensity in both red and green channels, as to show how much LC3-II has been delivered into the lysosomes. Cell number is normalized by using a live-cell penetrable nucleus dye, LSC2.

[0039] Figure 4 shows that AUTag1 is applicable for quantification of autophagy in Dictyostelium discoideum (D. discoideum). (A) Quantification of normalized autophagy index in WT, Atg1 knockout (KO) D. discoideum stained by AUTag1. (B) Quantification of normalized autophagy index in WT, Ampk knockdown (KD), or Ampk overexpressing (OE) D. discoideum stained by AUTag1. (C) Quantification of normalized autophagy index in WT, Raptor KD, or Raptor OE D. discoideum stained by AUTag1. (D) Quantification of normalized autophagy index in WT, Polycystin-2 KD, or Polycystin-2 OE D. discoideum stained by AUTag1. n = 30 – 130 cells. mean ± SEM. * represents significant differences. Quantification of fluorescence intensity in both channels of AUTag1 were measured in images taken using a fluorescence microscope.

[0040] Figure 5 shows that AUTag1 highlights autophagy fluctuations in cells treated by long COVID peptides. (A) Confocal images of AUTag1 stained SH-SY5Y cells without any treatment or treated by ORF6 or ORF10 peptides. Scale bar, 10 µm. (B) Quantification of normalized autophagy index in various peptide treated SH-SY5Y cells. n = 40 – 93 cells. mean ± SEM. * represents significant differences. Quantification of fluorescence intensity in both channels of AUTag1 were measured in images taken using a fluorescence microscope.

[0041] Figure 6 is a series of graphs showing that LD-AUTag1 features pH and viscosity dual sensitivity. (A) Estimation of pKa using absorbance measured at 423 nm and Boltzmann sigmoidal curve fitting for protonation of LD-AUTag1. The pKaof LD-AUTag1 was calculated around 4.81. (B-C) Plotting of photoluminescence (PL) maximum of the neutral form (by adding 0.1% triethylamine) (B) and the acid form (by adding 0.1% trifluoroacetic acid) (C) of LD-AUTag1 in glycerol-ethylene glycol mixtures with different glycerol fraction (fGly).

[0042] Figure 7 is a series of bar graphs showing that LD-AUTag1 possesses negligible cytotoxicity. Cell viability of MEFs (A) and HeLa cells (B) post LD-AUTag1 treatments. TO- PRO-3 cell viability assay was recorded using a flow cytometer. The percentage of live cells was quantified by the ratio of TO-PRO-3neggroup in total cell number. n = 3 biological replicates; mean ± SD.

[0043] Figure 8 is a series of airy scan images of adipose differentiation-related protein (ADRP)-GFP expressed HeLa cells stained with LD-AUTag1 without (A) or with (B) oleic acid (OA) treatment. Scale bar, 10 µm. Lower panels: maximum projection of zoom-in regions of interest (ROIs). Scale bar, 3 µm.

[0044] Figure 9 shows that signals of LD-AUTag1-H+(red channel) highlight the LD components in lysosomes. (A) Airy scan images of MEFs post 24-h amino acid starvation (EBSS) or serum starvation (-FBS) counter stained by LD-AUTag1 (neutral channel: LD- AUTag1; acid channel: LD-AUTag1-H+), BODIPY and LysoView 633. Scale bar, 5 µm. (B) Confocal images of MEFs without or with 24-h NH4Cl treatment counter stained by LD- AUTag1-H+and LysoView 633. Scale bar, 20 µm. (C) Representative histogram of intracellular LD-AUTag1-H+intensity in untreated and NH4Cl treated MEFs quantified by flow cytometry.

[0045] Figure 10 shows the results of an LD-AUTag1-based flow cytometry assay for quantifying the amount of lysosomal LD components in live MEFs. Normalized LD-AUTag1- H+intensity in MEFs treated with common autophagy modulators for 6 h (A) or 24 h (B). For treatments, “CM” means completed medium; “None” means no drug was added in corresponding medium, and the “None” group in CM means untreated cells; “Blank” means the autofluorescence in untreated cells without dye staining. Comparison is towards the untreated group (“None” in CM, “#”) wherever labelled with “#”; others (without “#”) are to compare with the corresponding “None” in each group. (C) LD-AUTag1-H+intensity in MEFs cultured in medium containing different percentage of FBS. n = 3 biological replicates; mean ± SD. * represents significant differences.

[0046] Figure 11 shows the cellular lipophagy levels quantified by LD-AUTag1-H+during Dictyostelium discoideum (D. discoideum) development. (A) Scheme illustration of development processes during D. discoideum starvation. (B) Bright field images of wide type D. discoideum at different time points of development. Scale bar, 10 µm for 0 h; 50 µm for both 10 and 25 h. (C) Maximum projection of LD-AUTag1-H+signals in single cells (0 h), cell clusters (10 h) and slugs (25 h) during D. discoideum development. (D) Heat map of averaged LD-AUTag1-H+intensity in D. discoideum cells at different time points of development, quantified by flow cytometry. n = 3 biological replicates.

[0047] Figure 12 shows the utilization of LD-AUTag1 for quantifying lipophagy levels in zebrafish. Quantification of retinal pigment epithelium (RPE) (A), intestine (B), and tail skin (C) areas from LD-AUTag1 stained zebrafish (7 dpf) without treatment or with the treatment of bafilomycin A1 (Baf A1), 3-MA, torin2, rapamycin (Rapa), E64d / pepstatin A (E / P), rapamycin + E64d / pepstatin A (Rapa+E / P). n = 13 – 15 biological replicates; mean ± SD. * represents significant differences.

[0048] Figure 13 shows that LD-AUTag1-H+highlights lysosomal storage disorder in live cells, using a Niemann Pick Type C1 (NP-C1) model as an example. (A) Quantification of LD-AUTag1-H+intensity in U18666A (an Npc1 inhibitor) treated MEFs. n = 3 biological replicates; mean ± SD. * represents significant differences. (B) Illustrated scheme of samples used in (C – D). (C) Representative FACS plots and corresponding histograms of primary cytotoxic T lymphocytes (CTL) stained by LD-AUTag1 from non-targeted control (upper) andNpc1 KO (lower) groups. (D) Representative airy scan images of cells in (C). Scale bar, 5 µm.

[0049] Figure 14 shows a potential usage of LD-AUTag1-H+as a diagnostic indicator for lysosomal storage disorder diseases (LSDs). (A) Illustrated scheme of samples used in (B – D). (B) Z-stack maximum projection of LD-AUTag1 stained CTL from Npc1 wide type (Npc1+ / +), heterozygote (Npc1+ / -) and KO (Npc1- / -) mice. Scale bar, 20 µm. (C) Histogram and plots of LD-AUTag1-H+signals in CTL from Npc1 wide type (Npc1+ / +), heterozygote (Npc1+ / -) and KO (Npc1- / -) mice. (D) Quantification of LD-AUTag1-H+intensity in CTL from Npc1 wide type (Npc1+ / +), heterozygote (Npc1+ / -) and KO (Npc1- / -) mice. n = 3 biological replicates; mean ± SD. * represents significant differences. (E) Illustrated scheme of samples used in (F – G). (F) Representative airy scan Z-stack images of Npc1- / -CTL cultured without or with HPβCD. Scale bar, 5 µm. (G) Quantification of LD-AUTag1-H+intensity in Npc1- / -CTL cultured without or with HPβCD. n = 4 technical replicates; mean ± SD. * represents significant differences.

[0050] Figure 15 is a bar graph evaluation the lipophagy dynamics in PD using LD- AUTag1. Levels of lysosomal LDs quantified by the intracellular intensity of LD-AUTag1-H+in lymphoblastoid cell lines (LCLs) derived from healthy controls or people with idiopathic, or LRRK2- or PARK2 deficient PD. n = 13 – 15 biological replicates; mean ± SD. * represents significant differences.

[0051] Figure 16 is a series of bar graphs showing that LD-AUTag2 possesses negligible cytotoxicity. Cell viability of MEFs (A) and HeLa cells (B) post LD-AUTag2 treatments. TO- PRO-3 cell viability assay was recorded using a flow cytometer. n = 3 biological replicates; mean ± SD.

[0052] Figure 17 is a series of airy scan images of ADRP-GFP expressed HeLa cells stained with LD-AUTag2 without (A) or with (B) OA treatment. Scale bar, 10 µm. Lower panels: maximum projection of zoom-in regions of interest (ROIs). Scale bar, 3 µm.

[0053] Figure 18 shows the results of an LD-AUTag2-based flow cytometry assay for quantifying the amount of lysosomal LD components in live MEFs. (A) Normalized LD- AUTag2-H+intensity in MEFs treated with common autophagy modulators for 24 h. For treatments, “CM” means completed medium; “None” means no drug was added in corresponding medium, and the “None” group in CM means untreated cells; “Blank” means the autofluorescence in untreated cells without dye staining. Comparison is towards the untreated group (“None” in CM, “#”) wherever labelled with “#”; others (without “#”) are to compare with the corresponding “None” in each group. (B) LD-AUTag2-H+intensity in MEFs cultured in medium containing different percentage of FBS. n = 3 biological replicates; mean ± SD. * represents significant differences.

[0054] Figure 19 shows a series of confocal images of untreated MEFs stained by M- AUTag1 (upper images) and airy scan images of untreated NIH / 3T3 cells stained by M- AUTag2 (lower images). Scale bar, 10 µm. The green channel of M-AUTag1 & 2 highlights the cellular membranous structures, including mitochondria, ER, and Golgi. The red signals of M-AUTag1 & 2 only exist in lysosomes.

[0055] Figure 20 shows that M-AUTag1 enables direct quantification of mitophagy levels in cells using flow cytometry analysis. (A) Representative M-AUTag1 FACS plots of wide type (WT) or Parkin overexpressing HeLa cells under various drug treatments for 6 h. (B) Percentage of mitophagy active population in WT or Parkin overexpressing HeLa cells under various drug treatments for 3 h. n = 3 biological replicates. mean ± SD. * represents significant differences. (C) Percentage of mitophagy active population in Parkin overexpressing HeLa cells under various drug treatments for 6 h. n = 3 biological replicates. mean ± SD. * represents significant differences.

[0056] Figure 21 is a series of airy scan images of ER-AUTag1 signals in HeLa cells under a short term (2 h) of amino acid starvation (EBSS) or serum starvation (-FBS). Scale bar, 10 µm.Detailed Description

[0057] Before describing the present invention in detail, it is to be understood that the terminology used herein is for the purpose of describing embodiments only and is not intended to be limiting.

[0058] In this specification, a number of terms are used that are well known to a skilled addressee. Nevertheless, for the purposes of clarity a number of terms will be defined. Unless specifically defined otherwise, all technical and scientific terms shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art.

[0059] As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise.

[0060] Throughout the description and claims of the specification the word “comprise” and variations of the word, such as “comprising” and “comprises”, is not intended to exclude other additives, components, integers or steps.

[0061] The term "and / or" as used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.

[0062] As used herein, the term "subject" shall be taken to mean any mammalian animal, preferably a human. As used herein, the term “normal subject” refers to a healthy subject.

[0063] As used herein, "disease", "disorder", "condition" and the like, as they relate to a subject's health, are used interchangeably, and have meanings ascribed to each and all such terms.

[0064] The term ‘inhibit” and variations thereof such as “inhibiting” means to prevent, block or reduce the function of the thing being inhibited. The term does not require complete inhibition with a reduction of activity at least 50% being considered inhibition.

[0065] In the definitions of a number of substituents below it is stated that “the group may be a terminal group or a bridging group”. This is intended to signify that the use of the term is intended to encompass the situation where the group is a linker between two other portions of the molecule as well as where it is a terminal moiety. Using the term alkyl as an example, some publications would use the term “alkylene” for a bridging group and hence in these other publications there is a distinction between the terms “alkyl” (terminal group) and “alkylene” (bridging group). In the present application no such distinction is made, and most groups may be either a bridging group or a terminal group.

[0066] As used herein, the term “unsubstituted” means that there is no substituent or that the only substituents are hydrogen.

[0067] The term "optionally substituted" as used throughout the specification denotes that the group may or may not be further substituted or fused (so as to form a condensed polycyclic system), with one or more non-hydrogen substituent groups. In certain embodiments the substituent groups are one or more groups independently selected from the group consisting of halogen, =O, =S, -CN, -NO2, -CF3, -OCF3, -N3, diazirine, alkyl, alkenyl, alkynyl, haloalkyl, haloalkenyl, haloalkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, heterocycloalkenyl, aryl, heteroaryl, cycloalkylalkyl, heterocycloalkylalkyl, heteroarylalkyl, arylalkyl, cycloalkylalkenyl, heterocycloalkylalkenyl, arylalkenyl, heteroarylalkenyl, cycloalkylheteroalkyl, heterocycloalkylheteroalkyl, arylheteroalkyl, heteroarylheteroalkyl, hydroxy, hydroxyalkyl, alkyloxy, alkyloxyalkyl, alkyloxycycloalkyl, alkyloxyheterocycloalkyl, alkyloxyaryl, alkyloxyheteroaryl, alkyloxycarbonyl, alkylaminocarbonyl, alkenyloxy, alkynyloxy, cycloalkyloxy, cycloalkenyloxy, heterocycloalkyloxy, heterocycloalkenyloxy, aryloxy, phenoxy, benzyloxy, heteroaryloxy, arylalkyloxy, amino, alkylamino, acylamino, aminoalkyl, arylamino, alkyldiazirine, alkyltriazole, sulfonylamino, sulfinylamino, sulfonyl, alkylsulfonyl, arylsulfonyl, aminosulfonyl, sulfinyl, alkylsulfinyl, arylsulfinyl, aminosulfinylaminoalkyl, B(ORe)2, CPO(ORe)2, -C(=O)OH, - C(=O)Re, -C(=O)ORe, C(=O)NReRf, C(=NOH)Re, C(=NRe)NRfRg, NReRf, NReC(=O)Rf,NReC(=O)ORf, NReC(=O)NRfRg, NReC(=NRf)NRgRh, NReSO2Rf, -SRe, SO2NReRf, -ORe,OC(=O)NReRf, OC(=O)Reand acyl, wherein Re, Rf, Rgand Rhare each independently selected from the group consisting of H, C1- C12alkyl, C1-C12haloalkyl, C2-C12alkenyl, C2-C12alkynyl, C1-C10heteroalkyl, C3-C12cycloalkyl, C3-C12cycloalkenyl, C1-C12heterocycloalkyl, C1-C12heterocycloalkenyl, C6-C18aryl, C1- C18heteroaryl, and acyl, or any two or more of Ra, Rb, Rcand Rd, when taken together with the atoms to which they are attached form a heterocyclic ring system with 3 to 12 ring atoms.

