antibodies

Antibodies targeting TCRbetal or TCRbeta2 address the diagnostic challenges of T-cell malignancies by enabling specific staining and therapeutic targeting, improving diagnosis and treatment of T-cell malignancies and inflammation.

WO2025202622A1PCT designated stage Publication Date: 2025-10-02OXFORD UNIVERSITY INNOVATION LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/GB2025/050625
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-04
Filing Date
2025-03-24
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

Current methods for diagnosing T-cell malignancies and associated inflammation are challenging due to the similarity in amino acid sequences of TCRbetal and TCRbeta2, requiring expensive and time-consuming PCR-based gene rearrangement studies, and lack spatial/morphological indication of monoclonal T-cell populations.

Method used

Development of antibodies or antigen binding fragments that specifically target TCRbetal or TCRbeta2, enabling staining of formalin-fixed pathology specimens and allowing therapeutic targeting of one T-cell subset while leaving the other unaffected, with applications in diagnosis, monitoring, and therapy.

Benefits of technology

Provides a cost-effective and specific means to identify and treat T-cell malignancies and inflammation by distinguishing TCRbetal and TCRbeta2, overcoming the limitations of existing diagnostic methods and enabling therapeutic interventions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GB2025050625_02102025_PF_FP_ABST
    Figure GB2025050625_02102025_PF_FP_ABST
Patent Text Reader

Abstract

The invention relates to antibodies which are capable of specifically binding to TCRbeta1 or TCRbeta2, and associated uses in diagnosis, prognosing and treatment of a disease or disorder associated with T-cell monotypia, or T cell-associated inflammation.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] ANTIBODIES

[0002] FIELD OF INVENTION

[0003] The present invention relates to antibodies, and their use in treating, preventing, diagnosing or monitoring diseases or disorders associated with T-cell monotypia, such as T-cell leukaemia and T-cell lymphoma and T-cell associated inflammation.

[0004] BACKGROUND

[0005] All T cells, including Natural Killer T cells (NKT cells), express multiple copies of a T cell receptor (TCR) on their surface. TCRs are composed of two chains (an alpha and beta chain or a gamma and a delta chain), each of which has a constant region and a variable region. The variable region, due to somatic recombinations during T-cell development, can exist in an almost infinite variety of different sequences. To be monoclonal, a T-cell population must have T-cells in which all V-regions are identical. Each chain of a TCR also has a constant region. All alpha constant regions are the same, however the beta constant regions when translated may exist in one of two forms as either TCRbetal (also known as TCRBC1) or TCRbeta2 (also known as TCRBC2). TCRbetal and TCRbeta2 are discussed in Droese et al. Leukemia (2004) 18, 1531-1538. A T cell will express either TRBC1 or TRBC2 but not both. The majority of T cells express the alpha-beta T cell receptor (TCR) and typically fall into this group. Additionally, the gamma chain comprises one of two very similar constant regions referred to as TCRgamma 1 (also known as TCRG1) or TCRgamma 2 (also known as TCRG2). The overall structure of the T cell receptor determines its specificity for binding to antigen presented by MHC or MHC-like molecules. In a monotypic population, all (or nearly all) T-cells in a population will have the same constant region, for example all or most will have TCRbetal or TCRbeta2.

[0006] Analysis of the monotypia of tissue infiltrating lymphocytes is an important and common clinico-pathological question in order to differentiate normal inflammatory infiltrates from neoplastic infiltrates (e g. lymphoma or leukaemia). In the setting of B cell lymphoma, this is frequently undertaken at an early stage of investigation by using detection reagents that are specific for kappa and lambda light chains. A skewed kappa: lambda ratio raises the possibility that a tissue B cell infiltrate is neoplastic rather than reactive / inflammatory. When all of the B-cells in a B cell population only express one light chain (only kappa or only lambda), it is known as a monotypic population. The presence of a monotypic population supports the likelihood that there is a clonal or neoplastic B cell population present, and so is a commonly used diagnostic investigation in clinical practice. A monoclonal population of B-cells would all have identical V-regions; this can only be determined by determining the exact sequence of the V-region or some surrogate of the sequence, e.g. PCR fragment size using specific primers.

