ACTA1 expression control elements
The AAV-based gene therapy using miRNA silencing to inhibit ACTA1 expression addresses the inadequacies of existing treatments by effectively restoring functional skeletal actin and inactivating mutated actin, enhancing therapeutic outcomes for muscle disorders.
Patent Information
- Application Number
- PCT/EP2025/057904
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-26
- Filing Date
- 2025-03-24
- Publication Date
- 2025-10-02
AI Technical Summary
Current treatments for muscle disorders caused by ACTA1 mutations, such as nemaline myopathy, are inadequate as they often fail to effectively restore functional skeletal actin while inactivating the mutated actin, leading to insufficient therapeutic outcomes.
An AAV-based gene therapy using muscle-specific transgene regulation and miRNA silencing to inhibit ACTA1 expression, combined with concomitant inactivation of mutated actin, is employed to restore functional skeletal actin by using modulatory polynucleotides that target specific sequences within the ACTA1 gene.
This approach achieves a significant reduction in ACTA1 expression, minimizing off-target effects and toxicity, thereby improving the clinical efficacy in treating congenital myopathies by restoring skeletal actin function.
Smart Images

Figure 00000093_0000 
Figure 00000094_0000 
Figure 00000095_0000
Abstract
Description
[0001]Docket No. P38844 ACTA1 EXPRESSION CONTROL ELEMENTS TECHNICAL FIELD The present disclosure relates to the fields of molecular biology and nucleic acidtechnology. The present disclosure also relates to therapy and prophylaxis of disease.BACKGROUND Muscle tissues represent the largest tissue class of the human body and is separated into three major muscle types: skeletal, cardiac and smooth muscle. Skeletal and cardiac muscle are therein grouped together into the class of striated muscle represented by the ability to generate contraction, force and movement (Mukund & Subramaniam, 2020). Several genetic mutations give rise to devastating muscle disorder including muscle dystrophies such as DMD, beckers or limb girdle muscular dystrophy as well as inherited myopathies such as x-linked myotubular myopathy. As in many other disease areas, rAAV vectors have shown many promising results in clinical trials towards the treatment of these otherwise incurable and devastating muscle diseases (Braun et al., 2014; D. Wang et al., 2014). ACTA1 encodes alpha-skeletal actin which is essential for muscle contraction. Mutations in ACTA1 can result in abnormal structure / level of protein and disrupted structure / function of muscle cells, manifesting in muscle weakness, such as in rare forms of congenital myopathies. Congenital myopathies are rare inherited muscular diseases with genetic, histological and clinical heterogeneity. Clinical features are, amongst others, decreased muscle tone and weakness due to affected skeletal muscles fibers. Disease onset ranges from severe neonatal tomilder forms in childhood, all of which are caused by genetic mutations.Mutations in ACTA1 result in overlapping congenital myopathies, such as, for example, nemaline myopathy, congenital fiber-type disproportion myopathy and myopathy with core-like areas (see, e.g., Wang, C.H., et al., J. Child. Neurol. 27 (2012) 363-382; Cassandrini, D., et al., Ital. J. Pediatr.43 (2017) 101). Docket No. P38844 ACTA1 encodes skeletal muscle alpha-actin, which is the principal actin isoform in skeletal muscle and forms the core of the thin filament to interact with myosin during muscle contraction. Until today over 200 pathogenic mutations in ACTA1 have been identified (see, e.g., Sparrow, J.C., et al., Neuromusc. Disord. 13 (2003) 519-531; Feng, J-J. and Marston, S., Neuromuscul. Doisord. 19 (2009) 6-16; Laing, N.G., et al., Hum. Mutat. 30 (2009) 1267-1277; Laitila, J. and Wallgren-Petterson, C. Neuromusc. Disord. 31 (2021) 955-967). About 90% of the mutations are dominant (most commonly de novo, although some areinherited) and predominantly lead to severe nemaline myopathy due to dominant -negativeeffect. No obvious mutation hot spots in gene or protein have been identified (see, e.g., Feng, J- J. and Marston, S., Neuromuscul. Doisord. 19 (2009) 6-16; Laing, N.G., et al., Hum. Mutat.30 (2009) 1267-1277). However, over 50% of severe nemaline myopathy patients have ACTA1 mutations (see, e.g., Labasse, C., et al., Acta Neuropathol. Commun. 10 (2022) 101; Neuhaus, S.B., et al., Neuromusc. Disord. 30 (2020) 866-875). Severe phenotypes manifest in infantile hypotonia, motor delay, bulbar and respiratory weakness resulting in early lethality of patients. Fewaffected patients have hypertrophic cardiomyopathy.Restoration of actin function improves pathogenic phenotype. Rare cases of children with homozygous ACTA1 null mutations have been observed (see, e.g., Nowak, K.J., et al., Ann. Neurol. 61 (2007) 175-184; O’Grady, G.L., et al., Eur. J. Hum. Genet. 23 (2015) 883-886; Nowak, K.J., et al., 2013), wherein cardiac actin (ACTC1) substituted for the loss of skeletal actin expression as the ACTC1 gene, which is normally expressed during foetal skeletal muscle development, continued to be expressed. Due to the high homology between the two actin isoforms (differ by 4 amino acids) increased lifespan of patients with increased cardiac actinexpression (see, e.g., Labasse, C., et al., Acta Neuropathol. Commun. 10 (2022) 101).Evidence is provided from disease models. Overexpression of ACTC1 compensated in the ACTA1 null mice and one disease model (ACTA1D286G) for functional loss and increased significantly their lifespan (see, e.g., Nowak, K.J., et al., J. Cell Biol. 185 (2009) 903-915; Ravencroft, G., et al., Hum. Mol. Genet.22 (2013) 3987-3997). Docket No. P38844 However, in another mouse model (ACTA1H40Y) overexpression of ACTC1 did not improve the lifespan or phenotype (see, e.g., Ravencroft, G., et al., Hum. Mol. Genet.22 (2013) 3987-3997). Thus, depending on the mutation restoration of actin without removal of the mutated form might not be sufficient for efficient treatment. BRIEF SUMMARY Herein provided is an AAV-based gene therapy for restoration of functional skeletal actin with concomitant inactivation of mutated actin using skeletal muscle specific transgene regulation and optionally a muscle tropic capsid. More generally, herein provided are expression control elements suitable to restore skeletal actin function in patients with mutations in ACTA1. Without being bound by this theory, it is assumed that best benefit for patients can be achieved with disease modifying potential when mutated actin is inactivated and skeletal actin is replaced, i.e. the therapeutic mode of action encompasses restoration of functional skeletal actin with and concomitant inactivation of mutated actin. This has been achieved by selective miRNA silencing mutated ACTA1 expression. In one aspect, provided is a modulatory polynucleotide that inhibits expression of ACTA1, wherein the modulatory polynucleotide encodes an miRNA scaffold, wherein the miRNA scaffold comprises an inhibitory RNA (RNAi) molecule, wherein the RNAi molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 82, and SEQ ID NO: 84, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from a reverse complementarynucleotide sequence of the nucleotide sequence of the sense strand.In one aspect, the modulatory polynucleotide inhibits activity of a ACTA1 gene. Docket No. P38844 In one apsect, the modulatory polynucleotide is a single-stranded DNA, a double- stranded DNA, a DNA that is a mixture of single- and double-stranded regions, a single- stranded RNA, a double-stranded RNA, a RNA that is mixture of single- and double-stranded regions, a single-stranded molecules comprising DNA and RNA, a double-stranded molecules comprising DNA and RNA, or a molecule comprising DNA and RNA having a mixture of single- and double-stranded regions, in particular, wherein the modulatory polynucleotide is a single-stranded DNA. In one aspect, the ACTA1 gene is a mutated endogenous gene in a cell or a subject. In one aspect, the ACTA1 gene is a wild-type ACTA1 gene. In one aspect, the ACTA1 gene is a mutated ACTA1 gene with at least one pathogenic mutation. In one aspect, the modulatory polynucleotide inhibits activity of both a wild-typeACTA1 gene and a mutated ACTA1 gene with at least one pathogenic mutation.In one aspect, the modulatory polynucleotide does not inhibit activity of a codon optimized ACTA1 gene. In one aspect, the modulatory polynucleotide comprises the sequence of SEQ ID NO: 93 or a sequence having at least 85 % sequence identity to SEQ ID NO: 93. In one aspect, the modulatory polynucleotide comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, and SEQ ID NO: 124. In one aspect, provided is an expression system comprising a modulatory polynucleotide as described hereinbefore, wherein the modulatory polynucleotide is operably linked to a promoter, and optionally wherein the expression system additionally comprises a codon optimized polynucleotide encoding ACTA1. Docket No. P38844 In one aspect, provided is an adeno-associated virus (AAV) vector comprising a modulatory polynucleotide as described hereinbefore, wherein the modulatory polynucleotide is operably linked to a promoter, and optionally wherein the AAV vector additionallycomprises a codon optimized polynucleotide encoding ACTA1.In one aspect, the expression system or vector comprises a first expression cassette comprising the polynucleotide encoding a codon optimized polynucleotide encoding ACTA1 and a second expression cassette comprising the modulatory polynucleotide as described hereinbefore. In one aspect, the first expression cassette comprises an intron comprising the second expression cassette encoding the modulatory polynucleotide. In one aspect, provided is an adeno-associated virus (AAV) vector comprising a vector genome, wherein the vector genome comprises in 5’ to 3’ order (i) a 5' inverted terminal repeat (ITR) sequence, (ii) a promoter, (iii) optionally, a 5' UTR sequence, (iv) a polynucleotide encoding an ACTA1 gene, or a codon optimized variant thereof, (v) a 3' UTR sequence, and (vi) a 3' inverted terminal repeat (ITR) sequence, wherein the vector genome comprises a modulatory polynucleotide as described hereinbefore. In one aspect, the vector genome is suitable for being packaged into an adeno-associated viral particle. In one aspect, provided is a pharmaceutical composition comprising an expression system as described herein above, or an AAV vector as described herein above, and a pharmaceutically-acceptable carrier, diluent, excipient or adjuvant. In one aspect, provided is an expression system as described herein above, or an AAV vector as described herein above, or a pharmaceutical composition as described herein above, for use in treating or preventing a disease or condition that would derive therapeutic or prophylactic benefit from an increase in the level of expression of ACTA1 in skeletal muscle cells. In one aspect, provided is use of an expression system as described herein above, or an AAV vector as described herein above, or a pharmaceutical composition as described hereinabove in the manufacture of a medicament for treating or prevent ing a disease or condition that Docket No. P38844 would derive therapeutic or prophylactic benefit from an increase in the level of expression of ACTA1. In one aspect, provided is a method of treating or preventing a disease or condition that would derive therapeutic or prophylactic benefit from an increase in the level of expression of ACTA1, comprising administering to a subject an expression system as described herein above, or an AAV vector as described herein above, or a pharmaceutical composition as described herein above. In one aspect, provided is a expression system, vector, AAV vector, or pharmaceutical composition for use as described herein above, or the method of treatment as described herein above, wherein the disease is a congenital myopathy, in particular wherein the disease is selected from the group consisting of a nemaline myopathy, an intranuclear rod myopathy, an actin filament aggregate myopathy, a congenital fiber type disproportion, and myopathy with core-like areas. Other technical features may be readily apparent to one skilled in the art from the following figures, descriptions, and claims. DETAILED DESCRIPTION The current invention is based, at least in part, on the identification of highly specific expression control elements, in particular inactivation constructs. Reducing endogenous ACTA1 expression is required for clinical efficiency. Over 200 mutations are known spread throughout the gene. Thus, targeting endogenous ACTA1 has to be done at locations without known mutations and at the same time high specificity is required as ACTA1 and cardiac actin (ACTC1) are highly conserved. The current invention is based, at least in part, on the identification of target sequenceswith high specificity identified that allow for successful rescue of disease phenotype.With the sequences according to the current invention efficient knockdown of wtACTA1 can be achieved, such as, e.g., a more than 75 % reduction in expression. Docket No. P38844 With the sequences according to the current invention negative influence on therapeutic transgene expression, i.e. of a codon-optimized or adapted ACTA1 (coACTA1), have beenlimited or even eliminated due to an achieved high splicing efficiency.With the sequences according to the current invention only limited toxicity, such as, e.g., off-targets, RNAi pathway interference, etc., was observed. Small non-coding RNA molecule (containing about 22 nucleotides) found in different species are denoted as microRNA (abbreviated miRNA). These miRNAs have functions of RNA silencing and post-transcriptional regulation of gene expression. The mode of action of miRNAs is by base-pairing with a complementary sequences within a target mRNA molecules resulting in silencing of the transcription of the target mRNA. A ‘microRNA’ or ‘miRNA’ is a small non-coding RNA molecule capable of mediating transcriptional or post-translational gene silencing. Typically, miRNA is transcribed as a hairpin or stem-loop (e.g., having a self-complementarity, single-stranded backbone) duplex structure, referred to as a primary miRNA (pri-miRNA), which is enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into a pre-miRNA. The length of a pri-miRNA can vary. In some embodiments, a pri-miRNA ranges from about 100 to about 5000 base pairs (e.g., about 100, about 200, about 500, about 1000, about 1200, about 1500, about 1800, or about 2000 base pairs) in length. In some embodiments, a pri-miRNA is greater than 200 base pairs inlength, e.g., 2500, 5000, 7000, 9000, or more base pairs in length.The structure of miRNAs is characterized by a folding back on themselves resulting in the formation of short hairpins. The nomenclature of miRNAs is as follows: the stem ‘mir / R’ is followed by a dash and a number. A capitalized “R” in the stem denotes the mature form of the miRNA, while the lower letter ‘r’ denotes the pre-miRNA and the pri-miRNA form. miRNAs with only one or two nucleotide difference in sequences contain an additional lower case letter. A three-letter prefix in the name denotes the original species of the miRNA, e.g., hsa- miR-33 is a human (Homo sapiens) miRNA-33. miRNAs originating in comparable amounts from opposite arms of the same pre- miRNA are denoted with a -3p or -5p suffix or are denoted with ‘s’ for the sense strand and ‘as’ Docket No. P38844 for the antisense strand. Normally, miRNAs originating from one arm of the hairpin are found much more abundant than those originating from the other arm. This is reflected by the use ofan “*” following the name which indicates the low level species.Pre-miRNA, which is also characterized by a hairpin or stem-loop duplex structure, can also vary in length. In some embodiments, pre-miRNA ranges in size from about 40 base pairs in length to about 500 base pairs in length. In some embodiments, pre-miRNA ranges in size from about 50 to 100 base pairs in length. In some embodiments, pre-miRNA ranges in size from about 50 to about 90 base pairs in length (e.g., about 50, about 52, about 54, about 56, about 58, about 60, about 62, about 64, about 66, about 68, about 70, about 72, about 74, about 76, about 78, about 80, about 82, about 84, about 86, about 88, or about 90 base pairs in length). Generally, pre-miRNA is exported into the cytoplasm, and enzymatically processed by Dicer to first produce an imperfect miRNA / miRNA* duplex and then a single-stranded mature miRNA molecule, which is subsequently loaded into the RNA-induced silencing complex (RISC). Typically, a mature miRNA molecule ranges in size from about 19 to about 30 base pairs in length. In some embodiments, a mature miRNA molecule is about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or 30 base pairs in length. An miRNA scaffold refers to a structured nucleic acid molecule, typically RNA, that serves as a platform for the assembly and processing of microRNA (miRNA) molecules. This scaffold may provide the structural framework for the formation of functional miRNA complexes, allowing for the precise regulation of gene expression. The miRNA scaffold may facilitate the maturation and stabilization of miRNAs, enabling them to carry out their roles in post-transcriptional gene regulation. The current invention provides in some aspects a modulatory polynucleotide sequence which interferes with target gene expression and / or target protein production and methods of use thereof, in particular wherein the modulatory polynucleotide sequence is integrated in an miRNA-33 scaffold. A ‘modulatory polynucleotide’ refers to a synthetic genetic material designed to influence or interfere with the expression of a specific target gene. For example, the current Docket No. P38844 invention provides in some aspects small interfering RNA (siRNA) to enable the precise regulation of gene expression at the post-transcriptional level. In some aspect of the present invention, an inhibitory RNA (RNAi) molecules is embedded into an miRNA scaffold. Preferably, the current invention provides for modulatory polynucleotides that encode a miRNA scaffold comprising an inhibitory RNA (RNAi) molecule. One preferred example of such modulatory polynucleotide encoding a miRNA scaffold comprising an RNAi molecule is a single stranded DNA (e.g. packaged into a viral vector) that encodes a miRNA scaffold comprising an RNAi molecule according to the present invention. By targeting specific mRNA sequences corresponding to the gene of interest, the modulatory polynucleotide can effectively modulate gene expression. The modulatory polynucleotide as herein described can be described by RNA sequences, as for example the exemplary sequences of SEQ ID NOs 45-86. Or alternatively, the modulatory polynucleotides can be described by DNA sequences encoding the relevant RNA sequences forming the RNAi molecules, as for example the exemplary sequences of SEQ ID NOs 109-124. The current invention is based, at least in part, on the finding that the miRNA scaffold miR33 is advantageous for the suppression of an endogenous gene product in particular such as an ACTA1 gene, especially when used in a recombinant adeno-associated viral particle. Table 1: Examples of miRNA scaffolds Species Sequence identifier miR517a SEQ ID NO: 89 miR30a SEQ ID NO: 90 miR155(eSIBR) SEQ ID NO: 91 miR450b SEQ ID NO: 92 mmu-pri-miR-33 SEQ ID NO: 93 miR16-2(3G) SEQ ID NO: 94 Docket No. P38844 miR802 SEQ ID NO: 95 MicroRNAs have emerged in recent years as important regulators of cell function in both normal and diseased cells. MiRNAs coordinately regulate large suites of target genes by mRNA degradation and / or translational inhibition. The mRNA target specificities of miRNAs in animals are primarily encoded within a 7 nt ‘seed region’ mapping to positions 2–8 at the molecule's 5′ end. The results indicate that a substitution of even a single nucleotide within the seed region changes the spectrum of mRNA targets by >50%. The high functional cost of even single nucleotide changes within seed regions is consistent with their high sequence conservation among miRNA families both within and between species and suggests processes that may underlie the evolution of miRNA regulatory control (see, e.g., Hill, C.G., et al., PloS One 9 (2014) e115241). Modulatory polynucleotide Herein disclosed are novel modulatory polynucleotides. A ‘polynucleotide’ refers to a polymer chain of a plurality of nucleotide monomers linked by bonds between the monomers, typically phosphodiester bonds (e.g. in the case of polynucleotides formed by naturally-occurring nucleotide monomers). Polynucleotides include oligonucleotides, which generally comprise ≤50 nucleotides. A polynucleotide may be single- stranded, or may be double-stranded (i.e. may comprise a duplex formed by hydrogen-bonding between complementary nucleotides). Polynucleotides according to the present disclosure may comprise or consist of: single-stranded DNA, double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single-stranded RNA, double-stranded RNA, RNA that is mixture of single- and double-stranded regions, single-stranded molecules comprising DNA and RNA, double-stranded molecules comprising DNA and RNA, and molecules comprising DNA and RNA having a mixture of single- and double-stranded regions. Docket No. P38844 In some aspects, a polynucleotide comprises or consists of DNA. In some embodiments, a polynucleotide is a polydeoxyribonucleotide. In some embodiments, a polynucleotide comprises or consists of RNA. In some embodiments, a polynucleotide is a polyribonucleotide. In aspects wherein the polynucleotide of the present disclosure is defined by reference to a given nucleotide sequence, and wherein the given nucleotide sequence comprises or consists of RNA and / or is a polyribonucleotide, it will be appreciated that instances of ‘T’ forthymidine in such sequences are replaced with ‘U’, for uracil.The present disclosure also contemplates polynucleotides comprising modified nucleotides, e.g. in which the phosphate and / or ribose and / or base of a deoxyribonucleotide or ribonucleotide is / are chemically modified. Nucleotide modifications contemplated in accordance with the present disclosure include those described in Hu et al., Sig. Transduc. Tar. Ther. (2020) 5(101), which is hereby incorporated by reference in its entirety. Phosphate modifications may be selected from phosphorothioate (e.g. Rp isomer, Sp isomer), phosphorodithioate, methylphosphonate, methoxypropylphosphonate, 5'-(E)- vinylphosphonate, 5'-methylphosphonate, (S)-5'-C-methyl with phosphate, 5’-phosphorothioate, and peptide nucleic acid modifications. Ribose