[0068] In some embodiments each optional substituent is independently selected from the group consisting of: halogen, =O, =S, -CN, -NO2, -CF3, -OCF3, N3, diazirine, alkyl, alkenyl, alkynyl, haloalkyl, haloalkenyl, haloalkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, heterocycloalkenyl, aryl, heteroaryl, hydroxy, hydroxyalkyl, alkyloxy, alkyloxyalkyl, alkyloxyaryl, alkyloxyheteroaryl, alkenyloxy, alkynyloxy, cycloalkyloxy, cycloalkenyloxy, heterocycloalkyloxy, heterocycloalkenyloxy, aryloxy, heteroaryloxy, arylalkyl, heteroarylalkyl, arylalkyloxy, amino, alkylamino, acylamino, aminoalkyl, arylamino, sulfonyl, alkylsulfonyl, arylsulfonyl, aminosulfonyl, aminoalkyl, -COOH, -SH, and acyl.

[0069] Examples of particularly suitable optional substituents include F, Cl, Br, I, CH3, CH2CH3, OH, OCH3, CF3, OCF3, NO2, NH2, diazirine, and CN.

[0070] "Acyl" means an R-C(=O)- group in which the R group may be an alkyl, cycloalkyl, heterocycloalkyl, aryl or heteroaryl group as defined herein. Examples of acyl include acetyl and benzoyl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the carbonyl carbon.

[0071] "Acylamino" means an R-C(=O)-NH- group in which the R group may be an alkyl, cycloalkyl, heterocycloalkyl, aryl or heteroaryl group as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the nitrogen atom.

[0072] "Alkenyl" as a group or part of a group denotes an aliphatic hydrocarbon group containing at least one carbon-carbon double bond and which may be straight or branched preferably having 2-12 carbon atoms, more preferably 2-10 carbon atoms, most preferably 2- 6 carbon atoms, in the normal chain. The group may contain a plurality of double bonds in the normal chain and the orientation about each is independently E or Z. The alkenyl group is preferably a 1-alkenyl group. Exemplary alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl and nonenyl. The group may be a terminal group or a bridging group.

[0073] "Alkenyloxy" refers to an alkenyl-O- group in which alkenyl is as defined herein. Preferred alkenyloxy groups are C1-C6alkenyloxy groups. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the oxygen atom.

[0074] "Alkyl" as a group or part of a group refers to a straight or branched aliphatic hydrocarbon group, preferably a C1–C12 alkyl, more preferably a C1-C10 alkyl, most preferably C1-C6 unless otherwise noted. Examples of suitable straight and branched C1-C6 alkyl substituents include methyl, ethyl, n-propyl, 2-propyl, n-butyl, sec-butyl, t-butyl, hexyl, and the like. The group may be a terminal group or a bridging group.

[0075] "Alkylamino" includes both mono-alkylamino and dialkylamino, unless specified. "Mono-alkylamino" means an Alkyl-NH- group, in which alkyl is as defined herein. "Dialkylamino" means a (alkyl)2N- group, in which each alkyl may be the same or different and are each as defined herein for alkyl. The alkyl group is preferably a C1-C6alkyl group. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the nitrogen atom.

[0076] "Alkylaminocarbonyl" refers to a group of the formula (Alkyl)x(H)yNC(=O)- in which alkyl is as defined herein, x is 1 or 2, and the sum of X+Y =2. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the carbonyl carbon.

[0077] "Alkyloxy" refers to an alkyl-O- group in which alkyl is as defined herein. Preferably the alkyloxy is a C1-C6alkyloxy. Examples include, but are not limited to, methoxy and ethoxy. The group may be a terminal group or a bridging group.

[0078] "Alkyloxyalkyl" refers to an alkyloxy-alkyl- group in which the alkyloxy and alkyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkyl group.

[0079] "Alkyloxyaryl" refers to an alkyloxy-aryl- group in which the alkyloxy and aryl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the aryl group.

[0080] "Alkyloxycarbonyl" refers to an alkyl-O-C(=O)- group in which alkyl is as defined herein. The alkyl group is preferably a C1-C6 alkyl group. Examples include, but are not limited to, methoxycarbonyl and ethoxycarbonyl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the carbonyl carbon.

[0081] "Alkyloxycycloalkyl" refers to an alkyloxy-cycloalkyl- group in which the alkyloxy and cycloalkyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the cycloalkyl group.

[0082] "Alkyloxyheteroaryl" refers to an alkyloxy-heteroaryl- group in which the alkyloxy and heteroaryl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the heteroaryl group.

[0083] "Alkyloxyheterocycloalkyl" refers to an alkyloxy-heterocycloalkyl- group in which the alkyloxy and heterocycloalkyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the heterocycloalkyl group.

[0084] "Alkylsulfinyl" means an alkyl-S-(=O)- group in which alkyl is as defined herein. The alkyl group is preferably a C1-C6 alkyl group. Exemplary alkylsulfinyl groups include, but not limited to, methylsulfinyl and ethylsulfinyl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the sulfur atom.

[0085] "Alkylsulfonyl" refers to an alkyl-S(=O)2- group in which alkyl is as defined above. The alkyl group is preferably a C1-C6alkyl group. Examples include, but not limited to methylsulfonyl and ethylsulfonyl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the sulfur atom.

[0086] “Alkyldiazirine” refers to alkyl group bonded two nitrogen atoms, which are double-bonded to each other, forming a cyclopropene-like ring, 3H-diazirene, in which alkyl is as defined herein. Preferably the alkyldiazirine is a C1-C12alkyldiazirine. Examples include, but are not limited to, methyldiazirine and ethyldiazirine. The group may be a terminal group or a bridging group.

[0087] “Alkyltriazole” refers to alkyl group bonded to a five-membered ring of two carbon atoms and three nitrogen atoms, in which alkyl is as defined herein. In the 1,2,3-triazoles, the three nitrogen atoms are adjacent; in the 1,2,4-triazoles, an interstitial carbon separates out one nitrogen atom. Preferably the alkyltriazole is a C1-C12alkyl-1,2,3-triazole. Examples include, but are not limited to, methyl-1,2,3-triazole and ethyl-1,2,3-triazole. The group may be a terminal group or a bridging group.

[0088] "Alkynyl” as a group or part of a group means an aliphatic hydrocarbon group containing a carbon-carbon triple bond and which may be straight or branched preferably having from 2-12 carbon atoms, more preferably 2-10 carbon atoms, more preferably 2-6carbon atoms in the normal chain. Exemplary structures include, but are not limited to, ethynyl and propynyl. The group may be a terminal group or a bridging group.

[0089] "Alkynyloxy" refers to an alkynyl-O- group in which alkynyl is as defined herein. Preferred alkynyloxy groups are C1-C6alkynyloxy groups. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the oxygen atom.

[0090] "Aminoalkyl" means an NH2-alkyl- group in which the alkyl group is as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkyl group.

[0091] "Aminosulfonyl" means an NH2-S(=O)2- group. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the sulfur atom.

[0092] "Aryl" as a group or part of a group denotes (i) an optionally substituted monocyclic, or fused polycyclic, aromatic carbocycle (ring structure having ring atoms that are all carbon) preferably having from 5 to 12 atoms per ring. Examples of aryl groups include phenyl, naphthyl, and the like; (ii) an optionally substituted partially saturated bicyclic aromatic carbocyclic moiety in which a phenyl and a C5-7cycloalkyl or C5-7cycloalkenyl group are fused together to form a cyclic structure, such as tetrahydronaphthyl, indenyl or indanyl. The group may be a terminal group or a bridging group. Typically, an aryl group is a C6-C18 aryl group.

[0093] "Arylalkenyl" means an aryl-alkenyl- group in which the aryl and alkenyl are as defined herein. Exemplary arylalkenyl groups include phenylallyl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkenyl group.

[0094] "Arylalkyl" means an aryl-alkyl- group in which the aryl and alkyl moieties are as defined herein. Preferred arylalkyl groups contain a C1-5alkyl moiety. Exemplary arylalkyl groups include benzyl, phenethyl, 1-naphthalenemethyl and 2-naphthalenemethyl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkyl group.

[0095] “Arylalkyloxy" refers to an aryl-alkyl-O- group in which the alkyl and aryl are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the oxygen atom.

[0096] "Arylamino" includes both mono-arylamino and di-arylamino unless specified. Mono-arylamino means a group of formula arylNH-, in which aryl is as defined herein. Di-arylamino means a group of formula (aryl)2N- where each aryl may be the same or different and are each as defined herein for aryl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the nitrogen atom.

[0097] "Arylheteroalkyl" means an aryl-heteroalkyl- group in which the aryl and heteroalkyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the heteroalkyl group.

[0098] "Aryloxy" refers to an aryl–O- group in which the aryl is as defined herein. Preferably the aryloxy is a C6-C18aryloxy, more preferably a C6-C10aryloxy. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the oxygen atom.

[0099] "Arylsulfonyl" means an aryl-S(=O)2- group in which the aryl group is as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the sulfur atom.

[0100] A “bond” is a linkage between atoms in a compound or molecule. The bond may be a single bond, a double bond, or a triple bond.

[0101] "Cycloalkenyl" means a non-aromatic monocyclic or multicyclic ring system containing at least one carbon-carbon double bond and preferably having from 5-10 carbon atoms per ring. Exemplary monocyclic cycloalkenyl rings include cyclopentenyl, cyclohexenylor cycloheptenyl. The cycloalkenyl group may be substituted by one or more substituent groups. A cycloalkenyl group typically is a C3-C12 alkenyl group. The group may be a terminal group or a bridging group.

[0102] "Cycloalkyl" refers to a saturated monocyclic or fused or spiro polycyclic, carbocycle preferably containing from 3 to 9 carbons per ring, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like, unless otherwise specified. It includes monocyclic systems such as cyclopropyl and cyclohexyl, bicyclic systems such as decalin, and polycyclic systems such as adamantane. A cycloalkyl group typically is a C3-C12 alkyl group. The group may be a terminal group or a bridging group.

[0103] "Cycloalkylalkyl" means a cycloalkyl-alkyl- group in which the cycloalkyl and alkyl moieties are as defined herein. Exemplary monocycloalkylalkyl groups include cyclopropylmethyl, cyclopentylmethyl, cyclohexylmethyl and cycloheptylmethyl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkyl group.

[0104] "Cycloalkylalkenyl" means a cycloalkyl-alkenyl- group in which the cycloalkyl and alkenyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkenyl group.

[0105] "Cycloalkylheteroalkyl" means a cycloalkyl-heteroalkyl- group in which the cycloalkyl and heteroalkyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the heteroalkyl group.

[0106] "Cycloalkyloxy" refers to a cycloalkyl-O- group in which cycloalkyl is as defined herein. Preferably the cycloalkyloxy is a C1-C6cycloalkyloxy. Examples include, but are not limited to, cyclopropanoxy and cyclobutanoxy. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the oxygen atom.

[0107] "Cycloalkenyloxy" refers to a cycloalkenyl-O- group in which the cycloalkenyl is as defined herein. Preferably the cycloalkenyloxy is a C1-C6cycloalkenyloxy. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the oxygen atom.

[0108] “Haloalkyl” refers to an alkyl group as defined herein in which one or more of the hydrogen atoms has been replaced with a halogen atom selected from the group consisting of fluorine, chlorine, bromine, and iodine. A haloalkyl group typically has the formula CnH(2n+1-m)Xmwherein each X is independently selected from the group consisting of F, Cl, Br, and I. In groups of this type n is typically from 1 to 10, more preferably from 1 to 6, most preferably 1 to 3. m is typically 1 to 6, more preferably 1 to 3. Examples of haloalkyl include fluoromethyl, difluoromethyl and trifluoromethyl.

[0109] “Haloalkenyl” refers to an alkenyl group as defined herein in which one or more of the hydrogen atoms has been replaced with a halogen atom independently selected from the group consisting of F, Cl, Br, and I.

[0110] “Haloalkynyl” refers to an alkynyl group as defined herein in which one or more of the hydrogen atoms has been replaced with a halogen atom independently selected from the group consisting of F, Cl, Br, and I.

[0111] "Halogen" represents chlorine, fluorine, bromine, or iodine.

[0112] “Heteroalkyl" refers to a straight- or branched-chain alkyl group preferably having from 2 to 12 carbons, more preferably 2 to 6 carbons in the chain, in which one or more of the carbon atoms (and any associated hydrogen atoms) are each independently replaced by a heteroatomic group selected from S, O, P and NR’ where R’ is selected from the group consisting of H, optionally substituted C1-C12alkyl, optionally substituted C3-C12cycloalkyl, optionally substituted C6-C18aryl, and optionally substituted C1-C18heteroaryl. Exemplary heteroalkyls include alkyl ethers, secondary and tertiary alkyl amines, amides, alkyl sulfides, and the like. Examples of heteroalkyl also include hydroxyC1-C6alkyl, C1-C6alkyloxyC1-C6alkyl, aminoC1-C6alkyl, C1-C6alkylaminoC1-C6alkyl, and di(C1-C6alkyl)aminoC1-C6alkyl. The group may be a terminal group or a bridging group.

[0113] "Heteroalkyloxy" refers to a heteroalkyl-O- group in which heteroalkyl is as defined herein. Preferably the heteroalkyloxy is a C2-C6heteroalkyloxy. The group may be a terminal group or a bridging group.

[0114] "Heteroaryl" either alone or part of a group refers to groups containing an aromatic ring (preferably a 5 or 6 membered aromatic ring) having one or more heteroatoms as ring atoms in the aromatic ring with the remainder of the ring atoms being carbon atoms. Suitable heteroatoms include nitrogen, oxygen, and sulphur. The group may be a monocyclic or bicyclic heteroaryl group. Examples of heteroaryl include thiophene, benzothiophene, benzofuran, benzimidazole, benzoxazole, benzothiazole, benzisothiazole, naphtho[2,3- b]thiophene, furan, isoindolizine, xantholene, phenoxatine, pyrrole, imidazole, pyrazole, 1,2,3- triazole, 1,2,4-triazole, pyridine, pyrazine, pyrimidine, pyridazine, tetrazole, indole, isoindole, 1H-indazole, purine, quinoline, isoquinoline, phthalazine, naphthyridine, quinoxaline, cinnoline, carbazole, phenanthridine, acridine, phenazine, thiazole, isothiazole, phenothiazine, oxazole, isooxazole, furazane, phenoxazine, 2-, 3- or 4- pyridyl, 2-, 3-, 4-, 5-, or 8- quinolyl, 1-, 3-, 4-, or 5- isoquinolinyl 1-, 2-, or 3- indolyl, and 2-, or 3-thienyl. A heteroaryl group is typically a C1-C18heteroaryl group. The group may be a terminal group or a bridging group.

[0115] "Heteroarylalkyl" means a heteroaryl-alkyl group in which the heteroaryl and alkyl moieties are as defined herein. Preferred heteroarylalkyl groups contain a lower alkyl moiety. Exemplary heteroarylalkyl groups include pyridylmethyl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkyl group.

[0116] "Heteroarylalkenyl" means a heteroaryl-alkenyl- group in which the heteroaryl and alkenyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkenyl group.