[0007] In the setting of T cell infiltrates, the designation of monotypia has been less straightforward because kappa and lambda chains are not expressed by T cells. Instead, the diagnosis of a T cell neoplasm is usually supported by undertaking T cell receptor gene rearrangement studies where the rearranged T cell receptor genes are amplified by PCR and then characterised by gel or bioanalyser such as a genescanner to examine the presence of dominant clonally- amplified T cell receptor variable regions (alpha, beta, gamma or delta). This is an expensive and time-consuming approach compared to kappa / lambda staining, and is only performed at specialist centres. Furthermore, it is still often difficult to distinguish reactive from neoplastic infiltrates using T cell receptor gene rearrangement studies, as the reactive infiltrates are also frequently associated with oligoclonal antigen-specific T cell expansions and the neoplastic populations can have an associated anti-tumour or other inflammatory T cell response. Interpretation of the data is therefore highly specialised and open to debate. In practice, T cell receptor gene rearrangement studies are interpreted in the context of the clinical background and associated histological features, but interpretation is hampered by the inability to visualise histologically the T-cells contributing to the monoclonality, unlike for B-cells where kappa and lambda staining can be used.

[0008] It is therefore an aim of the invention to provide new agents which can be used to identify and / or target neoplastic T-cell populations which are monotypic, and agents which can be used to deliver therapeutic benefits for T-cell monotypia and inflammatory diseases.

[0009] SUMMARY OF INVENTION

[0010] The invention relates to an antibody or antigen binding fragment thereof which is capable of binding to TCRbetal or TCRbeta2. The antibody or antigen binding fragment thereof may specifically bind to TCRbetal or TCRbeta2. The antibody or antigen binding fragment thereof may preferentially bind to TCRbetal or TCRbeta2. The antibody or antigen binding fragment thereof may induce cell death of cells expressing TCRbetal or TCRbeta2. The antibody or antigen binding fragment thereof may block the binding of ligands to TCRbetal or TCRbeta2.

[0011] The inventors have developed reagents which are able to distinguish TCRbetal and TCRbeta2 in a range of situations, which are valuable for diagnostic, monitoring, prognostic and therapeutic purposes in the context of T cell malignancies and / or T cell-associated inflammation. Previously, it has been extremely challenging for the field to distinguish TCRbetal and TCRbeta2 because the amino acid sequences are very similar. Small differences in sequence do exist but these sit close to sites potentially obscured by accompanying CD3 subunits and / or by glycosylation sites (10. 1016 / j. cell.2022.07.010). The JOVI-1 antibody is known to be relatively TCRbetal -specific although some TCRbeta2 cross-reactivity does exist (10.3390 / ijms22041817). Indeed, recent data suggest that modifications of JOVI-1 can modulate reactivity towards TCRbeta2 (10.21203 / rs.3.rs- 1475171 / vl). Nevertheless, these antibodies appear to require live T cells to bind; and thus far there have been no TCRbetal and TCRbeta2 specific antibodies which successfully stain formalin-fixed paraffin-embedded (FFPE) material. The invention represents a major advance as it allows staining the vast majority of routinely collected formalin-fixed pathology specimens worldwide and has applications in diagnosis, monitoring, prognosis and companion diagnostics. The invention also has utility in therapeutic applications for T cell malignancies and / or T cell-associated inflammation where it is desirable to target one subset of T cells while leaving the other subset unaffected, and / or to deliver therapeutic agents such as cytotoxic agents or other modulators including immunosuppressants, to cells expressing one constant chain over the other. The invention overcomes the current challenges with diagnosis of T cell malignancies such as T cell lymphoma and T cell leukaemia, which require expensive and time-consuming PCR-based gene rearrangement studies which are only available at specialist centres and show relatively poor specificity and sensitivity. In addition, PCR-based gene rearrangement studies give no spatial / morphological indication of which T cells contributed to a monoclonal signal.

[0012] In any aspect, an antibody or antigen binding fragment thereof which specifically binds to TCRbetal, may not bind to TCRbeta2. In any aspect, an antibody or antigen binding fragment thereof which specifically binds to TCRbeta2 may not bind to TCRbetal.