modifications may be selected from 2'-O- methyl, 2'-O-methoxyethyl, 2’-fluoro, 2’-deoxy-2’-fluoro, 2'-methoxyethyl, 2'-O-alkyl, 2'-O- allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, 2'-arabino-fluoro, 2’-O-benzyl, 2’-O-methyl-4-pyridine, locked nucleic acid, (S)-cEt-BNA, tricyclo-DNA, PMO, unlocked nucleic acid, hexitol nucleic acid and glycol nucleic acid modifications. Base modifications may be selected from pseudouridine, 2'-thiouridine, N6'-methyladenosine, 5’-methylcytidine, 5’-fluoro-2’- deoxyuridine, N-ethylpiperidine 7'-EAA triazole-modified adenine, N-ethylpiperidine 6'- triazole-modified adenine, 6'-phenylpyrrolo-cytosine, 2',4'-difluorotoluyl ribonucleoside and 5'- nitroindole modifications. In some aspects, a modified nucleotide may be selected from 2'-O-methyluridine-3'- phosphate, 2'-O-methyladenosine-3'-phosphate, 2'-O-methylguanosine-3'-phosphate, 2'-O- methylcytidine-3'-phosphate, 2'-O-methyluridine-3'-phosphorothioate, 2'-O-methyladenosine- 3'-phosphorothioate, 2'-O-methylguanosine-3'-phosphorothioate, 2'-O-methylcytidine-3'- phosphorothioate, 2'-fluorouridine-3'-phosphate, 2'-fluoroadenosine-3'-phosphate, 2'- fluoroguanosine-3'-phosphate, 2'-fluorocytidine-3'-phosphate, 2'-fluorocytidine-3'- Docket No. P38844 phosphorothioate, 2'-fluoroguanosine-3'-phosphorothioate, 2'-fluoroadenosine-3'- phosphorothioate, and 2'-fluorouridine-3'-phosphorothioate. In some aspects, the modulatory polynucleotide inhibits activity of a target gene. ‘Inhibits activity of a target gene’ refers to the prevention or reduction of the expression or function of a specific gene (target gene). Various methods and compounds can result in inhibition of the activity of a target gene, such as gene silencing, or gene knockdown. Methods to measure the expression or activity of a target gene are known in the art and also herein described for example in the Examples and the section Functional Properties of the Polynucleotides. In some aspects, the target gene is a mutated endogenous gene in a cell or a subject. A mutated endogenous gene refers to a gene that is naturally present within an organism (endogenous) but has undergone changes in its DNA sequence (mutation). These mutations can occur naturally due to errors in DNA replication or as a result of environmental factors like radiation or certain chemicals. Depending on where they occur and their nature, these mutations can lead to changes in the function of the gene, which can potentially lead to diseases or disorders. In some aspects, the modulatory polynucleotide is an isolated modulatory polynucleotide. An isolated modulatory polynucleotide is one which has been separated from a component of its natural environment (if it exists in nature). In some aspect, the modulatory polynucleotide comprises or encodes an inhibitory RNA (RNAi molecule). ‘Inhibitory RNA’ refers to a type of RNA molecule that is involved in regulating gene expression, often by silencing or inhibiting the activity of specific genes. The most common types of inhibitory RNAs are small interfering RNAs (siRNAs) and microRNAs (miRNAs). These molecules can bind to messenger RNAs (mRNAs) and prevent them from being translated into proteins, effectively reducing or inhibiting the expression of the target gene. This mechanism is used by cells to regulate gene expression and can also be exploited for research or therapeutic purposes. In some aspects, the activity of the target gene is expression of the target gene. In some aspects, the modulatory polynucleotide silences a target gene. Silencing a gene or gene silencing refers to a mechanism by which gene expression is reduced, Docket No. P38844 turned off (or silenced). Gene silencing can occur either during transcription or translation. In some aspects, the modulatory polynucleotide reduces or inhibits target gene expression. In some aspect, the modulatory polynucleotide sequence comprises or encodes a ‘sense strand’ sequence and an ‘antisense strand’ sequence. The sense stand, also known as the coding strand, has the same or a highly similar sequence of a part of the mRNA of a target gene. The antisense strand is complementary to the sense strand, i.e. its sequence is identical or highly similar to the complementary sequence of the sense strand. Sense and antisense strand is typical nomenclature for siRNA molecules. For miRNA molecules, the antisense strand and the sense strand are usually referred to as guide and passenger strand, respectively. The siRNA antisense strand and the miRNA guide strand are instrumental in targeting and downregulating gene expression by directing the RNA-induced silencing complex (RISC) to complementary mRNA sequences for cleavage or repression. Conversely, the siRNA sense strand, akin to the miRNA passenger strand, typically serves a regulatory function by being degraded, ensuring the specificity and efficiency of the gene silencing process. In Table 3, sequences labeled as antisense (strand) sequences do also refer to the respective guide strand sequences (e.g. SEQ IDNOs 45-88). Similarly, sequences labeled as sense (strand) sequences do also refer to therespective passenger strand sequences (e.g. SEQ ID NOs 128-171). And in the specific embodiments below, references to antisense strand sequences also include the respective reference to guide strand sequences. And references to sense strand sequences also include the respective reference to passenger strand sequences. The term ‘complementary nucleotide sequence’ refers to a sequence of DNA or RNA bases that can form specific base pairs with another nucleotide sequence by following the rules of base pairing. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G), while in RNA, uracil (U) replaces thymine. Consequently, a complementary nucleotide sequence will have bases that can form hydrogen bonds with their corresponding bases in another sequence, allowing the two sequences to pair together and form a double- stranded structure. In some aspect, the sense strand sequence comprises at least 20 contiguous nucleotides and the antisense strand sequence comprises at least 20 contiguous nucleotides. In a preferred aspect, the sense strand sequence comprises at least 21 contiguous nucleotides and the antisense strand sequence comprises at least 21 contiguous nucleotides. In some aspect, the Docket No. P38844 sense strand sequence comprises at least 22 contiguous nucleotides and the antisense strand sequence comprises at least 22 contiguous nucleotides. In some aspect, the sense strand sequence comprises at least 23 contiguous nucleotides and the antisense strand sequence comprises at least 23 contiguous nucleotides. In some aspect, the sense strand sequence comprises at least 24 contiguous nucleotides and the antisense strand sequence comprises at least 24 contiguous nucleotides. In some aspect, the sense strand sequence comprises at least 23 contiguous nucleotides and the antisense strand sequence comprises at least 23 contiguous nucleotides. In some aspect, the sense strand sequence comprises at least 25 contiguousnucleotides and the antisense strand sequence comprises at least 25 contiguous nucleot ides.In some aspect, the target gene is an actin gene. ‘Actin gene’ refers to any gene that encodes for actin, a family of globular multi-functional proteins that form microfilaments. Actin is one of the most highly conserved proteins and plays a key role in various types of cell motility, structure, and integrity. In humans, there are six actin isoforms, each encoded by a different gene. These include four alpha actins (found in muscle tissues) and two beta / gamma cytoplasmic actins. Mutations in actin genes can lead to various diseases, including a group of conditions known as actinopathies. In some aspect, the target gene is ACTA1. In some aspects the target gene is human ACTA1 (exemplary references: HGNC:129, NM_001100). In some aspect, the modulatory polynucleotide inhibits or suppresses the expression of the ACTA1 gene. In some aspect, the ACTA1 gene is the wild-type ACTA1 gene, a mutated ACTA1 gene with at least onepathogenic mutation or both. In some aspect, the ACTA1 gene is a mutated ACTA1 gene wit hat least one pathogenic mutation. A ‘pathogenic mutation’ refers to a change in the DNA sequence that leads to a disease or disorder. For example, the mutation can alter the function of a gene, resulting in a protein that does not function properly or is not produced at a non- pathogenic level. In some aspect, the antisense strand (or guide strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, Docket No. P38844 SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, and SEQ ID NO: 86. In a preferred aspect, the antisense strand (or guide strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 82, and SEQ ID NO: 84. In a more preferred aspect, the antisense strand (or guide strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, and SEQ ID NO: 82. In some aspect, the sense strand (or passenger strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence reverse complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, and SEQ ID NO: 86, and wherein said sense strand sequence and antisense strand sequence share a region of complementarity of at least four nucleotides in length. In a preferred aspect, the sense strand (or passenger strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence reverse complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, SEQ Docket No. P38844 ID NO: 82, and SEQ ID NO: 84, and wherein said sense strand sequence and antisense strandsequence share a region of complementarity of at least four nucleotides in length.In a more preferred aspect, the sense strand (or passenger strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence reverse complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, and SEQ ID NO: 82, and wherein said sense strand sequence and antisense strandsequence share a region of complementarity of at least four nucleotides in length.In some aspect, the sense strand (or passenger strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence selected from the group consisting of SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, and SEQ ID NO: 169. In a preferred aspect, the sense strand (or passenger strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence selected from the group consisting of SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 162, SEQ ID NO: 165, and SEQ ID NO: 167. In a more preferred aspect, the sense strand (or passenger strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence selected from the group consisting of SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 139, SEQ IDNO: 151, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 162, and SEQ ID NO: 165. Docket No. P38844 In some aspect, the modulatory polynucleotide is an siRNA. siRNA stands for small interfering RNA. These are double-stranded RNA molecules, typically 20-25 base pairs in length, that play a significant role in the RNA interference (RNAi) pathway, where they interfere with the expression of specific genes. The siRNA molecules bind to the RNA-induced silencing complex (RISC), guiding it to degrade messenger RNAs (mRNAs) that match the siRNA sequence, or inhibit their translation. This effectively silences the expression of the target gene. In some aspect, the siRNA has a length of 20 to 25 nucleotides. In one aspect, provided is an siRNA molecule that inhibits expression of ACTA1. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, and SEQ ID NO: 86. In a preferred aspect, provided is an siRNA molecule that inhibits expression of ACTA1. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 82, and SEQ ID NO: 84. In a more preferred aspect, provided is an siRNA molecule that inhibits expression of ACTA1. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected Docket No. P38844 from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, and SEQ ID NO: 82. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, and SEQ ID NO: 86, and wherein the sense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from the nucleotide sequence of the sense strand. In a preferred aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, and SEQ ID NO: 86, and wherein the antisense strand shares a region of complementarity of 21 in length to the sense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from the nucleotide sequence of the sense strand. Docket No. P38844 In a preferred aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 82, and SEQ ID NO: 84, and wherein the sense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the antisense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from the nucleotide sequence of the sense strand. In a preferred aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 82, and SEQ ID NO: 84, and wherein the sense strand shares a region of complementarity of 21 in length to the sense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from the nucleotide sequence of the sense strand. In a more preferred aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, and SEQ ID NO: 82, and wherein the sense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the antisense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from the nucleotide sequence of the sense strand. In a preferred aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 68, SEQ ID Docket No. P38844 NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, and SEQ ID NO: 82, and wherein the sense strand shares a region of complementarity of 21 in length to the sense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from the nucleotide sequence of the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 45, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from the nucleotide sequence of the sense strand. In some aspect, provided is an siRNA moleculethat inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense st rand andan antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ IDNO: 45, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 128.In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 46, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 46, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 129. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 47, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the Docket No. P38844 antisense strand comprises the nucleotide sequence of SEQ ID NO: 47, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 130. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 51, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 51, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 134. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 52, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 52, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 135. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 53, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 53, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 136. Docket No. P38844 In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 56, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 56, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 139. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 58, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 58, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 141. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 63, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 63, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 146. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 65, and wherein the antisense strand shares a region of complementarity of at least 20, Docket No. P38844 at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 65, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 148. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 66, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 66, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 149. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 68, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 68, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 151. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 74, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the Docket No. P38844 antisense strand comprises the nucleotide sequence of SEQ ID NO: 74, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 157. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 76, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 76, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 159. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 79, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 79, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 162. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 82, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 82, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 165. Docket No. P38844 In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 84, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand. In some aspect, provided is an siRNA molecule that inhibits expression of ACTA1, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 84, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 167. In some aspect, provided is a shRNA molecule that inhibits expression of ACTA1. shRNA stands for short hairpin RNA. It is a sequence of RNA that makes a tight hairpin turn and that can be used to silence target gene expression. Once inside the cell, the shRNA is cleaved by the enzyme Dicer into siRNA (small interfering RNA). These siRNAs can then incorporate into the RNA-induced silencing complex (RISC), which can degrade messenger RNAs or inhibit their translation, effectively reducing or inhibiting the expression of the target gene. In some aspects, provided is a shRNA molecule that inhibits expression of ACTA1, wherein the shRNA molecule comprises an siRNA molecule as described hereinabove. In some aspects, provided is a modulatory polynucleotide comprising a shRNA molecule that inhibits expression of ACTA1. In some aspects, provided is an miRNA scaffold comprising a modulatory polynucleotide as described hereinabove. In some aspects, the modulatory polynucleotide is embedded (integrated) into an miRNA scaffold. For example, parts of the complementary strands of the miRNA scaffold are replaced by the respective sequences of the modulatory polynucleotide (e.g. of the siRNA molecule). Embedding of the modulatory polynucleotide into an miRNA scaffold improves its stability and level of transcription. In some aspects, the miRNA scaffold is selected from the group consisting of miRNA- 517a, miR30a, miR155, miR450b, mmu-pri-miR-33, miR16-2(3G), and miR802. In a preferred aspect, the miRNA scaffold is an miRNA-33 scaffold (e.g. mmu-pri-miR-33). Exemplary miRNA-33 scaffold sequences are included herein below and in the appended Examples and Exemplary Sequences. In a particular aspect, the miRNA scaffold (without the modulatory polynucleotide, i.e. prior to embedding the modulatory polynucleotide in the miRNA scaffold) Docket No. P38844 comprises or consists of the polynucleotide sequence of SEQ ID NO: 93. In a preferred embodiment, the miRNA-33 scaffold comprises the sequence of SEQ ID NO: 93 or a sequence having at least 90 % sequence identity to SEQ ID NO: 93. In some aspect, the modulatory polynucleotide comprises a nucleotide sequence havingat least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nucleotidesequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, and SEQ ID NO: 124. In a preferred aspect, provided is a modulatory polynucleotide comprising a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, and SEQ ID NO: 123. In a most preferred aspect, provided is a modulatory polynucleotide comprising a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 122, and SEQ ID NO: 123. In one particular such most preferred aspect, the modulatory polynucleotide is selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 122, and SEQ ID NO: 123. In some aspect, the modulatory polynucleotide as described hereinabove (comprising an miRNA-33 scaffold comprising a modulatory polynucleotide) is operably linked to a promoter element. In some aspects, the promoter element is a promoter element selected from the list consisting of the ACTA1 promoter (NCBI gene ID 58, actin alpha 1), the CACNG1 promoter (NCBI gene ID 786, voltage-dependent calcium channel gamma-1 subunit), the MYBPC2 promoter (NCBI gene ID 4606, myosin binding protein C, fast type), the MYH2 promoter (NCBI gene ID 4620, myosin-2), the MYLPF promoter (NCBI gene ID 29895, and myosin regulatory light chain 2, skeletal muscle isoform), the MYBC1 promoter, the TTN promoter (NCBI gene ID Docket No. P38844 7273, titin), or fragments thereof that retain tissue specific expression, in particular skeletal muscle-specific expression. In aspects as described herein above, the promoter and / or promoter element preferably exhibits functional properties as described herein below. FUNCTIONAL PROPERTIES OF THE POLYNUCLEOTIDES In aspects and embodiments of the present disclosure, the modulatory polynucleotide of the present disclosure may be characterized by reference to one or more functional properties. Some of the very important functional properties of the provided modulatory polynucleotide comprising an miRNA-33 scaffold comprising a modulatory polynucleotide are stability of the scaffold, efficiency of transcription, and knock-down of the target gene, such as knock-down of endogenous ACTA1 (e.g. a mutated ACTA1 gene with at least one pathogenic mutation). In some embodiments, the modulatory polynucleotide inhibits expression of ACTA1. The term 'inhibits expression' of a gene in the context of RNA interference refers to the process by which the activity or production of a specific gene's protein product is suppressed or reduced through the introduction of small interfering RNA (siRNA) or microRNA (miRNA) molecules. These RNA molecules can selectively bind to the complementary messenger RNA (mRNA) molecules, leading to their degradation or the inhibition of their translation into proteins. This targeted interference at the RNA level effectively reduces the expression of the corresponding gene, offering a precise mechanism for regulating gene activity in a variety of biological processes and applications, including gene function studies and therapeutic interventions.. In some embodiments, skeletal muscle cells comprising a modulatory polynucleotide of the present invention have reduced or absent expression of an endogenous ACTA1 (e.g. a mutated ACTA1 gene with at least one pathogenic mutation). In a preferred embodiment, skeletal muscle cells comprising a modulatory polynucleotide of the present disclosure substantially do not express endogenous ACTA1 (e.g. a mutated ACTA1 