[0117] "Heteroarylheteroalkyl" means a heteroaryl-heteroalkyl- group in which the heteroaryl and heteroalkyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the heteroalkyl group.

[0118] "Heteroaryloxy" refers to a heteroaryl-O- group in which the heteroaryl is as defined herein. Preferably the heteroaryloxy is a C1-C18heteroaryloxy. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the oxygen atom.

[0119] “Heterocyclic” refers to saturated, partially unsaturated or fully unsaturated monocyclic, bicyclic or polycyclic ring system containing at least one heteroatom selected from the group consisting of nitrogen, sulfur, and oxygen as a ring atom. Examples of heterocyclic moieties include heterocycloalkyl, heterocycloalkenyl and heteroaryl.

[0120] "Heterocycloalkenyl" refers to a heterocycloalkyl group as defined herein but containing at least one double bond. A heterocycloalkenyl group typically is a C2- C12heterocycloalkenyl group. The group may be a terminal group or a bridging group.

[0121] "Heterocycloalkyl" refers to a saturated monocyclic, bicyclic, or polycyclic ring containing at least one heteroatom selected from nitrogen, sulfur, oxygen, preferably from 1 to 3 heteroatoms in at least one ring. Each ring is preferably from 3 to 10 membered, more preferably 4 to 7 membered. Examples of suitable heterocycloalkyl substituents include pyrrolidyl, tetrahydrofuryl, tetrahydrothiofuranyl, piperidyl, piperazyl, tetrahydropyranyl, morphilino, 1,3-diazapane, 1,4-diazapane, 1,4-oxazepane, and 1,4-oxathiapane. A heterocycloalkyl group typically is a C2-C12heterocycloalkyl group. The group may be a terminal group or a bridging group.

[0122] "Heterocycloalkylalkyl" refers to a heterocycloalkyl-alkyl- group in which the heterocycloalkyl and alkyl moieties are as defined herein. Exemplary heterocycloalkylalkylgroups include (2-tetrahydrofuryl)methyl, (2-tetrahydrothiofuranyl) methyl. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkyl group.

[0123] "Heterocycloalkylalkenyl" refers to a heterocycloalkyl-alkenyl- group in which the heterocycloalkyl and alkenyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the alkenyl group.

[0124] "Heterocycloalkylheteroalkyl" means a heterocycloalkyl-heteroalkyl- group in which the heterocycloalkyl and heteroalkyl moieties are as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the heteroalkyl group.

[0125] "Heterocycloalkyloxy" refers to a heterocycloalkyl-O- group in which the heterocycloalkyl is as defined herein. Preferably the heterocycloalkyloxy is a C1- C6heterocycloalkyloxy. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the oxygen atom.

[0126] "Heterocycloalkenyloxy" refers to a heterocycloalkenyl-O- group in which heterocycloalkenyl is as defined herein. Preferably the Heterocycloalkenyloxy is a C1-C6 Heterocycloalkenyloxy. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the oxygen atom.

[0127] “Hydroxyalkyl” refers to an alkyl group as defined herein in which one or more of the hydrogen atoms has been replaced with an OH group. A hydroxyalkyl group typically has the formula CnH(2n+1-x)(OH)x. In groups of this type n is typically from 1 to 10, more preferably from 1 to 6, most preferably 1 to 3. x is typically 1 to 6, more preferably 1 to 3.

[0128] "Sulfinyl" means an R-S(=O)- group in which the R group may be OH, alkyl, cycloalkyl, heterocycloalkyl; aryl or heteroaryl group as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the sulfur atom.

[0129] "Sulfinylamino" means an R-S(=O)-NH- group in which the R group may be OH, alkyl, cycloalkyl, heterocycloalkyl; aryl or heteroaryl group as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the nitrogen atom.

[0130] "Sulfonyl" means an R-S(=O)2- group in which the R group may be OH, alkyl, cycloalkyl, heterocycloalkyl; aryl or heteroaryl group as defined herein. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the sulfur atom.

[0131] "Sulfonylamino" means an R-S(=O)2-NH- group. The group may be a terminal group or a bridging group. If the group is a terminal group, it is bonded to the remainder of the molecule through the nitrogen atom.

[0132] It is understood that included in the family of compounds of Formula (I) are isomeric forms including diastereoisomers, enantiomers, tautomers, and geometrical isomers in "E" or "Z" configurational isomer or a mixture of E and Z isomers. It is also understood that some isomeric forms such as diastereomers, enantiomers, and geometrical isomers can be separated by physical and / or chemical methods and by those skilled in the art. For those compounds where there is the possibility of geometric isomerism the applicant has drawn the isomer that the compound is thought to be although it will be appreciated that the other isomer may be the correct structural assignment.

[0133] Some of the compounds of the disclosed embodiments may exist as single stereoisomers, racemates, and / or mixtures of enantiomers and / or diastereomers. All such single stereoisomers, racemates and mixtures thereof, are intended to be within the scope of the subject matter described and claimed.

[0134] Additionally, Formula (I) is intended to cover, where applicable, solvated as well as unsolvated forms of the compounds. Thus, each formula includes compounds having the indicated structure, including the hydrated as well as the non-hydrated forms.

[0135] The term "pharmaceutically acceptable salts" refers to salts that retain the desired biological activity of the above-identified compounds and include pharmaceutically acceptable acid addition salts and base addition salts. Suitable pharmaceutically acceptable acid addition salts of compounds of Formula (I) may be prepared from an inorganic acid or from an organic acid. Examples of such inorganic acids are hydrochloric, sulfuric, and phosphoric acid. Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, heterocyclic carboxylic and sulfonic classes of organic acids, examples of which are formic, acetic, propanoic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, fumaric, maleic, alkyl sulfonic, arylsulfonic. In a similar vein, base addition salts may be prepared by ways well known in the art using organic or inorganic bases. Example of suitable organic bases include simple amines such as methylamine, ethylamine, triethylamine, and the like. Examples of suitable inorganic bases include NaOH, KOH, and the like. Additional information on pharmaceutically acceptable salts can be found in Remington's Pharmaceutical Sciences, 19th Edition, Mack Publishing Co., Easton, PA 1995. In the case of agents that are solids, it is understood by those skilled in the art that the inventive compounds, agents, and salts may exist in different crystalline or polymorphic forms, all of which are intended to be within the scope of the present invention and specified formulae.

[0136] The term "therapeutically effective amount" or "effective amount" is an amount sufficient to effect beneficial or desired clinical results. An effective amount can be administered in one or more administrations. An effective amount is typically sufficient to palliate, ameliorate, stabilize, reverse, slow or delay the progression of the disease state.

[0137] The present invention relates to a compound having the general structure of Formula (I) F* – L – X (I) wherein F* is a pH sensitive fluorophore; L is an optional linker group; and X is a targeting moiety.

[0138] In the compound of Formula (I), the fluorophore F* is any suitable fluorophore and particularly a pH-sensitive fluorophore. In some embodiments, the fluorophore F* has the structurewherein n is an integer that is 1 or 2; and wherein each R1is an independently selected optionally substituted functional group.

[0139] In some preferred embodiments, the fluorophore F* is selected from the group consisting ofwherein each R1is an independently selected optionally substituted functional group.

[0140] In some preferred embodiments of the fluorophore, each R1is an independently selected optionally substituted C1-C12alkyl, C1-C12haloalkyl, C2-C12alkenyl, C2-C12alkynyl, C1- C10heteroalkyl, C3-C12cycloalkyl, C3-C12cycloalkenyl, C1-C12heterocycloalkyl, C1- C12heterocycloalkenyl, C1-C12alkylamino, C1-C12alkyloxy, C1-C12alkyloxycarbonyl, and C1- C6alkyloxycarbonylC1-C6alkyl.

[0141] Preferably, each R1is an independently selected optionally substituted C1-C12 alkyl group. More preferably, each R1is an independently selected methyl, ethyl, propyl, butyl, pentyl or hexyl group. Preferably, each R1is an ethyl group.

[0142] In some preferred embodiments, the fluorophore F* is.

[0143] In some the fluorophore F* is selected from the group consisting

[0144] In the compound of Formula (I), the linker group L is optional. In some embodiment of the present invention, linker group L is absent. In some embodiment of the present invention, linker group L is present. Any suitable linker group may be used with the present invention.

[0145] In some embodiments, the linker group L, if present, is selected from the group consisting of C1-C12alkyl, C1-C12alkyloxy, poly(C1-C12alkyloxy), C1-C12alkyloxycarbonyl, C1- C12alkyloxycarbonylC1-C12alkyl, C1-C12alkylaminocarbonyl, C1-C12alkylaminocarbonylC1- C12alkyl, poly(C1-C12alkyloxy)C1-C12alkyloxycarbonylC1-C12alkyl, and poly(C1-C12alkyloxy)C1- C12alkylaminocarbonylC1-C12alkyl. In some preferred embodiments, the linker group L, if present, is selected from the group consisting of C1-C12alkyl, C1-C6alkyloxy, poly(C1- C6alkyloxy), C1-C6alkyloxycarbonyl, C1-C6alkyloxycarbonylC1-C6alkyl, C1- C6alkylaminocarbonyl, C1-C6alkylaminocarbonylC1-C6alkyl, poly(C1-C6alkyloxy)C1- C6alkyloxycarbonylC1-C6alkyl, and poly(C1-C6alkyloxy)C1-C6alkylaminocarbonylC1-C6alkyl.

[0146] In some preferred embodiments, the linker group L, if present, is selected fromwherein m and n are independently selected integers between 1 and 12, preferably between 1 and 6.

[0147] In some embodiments, the linker group L, if present, is a triazole of structure, wherein m and n are independently selected integers between 1 and 12, preferably between 1 and 6.

[0148] In some preferred embodiments, the linker group L, if present, is C1-

[0149] In some preferred embodiments, the linker group L, if present, is, wherein m is an integer between 1 and 12, preferably between 1 and 6.

[0150] In some preferred embodiments, the linker group L, if present, is, wherein m and n are independently selected integers between 1 and 12, preferably between 1 and 6.

[0151] In some preferred embodiments, the linker group L, if present, is, wherein m and n are independently selected integers between 1 and 12, preferably between 1 and 6.

[0152] In the compound of Formula (I), the targeting moiety X is any suitable autophagy- targeting chimera (ligands that target autophagy markers such as LC3) or anchoring moieties that target autophagic cargos such as organelles. In some embodiments, the targeting moiety X is selected from the group consisting of:

[0153] In some embodiments, the targeting moiety X is.

[0154] In some preferred embodiments, the compound of Formula (I) is a compound of Formula (II)wherein R3is selected from the group consisting of optionally substituted C1-C12alkyl, C1- C12alkenyl, C3-C12cycloalkyl, C3-C12cycloalkenyl, C6-C18aryl, C6-C18arylalkyl, cycloalkylalkenyl, C6-C18arylalkenyl, C1- and aminoC1- R3is selected from the group consisting

[0155] In some preferred embodiments, the compound of Formula (I) is a compound of Formula (III)

[0156] The compound of Formula (III) is also referred to as LD-AUTag1 herein.

[0157] In some preferred embodiments, the compound of Formula (I) is a compound of Formula (IV)

[0158] The compound of Formula (IV) is also referred to as ER-AUTag1 herein.

[0159] In some preferred embodiments, the compound of Formula (I) is a compound of Formula (V)

[0160] The compound of Formula (V) is also referred to as M-AUTag1 herein.

[0161] In some preferred embodiments, the compound of Formula (I) is a compound of Formula (VI)

[0162] The compound of Formula (VI) is also referred to as M-AUTag2 herein.

[0163] In some preferred embodiments, the compound of Formula (I) is a compound of Formula (VII)

[0164] The compound of Formula (VII) is also referred to as AUTag1 herein.

[0165] In a further aspect the present invention provides a fluorescent labelling composition comprising a compound of the invention.

[0166] In a further aspect the present invention provides a method of measuring autophagic activity in a cell sample comprising: a) contacting the sample with the fluorescent labelling composition; b) detecting fluorescence emitted by said composition and forming a readout therefrom.

[0167] In a further aspect the present invention provides a method of imaging body tissue comprising: a) applying an imaging composition to a subject, wherein said composition comprises a compound of the invention; b) detecting fluorescence emitted by said composition and forming a readout therefrom.

[0168] In a further aspect the present invention provides a method of identifying, selecting, or diagnosing a disease state in a subject, comprising the steps of: a) applying a fluorescent labelling composition to a cell sample or a body tissue of the subject, wherein said composition comprises a compound of the invention; and b) detecting fluorescence emitted by said composition and forming a readout therefrom, wherein the readout indicates a level of autophagic activity present in the cell sample or body tissue.

[0169] In some embodiments, the method further comprises comparing the level of autophagic activity present in the cell sample or body tissue with a reference level to determine an increased or decreased level of autophagic activity present in the cell sample or body tissue, wherein the increased or decreased level of autophagic activity present in the cell sample or body tissue compared to the reference level is indicative of a disease state or a stage of development of a disease state.

[0170] Preferably, the reference level of autophagic activity present in the cell sample or body tissue is the level of autophagic activity present in the cell sample or body tissue from a normal subject.

[0171] In some embodiments, the disease state is a condition associated with dysregulation of autophagy. In some embodiments, the autophagic activity is lipophagic activity. In some embodiments, the autophagic activity is macroautophagic activity. In some embodiments, the autophagic activity is mitophagic activity. In some embodiments, the autophagic activity is ER-phagic activity. Preferably, the disease state is selected from neurological disorders, cancer, cardiovascular disease, infectious disease, lysosomal storage disorder diseases, obesity and metabolic diseases. Preferably, the disease state is selected from idiopathic Parkinson’s disease (PD), genetic PD, myalgic encephalomyelitis / chronic fatigue syndrome (ME / CFS), Niemann-Pick disease, liver cancer, long COVID, Charcot- Marie-Tooth disease, Batten disease, Gaucher disease, and Fabry disease.

[0172] The detection of fluorescence maybe be by any suitable means described in the art. In certain embodiments, the detection step is performed by use of fluorescence spectroscopy or by the naked eye. Thus, in certain embodiments, the detection step is performed using a microscope. In further embodiments, the detection step is performed using a flow cytometer. In further embodiments, the detection step is performed using a plate reader. The readout can be any relevant quantification of fluorescence intensity.

[0173] The term “detect” is used herein to mean the act of viewing, inferring, indicating presence, measuring, etc., a target substance based on light emitted from the compound. Specifically, in some cases, the compound will be able to bind to a target substance within the sample and will emit luminescence when exposed to absorbed light. The presence of luminescence can indicate the presence of the target substance, while light intensity quantification can be used to measure the concentration of the target substance. In the context of the present invention, in some embodiments, the target substance is a population of autolysosomes. In some embodiments, the target substance is a population of LDs. In some embodiments, the target substance is a population of mitochondria. In some embodiments, the target substance is a population of ER.