[0013] In any aspect, an antibody or antigen binding fragment thereof of the invention may bind to TCRbetal or TCRbeta2 in cells of a sample which has been formalin-fixed, paraffin- embedded.

[0014] An antibody or antigen binding fragment thereof of the invention may bind to live or dead cells.

[0015] In an aspect, the antibody or antigen binding fragment thereof may comprise: a) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 3, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 6, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or b) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 9, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 12, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or c) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 15, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 18, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or d) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 21, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 24, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or e) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 27, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 30, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or f) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 33, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 36, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or g) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 39, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 42, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or h) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 45, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 48, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto.

[0016] The antibody or antigen binding fragment thereof may comprise or consist of: a) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 1, a CDR2 with an amino acid sequence of SEQ ID NO: 2, and a CDR3 with an amino acid sequence of SEQ ID NO: 3, or sequences having at least

[0017] 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 4, a CDR2 with an amino acid sequence of SEQ ID NO: 5, and a CDR3 with an amino acid sequence of SEQ ID NO: 6, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or b) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 7, a CDR2 with an amino acid sequence of SEQ ID NO: 8, and a CDR3 with an amino acid sequence of SEQ ID NO: 9, or sequences having at least

[0018] 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 10, a CDR2 with an amino acid sequence of SEQ ID NO: 11, and a CDR3 with an amino acid sequence of SEQ ID NO: 12, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or c) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 13, a CDR2 with an amino acid sequence of SEQ ID NO: 14, and a CDR3 with an amino acid sequence of SEQ ID NO: 15, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 16, a CDR2 with an amino acid sequence of SEQ ID NO: 17, and a CDR3 with an amino acid sequence of SEQ ID NO: 18, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or d) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 19, a CDR2 with an amino acid sequence of SEQ ID NO: 20, and a CDR3 with an amino acid sequence of SEQ ID NO: 21, or sequences having at least%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 22, a CDR2 with an amino acid sequence of SEQ ID NO: 23, and a CDR3 with an amino acid sequence of SEQ ID NO: 24, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or e) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 25, a CDR2 with an amino acid sequence of SEQ ID NO: 26, and a CDR3 with an amino acid sequence of SEQ ID NO: 27, or sequences having at least%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 28, a CDR2 with an amino acid sequence of SEQ ID NO: 29, and a CDR3 with an amino acid sequence of SEQ ID NO: 30, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or f) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 31, a CDR2 with an amino acid sequence of SEQ ID NO: 32, and a CDR3 with an amino acid sequence of SEQ ID NO: 33, or sequences having at least%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 34, a CDR2 with an amino acid sequence of SEQ ID NO: 35, and a CDR3 with an amino acid sequence of SEQ ID NO: 36, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or g) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 37, a CDR2 with an amino acid sequence of SEQ ID NO: 38, and a CDR3 with an amino acid sequence of SEQ ID NO: 39, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 40, a CDR2 with an amino acid sequence of SEQ ID NO: 41, and a CDR3 with an amino acid sequence of SEQ ID NO: 42, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or h) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 43, a CDR2 with an amino acid sequence of SEQ ID NO: 44, and a CDR3 with an amino acid sequence of SEQ ID NO: 45, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 46, SEQ ID NO 119, or SEQ ID NO: 120, a CDR2 with an amino acid sequence of SEQ ID NO: 47, SEQ ID NO: 121 or SEQ ID NO: 122, and a CDR3 with an amino acid sequence of SEQ ID NO: 48, or sequences having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto.

[0019] The antibody or antigen binding fragment thereof may comprise or consist of: a) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 49, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 50, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or b) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 51, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 52, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or c) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 53, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 54, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or d) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 55, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 56, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or e) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 57, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 58, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or f) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 59, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 60, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or g) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 61, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 62, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or h) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 63, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 64, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto.

[0020] The antibody or antigen binding fragment thereof may comprise or consist of: a) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 65, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 66, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or b) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 67, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 68, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or c) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 69, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 70, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or d) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 71, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 72, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or e) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 73, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 74, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or f) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 75, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 76, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or g) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 77, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 78, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or h) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 79, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 80, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or i) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 81, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 82, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or j) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 83, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 84, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto.