gene with at least one pathogenic mutation). Docket No. P38844 In some embodiments, cells that substantially do not express an endogenous ACTA1 may display a level of expression which is less than 0.2 times, e.g. one of ≤0.1 times, ≤0.09 times, ≤0.08 times, ≤0.07 times, ≤0.06 times, ≤0.05 times, ≤0.04 times, ≤0.03 times, ≤0.02 times, or ≤0.01 times the level of expression by cells that express endogenous ACTA1. In some embodiments, cells that ‘express’ endogenous ACTA1 may display a level of expression which is greater than 5 times, e.g. one of ≥10 times, ≥20 times, ≥50 times, ≥100 times, ≥1000 times, ≥5000 times or ≥10000 times level of expression by cells that substantially do not express endogenous ACTA1. Expression of a (target) gene can be evaluated using any suitable technique for the detection and / or quantification of the relevant polypeptide encoded by the gene. Such techniques include e.g. antibody-based methods, for example immunocytochemistry (e.g. Western blot, ELISA), fluorescence microscopy and flow cytometry. Expression of a target gene can also be measured on the mRNA level. Methods for measuring mRNA levels include techniques such as Reverse Transcription Polymerase Chain Reaction (RT-PCR), Quantitative PCR (qPCR) or Real-Time PCR, RNA Sequencing (RNA-Seq), Northern Blotting, and Microarrays. In some embodiments, expression of a polypeptide of interest can be evaluated asdescribed in the experimental examples of the present disclosure.For example, the expression level of endogenous ACTA1 can be measured in a target cell (for example in a skeletal muscle cell or cell line) and the expression in the target cell can be compared to the expression of the same cell type or cell line comprising the nucleic acid comprising an miRNA-33 scaffold and modulatory polynucleotide as hereinabove described. A ratio between the expression of the endogenous ACTA1 in the cell without the nucleic acid comprising an miRNA-33 scaffold comprising the modulatory polynucleotide and the cell with the nucleic acid comprising an miRNA-33 scaffold comprising the modulatory polynucleotide can be calculated to illustrate knock-down efficacy. In some aspects, the ratio of i) the expression level of endogenous ACTA15 days after transduction with an AAV of the serotype 2 comprising miRNA-33 scaffold comprising the modulatory polynucleotide operable linked to a promoter at an MOI of 20,000 to ii) the expression level of endogenous ACTA15 days after transduction with the same AAV at an MOI of 20,000 is 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less, 0.1 or less, 0.01 or less, 0.001 or less.In some aspects, the expression of endogenous ACTA1 expression is determined by qPCR. Docket No. P38844 Exemplary miRNA-33 scaffolds comprising a modulatory polynucleotide exhibiting such functional properties include polynucleotides having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 122, and SEQ ID NO: 123. It will be appreciated that the functional properties described herein are evaluated employing the similar (or the same) experimental conditions for the evaluation of cells comprising the different modulatory polynucleotide. However, some experimental conditions might need to be adjusted, for example depending on the type of cells. Adjustment of the experimental conditions to a specific type of cells can be done according to methods known in the field and as described in the experimental section. Expression system In some embodiments, provided is an expression system comprising amodulatory polynucleotide as described hereinabove. In some embodiments, the modulatory polynucleotide comprises an miRNA-33 scaffold comprising a modulatory polynucleotide as described hereinabove. In some embodiments, the modulatory polynucleotide is operably linked to a polynucleotide encoding a polypeptide of interest. The term ‘operably linked’ may include the situation where a nucleic acid sequence (e.g. comprising a modulatory polynucleotide or a polynucleotide sequence encoding a polypeptide of interest according to the present disclosure) and regulatory nucleic acid sequence(s) (e.g. promoters and / or enhancers) are covalently linked in such a way as to place the expression of the modulatory polynucleotide under the influence or control of the regulatory nucleic acid sequence(s) (thereby forming an expression cassette). Thus, a regulatory sequence is operably linked to the selected nucleic acid sequence if the regulatory sequence is capable of effecting transcription of the nucleic acid sequence. The resulting transcript(s) may then be a modulatorypolynucleotide, or it / they may be translated into the desired polypeptide(s) of interest.In some embodiments, a polypeptide of interest is a polypeptide suitable for use in therapy or prophylaxis of a disease / condition. In some embodiments, the polypeptide of interest is an actin gene. In some embodiments, the polypeptide of interest is ACTA1. In some embodiments, the polypeptide of interest replaces a mutated ACTA1 (such as e.g. in gene Docket No. P38844 replacement therapy). In some embodiments, the mutated ACTA1 is associated with a disease or condition. In some embodiments, the mutated ACTA1 is associated with a congenital myopathy, such as for example nemaline myopathy, intranuclear rod myopathy, actin filament aggregate myopathy, congenital fiber type disproportion and myopathy with core-like areas. In some embodiments, the polynucleotide encoding a polypeptide of interest (e.g. ACTA1) is codon optimized. ‘Codon optimization’ refers to the process of altering the DNA sequence of a gene to improve its expression in a host organism, without changing the protein that the gene encodes. This is achieved by changing the codons (the three-letter sequences in mRNA that specify a particular amino acid in the protein being made) to those most frequently used in the host organism. This can increase the rate of protein production and the amount of protein produced. In the context of polynucleotides, ‘codon optimized’ would refer to apolynucleotide sequence that has been altered in this way to improve its expression.In some aspect, the polypeptide of interest comprises or consists of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity toa sequence selected from Column E of Table 2, or a fragment thereof that retains its activity.The modulatory polynucleotide of the present invention may comprise additional nucleotide sequences and / or sequence features in addition to the modulatory polynucleotide and the polynucleotide encoding a polypeptide of interest. The expression system of the present disclosure may comprise a start codon 5’ to ( i.e.upstream of, in the context of the nucleotide sequence of the polynucleotide) the polynucleotide sequence encoding a polypeptide of interest (e.g. ACTA1). The start codon is preferably the trinucleotide ‘ATG’. In some embodiments, the expression system of the present invention further comprises a Kozak sequence. In preferred embodiments, the Kozak sequence is provided immediately upstream of the start codon for initiating translation of the polypeptide of interest (e.g. ACTA1). In some embodiments, the expression system of the present invention further comprises one or more promoter sequences. The one or more promoter sequences are preferably 5’ to the Docket No. P38844 polynucleotide encoding a polypeptide of interest (e.g. ACTA1) and / or the modulatory polynucleotide comprising an miRNA-33 scaffold according to the present disclosure. In some embodiments, the expression system of the present invention comprises a 5'UTR. The term 5'UTR stands for 5' Untranslated Region. This region is transcribed but is not translated into protein. The 5'UTR can contain regulatory elements and can modulate the stability of the mRNA, its localization, and the rate of protein synthesis. In some embodiments, the 5'UTR is operably linked to the synthetic skeletal muscle-specific promoter of the present disclosure. In some embodiments, the 5'UTR comprises an intron. In preferred embodiments, the intron consists of fewer nucleotides than the number of nucleotides of a known (e.g. naturally- occurring) intron. In some aspect, the 5'UTR does not comprise a complete naturally occurring promoter intron. In some aspects, the intron is a truncated natural or synthetic intron. In some aspect, the 5'UTR does not comprise an intron. In some embodiments, the 5'UTR comprises or consists of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from Column B, C, and / or D of Table 2. In some embodiments, the expression system of the present invention further comprisesa stop codon. The stop codon is preferably provided immediately 3’ to ( i.e. downstream of, inthe context of the nucleotide sequence of the polynucleotide) the trinucleotide encoding the terminal amino acid of a polypeptide of interest (e.g. ACTA1). In some embodiments, the expression system of the present invention further comprises a polyadenylation signal sequence. In preferred embodiments, the polyadenylation signal sequence is provided 3’ to (i.e. downstream of, in the context of the nucleotide sequence of the polynucleotide) the nucleotide sequence encoding a polypeptide of interest (e.g. ACTA1). In some embodiments, the expression system of the present invention further comprises a terminator sequence. The terminator sequence is preferably 3’ to the nucleotide sequence encoding a polypeptide of interest (and 3’ to the polyadenylation signal sequence, when present). Docket No. P38844 In some embodiments, the expression system of the present invention comprises a 3'UTR. The term 3'UTR stands for 3' Untranslated Region. This region is transcribed but is not translated into protein. The 3'UTR refers to the polynucleotide sequence that follows the stopcodon and typically includes the polyadenylation signal.In some embodiments, the 3'UTR comprises or consists of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from Column H and / or I of Table 2. In preferred embodiments, the constituent nucleotide sequences of the expression system of the present invention are provided immediately adjacent to one another. However, in some embodiments, the polynucleotide further comprises one or more linker nucleotide sequences between one or more of the constituent nucleotide sequences of the expression system of the present invention. Linker nucleotide sequences may comprise, or consist of, 1-10, e.g. one of 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 nucleotides. Where an expression system of the present invention according to the present disclosure comprises one more linker nucleotide sequences, the linker sequences are preferably selected such that they do not alter the amino acid sequence of a polypeptide encoded by the polynucleotide. In preferred embodiments, where an expression system of the present invention according to the present disclosure comprises one more linker sequences, the expression system of the present invention encodes the same polypeptide as the equivalent expression system of the present invention lacking the linker nucleotide sequence(s). In some embodiments, the expression system of the present invention further comprises inverted terminal repeat (ITR) sequences. In some embodiments, the polynucleotide comprises an ITR 5’ to the promo ter and / orenhancer sequences, when present. In some embodiments, the polynucleotide comprises an ITR 3’ to the nucleotide sequence encoding a polypeptide of interest (and 3’ to the stop codon, polyadenylation signal sequence and / or terminator sequence, when present). In some embodiments, the 5'ITR comprises or consists of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from Column A of Table 2. Docket No. P38844 In some embodiments, the 3'ITR comprises or consists of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from Column J of Table 2. In some embodiments, the expression system of the present disclosure has a size permitting its delivery as a gene therapy, i.e. in a suitable vector. In some embodiments, the vector consists of a nucleotide sequence having a size within the packaging limit of a vector for delivering the polynucleotide. In some embodiments, the expression system has a size within the packaging limit of an AAV vector. In some embodiments, the expression system has a size within the packaging limit of an AAV vector of one of the following serotypes: AAV9, AAV9.45, AAV-PHP.eB, AAV1, AAV2, AAV2i8, AAV5, AAV6, AAV8, AAV10 or AAVrh74. In some embodiments, the expression system of the present disclosure consists of fewer than 6,000 nucleotides, e.g. one of ≤5,000, ≤4,750, ≤4,500, ≤4,250, ≤4,000, ≤3,750, ≤3,500,≤3,250, ≤3,000, ≤2,750, ≤2,500, ≤2,250, ≤2,000, ≤1,750, ≤1,500, ≤1,250 or ≤1,000 nucleotides.In some embodiment, the expression system comprises an AAV stuffer sequence. Such stuffer sequence may be required for example to accommodate for different sizes of promoter element or of the polynucleotide encoding the protein of interest. In some embodiments, the expression system of the present disclosure comprises one or more nucleotide sequences encoding a selectable marker, to facilitate identification and / or selection of cells comprising / expressing a polypeptide of interest. Selectable markers include proteins that confer resistance to antibiotics or other toxins, e.g., blasticidin, ampicillin, neomycin, methotrexate, or tetracycline, and proteins that complement auxotrophic deficiencies. In some embodiments, the expression system of the present disclosure comprises a nucleotide sequence encoding an internal ribosome entry site (IRES). In some embodiments, the expression system of the present disclosure comprises a nucleotide sequence permitting twoor more polypeptides to be translated separately from a single polyribonucleotide.The expression system of the present disclosure may be provided in purified or isolated form, i.e. from other nucleic acid, or naturally-occurring biological material. Docket No. P38844 In some embodiments, the expression system of the present disclosure is a vector. A ‘vector’ as used herein refers to a polynucleotide used as a vehicle to transfer exogenous nucleicacid into a cell. The vector may be a vector for expression of the nucleic acid in the cell ( i.e. thevector may be an expression vector). Such vectors may include a promoter sequence operably linked to the nucleotide sequence to be expressed. Vectors may also include a termination codon and expression enhancers. Any suitable vectors, promoters, enhancers and termination codons known in the art may be used in a vector according to the present disclosure. Vectors contemplated in connection with the present disclosure include DNA vectors, RNA vectors, plasmids (e.g. conjugative plasmids (e.g. F plasmids), non-conjugative plasmids, R plasmids, col plasmids, episomes), viral vectors (e.g. retroviral vectors, e.g. gammaretroviral vectors (e.g. murine Leukemia virus (MLV)-derived vectors, e.g. SFG vector), lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, vaccinia virus vectors, baculoviral vectors and herpesvirus vectors), transposon-based vectors, and artificial chromosomes (e.g. yeast artificial chromosomes), e.g. as described in Maus et al., Annu Rev Immunol (2014) 32:189-225 and Morgan and Boyerinas, Biomedicines (2016) 4:9, which are both hereby incorporated by reference in their entirety. In some embodiments, the vector may be a eukaryotic vector, i.e. a vector comprising the elements necessary for expression of protein from the vector in a eukaryotic cell. In some embodiments, the vector may be a mammalian vector, e.g. comprising a cytomegalovirus (CMV) or SV40 promoter to drive protein expression. In some embodiments, the vector comprises a CMV (e.g. mCMV), SV40, RSV or PGK promoter. In some embodiments, a vector is selected based on tropism for a cell type / tissue / organ to which it is desired to deliver the expression system according to the present disclosure. In some embodiments, a vector is selected based on tropism for a cell type / tissue / organ in which it is desired to express the polypeptide of interest. For example, it may be desired to deliver the expression system to, and / or express the polypeptide of interest in, a cell type / tissue / organ affected by a disease / condition to be treated / prevented in accordance with the present disclosure (e.g. a cell type / tissue / organ in which the symptoms of the disease / condition manifest). Docket No. P38844 For example, it might be desirable to deliver an expression system of the present disclosure encoding a polypeptide of interest (e.g. ACTA1) to skeletal muscle tissue, andvectors having a tropism for such cells / tissue may be employed in such instances.In preferred embodiments, the vector is an adeno-associated virus (AAV) vector. Adeno-associated virus vectors and their use to vector gene therapy is reviewed e.g. in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378 and Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272, both of which are hereby incorporated by reference in their entirety. In some embodiments, a vector may be an adeno-associated virus vector described in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378. In some embodiments, a vector may be an adeno- associated virus vector described in Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272. In some embodiments, the vector is a self-complementary adeno-associated virus (scAAV) vector. Self-complementary adeno-associated virus vectors are described e.g. in McCarty, Mol Ther. (2008) 16(10):1648-56, which is hereby incorporated by reference in its entirety. Conventional AAV have a single-stranded DNA genome, and depend on the DNA replication machinery of a transduced cell to synthesize the complementary strand, delaying transgene expression. By contrast, scAAV contain complementary sequences that spontaneously anneal upon infection, eliminating the requirement for DNA synthesis in the transduced host cell. Compared to classical, single-stranded AAV vectors, scAAV vectors have been shown to provide for accelerated onset of transgene expression, and an increased level of transgene expression. In some embodiments, a vector may be an adeno-associated viral vector of one of the following serotypes: AAV9 (including AAV9 variants AAV-PHP.eB and AAV9.45), AAV1, AAV2 (including AAV2 variant AAV2i8), AAV5, AAV6, AAV8, AAV10 or AAVrh74. In some embodiments, the vector is an AAV9 vector. In some embodiments a vector comprises modification to increase binding to and / or transduction of a cell-type of interest (i.e. as compared to the level of binding / transduction by the unmodified vector). In some embodiments modification is to a capsid protein. In some embodiments a vector comprises a capsid protein comprising a cell-targeting peptide. In some embodiments the cell-targeting peptide is a cell-targeting peptide described in Büning and Srivastava, Molecular Therapy: Methods & Clinical Development (2019) 12: 248- Docket No. P38844 265, which is hereby incorporated by reference in its entirety, e.g. a cell-targeting peptide shown in Table 1, 2, 3 or 4 thereof. In some embodiments a vector comprises a capsid protein comprising substitution to one or more tyrosine residues, e.g. one or more surface-exposed tyrosine residues. In some embodiments, one or more tyrosine residues of the capsid protein are substituted with phenylalanine. In some embodiments a vector comprises a capsid protein in which one or more tyrosine residues are substituted with another amino acid as described in Iida et al., Biomed Res Int. (2013) 2013: 974819, which is hereby incorporated by reference in its entirety. In some embodiments, a vector may be an adeno-associated virus vector described in Büning and Srivastava, supra. In some embodiments, a vector may be an adeno-associated virus vector described in Iida et al., supra. In some embodiments the vector comprises a control element for inducible expression of the expression system of the disclosure. In some embodiment, provided is an adeno-associated virus (AAV), comprising a vector genome, wherein the vector genome comprises in 5’ to 3’ order: (i) a 5' inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) optionally, a 5' UTR sequence; (iv) a codon optimized polynucleotide encoding ACTA1; (v) a 3' UTR sequence; and (vi) a 3' inverted terminal repeat (ITR) sequence, wherein the vector genome comprises a modulatory polynucleotide that inhibits expression of both a wild-type ACTA1 gene and a mutated ACTA1 gene with at least one pathogenic mutation, wherein the modulatory polynucleotide comprises a polynucleotide sequence having at least 85 % sequence identity to a sequence selected from the group consisting of group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ Docket No. P38844 ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, and SEQ ID NO: 123. In some embodiment, provided is an adeno-associated virus (AAV), comprising a vector genome, wherein the vector genome comprises in 5’ to 3’ order: (i) a 5' inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) optionally, a 5' UTR sequence; (iv) a codon optimized polynucleotide encoding ACTA1; (v) a 3' UTR sequence; and (vi) a 3' inverted terminal repeat (ITR) sequence, wherein the vector genome comprises a polynucleotide selected from the group consisting of group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, and SEQ ID NO: 123. In some embodiment, provided is an adeno-associated virus (AAV), comprising a vector genome, wherein the vector genome comprises in 5’ to 3’ order: (i) a 5' inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) a 5' UTR sequence comprising a modulatory polynucleotide that inhibits expression of of both a wild-type ACTA1 gene and a mutated ACTA1 gene with at least one pathogenic mutation, wherein the modulatory polynucleotide comprises a polynucleotide sequence having at least 85 % sequence identity to a sequence selected from the group consisting of group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, and SEQ ID NO: 123; Docket No. P38844 (iv) a codon optimized polynucleotide encoding ACTA1; (v) a 3' UTR sequence; and (vi) a 3' inverted terminal repeat (ITR) sequence. In some embodiment, provided is an adeno-associated virus (AAV), comprising a vector genome, wherein the vector genome comprises in 5’ to 3’ order: (i) a 5' inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) a 5' UTR sequence comprising a polynucleotide sequence selected from the group consisting of group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, and SEQ ID NO: 123; (iv) a codon optimized polynucleotide encoding ACTA1; (v) a 3' UTR sequence; and (vi) a 3' inverted terminal repeat (ITR) sequence. In some embodiment, provided is an adeno-associated virus (AAV), comprising a vector genome, wherein