[0174] The compounds of the present invention can have a wide range of absorption and emission properties. As the compounds of the present invention may comprise a variety of substituents around the core, embodiments of the compounds can include an absorption wavelength in the ultraviolet to near infrared spectrum. Particular embodiments of the present compounds are from about 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 600 nm, 700nm, 800 nm, 900 nm, 1000 nm, or any value therebetween. A selected absorption wavelength can be included. In certain embodiments, the compound comprises an absorption wavelength of about 1000 nm or greater. When activated, the compounds can emit detectable luminescence. The wavelength of emission can be changed by substitution of the base compound. In certain embodiments, the emission wavelength is about 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 600 nm, 700 nm, 800 nm, 900 nm, 1000 nm, or any value therebetween. Including a wavelength of about 100 nm to about 1000 nm.

[0175] In some embodiments, the method of identifying, selecting, or diagnosing a disease state in a subject, further comprises administering to the subject a therapeutically effective amount of an anti-disease state therapeutic.

[0176] In a further embodiment, the invention provides a pharmaceutical composition comprising a pharmaceutically acceptable salt of a compound of the invention, and a pharmaceutically acceptable excipient.

[0177] In a further embodiment, the invention provides a compound of the invention for use in the identification, treatment, prevention, or amelioration of a condition associated with dysregulation of autophagy. In some embodiments, the condition is associated with dysregulation of macroautophagy, lipophagy, mitophagy, or ER-phagy.

[0178] In a further embodiment, the invention provides a method of identifying, preventing, treating, or ameliorating a condition associated with dysregulation of autophagy, said method comprising administering to a patient in need thereof a therapeutically effective amount of a compound of the invention. In some embodiments, the condition is associated with dysregulation of macroautophagy, lipophagy, mitophagy, or ER-phagy.

[0179] In a further embodiment, the invention provides a use of a compound of the invention in the manufacture of a medicament for the identification, treatment, prevention, or amelioration of a condition associated with dysregulation of autophagy. In some embodiments, the condition is associated with dysregulation of macroautophagy, lipophagy, mitophagy, or ER-phagy.

[0180] In some preferred embodiments, the condition is selected from neurological disorders, cancer, cardiovascular disease, infectious disease, lysosomal storage disorder disease, obesity and metabolic diseases. Preferably, the condition is selected from idiopathic Parkinson’s disease (PD), genetic PD, myalgic encephalomyelitis / chronic fatigue syndrome (ME / CFS), Niemann-Pick disease, liver cancer, long COVID, Charcot-Marie-Tooth disease, Batten disease, Gaucher disease, and Fabry disease.

[0181] In a further embodiment, the invention provides a method for the manufacture of a compound of Formula (I). In further embodiments, the compound of Formula (I) is obtainable by the methods described in the ‘Examples’ section hereinafter. Examples

[0182] The invention will now be further explained and illustrated by reference to the following non-limiting examples.

[0183] The invention will now be further explained and illustrated by reference to the following non-limiting examples. Additional compounds, other than those described below, may be prepared using methods and synthetic protocols or appropriate variations or modifications thereof, as described herein.

[0184] The agents of the various embodiments may be prepared using the reaction routes and synthesis schemes as described below, employing the techniques available in the art using starting materials that are readily available. The preparation of particular compounds of the invention is described in detail in the following examples, but the skilled addressee will recognize that the chemical reactions described may be readily adapted to prepare a number of other agents of the various embodiments. For example, the synthesis of non-exemplified compounds may be successfully performed by modifications apparent to those skilled in the art, e.g., by appropriately protecting interfering groups, by changing to other suitable reagents known in the art, or by making routine modifications of reaction conditions. A list of suitable protecting groups in organic synthesis can be found in T.W.Greene's Protective Groups in Organic Synthesis, 3rdEdition, John Wiley & Sons, 1991. Alternatively, other reactions disclosed herein or known in the art will be recognized as having applicability for preparing other compounds of the various embodiments.

[0185] Reactions can be monitored according to any suitable method known in the art. For example, product formation can be monitored by spectroscopic means, such as nuclear magnetic resonance spectroscopy (e.g.,1H or13C), infrared spectroscopy, spectrophotometry (e.g., UV-visible), or mass spectrometry, or by chromatography such as high-performance liquid chromatography (HPLC) or thin layer chromatography (TLC).

[0186] Reagents useful for synthesizing compounds may be obtained from commercial suppliers or prepared according to techniques known in the art.

[0187] The symbols, abbreviations and conventions in the processes, schemes, and examples are consistent with those used in the contemporary scientific literature.

[0188] Unless otherwise indicated, all temperatures are expressed in °C (degree centigrade). All reactions conducted at room temperature unless otherwise mentioned. The expressions, “ambient temperature,” “room temperature,” and “r.t.”, as used herein, are understood in the art, and refer generally to a temperature, e.g., a reaction temperature, that is about the temperature of the room in which the reaction is carried out, for example, a temperature from about 20 ºC to about 30 ºC. Results and Discussion of an LC3 Probe for Bulk Autophagy:

[0189] To validate the specificity of AUTag1, we firstly used recombinant LC3B protein as an in vitro model. The mutated LC3B G120C was conjugated with DSPE-MI using Michael-thiol addition to mimic lipidated LC3B, LC3B G120C-DSPE (Figure 1A). Measurement of fluorescence via the plate reader demonstrated specific turn-on effect of AUTag1 in the presence of LC3B G120C-DSPE but not for other analytes (Figure 1B). Next, removal of LC3-targeting ligand on AUTag1 yielded the reference dye, which lost the puncta staining pattern that originally presented in the green channel of AUTag1 (Figure 2A). In rapamycin treated MEFs, it was also found that signals of LC3-GFP overlapped with the green channel of AUTag1 (Figure 2B), where the excess AUTag1 signals were ascribed to the labelling of endogenous LC3 without the GFP tag. These results confirm the specificity of AUTag1 with the LC3 protein in cells.

[0190] The introduction of a pH-sensitive fluorophore into the molecular design enables the discrimination between autophagosomes and acidic autolysosomes under fluorescence microscope. Autophagy induction by rapamycin and amino acid starvation (EBSS) resulted in the enhancement of signals in both green and red channels of AUTag1 (Figure 3A), suggesting the increase of AV number and autophagic flux in cells. Compared to EBSS-only group, inhibition of PI3K by wortmannin showed elimination of both green and red puncta, resulted from the blockage of the whole autophagy process (Figure 3A). On the other hand, inhibition of lysosomes by CQ caused the failure in fusion of autophagosomes and lysosomes, and hence led to accumulation of AVs in the green channel and dim signals in the red channel of AUTag1 (Figure 3A). By colocalizing the two channels of AUTag1, different types of AVs are distinguishable (Figure 3B).

[0191] Furthermore, the protocol based on plate reader for high-throughput quantitative analysis of cellular autophagy index has been established. The autophagy index is calculated by the percentage of normalized intensity in red channel in the sum of normalized intensity in both red and green channels, as to show the amount of LC3-II that has been delivered into the lysosomes. The quantitation capability of AUTag1 was validated under conditions that induce or inhibit autophagy, as well as with controversial drugs (Figure 3C).

[0192] By virtue of AUTag1, the role of several genes of D. discoideum were identified and confirmed, highlighting the impact of Atg1, Ampk, Torc1, and Polycystin-2 on cellular basal autophagy in vegetative D. discoideum (Figure 4). This tool was also applied in a long covid simulative models, which yielded significant differences in terms of autophagic dynamics between long covid peptide treated cells and the control peptide treated counterpart (Figure 5).

[0193] In this example, by incorporating an autophagy-targeting chimera, a fluorescent chemical probe, AUTag1 (Formular (VII)), that is highly specific to autophagy marker was synthesised. Compared to conventional methods that only evaluate the average autophagic flux within certain period, AUTag1 provides a robust tool to quantify cellular autophagy dynamics in situ and in real-time. Discussion and Summary of Lipophagy Probes:

[0194] After successful synthesis of LD-AUTag1, we then proceeded to inspect its photophysical properties. Measurement of absorbance spectra showed a decrease of absorbance at 423 nm in pH lower than 5.48 (Figure 6A). This was resulted from enhanced donor-acceptor properties by the protonation of the quinoline in the pH range 4.33 – 5.48. By plotting the absorbance trend at 423 nm, we determined the pKa for LD-AUTag1 to be 4.81 (Figure 6A), which is within the pH range in lysosomal lumen (pH 4.5-5.0). Next, we interrogated the spectral response of LD-AUTag1 to viscosity in the water-glycerol system. Following with the rise of glycerol percentages in the cosolvent systems, there was a significant enhancement of fluorescence from LD-AUTag1 (Figure 6B) and its protonated product (Figure 6C). Specifically, fluorescence of LD-AUTag1 and its protonated product was dim in low viscous water but had a drastic turn-on (>200 folds) in 98.9% glycerol (Figure 6B- C), which, to some extent, eliminates the background signals in aqueous buffers and favors for the biological applications. These phenomena can be interpreted by restricted intramolecular rotation (RIR) in high viscosity environments, which constrain the rotational motions of the single bonds and excited-state C=C double bonds and thus minimise the nonradiative energy loss.

[0195] With the photophysical properties being tested, we then sought to explore the applications of LD-AUTag1 in cells. The commercial dead cell staining, TO-PRO-3, showed that LD-AUTag1 posed no significant cytotoxicity to both MEFs and HeLa cells at concentrations of up to 6.5 µM for 0.5 – 24 h staining time periods, with cell viability of all experimental groups above 90% (Figure 7). Next, to confirm the cellular localization of LD- AUTag1, adipose differentiation-related protein (ADRP), a LD associated protein, fused with green fluorescence protein (GFP) was used as the marker of intracellular neutral LDs. In HeLa cells expressing ADRP-GFP, airy scan showed LD-AUTag1-stained spherical structures surrounded by ADRP-GFP, with a remarkable increase in number upon oleic acid (OA) treatment (Figure 8). This evidently demonstrated that LD-AUTag1 specifically stains the hydrophobic cores of cellular LDs.

[0196] It has been well characterized that under mild starvation, where only serum, but not amino acids and glucose, is depleted, lipophagy can be significantly induced. EBSS starved cells, conversely, end up with accumulation of LDs, most of which primarily undergo cytoplasmic lipolysis for cellular energy supply. Moreover, EBSS treatment stimulates autophagy and further leads to the upregulation of lysosomal activity, while lipophagy remains not activated. With these two discriminable models for lipophagy and lipolysis, we performed colocalization studies among LD-AUTag1, BODIPY and LysoView 633. LysoView 633 was used here as the lysosome indicator, which stained all lysosomes in cells, while BODIPY was used for LD staining. These two commercial stains were chosen because their excitation / emission wavelengths fit in the channels where there was minimal signal crosstalk with LD-AUTag1. Consistent with the previous reports, the green channel of LD-AUTag1 showed more LDs in EBSS-starved MEFs, and these green granules well colocalized with BODIPY staining (Figure 9A). On the other hand, the red channel indicating the localization of LD-AUTag1-H+(protonated product of LD-AUTag1 in acid environment) was hardly seen in MEFs under EBSS starvation (Figure 9A), of which lipophagy was negligible observed by rare colocalization between BODIPY and LysoView 633. By contrast, MEFs with serum starvation (-FBS) had nearly no LDs in cells, as shown by dim green signals from LD-AUTag1, whereas the red channel of LD-AUTag1-H+was significantly increased and coexisted with both BODIPY and LysoView 633. Meanwhile, the overlap between the BODIPY and LysoView 633 signals in cells under serum depletion confirms the significantly higher lipophagy levelscompared to the EBSS group. These results confirm the specificity of LD-AUTag1 to lipophagy.

[0197] To explore the impact of lysosomal pH on fluorescence signals from LD-AUTag1- H+, we further applied NH4Cl for cell treatment to inhibit the lysosomal acidification and degradation flux. As shown in Figure 9B, the intensity of LysoView 633 remained nearly unchanged in NH4Cl treated cells (Figure 9B). Nevertheless, LD-AUTag1-H+exhibited greatly enhanced fluorescence (Figure 9B-C) in NH4Cl-induced lysosomal dysfunction and highlighted the enlargement of damaged lysosomes which were suspected to comprise accumulated LD components through basal lipophagy pathway during the 24-h treatment period. The contrast between signals from LysoView 633 and LD-AUTag1-H+in NH4Cl- treated cells indicated that the fluorescence intensity of LD-AUTag1-H+is not reliant on lysosomal pH. Instead, the amount of LD components in lysosomes, which implies the levels of lipophagic flux, appears to determine the fluorescence of LD-AUTag1-H+.

[0198] With the lipophagy reporter in hand, profiling of the transient lipophagic flux in cells with a range of treatments was established. Flow cytometry analysis of cellular LD- AUTag1-H+fluorescence signals showed that the transient lipophagic flux in MEFs with short term (6 h) EBSS starvation was significantly downregulated compared to that of fed cells (Figure 10A), in line with the previous report (Developmental Cell, 2015, 32, 678–692). However, 24-h EBSS starvation of MEFs led to slightly increase in the lysosomal LDs (Figure 10B), which was likely ascribed to activation of microlipophagy under prolonged starvation. The induction of lipophagy in MEFs occurs when the percentage of FBS in the culturing medium is less than 6%, with greatly enhanced cellular lipophagy activities when percentage of FBS is less than 1% (Figure 10C). Most of the ER stressors, including tunicamycin and brefeldin A, were able to trigger the cellular lipophagy (Figure 10A-B). As one of the mechanisms for stress response, ER tended to boost the excretion of LDs to cast off the backlog of unfolded proteins, thereby promoting the lipophagic flux. Besides, general macroautophagy inducers, like LiCl, torin2, rapamycin, carbonyl cyanide m-chlorophenyl hydrazone (CCCP) etc., accelerated the lysosomal transportation of LDs but not hindered the breakdown and hydrolysis of cargo, resulting in the small enhancement of transient lipophagic flux with significant differences vs the untreated group (Figure 10A-B). The effects of lipopolysaccharide (LPS) on cellular lipophagy were found limited in MEFs (Figure 10B). Moreover, intensive treatments of deferiprone (DFP) and H2O2elicited not only high levels of acidic LD components but also markedly enlargement of lysosomal volumes, reflecting by approximately 4-fold increase of LD-AUTag1-H+signals in flow cytometric analysis (Figure 10B). Iron chelation by DFP, mimicking hypoxia, was previously reported to induce sequential selective autophagy, such as mitophagy, pexophagy and ferritinophagy. Here, our observations further expanded the consequences of DFP treatment to lipophagy induction and lysosomal dysfunction (Figure 10B), similar to H2O2that has already been known to enhance autophagic activities but to devastate lysosomes.