[0021] The antibody or antigen binding fragment thereof may comprise or consist of: a) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 85, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 86, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or b) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 87, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 88, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or c) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 89, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 90, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or d) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 91, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 92, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or e) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 93, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 94, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or f) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 95, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 96, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or g) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 97, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 98, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or h) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 99, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 100, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto.

[0022] The antibody or antigen binding fragment thereof may comprise or consist of: a) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 101, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 102, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or b) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 103, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 104, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or c) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 105, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 106, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or d) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 107, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 108, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or e) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 109, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 110, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or f) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 111, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 112, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or g) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 113, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 114, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or h) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 115, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 116, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto.

[0023] The antibody or antigen binding fragment thereof of the invention may be isolated.

[0024] In any therapeutic application disclosed herein, and / or in any method of monitoring or diagnosis disclosed herein, any combination of antibodies or antigen-binding fragments may be utilised. For example, antibody 9F06 (TCRbetal -specific) and 25E10 (TCRbeta2- specific), or any humanised variation thereof, may be used in combination. The combination would allow determination of the ratio and / or percentage of TCRbetal and TCRbeta2; furthermore, the combined staining would capture the total T cell population expressing a TCR beta chain.

[0025] In any method of monitoring or diagnosis disclosed herein, the method may further comprise determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRgammal and / or TCRgamma2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRgammal to TCRgamma2, or TCRgamma2 to TCRgammal. Any available reagent may be used to perform this step, such as one or more oligonucleotide which specifically binds the 3’UTR of TCRgammal, and / or an oligonucleotide which specifically binds the 3’UTR of TCRgamma2. Alternatively, one or more antibody or antigen binding fragment thereof which specifically binds to TCRgammal and / or one or more antibody or antigen binding fragment thereof which specifically binds to TCRgamma2 may be used to perform this step. Optionally, one or more reagent which specifically detects TCRgammal and one or more reagent which specifically detects TCRgamma2 are used to perform this step.

[0026] The antibody or antigen binding fragment thereof may be a monoclonal antibody, bispecific antibody, multi-specific antibody, ScFv or other single chain or modified format, Fab, (Fab’)2, Fv, dAb, Fd, nanobody, camelid antibody or a diabody. Preferably, the antibody or antigen binding fragment thereof is a monoclonal antibody. A bispecific antibody may comprise a TCRbetal and / or TCRbeta2 targeting moiety which comprises an antibody or antigen binding fragment thereof of the invention, and a T-cell or non-T-cell engaging moiety. The T-cell engaging moiety may be a CD3-targeting moiety, such as antibody UCHT1, or targeting a checkpoint pathway molecule, such as PD-1. The engager may target a molecule on the same cell or on a different cell as the TCRbetal or TCRbeta2.

[0027] In another aspect, the invention provides a nucleic acid encoding one or more antibody or antigen binding fragment thereof of the invention. The skilled person will understand that due to codon redundancy, a number of DNA sequences may be used to encode an antibody or antigen binding fragment thereof of the invention. Alternatively, codon optimization of the nucleotide sequence can be used to improve the efficiency of translation in expression systems for the production of an antibody or antigen binding fragment thereof of the invention.

[0028] In another aspect, the invention provides a vector comprising one or more nucleic acid of the invention. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator sequences, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Vectors may be for example plasmids or viral. For further details see, for example, (Sambrook, J., E. F. Fritsch, and T. Maniatis. (1989), Molecular cloning: a laboratory manual, 2nded. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in (Ausubel et al., Current protocols in molecular biology. New York: Greene Publishing Association; Wiley-Interscience, 1992). The vector may be an expression vector. The vector or expression vector may be a plasmid. A nucleic acid molecule or vector of the invention may be expressed using any suitable expression system, for example in a suitable host cell or in a cell-free system.