the vector genome comprises in 5’ to 3’ order (i) a 5' inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) optionally a 5' UTR; (iv) a codon optimized polynucleotide encoding ACTA1, wherein the polynucleotide encoding a codon optimized polynucleotide encoding ACTA1 additionally comprises a modulatory polynucleotide that inhibits expression of of both a wild-type ACTA1 gene and a mutated ACTA1 gene with at least one pathogenic mutation, wherein the modulatory polynucleotide comprises a polynucleotide sequence having at least 85 % sequence identity to a sequence selected from the group consisting of group consisting of SEQ ID NO: 109, SEQ ID Docket No. P38844 NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, and SEQ ID NO: 123; (v) a 3' UTR sequence; and (vi) a 3' inverted terminal repeat (ITR) sequence. In some embodiment, provided is an adeno-associated virus (AAV), comprising a vector genome, wherein the vector genome comprises in 5’ to 3’ order (i) a 5' inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) optionally a 5' UTR; (iv) a codon optimized polynucleotide encoding ACTA1, wherein the polynucleotide encoding a codon optimized polynucleotide encoding ACTA1 additionally comprises a modulatory polynucleotide that inhibits expression of of both a wild-type ACTA1 gene and a mutated ACTA1 gene with at least one pathogenic mutation, wherein the modulatory polynucleotide comprises a sequence selected from the group consisting of group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, and SEQ ID NO: 123; (v) a 3' UTR sequence; and (vi) a 3' inverted terminal repeat (ITR) sequence. In any of the above provided AAV, the modulatory polynucleotide does not inhibitexpression of the codon optimized polynucleotide encoding ACTA1.In some embodiments, the AAV comprises (i) a 5' ITR sequence comprising or consisting of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or100% sequence identity to a sequence selected from Column A of Table 2.In some embodiments, the AAV comprises (ii) a promoter comprising or consisting of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from Column B of Table 2. Preferably, the promoter comprises Docket No. P38844 or consists of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 99. In some embodiments, the AAV comprises (iii) a 5'UTR comprising or consisting of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from Column B, C, and / or D of Table 2. In some embodiments, the AAV comprises (iv) a polynucleotide encoding a protein of interest comprising or consisting of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from Column E of Table 2. In some embodiments, the AAV comprises (v) a 3'UTR comprising or consisting of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequenceidentity to a sequence selected from Column H and / or I of Table 2.In some embodiments, the AAV comprises (vi) a 3'ITR comprising or consisting of anucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, o r 100% sequenceidentity to a sequence selected from Column J of Table 2. In some embodiments, the AAV additionally comprises a polynucleotide comprising or consisting of a nucleotide sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, or100% sequence identity to a sequence selected from Column F of Table 2.In some embodiments, provided is an adeno-associated virus (AAV) comprising from 5' to 3' the sequences A-G from one row selected from Table 2, optionally connected by a linker polynucleotide sequence. CELLS The present disclosure also provides a cell comprising a modulatory polynucleotide according to the present invention. Also provided is a cell comprising an expression systems (such as one or more vectors) according to the present invention. Docket No. P38844 The cell may be a eukaryotic cell, e.g. a mammalian cell. The mammal may be a primate (rhesus, cynomolgous, non-human primate or human) or a non-human mammal (e.g. rabbit, guinea pig, rat, mouse, hamster or other rodent (including any animal in the order Rodentia), cat, dog, pig, sheep, goat, cattle (including cows, e.g. dairy cows, or any animal in the order Bos), horse (including any animal in the order Equidae), donkey, and non-human primate). Inpreferred embodiments, the cell is a human cell.The present disclosure also provides a method for producing a cell comprising an expressing system / vector according to the present disclosure, the method comprising introducing an expression system / vector of the present disclosure into a cell. In some embodiments, introducing an expression system / vector according to the present disclosure into a cell comprises transformation, transfection, electroporation or transduction (e.g. adeno-associated viral transduction). In some embodiments, the expression system / vector isintroduced to the cell in vivo, e.g. by administration of a vector according to the present disclosure (e.g. a viral vector, e.g. an adeno-associated viral vector) to a subject. In some embodiments, the expression system / vector is introduced into cells in culture ex vivo or in vitro. Any suitable method may be employed to produce a cell according to the present disclosure. Such methods may comprise nucleic acid transfer for permanent (i.e. stable) or transient expression of the polynucleotide of the present disclosure. In some embodiments, following introduction into a cell, the polynucleotide may be integrated into or form part of the genomic DNA of the cell. In some embodiments, following introduction into a cell, the expression system / vector may be maintained extrachromosomally. Any suitable genetic engineering platform may be used, and include gammaretroviral vectors, lentiviral vectors, adenovirus vectors, DNA transfection, transposon-based gene delivery and RNA transfection, for example as described in Maus et al., Annu Rev Immunol. (2014) 32:189-225, hereby incorporated by reference in its entirety. Methods also include those described e.g. in Wang and Rivière Mol Ther Oncolytics. (2016) 3:16015, which is hereby incorporated by reference in its entirety. Suitable methods for introducing nucleicacid(s) / vector(s) into cells include transduction, transfection and electroporation. Docket No. P38844 In some embodiments, the methods additionally comprise maintaining the cell under conditions suitable for expression of the vector / polypeptide of interest by the cell. The present disclosure also provides cells obtained or obtainable by the methods according to the present disclosure. COMPOSITIONS The present disclosure also provides compositions comprising the modulatory polynucleotide, expression systems, vectors and cells described herein. In particular, the present disclosure provides pharmaceutical compositions and medicaments comprising the modulatory polynucleotide, expression systems, vectors and cells of the present disclosure. Such compositions may comprise the relevant article (i.e. the modulatory polynucleotide / expression system / vector / cell) in a formulation suitable for clinical use. The present disclosure is concerned in particular with pharmaceutical compositions / medicaments comprising vectors according to the present disclosure. The compositions of the present disclosure may comprise one or more pharmaceutically- acceptable carriers (e.g. liposomes, micelles, microspheres, nanoparticles), diluents / excipients (e.g. starch, cellulose, a cellulose derivative, a polyol, dextrose, maltodextrin, magnesium stearate), adjuvants, fillers, buffers, preservatives (e.g. vitamin A, vitamin E, vitamin C, retinyl palmitate, selenium, cysteine, methionine, citric acid, sodium citrate, methyl paraben, propyl paraben), anti-oxidants (e.g. vitamin A, vitamin E, vitamin C, retinyl palmitate, selenium), lubricants (e.g. magnesium stearate, talc, silica, stearic acid, vegetable stearin), binders (e.g.sucrose, lactose, starch, cellulose, gelatin, polyethylene glycol (PEG), polyvinylpyrrolidone(PVP), xylitol, sorbitol, mannitol), stabilisers, solubilisers, surfactants (e.g., wetting agents), masking agents or colouring agents (e.g.titanium oxide). The term ‘pharmaceutically-acceptable’ as used herein pertains to compounds, ingredients, materials, compositions, dosage forms, etc., which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of the subject in question (e.g. a human subject) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. Each carrier, diluent, excipient, adjuvant, filler, buffer, preservative, anti-oxidant, lubricant, binder, stabiliser, Docket No. P38844 solubiliser, surfactant, masking agent, colouring agent, flavouring agent or sweetening agent of a composition according to the present disclosure must also be ‘acceptable’ in the sense of being compatible with the other ingredients of the formulation. Suitable carriers, diluents, excipients, adjuvants, fillers, buffers, preservatives, anti-oxidants, lubricants, binders, stabilisers, solubilisers, surfactants, masking agents, colouring agents, flavouring agents or sweetening agents can be found in standard pharmaceutical texts, for example, Remington’s ‘The Science and Practice of Pharmacy’ (Ed.(A)Adejare), 23rd Edition (2020), Academic Press. The pharmaceutical compositions / medicaments according to the present disclosure may be formulated for administration to a subject, e.g. administration via a route of administration as appropriate for the nature of the therapeutic agent and the disease to be treated / prevented. In some embodiments, a pharmaceutical composition / medicament may be formulated for parenteral, systemic, topical, intracavitary, intravascular, intravenous, intra-arterial, intramuscular, intrathecal, intraocular, intraconjunctival, intratumoral, subcutaneous, intradermal, oral or transdermal administration. In some embodiments, a pharmaceutical composition / medicament may be formulated for administration by injection or infusion, or administration by ingestion. Medicaments and pharmaceutical compositions may be formulated for administration to a blood vessel, or to a tissue / organ of interest (e.g. a tissue / organ affected by a disease / condition, e.g. a tissue / organ in which symptoms of the disease / condition manifest). The pharmaceutical compositions / medicaments may comprise the modulatory polynucleotide / expression system / vector / cell in a sterile or isotonic medium. The pharmaceutical compositions / medicaments may be provided in fluid, including gel, form. Fluid formulations may be formulated for administration by injection or infusion (e.g. via cannula) to a blood vessel, or a selected region of the human or animal body. The pharmaceutical compositions / medicaments may be provided in solid form, e.g. in lyophilised form. The present disclosure also provides methods for producing pharmaceutical compositions / medicaments according to the present disclosure. Such methods may comprise mixing a modulatory polynucleotide / expression system / vector / cell described herein with a pharmaceutically-acceptable carrier, diluent, excipient, adjuvant, filler, buffer, preservative, Docket No. P38844 anti-oxidant, lubricant, binder, stabiliser, solubiliser, surfactant, masking agent, colouring agent, flavouring agent or sweetening agent. Such methods generally include the step of bringing into association the modulatory polynucleotide / expression system / vector / cell with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing into association the active compound with carriers (e.g., liquid carriers, finely divided solid carrier, etc.), and then shaping the product, if necessary. Modulatory polynucleotide / expression systems, vectors, cells and compositions according to the present disclosure may be modified and / or formulated to facilitate delivery to, and / or uptake by, a cell type / tissue / organ of interest (e.g. a cell type / tissue / organ in which symptoms of a disease / condition manifest). Strategies for targeted delivery of polynucleotides are reviewed e.g. in Li et al., Int. J. Mol. Sci. (2015) 16: 19518-19536 and Fu et al., Bioconjug Chem. (2014) 25(9): 1602-1608,which are hereby incorporated by reference in their entirety.In some embodiments, articles of the present disclosure may be encapsulated in a nanoparticle or a liposome. In some embodiments, articles of the present disclosure may be (covalently or non-covalently) associated with a cell-penetrating peptide (e.g. a protein transduction domain, trojan peptide, arginine-rich peptide, vectocell peptide), a cationic polymer, a cationic lipid or a viral carrier. Nanoparticles may be organic, e.g. micelles, liposomes, proteins, solid-lipid particles, solid polymer particles, dendrimers, and polymer therapeutics. Nanoparticles may be inorganic, e.g. such as nanotubes or metal particles, optionally with organic molecules added. In some embodiments, a nanoparticle is a nanoparticle described in Chen et al., Mol Ther Methods Clin Dev. (2016) 3:16023, which is hereby incorporated by reference in its entirety. In some embodiments, a nanoparticle is a PLGA, polypeptide, poly(β-amino ester), DOPE, β- cyclodextrin-containing polycation, linear PEI, PAMAM dendrimer, branched PEI, chitosan or polyphosophoester nanoparticle. In some embodiments, expression systems and vectors according to the present disclosure comprise modification to incorporate one or more moieties facilitating delivery to,and / or uptake by, a cell type, organ or tissue of interest (e.g. a cell type / tissue / organ in which Docket No. P38844symptoms of a disease / condition manifest). In some embodiments, polynucleotides or vectorsaccording to the present disclosure are linked (e.g. chemically conjugated to) one or more moieties facilitating delivery to, and / or uptake by, a cell type, tissue or organ of interest. THERAPEUTIC / PROPHYLACTIC APPLICATIONS The modulatory polynucleotides, expression systems, vectors and cells and compositions of the present disclosure find use in therapy and prophylaxis. Accordingly, the present disclosure provides a modulatory polynucleotide, an expression system, vector, cell or composition described herein for use in a method of medical treatment or prophylaxis. Also provided is a modulatory polynucleotide, an expression system, vector, cell or composition described herein for use in a method of treating or preventing a disease / condition described herein. Also provided is the use of a modulatory polynucleotide, an expression system, vector, cell or composition described herein in the manufacture of a medicament for treating or preventing a disease or condition described herein. Also provided is a method of treating or preventing a disease or condition described herein, comprising administering to a subject a therapeutically- or prophylactically- effective amount of a modulatory polynucleotide, an expression system, vector, cell or composition described herein. The intervention described in the preceding paragraph may be effective to reduce the development or progression of a disease / condition, alleviate the symptoms of a disease / condition or reduce the pathology of a disease / condition. The intervention may be effective to prevent progression of the disease / condition, e.g. to prevent worsening of, or to slow the rate of development of, the disease / condition. In some embodiments, the intervention may lead to an improvement in the disease / condition, e.g. a reduction in the symptoms of the disease / condition or reduction in some other correlate of the severity / activity of the disease / condition. In some embodiments, the intervention may prevent progression / development of the disease / condition a later stage (e.g. a chronic stage). It will be appreciated that the modulatory polynucleotides, expression systems, vectors, cells and compositions described herein may be used for the treatment / prevention of any disease / condition that would derive therapeutic or prophylactic benefit from an increase in the level of the polypeptide of interest (i.e. the polypeptide of interest encoded by the polynucleotide). Docket No. P38844 For example, the disease / condition may be a disease / condition associated with and / or characterised by deficiency / insufficiency of the polypeptide of interest. Deficiency / insufficiency of the polypeptide of interest may be positively associated with the onset, development or progression of the disease / condition, and / or positively associated with the severity of one or more symptoms of the disease / condition. Deficiency / insufficiency of the polypeptide of interest may be a risk factor for the onset, development or progression of the disease / condition. The disease / condition may be characterised by a decreased level of expression or activity of the polypeptide of interest, e.g. as compared to the level of expression / activity in the absence of the disease / condition. In some embodiments, the disease / condition may be characterised by a decrease in the number / proportion / activity of cells expressing the polypeptide of interest, e.g. as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g. in a healthy subject, or in equivalent non-diseased tissue). By way of illustration, in some embodiments, the polypeptide of interest may be ACTA1, and the disease / condition to be treated / prevented in accordance with the present disclosure may be a disease / condition caused by deficiency / insufficiency of ACTA1, e.g. a congenital myopathy, such as for example nemaline myopathy, intranuclear rod myopathy, actin filament aggregate myopathy, congenital fibre type disproportion and myopathy with core-like areas (Laing et al, Hum Mutat.2009 Sep; 30(9): 1267–1277). By way of further example, in embodiments wherein the modulatory polynucleotide is capable of inhibiting the expression and / or activity of a target antigen of interest, the disease / condition may be a disease / condition in which the target antigen, or cells comprising / expressing the target antigen are pathologically-implicated, e.g. a disease / condition in which an increased level / activity of the target antigen, or an increase in the number / proportion / activity of cells comprising / expressing the target antigen is positively associated with the onset, development or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition. In some embodiments, an increased level / activity of the target antigen, or an increase in the number / proportion / activity of cells comprising / expressing the target antigen may be a risk factor for the onset, development or progression of the disease / condition. The disease / condition may be characterised by an increase in the level of expression or activity of the target antigen, e.g. as compared to the level of Docket No. P38844 expression / activity in the absence of the disease / condition. In some embodiments, the disease / condition may be characterised by an increase in the number / proportion / activity of cells expressing the target antigen, e.g. as compared to the level / number / proportion / activity in the absence of the disease / condition (e.g. in a healthy subject, or in equivalent non-diseased tissue). Therapeutic / prophylactic intervention in accordance with the present disclosure may achieve one or more of the following in a subject (compared to an equivalent untreated subject, or subject treated with an appropriate control): a reduction in the level of the (mutated) target antigen; a reduction in the activity of the target antigen; and / or a reduction in thenumber / proportion / activity of cells comprising / expressing the target antigen.The present disclosure provides the articles of the present disclosure for use, uses of articles of the present disclosure, and methods comprising administering modulatory polynucleotides, vectors, cells and compositions according to the present disclosure to a subject (e.g. a subject in need of treatment). Administration of the articles of the present disclosure is preferably in a ‘therapeutically-effective’ or ‘prophylactically-effective’ amount, this being sufficient to show therapeutic or prophylactic benefit to the subject. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of the disease / conditionand the particular article administered. Prescription of treatment, e.g. decisions on dosage etc.,is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disease / disorder to be treated, the condition of the individual subject, the site of delivery, the method of administration and other factors known to practitioners.Examples of the techniques and protocols mentioned above can be found in Remington’s ‘TheScience and Practice of Pharmacy’ (ed.