[0199] In terms of the lipophagy downregulation, several autophagy inhibitors were tested in combination with serum depletion condition. Supporting the role of PI3K and autophagosome-lysosome fusion in the upstream of autophagy machinery, cells with wortmannin or bafilomycin A1treatments exhibited significantly lower LD-AUTag1-H+signals (Figure 10A-B), as these treatments hindered the transportation of LDs into lysosomes. However, starving cells treated by compounds that inhibit or decrease lysosomal functions, lalistat 1 (lysosomal acid lipase inhibitor), E64d / pepstatin A (lysosomal protease inhibitor), chloroquine (lysosomotropic deprotonated weak base) and NH4Cl, amassed lysosomal LDs that could not be hydrolyzed, resulting in the enhancement of LD-AUTag1-H+signals (Figure 10B). The degree of signal changes also implies that proteases play a more important role than lipases for LD degradation via lipophagy. Moreover, combining the serum starvation with microtubule destabilizers, vinblastine or nocodazole, resulted in greatly increase of LD-filled lysosomes (Figure 10B). It seemed that upon serum starvation, they failed in halting the transportation of LDs into lysosomes as well as impeded the lysosomal degradative function,resulting in the backlog of lumenal LD components. Overall, LD-AUTag1 has demonstrated its broad and potent applicability for LD metabolism studies in cell-based experiments.

[0200] D. discoideum is a species of amoeba that bridges the unicellular-to-multicellular transition. upon nutrient restriction this species aggregates into a multicellular organism, differentiating and forming a spore that regerminates in conditions favorable to growth (Figure 11A-B). It has been well studied that autophagy plays a role in this development process. We engineered vegatative D. discoideum with overexpression (OE) or knockdown (KD) of Ampk / Torc1, and applied LD-AUTag1 to detect lipophagy under basal and development conditions. Compared to their counterparts, flow cytometric quantification shows that OE of Ampk and KD of Torc1 can significantly provoke basal lipophagy (Figure 11C-D). During the development triggered by amino acid starvation, the cellular level of lipophagy experienced a significant decline (Figure 11C-D), which was likely because cells tend to switch from lipophagy to lipolysis to support the energy consumption while migrating. After overnight starvation, D. discoideum from all groups formed slugs, and LD-AUTag1 revealed two populations of cells: one still had low lipophagy activities, while another one exhibited elevated level of lipophagy (Figure 11C-D). Confocal imaging showed that these lipophagy hyperactive cells were mainly from the slugs (Figure 11C).

[0201] Zebrafish is another model organism of interest, which features transparency and external embryonic development, making it one of the most suitable for in vivo live imaging. We treated zebrafish at 6 dpf with various drugs to create models for lipophagy inhibition, induction, and lysosomal dysfunction. Zebrafish larvae were then imaged post treatment, and lipophagy levels in different types of tissue were quantified as the corrected total cell fluorescence (CTCF) of LD-AUTag1-H+within specific regions of interest. Consistent with cellular experiments, the intensity of LD-AUTag1-H+decreased in larvae treated by autophagy inhibitors, 3-MA or bafilomycin A1, but increased in larvae upon lipophagy induction by rapamycin or torin2 (Figure 12A-C). Likewise, cotreatment of the autophagy inducer rapamycin with lysosomal protease inhibitors E64d / pepstatin A resulted in much higher LD-AUTag1-H+intensity compared to the corresponding solo treatments (Figure 12A- C), due to the increased input of lipophagy cargo but limited degradation function of lysosomes. On the other hand, the tendency of cellular responses towards these treatments was similar cross different types of tissue, ranging from RPE, intestine and skin (Figure 12A- C). There were distinctive basal lipophagy levels observed in different tissue (Figure 12A-C); and cells from intestine exhibited the acutest fluctuation upon lipophagy modulation (Figure 12B).

[0202] The excellent performance and versatility of LD-AUTag1 then inspired us to further broad its utility in studies of diseases. We started with one of the lysosomal storage disorder diseases, NP-C1, based on the ability of LD-AUTag1-H+in lighting up lysosomal dysfunction. Firstly, a chemical inhibitor, U18666A, of NPC1 was used in MEFs and results showed that intensity of LD-AUTag1-H+increased with prolonged treatment (Figure 13A), as expected. This assay was further applied to primary mouse CTLs with Npc1 KO. Interestingly, in the CRISPR KO group of CTLs (Figure 13B), we observed a decent separation between population with or without successful KO, indicating a KO efficiency around 62.7% (Figure 13C). The LD-AUTag1-H+ negpopulation in the KO group was found consistent with the control group treated by non-targeted guide RNA (Figure 13C). Airy scan imaging showed significant lysosomal lipid cumulant in LD-AUTag1-H+ poscells, along with swelling lysosomal morphology (Figure 13D); whereas LD-AUTag1-H+ negcells in both non-targeted and KO group showed dimmer signals in smaller dotted lysosomes possessing healthy morphology (Figure 13D). Note that this phenomenon was not due to the difference in dye uptake between KO and control cells as the green channel of LD-AUTag1 presented similar intensity (Figure 13D).

[0203] In another model, crossbreeding WT mouse with Npc1- / -mouse yielded siblings with phenotypes of WT (Npc1+ / +), heterozygote (Npc1+ / -), and Npc1 KO (Npc1- / -) (Figure 14A). Differing to the CRISPR KO system, the majority of CTLs isolated from Npc1 KO mice were LD-AUTag1-H+ pos, featuring unhealthy lysosome morphology (Figure 14B-C). Quantitativeanalysis of three biological replicates revealed a huge gap of LD-AUTag1-H+intensity between Npc1+ / +and Npc1- / -cells, with a ~3 fold increase in the Npc1- / -group (Figure 14D). To our surprise, a delicate difference between Npc1+ / +and Npc1+ / -could also be observed by virtue of LD-AUTag1-H+(Figure 14D). Finally, LD-AUTag1-H+was utilized to evaluate the therapeutic effect of HPβCD towards NP-C1. Primary CTLs isolated from Npc1- / -mice were subjected to culturing with or without the presence of HPβCD (Figure 14E). The HPβCD treated cells showed, to some extent, ease of symptoms by relatively smaller lysosomal volume (Figure 14F) and lower LD-AUTag1-H+intensity (Figure 14G), indicating the reduction in lysosomal lipid cumulant. These results highlight the capability of LD-AUTag1 in identifying cells with lysosomal storage disorder and evaluating drug effects on cells with lysosomal dysfunction, suggesting a potential application of LD-AUTag1 for diagnosis and treatment monitoring of lysosomal storage disorders.

[0204] LD-AUTag1 was further applied to study the lipophagy dynamics in Parkinson’s disease (PD). Our preliminary test using lymphoblasts revealed that while the basal lipophagy levels were relatively low in PD cells, particularly for LRRK2 mutated groups (Figure 15), prolonged serum starvation resulted in a profound accumulation of acidic LDs particularly in LRRK2 mutated PD, suggesting a malfunction of lysosomal lipid degradation in this group (Figure 15). This result also suggests a potential stress induced method for PD diagnosis and differentiation.

[0205] In this example, we optimized the lipophilic substitutions of a pH-sensitive fluorescent scaffold (Formular (II)) to yield a lipophagy reporter. The resultant probe, referred to as LD-AUTag1 (Formular (III)), possesses pH- and viscosity- dual sensitivity. The green channel of LD-AUTag1 indicates the location of neutral LDs in cells, which can be red shifted in LD-filled lysosomes as an indicator of lipolysosomes. By quantitative analysis of the transient lipophagic flux in cells under various conditions, LD-AUTag1 was found applicable for differentiating treatments that increase or decrease cellular lipophagy levels. LD-AUTag1 staining also highlighted the lysosomal backlog of LD components, a hallmark of lysosome dysfunction, by dramatic increase of lysosomal volumes and fluorescent intensity. Furthermore, the application scope of LD-AUTag1 was further expanded to Dictyostelium discoideum and zebrafish. Facilitated by LD-AUTag1, we identified and confirmed the role of lipophagy in starvation induced cell aggregation of Dictyostelium discoideum, highlighting the impact of key components, Ampk and Torc1, on this process. Also, quantification of LD- AUTag1-H+signals in zebrafish reveal distinctive responses of different tissues towards in terms of lipophagy dynamics upon various drug treatments. Moreover, utilizing LD-AUTag1, the visualization and early diagnosis of lysosomal storage disorder disease, e.g. Niemann- Pick disease type C1 (NP-C1), is made possible in live primary blood cells, for the first time. The high sensitivity of LD-AUTag1 towards NP-C1 enables a decent population separation between disease and wide type cells; and its signal is even discriminable between cells from heterozygote and wide type donors, which was not possible with traditional Filipin staining that possesses extremely poor photostability. We also applied this newly developed tool in a multitude of clinical samples driven from patients idiopathic Parkinson’s disease (PD) and genetic PD, which yielded significant differences in terms of autophagic dynamics between patients’ cells and healthy counterparts. Collectively, our data demonstrate the applicability of LD-AUTag1 in quantifying lipophagy and highlighting lysosomal damages, in multiple organisms and disease models.

[0206] The performance of another lipophagy probe, LD-AUTag2, is rather similar to LD- AUTag1, though its intracellular fluorescence intensity is lower. LD-AUTag2 possesses negligible cytotoxicity in MEFs and HeLa cells at concentrations of up to 6.5 µM for 0.5 – 24 h staining time periods, with cell viability of all experimental groups above 90% (Figure 16). The staining of LD-AUTag2 localizes in LDs (Figure 17) and like LD-AUTag1, LD-AUTag2 can also be used for lipophagy quantification in live cells using flow cytometry (Figure 18).Discussion and Summary of Other Probes:

[0207] M-AUTag1 & 2 were designed and synthesized to target lysosomal degradation of membrane-bound organelles, mainly mitochondria, ER, and Golgi. The green channel of these two dyes showed a staining pattern of cellular membrane systems, and the red channel highlighted the active lysosomal activities (Figure 19). The quantitative capability of M- AUTag1 in mitophagy measurement was validated in Parkin overexpressing HeLa cells. In WT HeLa, the cotreatment of oligomycin and antimycin (O / A) had nearly no effect in inducing mitophagy (Figure 20A-B), as O / A can only induce PINK / Parkin-dependent mitophagy. Whereas in Parkin overexpressing HeLa cells, the majority (92.5%) of cells were found mitophagy-active, revealed by M-AUTag1 (Figure 20A-B). Likewise, there were more Parkin- expressing cells exerting mitophagy upon CCCP treatment than WT cells (Figure 20A-B). Quantitative analysis of M-AUTag1 signals revealed effective mitophagy inducers in Parkin- expressing HeLa cells (Figure 20C), collectively demonstrating the potential of M-AUTag1 in mitophagy quantification.

[0208] ER-AUTag1 comprising of the pH-sensitive fluorophore and ER-targeting unit showed green signals mainly in ER and red signals in lysosomes (Figure 21). In a short-term (2 h) starvation model, amino acid starvation (EBSS) was found to activate cellular ER-phagy, while the serum starved (-FBS) cells remain not alternated in terms of ER-phagy, evidenced by the intensity of red channel of ER-AUTag1 (Figure 21). General Chemical Experimental Techniques

[0209] All chemicals, unless otherwise stated, were commercially available and used without further purification. All reactions were carried out in oven-dried glassware under argon atmosphere and commercially available anhydrous solvents were used. TLC was carried out on pre-coated silica gel 60 F254(Merck) with visualization under UV light (UV 254 nm).1H and13C NMR spectra were recorded using 400 MHz Bruker AV3HD-400 spectrometer. The chemical shift data for each signal are given as δ in units parts per million (ppm) relative to tetramethylsilane (TMS, δ = 0 ppm) as the internal standard. For1H-NMR, the multiplicity for each peak is represented by: s (singlet), d (doublet), t (triplet), q (quartet), dd (doublet of doublets) and m (multiplet). The number of protons (n) for a given resonance signal is shown as nH. Coupling constants (J) are given in Hz and recorded to nearest 0.1 Hz. Mass spectrometry (MS) data were acquired using a Bruker HCT mass spectrometer operating in ESI (electrospray ionization) mode. Synthetic Schemes

[0210] As stated above there are a number of ways in which the compounds of the invention can be synthesized as would be appreciated by a person skilled in the art. Nevertheless, we provide a reaction scheme for making certain compounds of the invention in Schemes 1-4.Scheme 1 Compound 3 (Williamson ether synthesis):

[0211] A round bottom flask equipped with a magnetic stirring bar was charged with 4- 3,5-dibromo-4-hydroxybenzaldehyde (1) (1.68 g, 6.0 mmol, 1.0 equiv.), tert-butyl 2- bromoacetate (2) (1 mL, 7.2 mmol, 1.2 equiv.), K2CO3 (1.66 g, 12 mmol) in DMF (18 mL) and heated at 90oC. The resulting reaction mixture was kept under vigorous stirring until the consumption of 4-3,5-dibromo-4-hydroxybenzaldehyde (monitored by TLC analysis). After completion of the reaction, the mixture was extracted with ethyl acetate. The combined organic layers were dried over Na2SO4 and the solvent was removed under reduced pressure. The residue was purified by column chromatography on a silica gel (petroleum ether / ethyl acetate) to afford 3 (1.84 g, 78%) as a white solid.1H NMR (400 MHz, CDCl3): δ = 9.86 (s, 1H), 8.03 (d, J = 0.5 Hz, 2H), 4.60 (s, 2H), 1.53 (s, 9H).13C NMR (101 MHz, CDCl3): δ = 188.3, 166.3, 157.3, 134.4, 134.0, 119.0, 82.7, 69.6, 28.1. Compound 5 (Knoevenagel condensation):

[0212] To a solution of 3 (449 mg, 1.14 mmol, 1.0 equiv.) in EtOH (5.1 mL) was added 5- iodoindolin-2-one (4) (310 mg, 1.20 mmol, 1.05 equiv.) and piperidine (12 µL, 0.114 mmol, 0.1 equiv.) at room temperature. Then the reaction was heated at reflux for 3 h. After completion of the reaction, the resultant precipitate was filtered and washed by cold ethanol to afford 5 (695 mg, 96%) as a yellow solid without further purification. Compound 6:

[0213] To a suspension of compound 5 (381 mg, 600 µmol) in DCM (8 mL) was added TFA (2 mL) and the reaction mixture was stirred at RT for 1 h. Then the resultant precipitate was filtered and washed by diethyl ether to afford 6 (323 mg, 93%) as an orange solid without further purification.1H NMR (400 MHz, DMSO-d6): δ = 10.82 (s, 1H), 8.77 (s, 2H), 8.03 (s, 1H), 7.84 (s, 1H), 7.55 (dd, J = 8.1, 1.3 Hz, 1H), 6.69 (d, J = 8.1 Hz, 1H), 4.59 (s, 2H).13C NMR (101 MHz, DMSO-d6): δ = 169.0, 167.0, 153.3, 141.0, 138.0, 136.6, 134.9, 133.6, 128.9, 127.5, 127.4, 117.4, 112.5, 84.7, 69.3. Compound 8:

[0214] To a solution of compound 7 (285 mg, 600 µmol) in DCM (8 mL) was added TFA (2 mL) and the reaction mixture was stirred at RT for 1 h. After completion of the reaction, solvents were removed under reduced pressure. Diethyl ether was added to the residue and then the resultant precipitate was filtered and washed by diethyl ether. The crude (TFA salt) was then worked up using DCM and saturated NaHCO3solution. The organic layer was collected and dried over Na2SO4. The solvent was removed under reduced pressure to afford8 (160 mg, 71%) as a yellow solid, which was directly used in the next step without further purification.1H NMR (400 MHz, DMSO-d6): δ = 8.67 (d, J = 9.2 Hz, 1H), 8.25 – 8.15 (m, 2H), 8.12 (d, J = 8.1 Hz, 1H), 8.04 (d, J = 8.4 Hz, 1H), 7.98 – 7.82 (m, 3H), 7.71 (t, J = 7.4 Hz, 1H), 7.58 (d, J = 8.8 Hz, 1H), 7.31 (d, J = 16.2 Hz, 1H), 6.47 (d, J = 8.5 Hz, 1H), 6.25 (s, 1H), 4.25 (t, J = 5.9 Hz, 2H), 3.47 (dd, J = 14.0, 7.1 Hz, 4H), 3.09 (d, J = 6.6 Hz, 2H), 2.23 – 2.12 (m, 2H), 1.16 (t, J = 7.0 Hz, 6H). AUTag1 (amide coupling):

[0215] To a glass tube was charged with compound 6 (41 mg, 70 µmol, 1.0 eqiv.), 8 (55 mg, 147 µmol, 2.1 eqiv.), PyClock (116 mg, 210 µmol, 3.0 eqiv.), DIPEA (91 µL, 68 µmol, 7.5 eqiv.), and DMF (2 mL) and the reaction was stirred at RT for 8 h. After completion of the reaction, the mixture was extracted with ethyl acetate. The combined organic layers were dried over Na2SO4and the solvent was removed under reduced pressure. The residue was purified by column chromatography on a silica gel (DCM / MeOH) to afford AUTag1 (15.7 mg, 24%) as a dark red solid.1H NMR (400 MHz, DMSO-d6): δ = 10.80 (d, J = 25.2 Hz, 1H), 8.78 (s, 1H), 8.38 (dd, J = 12.1, 6.0 Hz, 1H), 8.22 (d, J = 8.5 Hz, 1H), 8.07 – 7.96 (m, 2H), 7.95 – 7.83 (m, 3H), 7.74 (d, J = 8.7 Hz, 1H), 7.70 – 7.52 (m, 4H), 7.49 – 7.42 (m, 1H), 7.20 (d, J = 16.2 Hz, 1H), 6.72 (dd, J = 17.8, 8.1 Hz, 1H), 6.34 (d, J = 8.6 Hz, 1H), 6.26 (s, 1H), 4.49 (d, J = 8.8 Hz, 2H), 4.16 (t, J = 5.6 Hz, 2H), 3.51 (s, 2H), 3.40 (dd, J = 14.0, 7.1 Hz, 4H), 2.11 (s, 2H), 1.14 (t, J = 6.9 Hz, 6H).Scheme 2

[0216] A series of fluorophores were constructed by functionalizing the QBE core, Formula (II), featuring pH- and viscosity- dual sensitivity, with different hydrophobic LD- anchoring chains, including tert-butyl propylcarbamate (LD-AUTag1), ethyl benzene (LD- AUTag2), methyl cyclohexane (QBE-Cy6), and octane (QBE-8C) (Scheme 2).

[0217] The synthesis involved the etherification of phenol on 4- (diethylamino)salicylaldehyde (3), followed by the reaction with 2-methylquinoline through a Knoevenagel condensation to afford four final products (Scheme 2). The obtained intermediates and fluorophores were characterized by1H,13C NMR, and electrospray ionization mass spectrometry (ESI-MS). Compound 2 (Boc protection of amine):

[0218] 3-Bromopropylamine hydrobromide (6.6 g, 30 mmol, 1.0 equiv.) and triethylamine (3.4 g, 33 mmol, 4.6 mL, 1.1 equiv.) were dissolved in anhydrous dichloromethane (63 mL) and cooled to 0oC in a 250-mL round bottom flask under nitrogen. A solution of di-tert-butyl dicarbonate (6.6 g, 30 mmol, 6.9 mL, 1.0 equiv.) in dichloromethane (50 mL) was added dropwise to the above solution over 30 minutes. The resulting reaction mixture was allowed to warm to room temperature overnight. The reaction was then quenched with aqueous sodium hydroxide solution (25 mL, 5% w / w). The organic phase was washed with brine and then dried over anhydrous sodium sulfate. The solvent was removed in vacuo and afforded tert- butyl (3-bromopropyl)carbamate (2) as a white solid (5.8 g, 81%). The crude product wasused in further steps without purification.1H NMR (400 MHz, CDCl3): δ = 3.43 (t, J = 6.5 Hz, 2H), 3.27 (dd, J = 12.6, 6.4 Hz, 2H), 2.04 (p, J = 6.4 Hz, 2H), 1.44 (s, 9H). General synthetic procedure for compound 4s (Williamson ether synthesis):

[0219] A round bottom flask equipped with a magnetic stirring bar was charged with 4- (diethylamino)salicylaldehyde 3 (1.2 g, 6.0 mmol, 1.0 equiv.), bromoalkane (7.2 mmol, 1.2 equiv.), K2CO3(1.7 g, 12 mmol) in DMF (18 mL) and was heated at 90oC. The resulting reaction mixture was kept under vigorous stirring until the consumption of 3 (monitored by TLC analysis). After completion of the reaction, the mixture was extracted with ethyl acetate. The combined organic layers were dried over Na2SO4and the solvent was removed under reduced pressure. The residue was purified by column chromatography on a silica gel (petroleum ether / ethyl acetate = 9:1) to afford 4.

[0220] 4-3NHBoc was synthesized by using tert-butyl (3-bromopropyl)carbamate (compound 2) and obtained as an oily compound in 76% yield.1H NMR (400 MHz, DMSO- d6): δ = 10.01 (s, 1H), 7.49 (d, J = 8.9 Hz, 1H), 6.89 (s, 1H), 6.34 (dd, J = 8.9, 1.8 Hz, 1H), 6.12 (d, J = 2.1 Hz, 1H), 4.08 (t, J = 6.0 Hz, 2H), 3.43 (q, J = 7.0 Hz, 4H), 3.11 (q, J = 6.5 Hz, 2H), 1.87 (p, J = 6.4 Hz, 2H), 1.36 (s, 9H), 1.13 (t, J = 7.0 Hz, 6H).13C NMR (101 MHz, DMSO-d6): δ = 185.9, 163.7, 156.1, 154.1, 129.9, 113.8, 104.7, 93.9, 77.9, 66.0, 44.5, 37.4, 29.6, 28.7, 12.9. ESI-MS: calculated for C19H30N2O4[M+H]+351.2 m / z, found 351.2 m / z.

[0221] 4-2Ph was synthesized by using 2-phenylethyl bromide and obtained as an oily compound in 87% yield.1H NMR (400 MHz, DMSO-d6): δ = 9.94 (s, 1H), 7.48 (d, J = 8.9 Hz, 1H), 7.32 (q, J = 8.0 Hz, 4H), 7.22 (t, J = 6.8 Hz, 1H), 6.32 (d, J = 9.0 Hz, 1H), 6.14 (d, J = 2.0 Hz, 1H), 4.30 (t, J = 6.5 Hz, 2H), 3.47 – 3.39 (m, 5H), 3.08 (t, J = 6.4 Hz, 2H), 1.11 (t, J = 7.0 Hz, 6H).13C NMR (101 MHz, DMSO-d6): δ = 185.7, 163.6, 154.1, 139.0, 129.8, 129.5, 128.8, 126.8, 113.7, 104.8, 93.9, 69.0, 44.5, 35.4, 12.9. ESI-MS: calculated for C19H23NO2[M+H]+298.2 m / z, found 298.2 m / z.

[0222] 4-Cy6 was synthesized by using cyclohexylmethyl bromide and obtained as an oily compound in 75% yield.1H NMR (400 MHz, DMSO-d6): δ = 10.03 (s, 1H), 7.49 (d, J = 8.9 Hz, 1H), 6.32 (dd, J = 9.0, 1.9 Hz, 1H), 6.11 (d, J = 2.2 Hz, 1H), 3.89 (d, J = 5.8 Hz, 2H), 3.42 (q, J = 7.1 Hz, 4H), 1.73 (ddd, J = 39.7, 23.3, 11.6 Hz, 6H), 1.24 (dt, J = 30.4, 13.6 Hz, 3H), 1.16 – 1.06 (m, 8H).13C NMR (101 MHz, DMSO-d6): δ = 185.6, 163.9, 154.1, 129.9, 113.8, 104.7, 93.8, 73.2, 44.5, 37.7, 29.7, 26.5, 25.8, 12.9. ESI-MS: calculated for C18H27NO2 [M+H]+290.2 m / z, found 290.3 m / z.

[0223] 4-8C was synthesized by using octyl bromide and obtained as an oily compound in 91% yield.1H NMR (400 MHz, DMSO-d6): δ = 10.02 (s, 1H), 7.49 (d, J = 8.9 Hz, 1H), 6.30 (dd, J = 9.0, 2.2 Hz, 1H), 6.11 (d, J = 2.3 Hz, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.45 – 3.38 (m, 4H), 1.78 – 1.66 (m, 2H), 1.41 (p, J = 7.0 Hz, 2H), 1.33 – 1.20 (m, 9H), 1.11 (t, J = 7.0 Hz, 6H), 0.87 – 0.79 (m, 3H).13C NMR (101 MHz, DMSO-d6): δ = 185.57, 163.77, 154.08, 129.77, 113.79, 104.62, 93.81, 68.08, 61.21, 44.52, 33.02, 31.75, 31.68, 29.41, 29.24, 29.18, 29.11, 29.00, 26.05, 25.99, 22.57, 22.54, 14.33, 12.83. ESI-MS: calculated for C19H31NO2 [M+H]+306.2 m / z, found 306.3 m / z. General synthetic procedure for Knoevenagel condensation:

[0224] Corresponding benzaldehyde 4 (3.3 mmol, 1 equiv.), 2-methylquinoline (860 mg, 6 mmol, 854 μL, 1.8 equiv.), Fe(OAc)2(30 mg, 0.17 mmol, 0.05 equiv.), and TFA (22 μL, 0.34 mmol, 0.1 equiv.) were dissolved in dry toluene (7.5 mL) under N2protection and the mixture was stirred at 100oC for 24 h. The mixture was then cooled to room temperature and the solvent was removed under reduced pressure. The residue was purified by flash column chromatography on a silica gel to afford final products.

[0225] LD-AUTag1 was synthesized by using 4-3NHBoc and obtained as a dark red solid in 65% yield.1H NMR (400 MHz, DMSO-d6): δ 8.22 (d, J = 8.6 Hz, 1H), 7.90 (dt, J = 30.0, 16.2 Hz, 3H), 7.81 – 7.64 (m, 2H), 7.54 (d, J = 8.7 Hz, 1H), 7.52 – 7.44 (m, 1H), 7.19 (d, J = 16.3 Hz, 1H), 6.97 (s, 1H), 6.34 (d, J = 8.7 Hz, 1H), 6.23 (s, 1H), 4.06 (dd, J = 25.8, 6.4 Hz, 2H), 3.44 – 3.36 (m, 4H), 3.22 (d, J = 6.0 Hz, 2H), 1.97 (dd, J = 12.0, 5.7 Hz, 2H), 1.40 (s, 9H), 1.13 (t, J = 6.9 Hz, 6H).13C NMR (101 MHz, DMSO-d6): δ 158.8, 157.4, 156.2, 149.8,148.2, 136.5, 130.3, 130.0, 129.3, 128.8, 128.1, 127.0, 125.8, 123.4, 120.3, 112.7, 105.0, 95.8, 78.0, 66.0, 44.3, 37.6, 30.1, 28.7, 13.1. ESI-MS: calculated for C29H37N3O3 [M+H]+476.3 m / z, found 476.3 m / z.

[0226] LD-AUTag2 was synthesized by using 4-2Ph and obtained as a yellow solid in 72% yield.1H NMR (400 MHz, DMSO-d6): δ = 8.27 (d, J = 8.6 Hz, 1H), 7.98 – 7.83 (m, 3H), 7.75 – 7.66 (m, 1H), 7.58 (d, J = 8.7 Hz, 1H), 7.55 – 7.43 (m, 4H), 7.34 (t, J = 7.5 Hz, 2H), 7.23 (t, J = 7.4 Hz, 1H), 7.13 (d, J = 16.4 Hz, 1H), 6.31 (dd, J = 8.7, 2.1 Hz, 1H), 6.22 (d, J = 2.2 Hz, 1H), 4.30 (t, J = 6.3 Hz, 2H), 3.35 (q, 4H, under water peak), 3.16 (t, J = 6.2 Hz, 2H), 1.12 (t, J = 7.0 Hz, 6H).13C NMR (101 MHz, DMSO-d6): δ = 158.6, 157.5, 149.8, 148.3, 139.4, 136.4, 130.1, 129.7, 128.9, 128.8, 128.2, 127.0, 126.7, 125.8, 123.3, 119.9, 112.5, 105.0, 95.7, 69.0, 44.3, 35.7, 13.0. ESI-MS: calculated for C29H30N2O [M+H]+423.2 m / z, found 423.2 m / z.

[0227] QBE-Cy6 was synthesized by using 4-Cy6 and obtained as a yellow oil in 76% yield.1H NMR (400 MHz, DMSO-d6): δ = 8.24 (d, J = 8.6 Hz, 1H), 7.96 (d, J = 16.4 Hz, 1H), 7.87 (d, J = 8.2 Hz, 2H), 7.69 (dd, J = 11.2, 4.3 Hz, 1H), 7.61 (d, J = 8.6 Hz, 1H), 7.53 – 7.44 (m, 2H), 7.22 (d, J = 16.3 Hz, 1H), 6.31 (dd, J = 8.6, 2.2 Hz, 1H), 6.20 (d, J = 2.1 Hz, 1H), 3.90 (d, J = 5.6 Hz, 2H), 3.35 (q, 4H, under water peak), 2.00 – 1.60 (m, 7H), 1.32 – 1.17 (m, 4H), 1.12 (t, J = 7.0 Hz, 6H).13C NMR (101 MHz, DMSO-d6): δ = 159.1, 157.4, 149.8, 148.3, 136.6, 130.3, 130.1, 129.5, 128.8, 128.2, 127.0, 125.8, 123.4, 120.1, 112.7, 104.8, 95.9, 73.5, 44.3, 37.9, 29.9, 26.6, 25.9, 13.0. ESI-MS: calculated for C28H34N2O [M+H]+415.3 m / z, found 415.3 m / z.