[0029] In another aspect, the invention provides a host cell comprising one or more antibody or antigen binding fragment thereof, nucleic acid, and / or vector of the invention. The host cell may be selected from bacterial host cells (prokaryotic systems) such as E. Coll or eukaryotic cells such as those of yeasts, fungi, insect cells or mammalian cells. Preferably a host cell of the invention is capable of producing the antibody or antigen binding fragment thereof of the invention. The produced antibody or antigen binding fragment thereof may be enriched by means of selection and / or isolation.

[0030] An antibody or antigen binding fragment thereof of the invention may also be produced by chemical synthesis. The obtained antibody or antigen binding fragment thereof may be enriched by means of selection and / or isolation.

[0031] According to a further aspect, the invention provides a pharmaceutical composition comprising one or more antibody or antigen binding fragment thereof, nucleic acid, vector and / or host cell of the invention, optionally together with one or more pharmaceutically acceptable excipients or diluents. For example, a pharmaceutical composition of the invention may comprise two or more antibody or antigen binding fragments thereof, nucleic acids, vectors and / or host cells of the invention, optionally together with one or more pharmaceutically acceptable excipients or diluents.

[0032] Where more than one antibody or antigen binding fragment thereof, nucleic acid, vector and / or host cell of the invention are provided in a pharmaceutical composition, these will all target, or produce antibody or antigen binding fragments thereof which target, the same constant chain, either TCRbetal or TCRbeta2, but not both.

[0033] In another aspect, the invention provides a kit comprising one or more antibody or antigen binding fragment thereof, nucleic acid, vector, host cell and / or pharmaceutical composition of the invention. The kit may comprise instructions on how to perform any method of the invention.

[0034] An antibody or antigen binding fragment thereof, nucleic acid, vector, host cell or pharmaceutical composition of the invention will be useful in treating diseases or disorders associated with T-cell monotypia, such as neoplasms including T-cell leukaemia and T-cell lymphoma or an inflammatory condition. For example, one or more antibody of antigen binding fragment thereof of the invention may be able to directly target monotypic T-cells killing by antibody-dependent cell-mediated cytotoxicity (ADCC) or complement-dependent cytotoxicity (CDC) or antibody-dependent phagocytosis or by direct cytotoxicity or homotypic adhesion. One or more antibody of antigen binding fragment thereof of the invention may be able to deliver toxic or immunomodulatory agents to the cells, for example by being conjugated to a therapeutic drug as an antibody-drug conjugate (ADC), or being conjugated to another modulator such as a siRNA. One or more antibody of antigen binding fragment thereof of the invention may be incorporated into a chimeric antigen receptor (CAR). Alternatively, these reagents could be used to mark cells in a population that are neoplastic which could then be removed from the population, for example by using FACS, and the population of cells without the neoplastic cells could then be returned to the subject. This could be used to treat lymphomas or leukaemias for example, by treating bone marrow samples in this way.

[0035] Thus, the invention provides a CAR comprising an antibody or antigen binding fragment thereof of the invention. The skilled person is aware of numerous techniques in the art used to incorporate an antibody of antigen binding fragment into a CAR.

[0036] The invention also provides a cell comprising a CAR of the invention, The cell may be a T- cell, such as a CD8+ T-cell, or CD4+ T-cell, NKT cell or NK cell.

[0037] Therefore, in another aspect, the invention provides an antibody or antigen binding fragment thereof of the invention for use in medicine.

[0038] In another aspect, an antibody or antigen binding fragment thereof, nucleic acid, vector, host cell or pharmaceutical composition of the invention may be for use in the treatment or prevention of one or more disease or disorder associated with T-cell monotypia in a subject.

[0039] Therefore, in another aspect, the invention provides an antibody or antigen binding fragment thereof of the invention for use in a method of diagnosis.

[0040] In another aspect, an antibody or antigen binding fragment thereof, nucleic acid, vector, host cell or pharmaceutical composition of the invention may be for use in the diagnosis of one or more disease or disorder associated with T-cell monotypia in a subject. In another aspect, there is provided a method of treating or preventing one or more disease or disorder associated with T-cell monotypia in a subject, comprising administering to the subject an effective amount of an antibody or antigen binding fragment thereof, nucleic acid, vector, host cell or composition of the invention.