(A)Adejare), 23rd Edition (2020), Academic Press.Administration of the articles of the present disclosure may be parenteral, systemic, intravenous, intra-arterial, intramuscular, intracavitary, intrathecal, intraocular, intravitreal, intraconjunctival, subretinal, suprachoroidal, subcutaneous, intradermal, intrathecal, oral, nasal, topical or transdermal. Administration may be by injection or infusion. Multiple doses of an article of the present disclosure may be provided. Multiple doses may be separated by a predetermined time interval, which may be selected to be one of 1, 2, 3, Docket No. P38844 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 days, or 1, 2, 3, 4, 5, or 6 months. FURTHER METHODS The present disclosure also provides a method for modifying a cell to express a protein of interest according to the present disclosure, comprising introducing into a cell an expression system or vector according to the present disclosure. In some embodiments, introducing an expression systems or vector according to the present disclosure into a cell comprises transformation, transfection, electroporation or transduction (e.g. retroviral transduction). Transfection relates to the process of introducing nucleic acid into cells using means other than viral infection and is hence a non-viral method. Transfection may be performed by physical / mechanical methods (including electroporation, sonoporation, magnetofection, gene microinjection and laser irradiation) or chemical methods (liposomal-based or non-liposomal based). Liposomal-based transfection reagents are chemicals which enable the formation of positively charged lipid aggregates, which can then merge with the phospholipid bilayer of the cell to facilitate the entry of foreign genetic material. Examples of liposomal-based transfection reagents include, but are not limited to Oligofectamine®, Lipofectamine® and DharmaFECT®. Non-liposomal transfection reagents include, but are not limited to, calcium phosphate, nanoparticles, polymers, dendrimers and non-liposomal lipids. One example of a non-liposomal transfection reagent is polyethylenimine (PEI). Electroporation may be performed e.g. as described in Koh et al., Molecular Therapy –Nucleic Acids (2013) 2, e114, which is hereby incorporated by reference in its entirety.Transduction is a process by which nucleic acids may be introduced into a cell by a virus or a viral vector. Accordingly, in some embodiments the polynucleotide is, or is comprised in, a viral vector, or the vector is a viral vector. Transduction of immune cells with viral vectors is described e.g. in Simmons and Alberola-Ila, Methods Mol Biol. (2016) 1323:99-108, which is hereby incorporated by reference in its entirety. Agents may be employed in the methods of the present disclosure to enhance the efficiency of transduction. Hexadimethrine bromide (polybrene) is a cationic polymer which is commonly used to improve Docket No. P38844transduction, through neutralising charge repulsion between virions and sial ic acid residuesexpressed on the cell surface. Other agents commonly used to enhance transduction include e.g. the poloxamer-based agents such as LentiBOOST (Sirion Biotech), Retronectin (Takara), Vectofusin (Miltenyi Biotech) and also SureENTRY (Qiagen) and ViraDuctin (Cell Biolabs). In some embodiments the methods comprise centrifuging the cells into which it is desired to introduce an expression system or vector according to the present disclosure in the presence of cell culture medium comprising viral vector(s) comprising the expression system (referred to in the art as ‘spinfection’). In some embodiments, the methods comprise culturing the cell under conditions suitable for expression of the polypeptide of interest the cell. In some embodiments, the methods comprise culturing the cell under conditions suitable for transcription of a polydeoxyribonucleotide. In some embodiments, the methods comprise culturing the cell under conditions suitable for post-transcriptional processing (e.g. splicing) of a polyribonucleotide. In some embodiments, the methods comprise culturing the cell under conditions suitable fortranslation of a polypeptide from a polyribonucleotide.Methods for culturing (including generating and / or expanding) populations of cells in vitro / ex vivo – including suitable culture conditions (i.e. cell culture media, additives, stimulations, temperature, gaseous atmosphere), cell numbers, culture periods etc. – are well known to the skilled person. Conveniently, cultures of cells according to the present disclosure may be maintained at 37°C in a humidified atmosphere containing 5% CO2. The present disclosure also provides a method for modifying a cell to express a polypeptide of interest, comprising introducing into a cell an expression system or vector according to the present disclosure. Where the polynucleotide is, or wherein the vector comprises / encodes, an OFF-switch, the cell may express the polypeptide of interest following introduction of the expression system / vector into the cell. SUBJECTS A subject in accordance with the various aspects of the present disclosure may be any animal or human. Therapeutic and prophylactic applications may be in human or animals (veterinary use). Docket No. P38844 The subject to be administered with an article of the present disclosure (e.g. in accordance with therapeutic or prophylactic intervention) may be a subject in need of such intervention. The subject is preferably mammalian, more preferably human. The subject may be a non-human mammal, but is more preferably human. The subject may be male or female. In one embodiment, the subject is female. The subject may be a patient. A subject may have (e.g. may have been diagnosed with) a disease or condition described herein, may be suspected of having such a disease / condition, or may be at risk ofdeveloping / contracting such a disease / condition. In embodiments according to the presentdisclosure, a subject may be selected for treatment according to the methods based on characterisation for one or more markers of such a disease / condition. SEQUENCE IDENTITY The ‘sequence identity’ between a given nucleotide sequence (e.g. of a polynucleotide) and a reference nucleotide sequence is calculated by determining the percentage of the nucleotides in the given nucleotide sequence that are identical to those of the reference nucleotide sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve the maximum percentage sequence identity between the two sequences. Similarly, ‘sequence identity’ between a given amino acid sequence (e.g. of a polypeptide) and a reference amino acid sequence is calculated by determining the percentage of the amino acids in the given amino acid sequence that are identical to those of the reference amino acid sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve themaximum percentage sequence identity between the two sequences.Pairwise and multiple sequence alignment for the purposes of evaluating sequence identity between two or more nucleotide or amino acid sequences can be achieved in various ways known to a person of skill in the art, for instance, using publicly available computer software such as ClustalOmega (Söding, J.2005, Bioinformatics 21, 951-960), T-coffee (Notredame et al. 2000, J. Mol. Biol. (2000) 302, 205-217), Kalign (Lassmann and Sonnhammer 2005, BMC Bioinformatics, 6(298)) and MAFFT (Katoh and Standley 2013, Molecular Biology and Evolution, 30(4) 772–780) software. When using such software, thedefault parameters, e.g. for gap penalty and extension penalty, are preferably used. Docket No. P38844 Table 2: Exemplary constructs A B C D E F G H I J Construct 5’ITR Promoter / minI- 5’UTR Gene T2A Reporter pA HGT 3’ITR 5’UTR Mi33-sh TI_miR33_GFP-A - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:106 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-Luci - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:108 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA001 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:109 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA003 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:110 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA006 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:111 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA008 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:112 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA009 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:113 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA013 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:114 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA014 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:115 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA015 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:116 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA022 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:117 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA024 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:118 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA027 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:119 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA033 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:120 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA035 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:121 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA038 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:122 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA042 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:123 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_miR33-shSA044 - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:124 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 TI_no miR - SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID - NO:99 NO:125 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 AAV_GFP_ITR SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO:126 NO:99 NO :107 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33-Luci SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO:126 NO:99 NO :108 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA001 NO:126 NO:99 NO :109 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA003 NO:126 NO:99 NO :110 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA006 NO:126 NO:99 NO :111 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA008 NO:126 NO:99 NO :112 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA009 NO:126 NO:99 NO :113 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA013 NO:126 NO:99 NO :114 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA014 NO:126 NO:99 NO :115 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA015 NO:126 NO:99 NO :116 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 Docket No. P38844 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA022 NO:126 NO:99 NO :117 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA024 NO:126 NO:99 NO :118 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA027 NO:126 NO:99 NO :119 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA033 NO:126 NO:99 NO :120 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA035 NO:126 NO:99 NO :121 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA038 NO:126 NO:99 NO :122 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA042 NO:126 NO:99 NO :123 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 AAV_miR33- SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID shSA044 NO:126 NO:99 NO :124 NO:100 NO:101 NO:102 NO:103 NO:104 NO:105 NO:127 Table 3: Exemplary sequences SEQ ID DESCRIPTION SEQUENCE NO: 1 shSA001_target_seq TCGTAAACTGACACAGTGTTT 2 shSA002_target_seq AACTTATTACCTCATTTTGTT 3 shSA003_target_seq AAGCATTAAAGTCATTCTGTT 4 shSA004_target_seq TCACTTTCTTTGTAACAACTT 5 shSA005_target_seq TGAAGAAGCATTAAAGTCATT 6 shSA006_target_seq TGGAAAACTTGAAGAAGCATT 7 shSA008_target_seq CATCGTAAACTGACACAGTGT 8 shSA009_target_seq GAAGCATTAAAGTCATTCTGT 9 shSA010_target_seq GGGTCAGAAAGATTCCTACGT 10 shSA011_target_seq GCCATCGTAAACTGACACAGT 11 shSA012_target_seq AAGAAGCATTAAAGTCATTCT 12 shSA013_target_seq CGTGTACATACATTAACTTAT 13 shSA014_target_seq CCTGGACTTCGAGAACGAGAT 14 shSA015_target_seq CACCGACTACCTGATGAAGAT 15 shSA016_target_seq CAGTGTTTATAACGTGTACAT 16 shSA017_target_seq CCAGAAACTAGACACAATGTG 17 shSA018_target_seq GCCCAGAAACTAGACACAATG 18 shSA019_target_seq CAGAAACTAGACACAATGTGC 19 shSA020_target_seq ACGTGTACATACATTAACTTA 20 shSA021_target_seq TGTACATACATTAACTTATTA 21 shSA022_target_seq GGAAAACTTGAAGAAGCATTA 22 shSA024_target_seq CGACATCAGGAAGGACCTGTA 23 shSA026_target_seq GGGCATTCACGAGACCACCTA 24 shSA027_target_seq AGTGTTTATAACGTGTACATA 25 shSA028_target_seq GATCACCAAGCAGGAGTACGA 26 shSA029_target_seq CCCTGGACTTCGAGAACGAGA 27 shSA030_target_seq AGACACAATGTGCGACGAAGA 28 shSA031_target_seq ACTACCTGATGAAGATCCTCA 29 shSA032_target_seq ACCGCATGCAGAAAGAGATCA 30 shSA033_target_seq GCATTAAAGTCATTCTGTTAA 31 shSA034_target_seq TATAACGTGTACATACATTAA Docket No. P38844 shSA035_target_seq TCATTCTGTTAAGCTGCGTAA shSA036_target_seq AAACTGACACAGTGTTTATAA shSA037_target_seq TCTCACCGACTACCTGATGAA shSA038_target_seq TCGAAACAAAGCCCTGTGGAA shSA039_target_seq CTAGACACAATGTGCGACGAA shSA040_target_seq CCAGCAGATGTGGATCACCAA shSA042_target_seq AAAACTTGAAGAAGCATTAAA shSA043_target_seq AGGCTCAGAGCAAGAGAGGTA shSA044_target_seq CACCGCAAATGCTTCTAGACA shSA045_target_seq CGAGATCGTGCGCGACATCAA shSA046_target_seq GGGCGACGAGGCTCAGAGCAA GFP-A_target_seq CAGCCACAACGTCTATATCAT Luciferase_target_seq CCGCCTGAAGTCTCTGATTAA shSA001_seq 1 AAACACUGUGUCAGUUUACGA (antisense) shSA002_seq 1 AACAAAAUGAGGUAAUAAGUU (antisense) shSA003_seq 1 AACAGAAUGACUUUAAUGCUU (antisense) shSA004_seq 1 AAGUUGUUACAAAGAAAGUGA (antisense) shSA005_seq 1 AAUGACUUUAAUGCUUCUUCA (antisense) shSA006_seq 1 AAUGCUUCUUCAAGUUUUCCA (antisense) shSA008_seq 1 ACACUGUGUCAGUUUACGAUG (antisense) shSA009_seq 1 ACAGAAUGACUUUAAUGCUUC (antisense) shSA010_seq 1 ACGUAGGAAUCUUUCUGACCC (antisense) shSA011_seq 1 ACUGUGUCAGUUUACGAUGGC (antisense) shSA012_seq 1 AGAAUGACUUUAAUGCUUCUU (antisense) shSA013_seq 1 AUAAGUUAAUGUAUGUACACG (antisense) shSA014_seq 1 AUCUCGUUCUCGAAGUCCAGG (antisense) shSA015_seq 1 AUCUUCAUCAGGUAGUCGGUG (antisense) shSA016_seq 1 AUGUACACGUUAUAAACACUG (antisense) shSA017_seq 1 CACAUUGUGUCUAGUUUCUGG (antisense) shSA018_seq 1 CAUUGUGUCUAGUUUCUGGGC (antisense) shSA019_seq 1 GCACAUUGUGUCUAGUUUCUG (antisense) shSA020_seq 1 UAAGUUAAUGUAUGUACACGU (antisense) Docket No. P38844 shSA021_seq 1 UAAUAAGUUAAUGUAUGUACA (antisense) shSA022_seq 1 UAAUGCUUCUUCAAGUUUUCC (antisense) shSA024_seq 1 UACAGGUCCUUCCUGAUGUCG (antisense) shSA026_seq 1 UAGGUGGUCUCGUGAAUGCCC (antisense) shSA027_seq 1 UAUGUACACGUUAUAAACACU (antisense) shSA028_seq 1 UCGUACUCCUGCUUGGUGAUC (antisense) shSA029_seq 1 UCUCGUUCUCGAAGUCCAGGG (antisense) shSA030_seq 1 UCUUCGUCGCACAUUGUGUCU (antisense) shSA031_seq 1 UGAGGAUCUUCAUCAGGUAGU (antisense) shSA032_seq 1 UGAUCUCUUUCUGCAUGCGGU (antisense) shSA033_seq 1 UUAACAGAAUGACUUUAAUGC (antisense) shSA034_seq 1 UUAAUGUAUGUACACGUUAUA (antisense) shSA035_seq 1 UUACGCAGCUUAACAGAAUGA (antisense) shSA036_seq 1 UUAUAAACACUGUGUCAGUUU (antisense) shSA037_seq 1 UUCAUCAGGUAGUCGGUGAGA (antisense) shSA038_seq 1 UUCCACAGGGCUUUGUUUCGA (antisense) shSA039_seq 1 UUCGUCGCACAUUGUGUCUAG (antisense) shSA040_seq 1 UUGGUGAUCCACAUCUGCUGG (antisense) shSA042_seq 1 UUUAAUGCUUCUUCAAGUUUU (antisense) shSA043_seq 1 UACCUCUCUUGCUCUGAGCCU (antisense) shSA044_seq 1 UGUCUAGAAGCAUUUGCGGUG (antisense) shSA045_seq 1 UUGAUGUCGCGCACGAUCUCG (antisense) shSA046_seq 1 UUGCUCUGAGCCUCGUCGCCC (antisense) GFP-A_seq 1 (antisense) AUGAUAUAGACGUUGUGGCUG Luciferase_seq 1 UUAAUCAGAGACUUCAGGCGG (antisense) miR517a GAGTGCATGGGGTTTGAGTTTTCACTGGGGAAATGAAACCAACATCTTGGGT GCATGACCAGGTCATATATGCAGTCATATATGCAATATGCATGGTGGTGGGT GCCTCTAATCCCAGCTACTCAGGAGGCTGACGCAGAAGAATCGCTTGAACCC Docket No. P38844 AGGAGGCAGAAGTTGCCATGAGCCGAGATCCCACCACCGCATCCAGCCTGG GCGGCAGAGTGAGACTCCGTGTCAAAAAAAAGAAGATCTCAGGCAGTGTGN NNNNNNNNNNNNNNNNNNNNNNGTTGTATAAAAGAAANNNNNNNNNNNNN NNNNNNNNNNTACTGTTTGAGACAAGCAACGTTGAAGATGCTGCTGATCTTG GTAATACATTTGCAGAGCGTGCTTATCATCAGACTTGCATGATGTCGGGGTT CTGTTTGTGATTTGAAATTTTTCCAAGACAGGCTTTCTATTGCCCAGGCGTGG GTGGATAGCACCTTCCACCAAGATTTCTTGGGCTTAAGTGGTCCTCTTTTTAT TTTTTGATTTTTTGAGACACACTCTTGTTTCGTTGGGAGTGCAGTAGCAGGAT CTCTGCTCACCGGAAACTCCACCTCTCGGGTTCCAGTGATTCTCCCACCT miR30a AAGGTATATTGCTGTTGACAGTGAGCGNNNNNNNNNNNNNNNNNNNNNNTA GTGAAGCCACAGATGTANNNNNNNNNNNNNNNNNNNNNNTGCCTACTGCCT CG miR155(eSIBR) CTGGAGGCTTGCTTTGGGCTGTATGCTGNNNNNNNNNNNNNNNNNNNNNNT TTTGGCCACTGACTGANNNNNNNNNNNNNNNNNNNNNNGGACACAAGGCC CTTTATCAGCACTCACATGGAACAAATGGCC miR450b AAAAGATGGAGGGAATAAGCAAAAAATCTAACAGCGGCTATCTGTGGTTTA CTTCTGTGATAAATGTAAGATGCAGAATTATNNNNNNNNNNNNNNNNNNNN NNTGTAATATAAGTGACNNNNNNNNNNNNNNNNNNNNNNGTTTTGTATCAA CATATGGAGAAAAGTCTAGGAAGAAATATACCAAAACTTGTAACAGTATTA TAGTATAAAATTATAGGTAATGTTTG mmu-pri-miR-33 AGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGCTCCCTTGGGCCTGGGCCCA CTGACAGCCCTGGTGCCTCTGGCCGGCTGCACACCTCCTGGCGGGCAGCTGT GNNNNNNNNNNNNNNNNNNNNNTGTTCTGGCAATACCTGNNNNNNNNNNN NNNNNNNNNNCACGGAGGCCTGCCCTGACTGCCCACGGTGCCGTGGCCAAA GAGGATCTAAGGGCACCGCTGAGGGCCTACCTAACCATCGTGGGGAATAAG GACAGTGTCACCC miR16-2(3G) CCGGATCAACGCCCTAGGTTTATGTTTGGATGAACTGACATACGCGTATCCG TCNNNNNNNNNNNNNNNNNNNNNGTAGTGAAATATATATTAAACNNNNNN NNNNNNNNNNNNNNNTACGGTAACGCGGAATTCGCAACTATTTTATCAATTT TTTGCGTCGAC miR802 CAGTGCCAGAAATGAACCAGCAAAAAAAAGGACGGAGGCTCTATTTTCATA GGAGGAAGTTAACAAAATAATACCCACTCTGTTTCTCTGCAGCCTCTTGTGT CATTTCAGAAGAAAGTGCCATATGCCCATTGCGTGATTTGAAGCGTGTATTC CCAGCCTGACTCTTGGTCACCACTCGTTCTGTTATTTGCAGTNNNNNNNNNN NNNNNNNNNNNNNGTCCATCATGCANNNNNNNNNNNNNNNNNNNNNNNGT GTAATTAATAGCTGGACCTTGCAAAGGAAGGTGGGAGAAGGAAGCCGTTCA TGCATAGACCTGGATAAATTCAGAACAGGCTTTGCGGATCTTTGCTGCCTTTT GACCAATTAAGGTGCCAGAGCCCCAGCAGAAGAGGAAATATGGTAAACAAA GTGTTTTCTCTGGGGCTGTGTGTGTTATAATCCCAAGCTCTG Chimeric Intron (ChI) CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCNNNTGATAGGCACCTATTG GTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGTGT Minimal intron (MinI) GACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGGCAGGTA AGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTG TCGAGACNNNTAGCTTGCGTTTCTGATACGCACCTATTGGTCTTACTGACATC CACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGTTCAATTACAGCTCTTA AGGCTAGAGTACTTAATACGACTCACTATAGGGTAGCCTGGAGAATTGCTCG AGCCAC Intron A GACGTAAGTACCGCCTATAGAGTCTATAGGCCCACCCCCTTGGCTTCTTATG CATGCTATACTGTTTTTGGCTTGGGGTCTATACACCCCCGCTTCCTCATGTTA TAGGTGATGGTATAGCTTAGCCTATAGGTGTGGGTTATTGACCATTATTGAC CACTCCCCTATTGGTGACGATACTTTCCATTACTAATCCATAACATGGCTCTT TGCCACAACTCTCTTTATTGGCTATATGCCAATACACTGTCCTTCAGAGACTG Docket No. P38844 ACACGGACTCTGTATTTTTACAGGATGGGGTCTCATTTATTATTTACAAATTC ACATATACAACACCACCGTCCCCAGTGCCCGCAGTTTTTATTAAACATAACG TGGGATCTCCACGCGAATCTCGGGTACGTGTTCCGGACATGGGCTCTTCTCC GGTAGCGGCGGAGCTTCTACATCCGAGCCCTGCTCCCATGCCTCCAGCGACT CATGGTCGCTCGGCAGCTCCTTGCTCCTAACAGTGGAGGCCAGACTTAGGCA CAGCACGATGCCCACCACCACCAGTGTGCCGCACAAGGCCGTGGCGGTAGG GTATGTGTCTGAAAATGAGCTCGGGGAGCGGGCTTGCACCGCTGACGCATTT GGAAGACTTAAGGCAGCGGCAGAAGAAGATGCAGGCAGCTGAGTTGTTGTG TTCTGATAAGAGTCAGAGGTAACTCCCGTTGCGGTGCTGTTAACGGTGGAGG GCAGTGTAGTCTGAGCAGTACTCGTTGCTGCCGCGCGCGCCACCAGACATAA TAGCTGACAGACTAACAGACTGTTCCTTTCCATGGGTCTTTTCTGCAGTC CMV GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTA promoter+CMV5'UTR GTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCC CGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTA TGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAG TATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAA GTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGC CCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAG TCATCGCTATTAGCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGG ATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAAT GGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACA ACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTA TATAAGCAGAGCTCCGTTTAGTGAACGTCAGATCTCCTGGAGACGCCATCCA CGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCC GGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGAC px1000 TAGCTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGT GATCAGCACTGAACACAGAGG coACTA1 ATGTGTGATGAGGATGAAACAACAGCTCTGGTTTGTGATAATGGGTCTGGGC TTGTTAAGGCTGGGTTTGCTGGAGATGATGCTCCAAGGGCTGTTTTTCCATCT ATTGTTGGGAGACCTAGACATCAAGGGGTCATGGTTGGAATGGGACAAAAG GACTCTTATGTTGGGGATGAAGCACAATCTAAAAGGGGCATTCTTACACTTA AATATCCCATTGAACATGGGATTATTACAAATTGGGATGATATGGAAAAAAT TTGGCATCATACATTTTATAATGAATTGAGAGTTGCACCTGAAGAACATCCT ACACTTCTGACTGAAGCACCTCTGAACCCTAAAGCTAATAGAGAAAAAATG ACACAAATTATGTTTGAAACATTTAATGTTCCTGCTATGTATGTTGCTATTCA AGCTGTTCTTTCTCTGTATGCTTCTGGGAGGACAACAGGGATTGTTCTTGATT CTGGGGATGGGGTCACACATAATGTTCCTATATATGAAGGCTATGCACTTCC ACATGCTATTATGAGACTTGATCTTGCTGGGAGAGACCTGACAGATTATCTT ATGAAAATTCTGACTGAAAGAGGGTATTCTTTTGTTACAACTGCAGAAAGAG AAATTGTTAGAGATATTAAAGAAAAACTTTGTTATGTTGCTCTTGATTTTGAA AATGAAATGGCAACTGCTGCTTCTTCTTCTTCTCTTGAGAAATCTTATGAACT TCCTGATGGACAAGTGATTACAATAGGGAATGAAAGATTTAGATGTCCAGA AACTCTGTTTCAACCTTCTTTTATTGGAATGGAAAGTGCAGGGATACATGAA ACAACATATAATTCTATTATGAAATGTGATATTGATATTAGGAAGGATCTTT ATGCTAATAATGTGATGAGTGGAGGGACAACTATGTATCCAGGAATTGCAG ATAGAATGCAAAAGGAAATTACAGCACTTGCTCCTTCTACAATGAAAATTAA AATTATTGCTCCACCTGAAAGAAAGTATAGTGTTTGGATTGGGGGGTCTATT CTTGCTTCCCTTTCTACATTTCAACAAATGTGGATTACAAAACAAGAATATG ATGAAGCTGGGCCATCTATTGTGCATAGAAAGTGTTTT T2A GGCTCTGGCGAAGGGCGGGGATCTCTTCTGACATGTGGTGATGTTGAGGAAA ATCCCGGGCCC mCherry ATGGTCTCAAAAGGCGAAGAGGATAATATGGCCATTATCAAGGAGTTCATG AGATTTAAAGTGCACATGGAAGGTTCCGTTAACGGTCACGAGTTCGAGATAG Docket No. P38844 AAGGTGAAGGTGAGGGCCGACCTTATGAAGGCACGCAGACCGCCAAGCTGA AAGTAACAAAGGGTGGCCCCCTTCCCTTTGCATGGGACATCTTGTCCCCACA ATTCATGTACGGGTCCAAAGCCTATGTTAAACATCCAGCAGATATTCCCGAC TACCTGAAGTTGAGCTTTCCAGAGGGATTCAAATGGGAAAGGGTTATGAATT TTGAAGATGGCGGCGTTGTGACAGTCACTCAAGACTCCAGTCTGCAAGATGG AGAGTTCATCTATAAGGTAAAACTGAGAGGAACAAACTTTCCCAGCGACGG ACCCGTTATGCAGAAGAAAACGATGGGGTGGGAAGCCTCTAGCGAGCGTAT GTACCCCGAAGATGGCGCGTTGAAAGGCGAGATTAAGCAACGACTGAAATT GAAGGACGGCGGGCACTATGATGCAGAAGTGAAAACGACCTATAAGGCGAA GAAACCTGTACAGTTGCCAGGGGCATACAATGTAAACATCAAGCTCGATATA ACATCACATAATGAAGACTATACCATAGTCGAGCAATACGAACGCGCTGAG GGACGGCATTCTACCGGAGGCATGGATGAACTCTATAAA BGHpA GTACGTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTT GACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATT GCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGC AGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGAT GCGGTGGGCTCTATGGGGCGCG HGT GGCAGGATAATATATGGTAGGGTTCATAGCCAGAGTAACCTTTTTTTTTAATT TTTATTTTATTTTATTTTTGAGG miR33_GFP-A ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGATGATATAGACGTTGTGGCTGTGTTCTGGCAA TACCTGCAGCCACATGGCCTATATCATCACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC minI ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACTAGCTTGCGTTTCTGATACGCACCTATTGGTCTTACTGAC ATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGTTCAATTACAGCTC TTAAGGCTAGAGTACTTAATACGACTCACTATAGGGTAGCCTGGAGAATTGC TCGAGCCACGTGTCGGTAC miR33-Luci ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGTTAATCAGAGACTTCAGGCGGTGTTCTGGCAA TACCTGCCGCCTGATCTTTCTGATTAACACGGAGGCCTGCCCTGACTGCCCAC GGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAACC ATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTCT GATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGT GTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA001 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGAAACACTGTGTCAGTTTACGATGTTCTGGCAA TACCTGTCGTAAACACATACAGTGTTTCACGGAGGCCTGCCCTGACTGCCCA Docket No. P38844 CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA003 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGAACAGAATGACTTTAATGCTTTGTTCTGGCAA TACCTGAAGCATTATTGCCATTCTGTTCACGGAGGCCTGCCCTGACTGCCCAC GGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAACC ATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTCT GATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGT GTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA006 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGAATGCTTCTTCAAGTTTTCCATGTTCTGGCAAT ACCTGTGGAAAACAAGGAGAAGCATTCACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA008 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGACACTGTGTCAGTTTACGATGTGTTCTGGCAA TACCTGCATCGTAATGTAACACAGTGTCACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA009 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGACAGAATGACTTTAATGCTTCTGTTCTGGCAA TACCTGGAAGCATTTTAATCATTCTGTCACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA013 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA Docket No. P38844 CCTCCTGGCGGGCAGCTGTGATAAGTTAATGTATGTACACGTGTTCTGGCAA TACCTGCGTGTACAATCGTTAACTTATCACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA014 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGATCTCGTTCTCGAAGTCCAGGTGTTCTGGCAA TACCTGCCTGGACTAGGGGAACGAGATCACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA015 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGATCTTCATCAGGTAGTCGGTGTGTTCTGGCAA TACCTGCACCGACTTGCCGATGAAGATCACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA022 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGTAATGCTTCTTCAAGTTTTCCTGTTCTGGCAAT