[0228] QBE-8C was synthesized by using 4-8C and obtained as a yellow oily compound in 84% yield.1H NMR (400 MHz, DMSO-d6): δ = 8.22 (d, J = 8.6 Hz, 1H), 7.94 (d, J = 16.3 Hz, 1H), 7.88 (t, J = 8.0 Hz, 2H), 7.72 – 7.65 (m, 1H), 7.63 (d, J = 8.6 Hz, 1H), 7.52 (d, J = 8.8 Hz, 1H), 7.50 – 7.42 (m, 1H), 7.20 (d, J = 16.3 Hz, 1H), 6.32 (dd, J = 8.9, 2.2 Hz, 1H), 6.22 (d, J = 2.2 Hz, 1H), 4.07 (t, J = 6.2 Hz, 2H), 3.35 (q, 4H, under water peak), 1.87 – 1.75 (m, 2H), 1.62 – 1.46 (m, 2H), 1.44 – 1.35 (m, 4H), 1.25 (dd, J = 6.7, 4.3 Hz, 4H), 1.12 (t, J = 7.0 Hz, 6H), 0.79 (t, J = 7.0 Hz, 3H).13C NMR (101 MHz, DMSO-d6): δ = 158.9, 157.4, 149.8, 148.3, 136.5, 130.3, 130.0, 129.3, 128.8, 128.2, 127.0, 125.8, 123.4, 120.1, 112.7, 104.9, 95.9, 68.2, 44.3, 31.7, 29.3, 29.3, 29.2, 26.3, 22.5, 14.3, 13.1. ESI-MS: calculated for C29H38N2O [M+H]+431.3 m / z, found 431.4 m / z.M-AUTag1:

[0229] A solution of acetic anhydride (61 µL, 639 µmol, 4 equiv.) in DCM (0.3 mL) was added dropwise at 0 °C to a solution of compound 1 (60 mg, 160 µmol, 1 equiv.) in DCM (0.3 mL) in the presence of triethylamine (45 µL, 320 µmol, 2 equiv.). After 15 min, the reaction mixture was allowed to warm to room temperature and stirred for 5 h. Then the reaction was terminated by the addition of saturated NaHCO3 solution. After extraction using DCM, the organic layers were combined and dried over Na2SO4. The solvent was then removed under reduced pressure. The crude was further purified by silica plug (DCM / MeOH) to afford the pure M-AUTag1 (62 mg, 93%) as a dark red solid.1H NMR (400 MHz, CDCl3): δ = 8.09 (t, J = 9.1 Hz, 1H), 7.92 (d, J = 16.4 Hz, 1H), 7.74 (d, J = 8.2 Hz, 1H), 7.66 (dd, J = 14.5, 7.7 Hz, 1H), 7.53 (d, J = 8.8 Hz, 1H), 7.45 (t, J = 7.1 Hz, 1H), 7.33 (d, J = 16.0 Hz, 1H), 6.35 (dd, J = 8.8, 2.4 Hz, 1H), 6.18 (d, J = 2.4 Hz, 1H), 4.14 (t, J = 5.6 Hz, 2H), 3.58 (dd, J = 12.3, 6.2 Hz, 2H), 3.39 (q, J = 7.1 Hz, 4H), 2.22 – 2.10 (m, 2H), 1.21 (t, J = 7.1 Hz, 6H). Compound 3 (Williamson ether synthesis):

[0230] A round bottom flask equipped with a magnetic stirring bar was charged with 4- (diethylamino)salicylaldehyde (2) (966 mg, 5.0 mmol, 1.0 equiv.), 2-chloroethanol (755 µL, 11.25 mmol, 2.25 equiv.), K2CO3 (2.07 g, 15 mmol, 3.0 equiv.) and KI (125 mg, 0.75 mmol, 0.15 equiv.) in DMF (13.5 mL) and heated at 90oC. The resulting reaction mixture was kept under vigorous stirring until the consumption of 2 (monitored by TLC analysis). After completion of the reaction, the mixture was extracted with ethyl acetate. The combined organic layers were dried over Na2SO4and the solvent was removed under reduced pressure. The residue was purified by column chromatography on a silica gel (petroleum ether / ethyl acetate) to afford 3 (857 mg, 72%) as a pale white solid. M-AUTag2 (Knoevenagel condensation):

[0231] Compound 3 (854 mg, 3.6 mmol, 1 equiv.), 2-methylquinoline (4) (615 μL, 4.32 mmol, 1.2 equiv.), Fe(OAc)2 (63 mg, 0.36 mmol, 0.1 equiv.), and TFA (55 μL, 0.72 mmol, 0.2 equiv.) were dissolved in dry toluene (9 mL) under N2protection and the mixture was stirred at 100oC for 24 h. The mixture was then cooled to room temperature and the solvent was removed under reduced pressure. The residue was purified by flash column chromatography on a silica gel (petroleum ether / ethyl acetate) to afford M-AUTag2 (793 mg, 61%) as a dark red solid.1H NMR (400 MHz, DMSO-d6): δ = 8.23 (d, J = 8.6 Hz, 1H), 8.02 – 7.85 (m, 3H),7.74 (d, J = 8.6 Hz, 1H), 7.69 (t, J = 7.6 Hz, 1H), 7.55 (d, J = 8.7 Hz, 1H), 7.48 (t, J = 7.4 Hz, 1H), 7.20 (d, J = 16.4 Hz, 1H), 6.33 (d, J = 8.8 Hz, 1H), 6.25 (s, 1H), 5.04 (t, J = 5.3 Hz, 1H), 4.10 (t, J = 4.9 Hz, 2H), 3.84 (d, J = 4.7 Hz, 2H), 3.35 (q, 4H, under water peak), 1.12 (t, J = 6.9 Hz, 6H).13C NMR (101 MHz, DMSO-d6): δ = 158.9, 157.6, 149.8, 148.2, 136.4, 130.3, 130.0, 129.1, 128.7, 128.2, 127.0, 125.8, 123.5, 120.0, 112.8, 105.0, 96.1, 70.5, 60.3, 44.3, 13.1.Scheme 4. Synthetic route of ER-AUTag1.

[0232] To a stirred solution of compound 1 (48 mg, 128 µmol, 1.0 equiv.) and triethylamine (22 µL, 153 µmol, 1.2 equiv.) in DCM (0.32 mL) at 0oC was slowly added 4- toluenesulfonyl chloride (25 mg, 128 µmol, 1.0 equiv.). The reaction mixture was then warmed to room temperature and stirred until completion as monitored by TLC. Upon completion, the reaction was washed with water and then the aqueous phase was then separated and extracted three times with DCM. The combined organic extracts were washed with 1 M HCl, then with brine, and dried over Na2SO4. The solvent was removed in vacuo and the residue was purified by silica plug (DCM) to afford ER-AUTag1 (54 mg, 81%) as a yellow solid.1H NMR (400 MHz, DMSO-d6): δ = 8.23 (d, J = 8.6 Hz, 1H), 7.89 (dd, J = 21.4, 12.6 Hz, 3H), 7.67 (qd, J = 9.2, 5.5 Hz, 5H), 7.55 – 7.45 (m, 2H), 7.24 (d, J = 8.1 Hz, 2H), 7.14 (d, J = 16.3 Hz, 1H), 6.32 (dd, J = 8.8, 2.0 Hz, 1H), 6.16 (d, J = 2.0 Hz, 1H), 4.05 (t, J = 6.0 Hz, 2H), 3.35 (q, 4H, under water peak), 3.03 (dd, J = 12.9, 6.6 Hz, 2H), 2.24 (s, 3H), 1.97 – 1.83 (m, 2H), 1.12 (t, J = 7.0 Hz, 6H).13C NMR (101 MHz, DMSO-d6): δ = 158.6, 157.4, 149.8, 148.3, 143.0, 138.0, 136.5, 130.1, 130.0, 129.2, 128.8, 128.2, 127.0, 126.9, 125.8, 123.4, 120.0, 112.6, 105.0, 95.7, 65.2, 44.3, 29.6, 21.3, 13.1. Cell Culture

[0233] HeLa cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Scientifix) and 1% penicillin-streptomycin (Gibco) at 37oC with 5% CO2. Mouse embryonic fibroblast (MEF) cells were cultured in DMEM (Gibco) supplemented with 250 µM L-asparagine (Sigma), 1 mM HEPES (Gibco), 50 µM 2-mercaptoethanol (Gibco), 10% FBS (Scientifix) and 1% penicillin-streptomycin (Gibco) at 37oC with 5% CO2. Lymphoblastoid cell lines (LCLs) were generated from the Epstein-Barr virus (EBV)-mediated transformation of lymphocytes isolated from blood collected from idiopathic Parkinson’s (PD) patients or age-matching healthy individuals. LCLs derived from genetic PD patients with deficiency in LRRK2 or PARK2 were purchased from the Coriell Institute for Medical Research. LCLs were cultured in Minimum Essential Media α (MEM α; Gibco) supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin (Gibco) at 37oC with 5% CO2. Access to the LCLs used in this study was approved by the Ethics, Integrity and Biosafety Team of La Trobe University under human ethics HEC20445. Cell lines were tested not contaminated with mycoplasma. D. discoideum Strains

[0234] All transformants of Dictyostelium discoideum (D. discoideum) used in this study were derived from the WT strain, AX2, and were kindly provided by Professor Paul Fisher (La Trobe University, Australia). The AMPKαT transformant overexpressing the catalytic domain of the AMPKα subunit (snfA), HPF443, is used as the AMPK OE model; the transformant strain carrying the snfA antisense inhibition construct, HPF456, is used as the Ampk KDmodel. Raptor KD (RA69) and OE (ROE31) strains were verified by RNA-Seq and qRT-PCR to confirm the changes in gene expression levels.

[0235] Vegetatively growing D. discoideum cells were maintained in axenic HL-5 nutrient medium (Formedium) supplemented with 100 µg / mL ampicillin (Roche) and 20 µg / mL geneticin (G-418; Gibco) as the selective agent. Cell suspensions were cultured at 22oC on a rotary shaker at 150 rpm. Zebrafish Models

[0236] Zebrafish work was conducted in compliance with animal ethics at La Trobe University (AEC23011) and the Peter MacCallum Cancer Centre. The casper line of zebrafish was kindly provided by Dr Kazuhide Shaun Okuda (La Trobe University). Zebrafish were bred and maintained in temperature (28oC), pH (7.4), and salinity-controlled conditions. All fish were maintained in a 14 h on / 10 h off light cycle. Mouse Models

[0237] Mice were bred and maintained in compliance with approved ethics guidelines at the Peter MacCallum Cancer Centre. BL / 6 and BL / 6.OTI and BALB / c-Npc1m1N(Npc1- / -) mice were crossed with BALB / c mice, which are transgenic for a T-cell receptor specific to an epitope of hemagglutinin IYSTVASSL (BALB / c.CL4), resulting in Npc1- / -.CL4. Antigen-specific CD8+T cells were generated using a standard protocol as previously described (Nat Commun.2019, 10, 5396). Mouse Primary CTLs

[0238] To generate antigen-specific CD8+ T cells from C57BL / 6.OTI (BL / 6.OTI) or BALB / c.CL4 mice that are transgenic for ovalbumin or haemagglutinin specific TCR, splenic single-cell suspensions were cultured in RPMI-1640 (Gibco) supplemented with 10% heat inactivated foetal calf serum (hi-FCS), 2 mM GlutaMAXTM(Gibco), 1mM sodium pyruvate, 100 μM non-essential amino acids, 50 μM 2-mercaptoethanol and 1% penicillin / streptomycin. On day 0 of culture, 100 U / ml of human recombinant IL‐2 (Peprotech) and 10 nM of HA518-526 or OVA257-264 immunodominant peptides were added to cell culture to activate and expand antigen specific CD8+ T-cells, in CL4+ and OTI+ cells, respectively. Splenocytes were incubated at 37 °C with 5% CO2. In Vitro Spectroscopy

[0239] UV-visible absorption spectra were recorded at room temperature on an Agilent Cary 300 UV-visible spectrophotometer equipped with a 1.0 cm quartz cell. Fluorescence emission spectra were recorded on an Agilent Cary Eclipse Fluorescence Spectrophotometer and used 1.0 cm quartz cells. For UV-visible absorption measurement, the background of (co- )solvent alone was subtracted. For photoluminescence measurement, the emission slit was set at 5 nm, and the scan speed was set at medium. Data were plotted using Origin 2019.

[0240] Measurement of pH titrations was performed immediately after pH adjustment using a pH meter. The aqueous solutions consist of 25 mM pH buffer (for pH 2.5 – 3.5: citrate buffer; pH 4.0 – 5.0: acetate buffer; pH 5.5 – 6.5: MES buffer; pH 7.0 – 8.0: HEPES Buffer), 125 mM KCl, 20 mM NaCl, 2 mM CaCl2, and 2 mM MgCl2. Cytotoxicity Assay

[0241] 6 × 104cells were plated onto 24-well plates 24 h prior to dye application. Varying concentrations of dyes were applied for designated period to test the cellular viability. Afterwards, cells were harvested by trypsinization, and washed once by ice-cold PBS. Cells were then resuspended in FACS buffer containing 0.4 µM TO-PRO-3 (Invitrogen) for viability quantification using the Beckman CytoFLEX S flow cytometer. Samples fixed by 4% PFA for 20 min were used as the positive controls for TO-PRO-3. The APCnegpopulation was gated as live cells. The cell viability was quantified as the percentage (%) of APCneg / total single cells, and further normalized by the reference of untreated cells. Molecular Cloning and Transfection

[0242] HeLa cells were transiently transfected with EGFP-ADRP using PEI transfection reagent (Sigma-Aldrich) as per manufacturer’s instructions at a concentration of 1 µg / ml. The EGFP-ADRP plasmid was a kind gift from Dr Nicholas Eyre (Flinders University).Cell Staining by LD-AUTags

[0243] The LD-AUTag dyes were dissolved in DMSO as 300 µM stock solution, which was stored at -20oC in the dark. Treatments, starvation, or stressors were applied to cells before dye staining. Cells with respective treatments were washed with serum-free FluoroBrite DMEM (Gibco) twice and stained by freshly diluted LD-AUTag dyes (3 µM, in serum-free FluoroBrite DMEM) for 30 min at 37oC. The stained cells were next washed with serum-free FluoroBrite DMEM once and subjected to subsequent analysis. Counter staining with other commercially available dyes can be achieved by directly adding other dyes in the staining medium. The usage of commercially available dyes, including BODIPY (Sigma), LysoView 633TM(Biotium), MitoTrackerTMDeep Red (Invitrogen) and WGA640 (Biotium), was adopted according to manufacturers’ instructions. Flow Cytometry

[0244] For adherent cells, cells were seeded in 24-well plates and cultured overnight to reach approximately 75% confluency. After respective treatments and staining, cells were detached by TrypLE (Gibco) which was subsequently quenched by the addition of equal volume of complete medium. Cells were then transferred to U-bottom 96-well plates and centrifuged to remove TrypLE containing medium. Without extra washing step, cell pellets were resuspended in ice-cold PBS containing 0.4 μM of TO-PRO-3 for flow cytometry analysis.