[0041] In another aspect, there is provided the use of an antibody or antigen binding fragment thereof, nucleic acid, vector, host cell or pharmaceutical composition of the invention in the manufacture of a medicament for the treatment or prevention of one or more disease or disorder associated with T-cell monotypia in a subject.

[0042] An antibody or antigen binding fragment thereof, nucleic acid, vector, host cell or pharmaceutical composition of the invention may be administered alone or in combination with one or more other therapeutic agent, either simultaneously, sequentially or separately, dependent upon the condition to be treated. The one or more other therapeutic agent may be selected from the group comprising cytotoxic agents, immune activation agents such as checkpoint inhibitors or TLR agonists, anti-inflammatory agents such as steroids, CAR-T cells such as regulatory or cytolytic CAR-T cells, or other cells expressing or presenting one or more antibody or antigen binding fragment of the invention.

[0043] In another aspect, the invention provides a method of monitoring treatment efficacy or disease status in a subject diagnosed with a disease or disorder associated with T-cell monotypia, comprising: i. providing a biological sample obtained from the subject; ii. determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal, before treatment, or at intervals between treatments, or at time intervals in the absence of treatment; iii. determining that the treatment is effective, or that the disease status is improving, if: a) the tumour volume is reduced after treatment or between treatment intervals or at time intervals in the absence of treatment; or if: b) the ratio of T-cells expressing TCRbetal :TCRbeta2 or TCRbeta2:TCRbetal begins to reverse, or the percentage of cells expressing either TCRbetal or TCRbeta2 (whichever the monotypic cells express) begins to reduce in equivalent samples after treatment, or between treatment intervals, or at time intervals in the absence of treatment.

[0044] Optionally, if the ratio does not begin to reverse, or the percentage of either TCRbetal or TCRbeta2 (whichever the monotypic cells express) does not begin to reduce, the subject may be identified as having a neoplastic recurrence.

[0045] Optionally, in the method, the percentage or ratio of T cells in the sample, or subset of the sample, as referred to above, is determined using one or more antibody or antigen binding fragment thereof of the invention.

[0046] Tumour volume may be determined by any suitable technique known to the skilled person.

[0047] In any aspect, tumour volume may refer to the physical volume (for example, in cm / inches, or cm3) of a solid tumour, such as a tumour deposit. Alternatively, tumour volume may refer to the amount of monotypic cells per ml of blood, or number of cells per cm2of tissue sample, such as an FFPE tissue sample.

[0048] Tumour volume may also refer to the metabolic activity within a tumour. Thus, tumour volume may be determined using a PET scan to determine the metabolic activity. A drop in metabolic activity would correlate to a reduction in tumour volume.

[0049] The reduction in tumour volume may be by 10% or more, such as 25% or more, 50% or more, 75% or more, or 90% or more.

[0050] The treatment intervals or time intervals in the absence of treatment may be two weeks or more, such as four weeks or more, 8 weeks or more, 12 weeks or more, six months or more, or 12 months or more.

[0051] In another aspect, there is provided a method of diagnosing a subject with a disease or disorder associated with T-cell monotypia, comprising: i. providing a biological sample obtained from the subject; ii. using one or more antibody or antigen-binding fragment thereof of the invention to detect cells expressing TCRbetal in the sample, or in a subset of the sample; iii. determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbetal, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal; iv. comparing the percentage or ratio with a percentage or ratio in a positive or negative reference value; iv. determining that the subject has a disease or disorder associated with T-cell monotypia, if the percentage or ratio in the sample obtained from the subject, or in a subset of the sample obtained from the subject, is higher than the percentage or the ratio in the negative reference value, or equal to or higher than the percentage or ratio in the positive reference value.

[0052] The method may also comprise using one or more antibody or antigen-binding fragment thereof of the invention to detect cells expressing TCRbeta2 in the sample obtained from the subject, or in a subset of the sample obtained from the subject.