ACCTGGGAAAACTACAGGAAGCATTACACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA024 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGTACAGGTCCTTCCTGATGTCGTGTTCTGGCAAT ACCTGCGACATCACCAGGGACCTGTACACGGAGGCCTGCCCTGACTGCCCAC GGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAACC ATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTCT GATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGT GTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA027 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG Docket No. P38844 GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGTATGTACACGTTATAAACACTTGTTCTGGCAA TACCTGAGTGTTTAATATGTGTACATACACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA033 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGTTAACAGAATGACTTTAATGCTGTTCTGGCAA TACCTGGCATTAAACACGTTCTGTTAACACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA035 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGTTACGCAGCTTAACAGAATGATGTTCTGGCAA TACCTGTCATTCTGAAAGGCTGCGTAACACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA038 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGTTCCACAGGGCTTTGTTTCGATGTTCTGGCAAT ACCTGTCGAAACATTGTCCTGTGGAACACGGAGGCCTGCCCTGACTGCCCAC GGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAACC ATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTCT GATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGT GTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC miR33-shSA042 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGTTTAATGCTTCTTCAAGTTTTTGTTCTGGCAAT ACCTGAAAACTTGTTGGAGCATTAAACACGGAGGCCTGCCCTGACTGCCCAC GGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAACC ATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTCT GATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGT GTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC Docket No. P38844 miR33-shSA044 ACTGGGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGG CAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCTTGTCGAGACACATCTAGGGCTCTGCGTTTGCTCCAGGTAGTCCGCTGC TCCCTTGGGCCTGGGCCCACTGACAGCCCTGGTGCCTCTGGCCGGCTGCACA CCTCCTGGCGGGCAGCTGTGTGTCTAGAAGCATTTGCGGTGTGTTCTGGCAA TACCTGCACCGCAATAGTTTCTAGACACACGGAGGCCTGCCCTGACTGCCCA CGGTGCCGTGGCCAAAGAGGATCTAAGGGCACCGCTGAGGGCCTACCTAAC CATCGTGGGGAATAAGGACAGTGTCACCCTTTTTCTGCAGTAGCTTGCGTTTC TGATACGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGG TGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCTAGAGTACTTAATACGACT CACTATAGGGTAGCCTGGAGAATTGCTCGAGCCACGTGTCGGTAC no miR ACTGGGCAGGACACTAGTAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACT GGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAA CTGGGCTTGTCGAGACTAGCTTGCGTTTCTGATACGCACCTATTGGTCTTACT GACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGTTCAATTACAG CTCTTAAGGCTAGAGTACTTAATACGACTCACTATAGGGTAGCCTGGAGAAT TGCTCGAGCCACGTGTCGGTAC 5’ ITR AAV2 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCC CGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCG CAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 3’ ITR AAV2 AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCT CACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGC GGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG shSA001_seq 2 (sense) UCGUAAACUGACACAGUGUUU shSA002_seq 2 (sense) AACUUAUUACCUCAUUUUGUU shSA003_seq 2 (sense) AAGCAUUAAAGUCAUUCUGUU shSA004_seq 2 (sense) UCACUUUCUUUGUAACAACUU shSA005_seq 2 (sense) UGAAGAAGCAUUAAAGUCAUU shSA006_seq 2 (sense) UGGAAAACUUGAAGAAGCAUU shSA008_seq 2 (sense) CAUCGUAAACUGACACAGUGU shSA009_seq 2 (sense) GAAGCAUUAAAGUCAUUCUGU shSA010_seq 2 (sense) GGGUCAGAAAGAUUCCUACGU shSA011_seq 2 (sense) GCCAUCGUAAACUGACACAGU shSA012_seq 2 (sense) AAGAAGCAUUAAAGUCAUUCU shSA013_seq 2 (sense) CGUGUACAUACAUUAACUUAU shSA014_seq 2 (sense) CCUGGACUUCGAGAACGAGAU shSA015_seq 2 (sense) CACCGACUACCUGAUGAAGAU shSA016_seq 2 (sense) CAGUGUUUAUAACGUGUACAU shSA017_seq 2 (sense) CCAGAAACUAGACACAAUGUG shSA018_seq 2 (sense) GCCCAGAAACUAGACACAAUG shSA019_seq 2 (sense) CAGAAACUAGACACAAUGUGC shSA020_seq 2 (sense) ACGUGUACAUACAUUAACUUA shSA021_seq 2 (sense) UGUACAUACAUUAACUUAUUA shSA022_seq 2 (sense) GGAAAACUUGAAGAAGCAUUA shSA024_seq 2 (sense) CGACAUCAGGAAGGACCUGUA shSA026_seq 2 (sense) GGGCAUUCACGAGACCACCUA shSA027_seq 2 (sense) AGUGUUUAUAACGUGUACAUA shSA028_seq 2 (sense) GAUCACCAAGCAGGAGUACGA shSA029_seq 2 (sense) CCCUGGACUUCGAGAACGAGA shSA030_seq 2 (sense) AGACACAAUGUGCGACGAAGA shSA031_seq 2 (sense) ACUACCUGAUGAAGAUCCUCA shSA032_seq 2 (sense) ACCGCAUGCAGAAAGAGAUCA Docket No. P38844 shSA033_seq 2 (sense) GCAUUAAAGUCAUUCUGUUAA shSA034_seq 2 (sense) UAUAACGUGUACAUACAUUAA shSA035_seq 2 (sense) UCAUUCUGUUAAGCUGCGUAA shSA036_seq 2 (sense) AAACUGACACAGUGUUUAUAA shSA037_seq 2 (sense) UCUCACCGACUACCUGAUGAA shSA038_seq 2 (sense) UCGAAACAAAGCCCUGUGGAA shSA039_seq 2 (sense) CUAGACACAAUGUGCGACGAA shSA040_seq 2 (sense) CCAGCAGAUGUGGAUCACCAA shSA042_seq 2 (sense) AAAACUUGAAGAAGCAUUAAA shSA043_seq 2 (sense) AGGCUCAGAGCAAGAGAGGUA shSA044_seq 2 (sense) CACCGCAAAUGCUUCUAGACA shSA045_seq 2 (sense) CGAGAUCGUGCGCGACAUCAA shSA046_seq 2 (sense) GGGCGACGAGGCUCAGAGCAA GFP-A_seq 2 (sense) CAGCCACAACGUCUAUAUCAU Luciferase_seq 2 (sense) CCGCCUGAAGUCUCUGAUUAA In Table 3 above, sequences labeled as antisense (strand) sequences do also refer to the respective guide strand sequences (e.g. SEQ ID NOs 45-88). Similarly, sequences labeled as sense (strand) sequences do also refer to the respect ive passenger strand sequences (e.g. SEQID NOs 128-171). NUMBERED STATEMENTS The following numbered paragraphs (paras) describe particular aspects and embodiments of the present disclosure: 1. A modulatory polynucleotide that inhibits expression of ACTA1, wherein the modulatory polynucleotide encodes an miRNA scaffold, wherein the miRNA scaffold is selected from the group consisting of a miR30a scaffold, a miR33 scaffold, and a miR155 scaffold, wherein the miRNA scaffold comprises an inhibitory RNA (RNAi) molecule, wherein the RNAi molecule comprises a sense strand and an antisense strand forming a double-stranded region, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from a reverse complementary nucleotide sequence of the nucleotide sequence of the sense strand. 2. The modulatory polynucleotide according to para 1, wherein the miRNA scaffold is selected from the group consisting of an miRNA30a scaffold, an miRNA33 scaffold, and an miRNA155 scaffold. Docket No. P38844 3. The modulatory polynucleotide according to para 1 or 2, wherein the miRNA scaffold is a an miRNA-33. 4. The modulatory polynucleotide according to any one of paras 1 to 3, wherein the antisense strand (or guide strand) comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 82, and SEQ ID NO: 84. 5. The modulatory polynucleotide according to any one of the preceding paras, whereinthe modulatory polynucleotide inhibits activity of a ACTA1 gene.6. The modulatory polynucleotide according to any one of the preceding paras, wherein the modulatory polynucleotide suppresses or silences an ACTA1 gene. 7. The modulatory polynucleotide according to any one of the preceding paras, wherein the modulatory polynucleotide reduces the expression of the ACTA1 gene. 8. The modulatory polynucleotide according to any one of paras 5 to 7, wherein the modulatory polynucleotide is a single-stranded DNA, a double-stranded DNA, a DNA that is a mixture of single- and double-stranded regions, a single-stranded RNA, a double-stranded RNA, a RNA that is mixture of single- and double-stranded regions, a single-stranded molecules comprising DNA and RNA, a double-stranded molecules comprising DNA and RNA, or a molecule comprising DNA and RNA having a mixture of single- and double- stranded regions, in particular, wherein the modulatory polynucleotide is a single-stranded DNA. 9. The modulatory polynucleotide according to any one of paras 5 to 8, wherein theACTA1 gene is a wild-type ACTA1 gene, or a mutated ACTA1 gene.10. The modulatory polynucleotide according to any one of paras 5 to 9, wherein theACTA1 gene is a mutated ACTA1 gene with at least one pathogenic mutation.11. The modulatory polynucleotide according to any one of the preceding paras, whereinthe modulatory polynucleotide is an isolated modulatory polynucleotide. Docket No. P38844 12. The modulatory polynucleotide according to any one of the preceding paras, wherein the modulatory polynucleotide inhibits activity of both a wild-type ACTA1 gene and a mutatedACTA1 gene with at least one pathogenic mutation.13. The modulatory polynucleotide according to any one of the preceding paras, whereinthe modulatory polynucleotide does not inhibit activity of a codon optimized ACTA1 gene.14. The modulatory polynucleotide according to any one of the preceding paras, wherein the sense strand sequence comprises at least 20 contiguous nucleotides and wherein theantisense strand sequence comprises at least 20 contiguous nucleotides.15. The modulatory polynucleotide according to any one of the preceding paras, wherein the sense strand sequence comprises at least 21 contiguous nucleotides and wherein theantisense strand sequence comprises at least 21 contiguous nucleotides.16. The modulatory polynucleotide according to any one of the preceding paras, wherein the sense strand sequence comprises at least 22 contiguous nucleotides and wherein theantisense strand sequence comprises at least 22 contiguous nucleotides.17. The modulatory polynucleotide according to any one of the preceding paras, wherein the sense strand sequence comprises at least 23 contiguous nucleotides and wherein theantisense strand sequence comprises at least 23 contiguous nucleotides.18. The modulatory polynucleotide according to any one of the preceding paras, wherein the sense strand sequence comprises at least 24 contiguous nucleotides and wherein theantisense strand sequence comprises at least 24 contiguous nucleotides.19. The modulatory polynucleotide according to any one of the preceding paras, wherein the sense strand sequence comprises at least 25 contiguous nucleotides and wherein theantisense strand sequence comprises at least 25 contiguous nucleotides.20. The modulatory polynucleotide according to any one of the preceding paras, wherein the modulatory polynucleotide comprises an siRNA molecule. 21. The modulatory polynucleotide according to any one of the preceding paras, wherein the modulatory polynucleotide comprises an shRNA molecule. Docket No. P38844 22. The modulatory polynucleotide according to any one of the preceding paras, wherein the antisense strand (or guide strand) sequence differs by no more than 4 nucleotides from the nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, and SEQ ID NO: 82. 23. The modulatory polynucleotide according to any one of the preceding paras, wherein the sense strand (or passenger strand) sequence differs by no more than 4 nucleotides from the nucleotide sequence complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO:56, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, and SEQ ID NO: 82.24. The modulatory polynucleotide according to any one of the preceding paras, wherein the antisense strand (or guide strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47,SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 68, SEQ ID NO: 74, SEQ IDNO: 76, SEQ ID NO: 79, and SEQ ID NO: 82, wherein the sense strand (or passenger strand) sequence differs by no more than 4 nucleotides from a nucleotide sequence selected from the group consisting of SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 151, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 162, and SEQ ID NO: 165. 25. The modulatory polynucleotide according to any one of the preceding paras, wherein the modulatory polynucleotide comprises the sequence of SEQ ID NO: 93 or a sequence having at least 85 % sequence identity to SEQ ID NO: 93. 26. The modulatory polynucleotide according to any one of the preceding paras, wherein the modulatory polynucleotide is capable of forming a double-stranded region with a sequence of the ACTA1 gene. 27. The modulatory polynucleotide according to para 23, wherein the double-stranded region is at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand, and wherein the double-stranded region differs by no more than 4 nucleotides from the nucleotide sequence of the sense strand. Docket No. P38844 28. The modulatory polynucleotide according to any one of the preceding paras, wherein the modulatory polynucleotide comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, and SEQ ID NO: 124, in particular wherein the modulatory polynucleotide comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, and SEQ ID NO: 123. 29. A modulatory polynucleotide that inhibits expression of ACTA1, comprising a polynucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 123, and SEQ ID NO: 124, in particular wherein the modulatory polynucleotide comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 122, and SEQ ID NO: 123. 30. An expression system comprising a modulatory polynucleotide according to any oneof paras 1 to 29, wherein the modulatory polynucleotide is operably linked to a promoter , andoptionally wherein the expression system additionally comprises a codon optimized polynucleotide encoding a polypeptide of interest, in particular wherein the polypeptide of interest is ACTA1. 31. A vector comprising a modulatory polynucleotide according to any one of paras 1 to 29, wherein the modulatory polynucleotide is operably linked to a promoter, and optionally wherein the vector additionally comprises a codon optimized polynucleotide encoding a polypeptide of interest, in particular wherein the polypeptide of interest is ACTA1. Docket No. P38844 32. The expression system according to para 30 or the vector according to para 31,comprising a start codon located 5' to the polynucleotide encoding a polypeptide of interest.33. The expression system according to para 30 or 32, or the vector according to para 31 or 32, further comprising a polyadenylation sequence 3’ to the nucleotide sequence encoding a polypeptide of interest. 34. The expression system according to any one of paras 30 or 32 to 33, or the vector according to any one of paras 30 to 32, further comprising an inverted terminal repeat (ITR)sequence at its 5’ end, and an ITR sequence at its 3’ end.35. The expression system according to any one of paras 30 or 32 to 34, or the vector according to any one of paras 28 to 31, wherein the expression system or vector comprises a first expression cassette comprising the polynucleotide encoding a polypeptide of interest and asecond expression cassette comprising the modulatory polynucleotide according to any one o fparas 1 to 25. 36. The expression system according to any one of paras 30 or 32 to 35, or the vector according to any one of paras 31 to 35, wherein first expression cassette comprises an intron comprising the second expression cassette encoding the modulatory polynucleotide. 37. The expression system according to any one of paras 30 or 32 to 35, or the vector according to any one of paras 31 to 36, wherein the modulatory polynucleotide is integrated into the polynucleotide encoding the polypeptide of interest, optionally, wherein the modulatory polynucleotide is integrated into an intron comprised in the polynucleotide encoding the polypeptide of interest. 38. The expression system according to any one of paras 30 or 32 to 37, or the vector according to any one of paras 31 to 37, wherein the second expression cassette encoding the modulatory polynucleotide comprises a promoter that is operably linked to the modulatory polynucleotide. 39. The expression system according to any one of paras 30 or 32 to 38, or the vector according to any one of paras 31 to 38, wherein the promoter of the second expression cassette is a constitutive promoter, a cell-type specific promoter, or an inducible promoter. Docket No. P38844 40. The expression system according to any one of paras 30 or 32 to 39, or the vector according to any one of paras 31 to 39, wherein the promoter of the second expression cassette is a pol III promoter or a U6 promoter. 41. The expression system according to any one of paras 30 or 32 to 40, or the vector according to any one of paras 31 to 40, wherein the modulatory polynucleotide is not operably linked to a promoter. 42. The expression system according to any one of paras 30 or 32 to 41, or the vector according to any one of paras 31 to 41, wherein the first expression cassette comprises a promoter that is operably linked to the polynucleotide encoding the polypeptide of interest. 43. The expression system according to any one of paras 30 or 32 to 42, or the vector according to any one of paras 31 to 42, wherein the promoter of the first expression cassette is a constitutive promoter, a cell-type specific promoter, or an inducible promoter. 44. The expression system according to any one of paras 30 or 32 to 43, or the vector according to any one of paras 31 to 43, wherein the first and / or second expression cassette comprises an enhancer element. 45. The expression system according to any one of paras 30 or 32 to 44, or the vector according to any one of paras 31 to 44, wherein the first and / or second expression cassette comprises an intron, a filler polynucleotide sequence, a polyadenylation signal sequence, or a combination thereof. 46. The expression system according to any one of paras 30 or 32 to 45, or the vector according to any one of paras 31 to 45, wherein the modulatory polynucleotide inhibits the expression of a gene in a cell or subject to about 20 % to about 80 % relative to the expression level prior to the administration of an expression vector comprising the modulatory polynucleotide according to any one of embodiments 1 to 29 to said cell or subject. 47. The expression system according to any one of paras 30 or 32 to 46, or the vector according to any one of paras 31 to 46, wherein the inhibition or suppression of gene expression is to less than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% relative to the expression level prior to the administration of an expression vector comprising the modulatory polynucleotide according any one of paras 1 to 29 to the cell or subject. Docket No. P38844 48. The vector according to any one of paras 31 to 47, wherein the vector is an adeno- associated virus (AAV) vector. 49. An adeno-associated virus (AAV) vector comprising a vector genome, wherein the vector genome comprises in 5’ to 3’ order: (i) a 5' inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) optionally, a 5' UTR sequence; (iv) a polynucleotide encoding a protein of interest; (v) a 3' UTR sequence; and (vi) a 3' inverted terminal repeat (ITR) sequence, wherein the vector genome comprises a modulatory polynucleotide according to any one of paras 1 to 29. 50. The AAV vector according to para 49, wherein the modulatory polynucleotide is included in (iii) the 5' UTR sequence. 51. The AAV vector according to para 49, wherein the modulatory polynucleotide isincluded in (iv) the polynucleotide encoding a protein of interest.52. The AAV vector according to any one of paras 49 to 51, wherein the 5' ITR sequence comprises a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence according to SEQ ID NO: 126. 53. The AAV vector according to any one of paras 49 to 52, wherein the 5' UTR sequence comprises: (i) a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 99; Docket No. P38844 (ii) a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 122, and SEQ ID NO: 123; and / or (iii) a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 100. 54. The AAV vector according to any one of paras 49 to 53, wherein the polynucleotide sequence encoding the protein of interest is 3' to the polynucleotide sequence comprising the modulatory polynucleotide comprising the modulatory polynucleotide. 55. The AAV vector according to any one of paras 49 to 54, wherein the polynucleotidesequence encoding the protein of interest is a cDNA sequence.56. The AAV vector according to any one of paras 49 to 55, wherein the polypeptide of interest is a functional variant of the target gene of the modulatory polynucleotide. 57. The AAV vector according to any one of paras 49 to 56, wherein the polypeptide ofinterest is an ACTA1 gene, or a codon optimized variant thereof.58. The AAV vector according to any one of paras 49 to 57, wherein the polynucleotide encoding a protein of interest comprises or consists of a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence according to SEQ ID NO: 101. 59. The AAV vector according to any one of paras 49 to 58, wherein the 3' UTR sequence comprises a polyadenylation sequence. 60. The AAV vector according to any one of paras 49 to 59, wherein the 3' UTR sequence comprises: (i) a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 104; and / or (ii) a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 105. Docket No. P38844 61. The AAV vector according to any one of paras 49 to 60, wherein the 3' ITR sequence comprises a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nucleotide sequence according to SEQ ID NO: 127. 62. The AAV vector according to any one of paras 49 to 61, wherein the vector genome is suitable for being packaged into an adeno-associated viral particle. 63. A cell comprising an expression system according to any one of paras 30 or 32 to 47, or a vector according to any one of paras 31 to 48, or an AAV vector according to any one of paras 49 to 62. 64. A pharmaceutical composition comprising an expression system according to any one of paras 30 or 32 to 47, or a vector according to any one of paras 31 to 48, or an AAV vector according to any one of paras 49 to 62, and a pharmaceutically-acceptable carrier, diluent, excipient or adjuvant. 65. An expression system according to any one of paras 30 or 32 to 47, or a vector according to any one of paras 31 to 48, or an AAV vector according to any one of paras 49 to 62, or a pharmaceutical composition according to para 64, for use in treating or preventing a disease or condition that would derive therapeutic or prophylactic benefit from an increase inthe level of expression of ACTA1 in skeletal muscle cells.66. Use of an expression system according to any one of paras 30 or 32 to 47, or a vector according to any one of paras 31 to 48, or an AAV vector according to any one of paras 49 to 62, or a pharmaceutical composition according to para 64 in the manufacture of a medicament for treating or preventing a disease or condition that would derive therapeutic orprophylactic benefit from an increase in the level of expression of ACTA1.67. A method of treating or preventing a disease or condition that would derive therapeutic or prophylactic benefit from an increase in the level of expression of ACTA1, comprising administering to a subject an expression system according to any one of paras 30 or 32 to 47, or a vector according to any one of paras 31 to 48, or an AAV vector according to any one of paras 49 to 62, or a pharmaceutical composition according to para 64. Docket No. P38844 68. The expression system, vector, AAV vector, or pharmaceutical composition for use according to para 65 or 66, or the method of treatment according to para 67, wherein the disease is a congenital myopathy, in particular wherein the disease is selected from the group consisting of a nemaline myopathy, an intranuclear rod myopathy, an actin filament aggregate myopathy, a congenital fiber type disproportion, and myopathy with core-like areas. 