[0245] Flow cytometry analysis was performed on the Beckman CytoFLEX S flow cytometer. Intracellular LD-AUTag1 and LD-AUTag1-H+fluorescence was recorded in the A525 and PE channels, respectively. Only signals from live cells, gated by negative TO-PRO- 3 staining in the APC channel, were used for analysis. Analysis of flow cytometry data were carried out using FlowJo. Live Cell Imaging

[0246] For adherent cells, cells were seeded in μ-slide 8 well chambers (Ibidi) and cultured overnight before applying treatments. After treatments and dye staining, live cells were directly imaged. Images were acquired on the Zeiss LSM 800 microscope using 63× objective lens. For airy scan imaging, the optimal pixel frame size was based on image magnification; for normal confocal imaging, the pixel frame size was set at 1024 × 1024 for image acquisition or 512 × 512 for Z-stack or time-lapse imaging. Signals of LD-AUTag1 and LD-AUTag1-H+were generated using 405 nm and 561 nm excitation lasers, respectively. Image quantification and analysis were carried out using Fiji (ImageJ). LD Induction and Treatments

[0247] For LD induction, pure OA stored at -20oC was warmed up to 37oC until it was completely liquefied, and diluted in 50% EtOH / H2O (v / v) at 150 mM. OA-BSA complex was freshly prepared immediately before cell treatment, by mixing equal volumes of 150 mM OA in 50% EtOH / H2O (v / v) with 100 mg / mL BSA in MilliQ water. The mixture was then incubated at 37oC for at least 1 h prior to cell experiment and subsequently used as the OA stock at 75 mM. The OA containing medium was made by diluting the OA stock (1:375) into culturing medium and applied to cells for the 6-h treatment. The final working concentration for the OA treatment was 0.2 mM. Drug Treatments

[0248] Treatments used were amino acid starvation in EBSS (Gibco); treated with; MG132 (5 µM; Cayman), brefeldin A (2.5 µM), LiCl (10 mM), rapamycin (500 nM), torin2 (500 nM), tunicamycin (2 µg / mL), thapsigargin (1 µM), carbonyl cyanide 3-chlorophenylhydrazone (CCCP; 20 µM), lipopolysaccharides (LPS; 1 µg / mL), deferiprone (1 mM), H2O2(0.6 mM) or torin2 (500 nM) / NH4Cl (1 mM) in culture medium; or treated with wortmannin (50 nM), bafilomycin A1(baf A1; 50 nM), chloroquine (25 µM), lalistat 1 (10 µM), E64d (25µM) / pepstatin (50 µM), nocodazole (100 ng / mL) and vinblastine (30 µM) in serum free DMEM; or NH4Cl (1 mM) in culture medium or serum free DMEM.D. discoideum Development

[0249] D. discoideum cells were cultured in shaking culture in low fluorescence axenic LoFlo medium, in place of HL-5 medium, overnight before the experiment. Cells were plated in LoFlo medium in μ-slide 8 well chambers, for imaging, or in 24 well plates, for flow cytometry analysis, and allowed to adhere for 1 h without shaking, ensuring consistent adherence between samples. For the starved groups, the culture medium was then carefully removed and changed to the development buffer (5 mM Na2HPO4, 5 mM KH2PO4, 1 mM CaCl2, 2 mM MgCl2 in MilliQ H2O), and cells were incubated at 21oC in the dark for the indicated times. At the desired time point, cells were carefully washed by PBS twice, and stained by LD-AUTag1 (5 µM) in PBS for 45 min. After staining, cells were washed by PBS and directly subjected for live cell imaging. For flow cytometric experiment, cells were collected and disaggregated by intensive pipetting during the staining period. Then the dye containing PBS was removed by centrifugation and the cells were resuspended in ice-cold PBS containing 0.4 µM TO-PRO-3. Cells were analyzed using a Beckman CytoFLEX S flow cytometer. Zebrafish Imaging

[0250] Zebrafish whole-mount imaging was performed as per procedures described (Lymphangiogenesis. Methods in Molecular Biology, 1846. Humana Press, New York, NY.) Fifteen zebrafish larval per condition were transferred to a 6 well plates. The E3 medium was then removed and changed to the medium supplemented with indicated drugs, or replaced with fresh E3 medium. In the last 3 h of treatment, LD-AUTag1 was added to each well at a working concentration of 10 µM with gentle shaking. Afterwards, fish were mounted in 0.5% low-melting agarose containing 0.16 mg / mL tricaine for anesthetizing and 10 µM LD- AUTag1, into 35 mm glass-bottom confocal dishes for imaging. Z-stack images were acquired by the Andor Dragonfly 202 spinning disk confocal microscope using the 20× lens at a Z- stack interval of 5 µm.

[0251] Treatments used for lipophagy modulation in zebrafish were baf A1(50 nM) for 6 h, 3-MA (5 mM) for 6 h, torin2 (500 nM) for 24 h, rapamycin (1 µM) for 24 h, E64d (25 µM) / pepstatin A (50 µM) for 24 h, and rapamycin (1 µM) / E64d (25 µM) / pepstatin A (50 µM) for 24 h.

[0252] Lipophagy levels was quantified using Z-stack projections of images taken with the same gain, offset and laser intensity by calculating the corrected total fluorescence in the regions of interest (ROIs) with fixed sizes at 603 × 603 µm and 126.6 × 126.6 µm, for head and tail skin, respectively. For the quantification of lipophagy in intestine, the length was fixed at 603 µm, with manual drawing to exclude any non-intestine signals. A threshold for each individual experiment was determined using a negative control, and calculated by correcting for the background signal to remove autofluorescence. This threshold was then applied to all images analyzed within each cohort. CRISPR / Cas9 Gene Knock-out in Primary Murine CTLs

[0253] Gene knockout was carried out as per procedures described in Immunol. 2020;204(8):2308-2315. In brief, naïve CD8+ T cells were isolated from splenic single-cell suspensions of Bl / 6.OTI mice by negative selection using CD8+ Negative selection EasySepTMkit (STEMCELL Technology) according to manufacturer’s instructions. In parallel, a ribonucleoprotein (RNP) complex was generated by mixing recombinant Alt-RTMspCas9 (6 μg) (Integrated DNA Technologies) and synthetic short guide RNAs (0.5 μg) (Synthego) in PBS (2 μL) for 10 minutes at room temperature. We used a mixture of three guides targeting murine Npc1 gene: 5’-GAAUUGCGACUGGAGAUAAG, 5’- ACACUCUCCAUACCAAACAC and 5’-UCGCAAUCCUGUGUUUGGUA.1.5 - 2million cells were nucleofected with the RNP complex in P3 Primary Cell 4D-NucleofectorTMbuffer (Lonza 4D nucleofection system) according to the manufacturer’s instructions. Nucleofected cells were then mixed with BL / 6 splenic single cell suspensions that were depleted of CD8+ T cells, and cultured under the same conditions as specified above.LD-AUTag1 Protocol for Primary Murine CTLs

[0254] For primary murine CTLs (suspension cells), 3 × 105cells per samples were harvested from culturing to U-shape 96-well plates or 1.5 mL Eppendorf tubes, and washed with serum-free FluoroBrite™ DMEM (Gibco) for twice. Cells were then stained with LD- AUTag1 (3 µM) at 1 × 106cells / mL for 30 min, at 37oC. For flow cytometry analysis, stained cells were washed with FluoroBrite™ DMEM and resuspended in FACS buffer containing 0.4 μM of TO-PRO-3 (Invitrogen). For live cell imaging, stained cells were resuspended in FluoroBrite™ DMEM (Gibco) and applied onto glass slides (for airy scan on the Zeiss LSM 800 microscope using a 63× lens) or transferred to 35 mm glass bottom dishes (Ibidi, for fast Z-stack imaging on the Andor Dragonfly 202 spinning disk confocal microscope using a 60× lens). Quantification and Statistical Analysis

[0255] All quantitative data are shown as the mean from n ≥ 3 biological replicates. Unless otherwise specified, approximately 2 × 104cells were analysed in each flow cytometry-based quantification and median values from each replicate were plotted. Statistical analyses were performed using the Student’s t-test function in GraphPad Prism 8.0. In all tests, P value < 0.05 was considered statistically significant. ***

[0256] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is understood that the invention includes all such variations and modifications which fall within the spirit and scope of the present invention.

Claims

CLAIMS 1. A compound having the general structure of Formula (I) F* – L – X (I) wherein F* is a pH sensitive fluorophore; L is an optional linker group; and X is a targeting moiety.

2. The compound of claim 1, wherein the fluorophore F* has the structurewherein n is an integer that is 1 or 2; and wherein each R1is an independently selected optionally substituted functional group.

3. The compound of claim 1, wherein the fluorophore F* is selected from the group consisting ofwherein each R1is an independently selected optionally substituted functional group.

4. The compound of claim 2 or claim 3, wherein each R1is an independently selected optionally substituted C1-C12alkyl, C1-C12haloalkyl, C2-C12alkenyl, C2-C12alkynyl, C1- C10heteroalkyl, C3-C12cycloalkyl, C3-C12cycloalkenyl, C1-C12heterocycloalkyl, C1- C12heterocycloalkenyl, C1-C12alkylamino, C1-C12alkyloxy, C1-C12alkyloxycarbonyl, and C1- C6alkyloxycarbonylC1-C6alkyl.

5. The compound of claim 4, wherein each R1is an independently selected optionally substituted C1-C12 alkyl group.

6. The of claim 1, wherein the fluorophore F* is7. The of claim 1, wherein the fluorophore F* is selected from the group consisting8. The compound of any one of claims 1 to 7, wherein when present, the linker group L is selected from the group consisting of C1-C12alkyl, C1-C12alkyloxy, poly(C1-C12alkyloxy), C1- C12alkyloxycarbonyl, C1-C12alkyloxycarbonylC1-C12alkyl, C1-C12alkylaminocarbonyl, C1- C12alkylaminocarbonylC1-C12alkyl, poly(C1-C12alkyloxy)C1-C12alkyloxycarbonylC1-C12alkyl, and poly(C1-C12alkyloxy)C1-C12alkylaminocarbonylC1-C12alkyl.

9. The compound of claim 8, wherein when present, the linker group L is selected fromwherein m and n are independently selected integers between 1 and 12, preferably between 1 and 6.

10. The of one of claims 1 to 7, wherein when present, the linker group L iswherein m and n are independently selected integers between 1 and 12, preferably between 1 and 6.

11. The compound of claim 9, wherein when present, the linker group L is selected from the group consisting of C1-C8alkyl.

12. The compound of any one of claims 1 to 11, wherein the targeting moiety X is selected from the group consisting of:

13. The compound of claim 12, wherein the targeting moiety X is14. The compound of claim 1, having a Formula (II):wherein R3is selected from the group consisting of optionally substituted C1-C12alkyl, C1- C12alkenyl, C3-C12cycloalkyl, C3-C12cycloalkenyl, C6-C18aryl, C6-C18arylalkyl, cycloalkylalkenyl, C6-C18arylalkenyl, C1-C12heteroalkyl, and aminoC1-C12alkyl.

15. The of claim wherein R3is selected from the group consisting of16. A compound of Formula (III)17. A compound of Formula (IV)18. A compound of Formula (V)(VII).

21. A fluorescent labelling composition comprising a compound according to one of claims 1 to 20.

22. A method of measuring autophagic activity in a cell sample comprising: a) contacting the sample with the fluorescent labelling composition according to claim 21; b) detecting fluorescence emitted by said composition and forming a readout therefrom.

23. A method of imaging body tissue comprising: a) applying an imaging composition to a subject, wherein said composition comprises a fluorescent labelling composition according to claim 21; b) detecting fluorescence emitted by said composition and forming a readout therefrom.

24. A method of identifying, selecting, or diagnosing a disease state in a subject, comprising the steps of: a) applying a fluorescent labelling composition to a cell sample or a body tissue of the subject, wherein said composition comprises a compound according to any one of claims 1 to 20; and b) detecting fluorescence emitted by said composition and forming a readout therefrom, wherein the readout indicates a level of autophagic activity present in the cell sample or body tissue.

25. The method of claim 24, further comprising step c) comparing the level with a reference level to determine an increased or decreased level of autophagic activity present inthe cell sample or body tissue, wherein the increased or decreased level of autophagic activity present in the cell sample or body tissue compared to the reference level is indicative of a disease state or a stage of development of a disease state.

26. The method of claim 25, wherein the reference level of autophagic activity present in the cell sample or body tissue is the level of autophagic activity present in the cell sample or body tissue from a normal subject.

27. The method of any of claims 24 to 26, wherein said disease state is a condition associated with dysregulation of autophagy.

28. The method of any of claims 24 to 27, wherein the autophagic activity is macroautophagic activity, lipophagic activity, mitophagic activity or ER-phagic activity.

29. The method of any of claims 24 to 28, wherein said disease state is selected from neurological disorders, cancer, cardiovascular disease, infectious disease, lysosomal storage disorder diseases, obesity and metabolic diseases.

30. The method of any of claims 24 to 29, wherein said disease state is selected from idiopathic Parkinson’s disease (PD), genetic PD, myalgic encephalomyelitis / chronic fatigue syndrome (ME / CFS), Niemann-Pick disease, liver cancer, long COVID, Charcot-Marie-Tooth disease, Batten disease, Gaucher disease, and Fabry disease.

31. The method of any of claims 24 to 30, further comprising administering to the subject a therapeutically effective amount of an anti-disease state therapeutic.

32. A pharmaceutical composition comprising a pharmaceutically acceptable salt of the compound according to any one of claims 1 to 20, and a pharmaceutically acceptable excipient.

33. A compound of any one of claims 1 to 20 for use in the identification, treatment, prevention, or amelioration of a condition associated with dysregulation of autophagy.

34. A method of identifying, preventing, treating, or ameliorating a condition associated with dysregulation of autophagy, said method comprising administering to a patient in need thereof a therapeutically effective amount of a compound of any one of claims 1 to 20.

35. Use of a compound of any one of claims 1 to 20 in the manufacture of a medicament for the identification, treatment, prevention, or amelioration of a condition associated with dysregulation of autophagy.

36. The compound for use, method or use of any of claims 33 to 35, wherein the condition is associated with dysregulation of macroautophagy, lipophagy, mitophagy, or ER-phagy.

37. The compound for use, method or use of any of claims 33 to 35, wherein said condition is selected from neurological disorders, cancer, cardiovascular disease, infectious disease, lysosomal storage disorder disease, obesity and metabolic diseases.

38. The compound for use, method or use of claim 37, wherein said condition is selected from idiopathic Parkinson’s disease (PD), genetic PD, myalgic encephalomyelitis / chronic fatigue syndrome (ME / CFS), Niemann-Pick disease, liver cancer, long COVID, Charcot- Marie-Tooth disease, Batten disease, Gaucher disease, and Fabry disease.

Images