69. The invention as hereinbefore described and with reference to the Figures and Examples. *** The present disclosure includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided. The section headings used herein are for organisational purposes only and are not to be construed as limiting the subject matter described. Aspects and embodiments of the present disclosure will now be illustrated, by way of example, with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference. Throughout this specification, including the claims which follow, unless the context requires otherwise, the word ‘comprise’, and variations such as ‘comprises’ and ‘comprising’, will be understood to imply the inclusion of a stated integer or step or group of integers or stepsbut not the exclusion of any other integer or step or group of integers or steps.As used herein, a ‘peptide’ refers to a chain of two or more amino acid monomers linked by peptide bonds. A peptide typically has a length in the region of about 2 to 50 amino acids. A ‘polypeptide’ is a polymer chain of two or more peptides. Polypeptides typically have a length greater than about 50 amino acids. Reference herein to peptides, polypeptides and proteins also includes glycopeptides / glycopolypeptides / glycoproteins, lipopeptides / lipopolypeptides / lipoproteins, nucleopeptides / nucleopolypeptides / nucleoproteins, etc. Docket No. P38844 As used herein, an amino acid sequence, or a region of a polypeptide, which ‘corresponds’ to a specified reference amino acid sequence or region of a polypeptide has at least 60%, e.g. one of at least ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97 %, ≥98%, ≥99% or 100% sequence identity to the amino acid sequence of the amino acid sequence / polypeptide / region. An amino acid sequence / region / position of a polypeptide / amino acid sequence which ‘corresponds’ to a specified reference amino acid sequence / region / position of a polypeptide / amino acid sequence can be identified by sequence alignment of the subject sequence to the reference sequence, e.g. using sequence alignment software such as ClustalOmega (Söding, J. 2005, Bioinformatics 21, 951-960). Similarly, a nucleotide sequence, or a region of a polynucleotide, which ‘corresponds’ to a specified reference nucleotide sequence or region of a polynucleotide has at least 60%, e.g. one of at least ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97 %, ≥98%, ≥99% or 100% sequence identity to the amino acid sequence of the nucleotide sequence / polynucleotide / region. A polynucleotide / region / position of a polynucleotide / nucleotide sequence which ‘corresponds’ to a specified reference nucleotide sequence / region / position of a polynucleotide / nucleotide sequence can be identified by sequence alignment of the subject sequence to the reference sequence, e.g. using sequence alignment software such as ClustalOmega (Söding, J. 2005, Bioinformatics 21, 951-960). As used herein, an amino acid sequence (e.g. the amino acid sequence of a peptide / polypeptide / domain / region) which is ‘derived from’ a reference amino acid sequence (e.g. the amino acid sequence of a reference peptide / polypeptide / domain / region) comprises, or consists of, an amino acid sequence having at least 60%, e.g. one of at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the reference amino acid sequence. Similarly, a nucleotide sequence (e.g. anucleotide sequence of a polynucleotide) which is ‘derived from’ a reference nucleotidesequence comprises, or consists of, a nucleotide sequence having at least 60%, e.g. one of at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the reference nucleotide sequence. Docket No. P38844 It must be noted that, as used in the specification and the appended claims, the singular forms ‘a’, ‘an’, and ‘the’ include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from ‘about’ one particular value, and / or to ‘about’ another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent ‘about,’ it will be understood that the particular value forms another embodiment. Where a nucleic acid sequence is disclosed herein, the reverse complement thereof is also expressly contemplated. Methods described herein may preferably be performed in vitro. The term ‘in vitro’ is intended to encompass procedures performed with cells in culture whereas the term ‘in vivo’ is intended to encompass procedures with / on intact multi-cellular organisms. BRIEF DESCRIPTION OF THE FIGURES Embodiments and experiments illustrating the principles of the present disclosure willnow be discussed with reference to the accompanying figures.Figure 1: rAAV-encoding example of intronic artificial miRNA scaffold enablingsimultaneous knockdown of endogenous genes and transgenic expression.Figure 2: miRNA knockdown screening system in a CHO targeted-integration cell line. Front plasmid encodes a gene expression cassette with a CMV-driven intronic artificial miRNA scaffold encoding miRNA sequences that target a gene of interest. It also encodes for coACTA1- T2A-mCherry expression to monitor splicing efficiency of the intronic miRNA scaffold. The Back plasmid encodes for two expression cassettes: (i) the targeted reporter expression, which ismodulated by the artificial miRNA. (ii) A normalization reporter transgene expression cassette.Figure 3: GFP / iRFP normalized measurement of miRNA knockdown screening system in CHO targeted-integration cell line encoding different artificial miRNA scaffolds and introns. CHO-TI cells have been transfected and selected for stable integration of Front and Back plasmid and measured for GFP, iRFP expression using flow cytometry. Designs of minI-miR33a scaffolds Docket No. P38844 encoding non-target siRNAs (Luci) were used. Values are normalized to introns without artificial miRNA scaffolds. Figure 4: Raw flow cytometry data of miRNA knockdown screening system in CHO targeted-integration cell line stably encoding artificial miR33 scaffolds with different siRNAs targeting ACTA1. CHO-TI cells have been transfected and selected for stable integration of Front and Back plasmid and measured for GFP, mCherry and iRFP expression using flow cytometry. The performance differences in GFP miRNA knockdown efficiency with CMV-driven expression of minI-intronic artificial miR33 scaffolds encoding ACTA1-targeting siRNAs as well as controls. Control designs without artificial miRNA scaffold in the intron (minI) as wellas minI-miR33a scaffolds encoding non-target siRNAs (shGFP, shLuc) were used.Figure 5: Raw flow cytometry data of miRNA knockdown screening system in CHO targeted-integration cell line encoding artificial miR33 scaffolds with different siRNAs targeting ACTA1 comparing two different promoters. CHO-TI cells have been transfected and selected for stable integration of Front and Back plasmid and measured for GFP, mCherry and iRFP expression using flow cytometry. Comparison of miRNA knockdown efficiency with CMV- driven and minCMV-driven expression of minI-intronic artificial miR33 scaffolds encoding ACTA1-targeting siRNAs as well as controls. As controls, a design without artificial miRNA scaffold in the intron (minI) was used as well as designs of minI-miR33a scaffolds encoding non- target siRNAs (shGFP) and cells without fluorescence (neg control). Figure 6: Raw flow cytometry data of rAAV-delivered artificial miRNA-mediated GFP knockdown in HEK293-GFP-high cell line. Different MOIs of rAAVs encoding for CMV-driven mCherry expression with minimal intron but without miRNA scaffold were used for transduction of a HEK293-GFP-high cell line with stably expression of GFP. rAAV transduction was measured by mCherry expression and miRNA-mediated gene knockdown with GFP expression. A HEK293 cell line without GFP was used as comparator. Figure 7: Raw flow cytometry data of rAAV-delivered artificial miRNA-mediated GFP knockdown in HEK293-GFP-high cell line. Different MOIs of rAAVs encoding for CMV-driven minI-intronic miR33a-GFP scaffold as well as mCherry expression were used for transduction of a HEK293-GFP-high cell line with stably expression of GFP. rAAV transduction was measured Docket No. P38844 by mCherry expression and miRNA-mediated gene knockdown with GFP expression. A HEK293 cell line without GFP was used as comparator. Figure 8: Performance of rAAV-delivered artificial miRNA-mediated ACTA-1 knockdown in HEK293 cell lines stably expressing ACTA1 or ACTC1. Transduction efficiency measured by flow cytometry after 5 days of rAAVs encoding for CMV-driven GFP expression with minI-intronic miR33a scaffold with different ACTA1-targeting siRNA. A HEK293 cell line without GFP was used as a comparator. Figure 9: Performance of rAAV-delivered artificial miRNA-mediated ACTA-1 knockdown in HEK293 cell lines stably expressing ACTA1 or ACTC1. ACTA1 or ACTC1 knockdown measurements with qPCR after 5 days. Relative Quantitation (RQ) is shown for different rAAVs encoding for CMV-driven GFP expression with minI-intronic miR33a scaffold with different ACTA1-targeting siRNA and including controls (no AAV, no miRNA scaffold). GUSB expression levels are used for RQ calculation. Figure 10: Performance of rAAV-delivered artificial miRNA-mediated ACTA-1 knockdown in primary human skeletal muscle myotubes (pHSMM). Transduction efficiency measured by flow cytometry after 3 days of rAAVs encoding for CMV-driven GFP expression with minI-intronic miR33a scaffold with different ACTA1-targeting siRNA. No AAV treatment was used as a control. Figure 11: Performance of rAAV-delivered artificial miRNA-mediated ACTA-1 knockdown in primary human skeletal muscle myotubes (pHSMM). ACTA1 or ACTC1 knockdown measurements with qPCR after 3 days for MOI=6250 is shown. Relative Quantitation(RQ) nromalized to no AAV treatment is shown for different rAAVs encoding for CMV-drivenGFP expression with minI-intronic miR33a scaffold with different ACTA1-targeting siRNA and including controls (no AAV, no miRNA scaffold). GUSB expression levels are used for RQ calculation. Figure 12: Aggregation phenotype (“nemaline rods”) of HEK293 cell line stably overexpressing ACTA1 H40Y but not D286G mutation. A) Confocal micrographs of HEK293 cells overexpressing ACTA1 H40Y mutation and different immunofluorescence stainings: DAPI (nucleus), phalloidin (actin filaments) and overlay. B) Confocal micrographs of HEK293 cells Docket No. P38844 overexpressing ACTA1 D286G mutation and different immunofluorescence stainings: DAPI(nucleus), phalloidin (actin filaments) and overlay of all three stainings.Figure 13: Aggregation phenotype (“nemaline rods”) of HEK293 cell line stably overexpressing ACTA1 H40Y mutation can be reverted by rAAV-delivered ACTA1-targeting miR33 scaffold expression. A Confocal micrographs of HEK293 cells overexpressing ACTA1 H40Y mutation and different immunofluorescence stainings: DAPI (nucleus), phalloidin (actin filaments) showing the overlay of both stainings before and after rAAV treatment encoding miR33-ACTA1. Total nemaline rod intensity per nuclei count is shown for control without rAAV treatment (negctr) and two rAAV treatments expressing miR33 scaffolds with two different siRNA targeting ACTA1 (166 and 169). B Description of method for total rod intensitymeasurement and normalization to cell count (nuclei).Figure 14: Performance of rAAV-delivered artificial miRNA-mediated gene knockdown and influence on different genes in primary human skeletal muscle myotubes (pHSMM) measured by DRUG-seq. Different MOIs of rAAVs encoding for CMV-driven minI-intronic miR33-ACTA1 scaffold as well as coACTA1-T2A-GFP or GFP expression were used for transduction of pHSMM showing different plots of expression levels for specific genes: 14A) wildtype ACTA1 gene expression normalized to non-transduced control. 14B) wildtype ACTA1 gene expression. As controls, a design without artificial miRNA scaffold in the intron (210_minI+GFP and 146_MinI+coA+GFP) was used as well as designs of minI-miR33 scaffolds encoding non-target siRNAs (shLuc+GFP) and cells without fluorescence (negcon(noAAV)). Figure 15: Performance of rAAV-delivered artificial miRNA-mediated gene knockdown and influence on different genes in primary human skeletal muscle myotubes (pHSMM) measured by DRUG-seq. Different MOIs of rAAVs encoding for CMV-driven minI-intronic miR33-ACTA1 scaffold as well as coACTA1-T2A-GFP or GFP expression were used for transduction of pHSMM showing different plots of expression levels for specific genes: 15A) GFP gene expression. 15B) coACTA1 gene expression. As controls, a design without artificial miRNA scaffold in the intron (210_minI+GFP and 146_MinI+coA+GFP) was used as well as designs of minI-miR33 scaffolds encoding non-target siRNAs (shLuc+GFP) and cells without fluorescence (negcon(noAAV)). Docket No. P38844 Figure 16: Performance of rAAV-delivered artificial miRNA-mediated gene knockdown and influence on different genes in primary human skeletal muscle myotubes (pHSMM) measured by DRUG-seq. Different MOIs of rAAVs encoding for CMV-driven minI-intronic miR33-ACTA1 scaffold as well as coACTA1-T2A-GFP or GFP expression were used for transduction of pHSMM showing different plots of expression levels for specific genes: 16A) ACTC1 gene expression 16B) BAX gene expression. As controls, a design without artificial miRNA scaffold in the intron (210_minI+GFP and 146_MinI+coA+GFP) was used as well as designs of minI-miR33 scaffolds encoding non-target siRNAs (shLuc+GFP) and cells without fluorescence (negcon(noAAV)). Figure 17: Performance of rAAV-delivered artificial miRNA-mediated gene knockdown and influence on different genes in primary human skeletal muscle myotubes (pHSMM) measured by DRUG-seq. Different MOIs of rAAVs encoding for CMV-driven minI-intronic miR33-ACTA1 scaffold as well as coACTA1-T2A-GFP or GFP expression were used fortransduction of pHSMM showing different plots of expression levels for specific genes: 17A)CASP3 gene expression. 17B) TP53 gene expression. As controls, a design without artificial miRNA scaffold in the intron (210_minI+GFP and 146_MinI+coA+GFP) was used as well as designs of minI-miR33 scaffolds encoding non-target siRNAs (shLuc+GFP) and cells without fluorescence (negcon(noAAV)). Figure 18: Performance of rAAV-delivered artificial miRNA-mediated gene knockdown and influence on different gene expression in primary human skeletal muscle myotubes (pHSMM) measured by DRUG-seq. rAAVs encoding for CMV-driven minI-intronic miR33- ACTA1 scaffold as well as coACTA1-T2A-GFP (18B) or GFP (18A) expression that were used for transduction of pHSMM showing volcano plot of different gene expression compared to untreated cells. C Differential gene expression analysis of different rAAVs encoding for CMV- driven minI-intronic miR33-ACTA1 scaffold as well as coACTA1-T2A-GFP (18B) or GFP (18A) expression that were used for transduction of pHSMM. As controls, a design without artificial miRNA scaffold in the intron (Intron) as well as designs of minI-miR33 scaffolds encoding non-target siRNAs (miLuc) were used. EXAMPLES Docket No. P38844 EXAMPLE 1: GENERAL METHODS 1.1 Recombinant DNA techniques Standard methods were used to manipulate DNA as described in Sambrook, J. et al, Molecular cloning: A laboratory manual; Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989. The molecular biological reagents were used according to the manufacturer’s instructions. Desired gene segments were synthesized at Geneart AG (Regensburg, Germany) from synthetic oligonucleotides and PCR products by automated gene synthesis. The gene segments flanked by singular restriction endonuclease cleavage sites were cloned into standard cloning / sequencing plasmids. The plasmid DNA was purified from transformed bacteria and concentration determined by UV spectroscopy. The DNA sequence of the cloned gene fragments was confirmed by DNA sequencing. Gene segments were designed with suitable restriction sites to allow transfer into the respective reporter vectors. miRNA scaffolds were cloned into different introns of a CMV-driven gene expression cassette encoding a Transgene only or two transgenes linked via T2A cleavage site (Figure 1). The mmu-pri- miR-33 was engineered in a way to replace the miRNA and miRNA* sequence as described in Xie et al., Molecular Therapy (2020). Other scaffolds are derived from miRBase database and engineered in a way to replace the miRNA and miRNA* sequence. Used genetic elements are described in Table 2. 1.2 Production of rAAV by triple transfection Recombinant AAVs were produced by triple transfection in Expi293F (Thermo Fisher Scientific) cells using PEI MAX (Polysciences) as a transfection reagent according to the manufacturers’ recommendation. In brief, Expi293F cells were grown in 500mL shake flasks and a culture volume of 125 mL to a density of 3x106cells / mL. For transfection, equimolar amounts of a first plasmid carrying the rep-cap gene of AAV2 (pAAV2 rep / cap), a second plasmid carrying the adenoviral helper genes E4, E2a and VA (pHelper) and a third plasmid carrying the reporter gene of interest flanked by AAV2 ITRs (pTransgene) were combined and diluted in 2.5 mL Expi293 expression medium. In total 0.6 µg DNA per 106cells were Docket No. P38844 used. PEI MAX was separately mixed with 2.5 mL Expi293 expression medium and combined with the previously prepared DNA mix at a ratio of 1:2.5 (DNA:PEI). After incubation the DNA-PEI complexes were added dropwise to the cells. Finally, transfected cell cultures were incubated at 37°C, 125 rpm and 8% CO2 for 72 h. To harvest recombinant AAVs, cells were centrifuged at 300 g for 5 min and chemically lysed using a Triton CG-110-based lysis buffer containing 50 U / mL DENARASE (c-LEcta). For complete lysis, the cells were incubated and agitated for 1.5 h at 37°C and 180 rpm. To remove cell debris after the lysis, the suspension was centrifuged at 4,000 x g for 60 min. At last, the supernatant was passed through a 0.8 / 0.2 µm dual filter unit and collected. The sterile and clarified cell lysates were stored at -80°C until the iodixanol gradient purification was performed. 1.3 Purification of rAAV by iodixanol gradient ultracentrifugation For purification and separation of desired full rAAV capsids, iodixanol density-gradient ultracentrifugation was applied, using layers of 60%, 40%, 25% and 15% iodixanol. Filtrated virus lysates were thawed and transferred to an ultracentrifugation tube. Subsequently, the differently concentrated iodixanol gradients were added on top, tubes were mass balanced, sealed and centrifuged at 230,000 x g for 2 h at 4°C in a Beckman 50.2 Ti Rotor. Upon centrifugation, tubes were fixed well and punctured on the top with a 21G needle to allow air inflow. A second 21G needle attached to a syringe was carefully inserted below the 60-40% interface and 1.0 to 2.5 mL were collected from the 40% phase. The resulting vector stocks were either stored at -80°C or further processed to exchange the iodixanol against PBS and increase the virus concentration. This was achieved by ultrafiltration using Amicon Ultra-15 centrifugal filter units. Concentrated samples were stored at -80°C. 1.4 rAAV transduction and analysis of reporter gene expression Primary human skeletal muscle myoblasts (HSMM) were used as a cellular model to measure promoter activity in human skeletal muscle. For the transduction of HSMM, cells were seeded at 3 to 4.5x104cells / cm2(typically in 96 well format) in growth medium (Lonza SkBM- Docket No. P38844 2 or PromoCell skeletal muscle growth medium plus respective supplements as provided by the vendor) and checked for proper morphology. On the next day, the cells were transduced by constructs diluted in MEM (L-Glutamine, Pen / Strep, 10 µM Etoposide, w / o phenol red). 4-5hours post-transduction, cells were supplemented with fetal calf serum (c f=2.5%v / v). On day 3,etoposide was withdrawn by growth medium exchange. On day 5 the medium was changed against differentiation medium (Lonza DMEM / BioWhittaker F-12 [1:1], L-Glutamine, heat inactivated horse serum plus Pen / Strep). Between d7 and d9 cells were typically analyzed on an Incucyte (Sartorius) or via flow cytometry for fluorescent protein expression (e.g. eGFP, mCherry). For flow cytometry, cells were washed twice with PBS and detached with 0.05%Trypsin / EDTA. Detachment was stopped by addition of growth medium or PBS / 10%FBS. Cells were then centrifuged, washed and co-stained for viability (7AAD) for 15 min. Adherent Hek293 cells and 4 different adherent Hek293 based ACTA1 / ACTC1 cell lines were used to test the transduction efficiency and the knock-down efficiency. For the transduction, cells were seeded at 3 to 3.5x104cells / cm2(typically in 96 well format) in growth medium (DMEM high glucose (PAN biotech) with fetal calf serum (c= 10%v / v) and L- glutamine (4mM). 2 hours later the cells were transduced by constructs diluted in the DMEM medium. On the next day DMEM medium was added (0,25v / v). On day 5 the cells were analyzed via qRT-PCR for knock-down efficiency and via flow cytometry for fluorescent protein expression (e.g. eGFP). For flow cytometry, cells were detached with 0.05% Accutase. Detachment was stopped by addition of PBS / 2,5%FBS. Cells were then centrifuged, washed and measured with FACS CantoII. EXAMPLE 2: CHO TI GENERATION AND FACS ANALYSIS A novel artificial miRNA gene knockdown screening method has been developed based on a targeted integration technology in CHO cells that uses RMCE-mediated stable integration of two plasmids (Front and Back) simultaneously (Figure 2). TI host cells were propagated in disposable 125 ml vented shake flasks under standard humidified conditions (95 % rH, 37 °C, and 5 % CO 2 ) at a constant agitation rate of 150 rpm in a proprietary DMEM / F12-based medium. Every 3-4 days the cells were seeded in chemically Docket No. P38844 defined medium containing Blasticidin S (selection marker 1) and Hygromycin B (selection marker 2) in effective concentrations with a concentration of 3x10E5 cells / ml. Density and viability of the cultures were measured with a Cedex HiRes cell counter (F. Hoffmann-La Roche Ltd, Basel, Switzerland). For stable transfection, two days prior to transfection TI host cells were seeded in fresh medium with a density of 4x10E5 cells / ml. Transfection was performed with the MaxCyte STX electroporation device (MaxCyte Inc., Gaithersburg) using OC-400 electroporation cassettes according to the manufacturer’s protocol. 3x10E7 cells were transfected with a total of 30 µg with plasmid ratio 2.5:2.5:1 (front-, back-, Cre-Recombinase plasmid) per transfection. After transfection, the cells were seeded in 30 ml medium without selection agents. On day 5 after seeding the cells were centrifuged (1200rpm, 5min) and transferred to 80 mL chemically defined medium containing puromycin (selection agent 1) and 1-(2’-deoxy-2’- fluoro-1-beta-D-arabinofuranosyl-5-iodo)uracil (FIAU; selection agent 2) at effective concentrations at 6x10E5 cells / ml for selection of recombinant cells. The cells were incubated at 37 °C, 150 rpm.5% CO2, and 85% humidity from this day on without splitting. Cell density and viability of the culture was monitored regularly. When the viability of the culture started to increase again, the concentrations of selection agents 1 and 2 were reduced to half the amount used before. In more detail, to promote the recovery of the cells, the selection pressure was reduced if the viability is >40 % and the viable cell density (VCD) is >0.5x10E6 cells / mL. Therefore, 4x10E5 cells / ml were centrifuged and resuspended in 40 ml selection media II (chemically defined medium, ½ selection marker 1 and ½ selection marker 2). The cells were incubated with the same conditions as before and continued with regular splitting and monitoring.Once the viability was >90%, pool generation was considered as complete.The success of Cre mediated cassette exchange was checked by flow cytometry measuring the expression of both fluorescent reporters GFP (for assessing knockdown efficiency of the miRNA) and of mCherry (for measuring protein expression of the CMV-intron-miRNA-mCherry gene cassette). Flow cytometry was performed with a BD FACSCelesta™ Flow Cytometer (BD, Heidelberg, Germany). Ten thousand events per sample were measured. Living cells were gated in a plot of forward scatter (FSC) against side scatter (SSC). The live cell gate was defined with non-transfected TI host cells and applied to all samples by employing the FlowJo 10.8.1 EN software (Ashland, OR 97520 USA). Fluorescence of GFP was quantified in the FITC channel Docket No. P38844 (excitation at 488 nm, detection at 530 nm). mCherry was measured in the PE-CF594 channel (excitation at 561 nm, detection at 610 nm). Parental CHO cells, i.e. those cells used for the generation of the TI host cell, were used as a negative control with regard to GFP and mCherry expression. We cloned different introns (see Table 2) containing different miRNA scaffolds (see Table 2) that encode for siRNAs against GFP (on-target) or Luciferase (off-target control) into the Front vector. After stable CHO-TI pool generation, GFP, mCherry and iRFP was measured to quantify gene knockdown efficiency. Depending on the intron as well as miRNA scaffold, different GFP knockdown efficiencies were measured (Figure 3). For example the miR450b scaffold didn’t result in GFP gene knockdown, while miR30a, miR33 and miR155(eSIBR) resulted in highly efficient GFP knockdown independently of the intronic context. We cloned different siRNAs targeting ACTA-1 into the minI-miR33 scaffold of the Front vector to identify candidates with high ACTA-1 gene knockdown efficiency. Therefore, the a ACTA-1 sequence was codon-optimized in a way to diverge from wildtype ACTA-1 sequence (named coACTA-1) as much as possible to avoid self-targeting its own transcript of the miR-ACTA1 candidates (Figure 2). Stable CHO-TI pools were generated for all the candidates and GFP, mCherry and iRPF measured by flow cytometry (Figure 4). Interestingly, the ACTA-1 gene knockdown efficiency varied for the different miR33-ACTA1 variants enabling selection of candidates based on gene knockdown performance with this assay. Importantly, since the miRNA scaffold and the respective targeted transgene are both stably integrated, all CHO-TI cells harboring the Front and Back vector (mCherry+ and iRFP+) display a narrow and clear GFP intensity peak enabling improved differentiation of gene knockdown performance mediated by different miR-ACTA1 variants. Replacing the CMV promoter driving the expression of the miRNA scaffold with a minimal promoter (minCMV) strongly reduced the dynamic range of gene knockdown, e.g. ACTA1 gene knockdown efficiency across different miR-ACTA1 candidates (Figure 5). EXAMPLE 3: ADHERENT HEK293-ACTA1 STABLE CELL LINE GENERATION To assess the activity of different ACTA1 shRNA candidates in an in-vitro cell model, an adherent HEK293 cell line was genetically engineered to express the wildtype forms of ACTA1, Docket No. P38844 ACTA1_H40Y mutant, ACTA1_D286G mutant or ACTC1 as off-target. For modification, a transposon vector system was used which consists of two plasmids: transposon vector in which the gene of interest is flanked by two inverted / direct repeats IR / DR, and a vector encoding the SleepingBeauty transposase SB100x. Full-length wildtype cDNA encoding human ACTA1, ACTA1_H40Y, ACTA1_D286G or ACTC1 together with their 3’ UTR region was subcloned into the transposon vector, carrying a Puromycin-resistance. In the final plasmid the expressionis under the control of a CMV promoter. The transposon and the transposase vectors were co -transfected into adherent HEK293 cells using 293Fectin reagent (Gibco, #12347019) according to the manufacturer’s protocol. Adherent HEK293 cells were maintained in DMEM media (PAN, #P04-03609) supplemented with 10% FCS (Gibco, #10500), 2 mM L-Glutamine and after stable transfection in addition with 2.5µg / mL Puromycin (Gibco, #A11138-03). Adherent HEK293 cells stably expressing human ACTA1, ACTA1 mutants or ACTC1 were isolated by single cell sorting with a BD FACSAria III cell sorter (BD Biosciences) and cultured to establish stable cell clones. Stable cell clones were screened for ACTA1 or ACTC1 expression and expanded. The expression level and stability was confirmed by flow cytometry analysis after cell preparation with 4% PFA and Methanol and staining using mIgG1 mouse anti Actin clone 3B3 (NovusBio) and anti mouse IgG-PE (Jackson Immunoresearch) for ACTA1 cell clones or anti-muscle Actin antibody [ERP8484] (Abcam) and anti rabbit IgG-PE (Jackson Immunoresearch) for ACTC1 cell clones over a period of 4 weeks. In order to evaluate the gene knockdown efficiency of rAAV-delivered miRNA scaffolds, HEK293 cells stably expressing GFP were used as a cellular model. The rAAVs encoded for CMV-driven minI-intronic miR33-GFP scaffold (on-target) or without miR33 scaffold (control, no miR) both also encoding for mCherry as transgene. After rAAV transduction with different MOIs, a MOI-dependent transduction efficiency measured by mCherry expression levels as well as a MOI-dependent GFP gene knockdown efficiency measured by GFP expression levels could be observed for the miR33-GFP rAAV (Figure 7), but not the control rAAV (Figure 6). Importantly, with increased transduction efficiency the GFP gene knockdown efficiency also increased. With the highest MOI=250k the GFP intensity levels were comparable to a HEK293 cell line without GFP expression (Figure 7). In order to evaluate different miR33-ACTA1 candidate performance in a cellular context, two different cellular models were used. In a first experiment, HEK293 cells stably Docket No. P38844 overexpressing ACTA1 or ACTC1 were used. The rAAVs encoded for CMV-driven minI- intronic miR33-ACTA1 scaffold encoding for different ACTA1 siRNAs (on-target) or without miR33 scaffold (control, no miR) both also encoding for co-ACTA1-T2A-GFP as transgene. Five days after rAAV transduction, the rAAVs efficiently transduced the cells (Figure 8) as measured by flow cytometry-based GFP intensity and no significant difference was observed between the miR33-ACTA1 candidates and also between the two stable cell line. After five days, the ACTA1 or ACTC1 gene knockdown efficiency was measured by qPCR (Figure 9) showing strong knockdown for miR33-ACTA1 candidates and no influence with the control rAAV. ACTC1 expression was only slightly influenced by some miR33-ACTA1 candidates. In addition, primary human skeletal muscle myotube (pHSMM) cells were transduced with the same rAAVs in a dose-dependent manner (using different MOIs). Here, a clear dose- dependent transduction efficiency was measured by flow cytometry (Figure 10) with comparable transduction efficiencies across the rAAV variants. The ACTA1 gene knockdown was highly efficient with the miR33-ACTA1 candidates (Figure 11) and no ACTA1 gene knockdown was observed with the control rAAV (no miR). ACTC1 expression was moderately reduced by the miR-ACTA1 candidates. Stable HEK293 cell lines overexpressing ACTA1 protein with two clinically-observed mutations in patients that have been further characterized (xxx reference to literature!), which are H40Y and D286G, have been established as well. Interestingly, the HEK293-ACTA1-H40Y cell line exhibited a massive aggregation-like phenotype, similar to rods (described in literature) in the cytosol and nucleus, while the HEK293-ACTA1-D286G cell line did not exhibit this phenotype (Figure 12). Treatment of the HEK293-ACTA1-H40Y with rAAVs that either contain an ACTA1-targeting minI-miR33-ACTA1 scaffold or not contain an miRNA scaffold demonstrated removal of the rods after three days with the minI-miR33-ACTA1 variant (Figure 13). This indicates that the observed rods in the HEK293-ACTA1-H40Y cell line are triggered by ACTA1-H40Y overexpression and this phenotype can be reversed by artificial ACTA1 miRNA gene knockdown delivered by rAAVs. Docket No. P38844 EXAMPLE 4: RESCUE OF HEK CELLS EXPRESSING MUTANT ACTA1 Cell Culture and Confocal Immunofluorescence Analysis. HEK cells (stably expressing either H40Y of D268G mutation of ACTA1) were grown on calibrated glass coverslips to a confluency of 80%. Subsequently, cells were fixed with 4% freshly prepared paraformaldehyde, washed and incubated with Alexa Fluor™ 488 Phalloidin (1:100; Thermo)for 1h and DAPI for 5 min at RT. Alexa Fluor™ 488 Phalloidin has a conformatio nal epitopethat lies in the groove of an actin filament consisting of at least 3 actin monomers. We found that phalloidin strongly labels both cytoplasmic and nuclear rods in the H40Y but not in the D268G mutant cells indicating that the H40Y structural binding site is specific to filamentous actin. Imaging was performed on a Leica Falcon SP8 confocal microscope using hybrid detectors (HyD). Imaging conditions were as follows: 63× / 1.40 N.A. oil immersion lens with sequential acquisition for each channel using 405nm laser diode and white light laser excitation (Ex) at 405 nm / emission (Em) 413–455 nm, Ex 488 / Em 495-537 nm, respectively. Images were recorded sequentially. Images were gated in a way that filamentous stress fibers were excluded from image analysis. Total Alexa Fluor™ 488 phalloidin fluorescence of H40Y nemaline rods was then measured and normalized to the cell number determined by the DAPI staining using MetaMorph imaging software (Molecular Devices). Interestingly, the HEK293-ACTA1-H40Y cell line exhibited a massive aggregation-like phenotype, similar to rods in the cytosol and nucleus, while the HEK293-ACTA1-D286G cell line did not exhibit this phenotype (Figure 12). Treatment of the HEK293-ACTA1-H40Y with rAAVs that either contain an ACTA1-targeting minI-miR33-ACTA1 scaffold or not contain an miRNA scaffold demonstrated removal of the rods after three days with the minI-miR33- ACTA1 variant (Figure 13). This indicates that the observed rods in the HEK293-ACTA1- H40Y cell line are triggered by ACTA1-H40Y overexpression and this phenotype can be reversed by artificial ACTA1 miRNA gene knockdown delivered by rAAVs. EXAMPLE 5: RNA QUANTIFICATION AND DRUG-SEQ Human Skeletal Muscle Myoblasts (HSMMs) (Lonza CC-2580 Lot 20TL293904 Donor 5) were seeded in growth medium (Lonza SkbM-2 CC-3244 plus provided supplements) at a density of 20,000 cells per well in two 96-well plates. 24 hours post-seeding, the medium was Docket No. P38844 changed to differentiation medium (500 ml DMEM:F12 Thermo Fisher 11330-032, 10 ml Horse Serum, Thermo Fisher 26050070, 5 ml Pen / Strep Thermo Fisher 15140122), and simultaneously cells were transduced with AAVs in triplicates at MOIs 500, 1000, 6000, and 20000. Every 2-3 days, the medium was exchanged, and 8 days after transduction, the HSMM cultures were processed using the DRUG-Seq (Alithea Genomics 10841) RNA sequencing library preparation protocol, adhering to the manufacturer's guidelines. In brief, the cells were washed with PBS and incubated for 15 min with lysis buffer on ice to facilitate cytoplasmic lysis. Post-centrifugation (300x g, 5 min, +4 C), the lysate was used directly in the reverse transcription (RT) reaction employing oligo-dT primers with a well-specific barcode and a unique molecular identifier (UMI), allowing to pool all samples in a single tube following RT incubation. Subsequently, standard RNA library preparation steps were performed, including Second-Strand Synthesis, Tagmentation, Library Amplification, and multiple rounds of Solid-Phase Reversible Immobilization (SPRI) bead purification. The final library was sequenced on a NovaSeq 6000 SP1 flow cell (Illumina), aiming for a minimum of 5 million reads per sample. The resulting FASTQ files were aligned to the human genome (GRCh38.p14, Ensembl May 2023) and expanded for GFP and codon-optimized ACTA1 sequences, using the Spliced Transcripts Alignment to a Reference (STAR, Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR. STAR: ultrafast universal RNA-seq aligner. Bioinformatics.2013 Jan 1;29(1):15-21. doi: 10.1093 / bioinformatics / bts635. Epub 2012 Oct 25. PMID: 23104886; PMCID: PMC3530905.) aligner in 'solo' mode, generating a UMI-corrected count matrix for each 96-well plate. Of 192 samples, 181 met the quality threshold of at least 6,000 reads per sample and showed, on average, 15,000 genes per sample. The count matrix was analyzed using the Seurat (Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol. 2018 Jun;36(5):411-420. doi: 10.1038 / nbt.4096. Epub 2018 Apr 2. PMID: 29608179; PMCID: PMC6700744.) package in Rstudio (Version 2023.06.0+421), employing counts per million (CPM) normalization to compare transcript levels. For differential gene expression analysis, transduced samples were compared to non-transduced controls with the Seurat-implemented likelihood ratio test (McDavid A, Finak G, Chattopadyay PK, Dominguez M, Lamoreaux L, Ma SS, Roederer M, Gottardo R. Data exploration, quality control and testing in single-cell qPCR-based gene expression experiments. Bioinformatics.2013 Feb 15;29(4):461- 7. doi: 10.1093 / bioinformatics / bts714. Epub 2012 Dec 24. PMID: 23267174; PMCID: Docket No. P38844 PMC3570210.). Genes with an adjusted p-value below 0.05 and a log fold change (LFC) of less than -0.32 or greater than 0.32, indicative of at least a 25% change in expression, were deemed differentially expressed and treated as potential off-targets. DRUG-seq of pHSMM cells was performed in order to verify qPCR data and in addition obtain differential gene expression data from rAAV-delivered minI-miR33-ACTA1 variants as well as controls (Figure 14-18). For the experiment, different MOIs of rAAVs encoding for minI-miR33-ACTA1 with either coACTA1-T2A-GFP or only GFP were transduced in pHSMM cells. After 8 days, DRUG-seq was performed. Wildtype ACTA1 expression was knocked down in a dose-dependent manner for the minI-miR33-ACTA1 candidates to a different extent while control rAAVs did not strongly affect wildtype ACTA1 expression (Figure 14). GFP and coACTA1 expression increased with increasing MOI for all rAAV constructs encoding the respective transgenes (Figure 15). Other genes, such as ACTC1, CASP3, and T53 were not influenced by the rAAV transduction (Figure 16, 17A). However, the apoptosis marker BAX tended to be higher expressed in high MOI conditions of different construction, potentially representing the negative influence of increased AAV titers on cell viability (Figure 17B). Comparison of two rAAV designs with the same minI-miR33-ACTA1 variant (shSA013), but two different transgenes (coACTA-T2A-GFP or only GFP) demonstrated an impact of coACTA1 on the expression of several genes (Figure 18). Volcano plots of minI-miR33- ACTA1 candidates enable the selection of candidates with low off-target profiles (example shown in Figure 18).
Claims
Docket No. P38844 CLAIMS What is claimed is:
1. A modulatory polynucleotide that inhibits expression of ACTA1, wherein the modulatory polynucleotide encodes an miRNA-33 scaffold, wherein the miRNA-33 scaffold comprises an inhibitory RNA (RNAi) molecule, wherein the RNAi molecule comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 82, and SEQ ID NO: 84, and wherein the antisense strand shares a region of complementarity of at least 20, at least 21, at least 22 at least 23, at least 24, or at least 25 nucleotides in length to the sense strand, and wherein the antisense strand sequence differs by no more than 4 nucleotides from a reverse complementary nucleotide sequence of the nucleotide sequence of the sense strand.
2. The modulatory polynucleotide according to claim 1, wherein the modulatory polynucleotide is a single-stranded DNA, a double-stranded DNA, a DNA that is a mixture of single- and double-stranded regions, a single-stranded RNA, a double-stranded RNA, a RNA that is mixture of single- and double-stranded regions, a single-stranded molecules comprising DNA and RNA, a double-stranded molecules comprising DNA and RNA, or a molecule comprising DNA and RNA having a mixture of single- and double-stranded regions, in particular, wherein the modulatory polynucleotide is a single-stranded DNA.
3. The modulatory polynucleotide according to claim 1 or 2, wherein the modulatory polynucleotide inhibits activity of a ACTA1 gene.
4. The modulatory polynucleotide according to claim 3, wherein the ACTA1 gene is a wild- type ACTA1 gene, or a mutated ACTA1 gene.
5. The modulatory polynucleotide according to claim 3 or 4, wherein the ACTA1 gene is a mutated ACTA1 gene with at least one pathogenic mutation.Docket No. P38844 6. The modulatory polynucleotide according to any one of claims 1 to 5, wherein the modulatory polynucleotide inhibits activity of both a wild-type ACTA1 gene and a mutatedACTA1 gene with at least one pathogenic mutation.
7. The modulatory polynucleotide according to any one of claims 1 to 6, wherein themodulatory polynucleotide does not inhibit activity of a codon optimized ACTA1 gene.
8. The modulatory polynucleotide according to any one of claims 1 to 7, wherein the modulatory polynucleotide comprises the sequence of SEQ ID NO: 93 or a sequence having at least 85 % sequence identity to SEQ ID NO:
93.
9. The modulatory polynucleotide according to any one of claims 1 to 8, wherein the modulatory polynucleotide comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, and SEQ ID NO:
124.
10. An expression system comprising a modulatory polynucleotide according to any one of claims 1 to 9, wherein the modulatory polynucleotide is operably linked to a promoter, and optionally wherein the expression system additionally comprises a codon optimized polynucleotide encoding ACTA1.
11. An adeno-associated virus (AAV) vector comprising a modulatory polynucleotide according to any one of claims 1 to 9, wherein the modulatory polynucleotide is operably linked to a promoter, and optionally wherein the AAV vector additionally comprises a codon optimized polynucleotide encoding ACTA1.
12. The expression system according to claim 10, or the AAV vector according to claim 11, wherein the expression system or vector comprises a first expression cassette comprising the polynucleotide encoding the codon optimized polynucleotide encoding ACTA1 and a second expression cassette comprising the modulatory polynucleotide according to any one of claims 1 to 9.Docket No. P38844 13. The expression system according to claim 10 or 12, or the AAV vector according to claim 11, wherein first expression cassette comprises an intron comprising the second expression cassette encoding the modulatory polynucleotide.
14. An adeno-associated virus (AAV) vector comprising a vector genome, wherein the vector genome comprises in 5’ to 3’ order: (i) a 5' inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) optionally, a 5' UTR sequence; (iv) a codon optimized polynucleotide encoding ACTA1; (v) a 3' UTR sequence; and (vi) a 3' inverted terminal repeat (ITR) sequence, wherein the vector genome comprises a modulatory polynucleotide according to any one of claims 1 to 9.
15. The AAV vector according to claim 14, wherein the vector genome is suitable for being packaged into an adeno-associated viral particle.
16. A pharmaceutical composition comprising an expression system according to any one of claims 10, 12 or 13, or an AAV vector according to any one of claims 11, 14 or 15, and a pharmaceutically-acceptable carrier, diluent, excipient or adjuvant.
17. An expression system according to any one of claims 10, 12 or 13, or an AAV vector according to any one of claims 11, 14 or 15, or a pharmaceutical composition according to claim 16, for use in treating or preventing a disease or condition that would derive therapeutic or prophylactic benefit from an increase in the level of expression of ACTA1 in skeletal muscle cells.
18. Use of an expression system according to any one of claims 10, 12 or 13, or an AAV vector according to any one of claims 11, 14 or 15, or a pharmaceutical composition according toclaim 16 in the manufacture of a medicament for treating or prevent ing a disease or conditionthat would derive therapeutic or prophylactic benefit from an increase in the level of expression of ACTA1.Docket No. P38844 19. A method of treating or preventing a disease or condition that would derive therapeutic or prophylactic benefit from an increase in the level of expression of ACTA1, comprising administering to a subject an expression system according to any one of claims 10, 12 or 13, or an AAV vector according to any one of claims 11, 14 or 15, or a pharmaceutical composition according to claim 16.
20. The expression system, vector, AAV vector, or pharmaceutical composition for use according to claim 18, or the method of treatment according to claim 19, wherein the disease is a congenital myopathy, in particular wherein the disease is selected from the group consisting of a nemaline myopathy, an intranuclear rod myopathy, an actin filament aggregate myopathy, a congenital fiber type disproportion, and myopathy with core-like areas.
Citation Information
Patent Citations
Use of ACTA1 as diagnosis and treatment marker of tongue squamous cell carcinoma
CN106811532A