[0053] Alternatively, there is provided a method of diagnosing a subject with a disease or disorder associated with T-cell monotypia, comprising: i. providing a biological sample obtained from the subject; ii. using one or more antibody or antigen-binding fragment thereof of the invention to detect cells expressing TCRbeta2 in the sample, or in a subset of the sample; iii. determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbeta2 to TCRbetal or TCRbetal to TCRbeta2; iv. comparing the percentage or ratio with a percentage or ratio in a positive or negative reference value; iv. determining that the subject has a disease or disorder associated with T-cell monotypia, if the percentage or ratio in the sample obtained from the subject, or in a subset of the sample obtained from the subject, is higher than the percentage or ratio in the negative reference value, or equal to or higher than the percentage or ratio in the positive reference value.

[0054] The method may also comprise using one or more antibody or antigen-binding fragment thereof of the invention to detect cells expressing TCRbetal in the sample obtained from the subject, or in a subset of the sample obtained from the subject.

[0055] A negative reference value as used herein may have been obtained from an equivalent biological sample taken from a healthy subject, known not to have a disease or disorder associated with T-cell monotypia. A negative reference value may have a ratio of T-cells that express TCRbetal to TCRbeta2 of about 1: 1. A negative reference value may have a ratio of T-cells that express TCRbetal to TCRbeta2 of about 11:9. A negative reference value may have a ratio of T-cells that express TCRbetal to TCRbeta2 of about 9: 11. A negative reference value may have a ratio of T-cells that express TCRbetal to TCRbeta2 of about 7: 13. A negative reference value may have a ratio of T-cells that express TCRbetal to TCRbeta2 of about 13:7. A negative reference value may have a ratio of T-cells that express TCRbeta2 to TCRbetal of about 0.18: 1 to 5.7: 1, or any value within this range. This ratio window may be influenced by other indicators such as cell morphology, tissue architecture and co-staining, amongst others.

[0056] A negative reference value may have a percentage of the total T cells or a subset of the total T cells that express TCRbetal or TCRbeta2 of about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, or about 85%. A negative reference value may have a percentage of the total T cells or a subset of the total T cells that express TCRbetal or TCRbeta2 of about 50%, about 55%, about 60%, about 65%, or about 70%. A negative reference value may have a percentage of the total T cells or a subset of the total T cells that express TCRbetal or TCRbeta2 of about 50%, about 55%, or about 60%.

[0057] A positive reference value as used herein may have been obtained from an equivalent biological sample taken from a subject already diagnosed with a disease or disorder associated with T-cell monotypia, such as T-cell leukaemia or T-cell lymphoma. A positive reference value may have a percentage or ratio of T-cells that express TCRbetal to TCRbeta2 as further from the above values corresponding to a negative reference value. A positive reference value may have a ratio of T-cells that express TCRbetal to TCRbeta2 of about 3:2, about 7:3, about 4: 1, about 9: 1, about 19: 1. A positive reference value may have a ratio of T- cells that express TCRbeta2 to TCRbetal outside of the range of about 0.18: 1 to 5.7: 1. This ratio window may be influenced by other indicators such as cell morphology, tissue architecture and co-staining, amongst others.

[0058] A positive reference value may have a ratio of T-cells that express TCRbeta2 to TCRbetal of about 3:2, about 7:3, about 4: 1, about 9: 1, about 19: 1. A positive reference value may have a percentage of the total T cells or a subset of the total T cells that express TCRbetal or TCRbeta2 of about 55% or more, about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more.

[0059] A positive or negative reference value may be obtained from a biological sample from a similar tissue type and / or a subject of similar age, gender, weight, and / or race. A positive reference value may be obtained from a subject with similar medical history. The term “higher” as used herein may mean about a 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 35% or more, about 50% or more, increase in the percentage of T-cells that express a given TCRbeta chain in the sample, or subset of the sample (up to 100% maximum).

[0060] Therefore, if more than about 60%, or more than about 70%, or more than about 80%, or more than about 85%, or more than about 90%, of the T-cells in a sample, or subset of a sample, express a particular beta constant chain, be that TCRbetal or TCRbeta2, then the population may be defined as monotypic and likely to be clonal. If a population is defined as monotypic, and therefore is likely to be clonal, it may also be defined as neoplastic. Preferably, if more than 80% the T-cells in a sample, or subset of a sample, express TCRbetal or TCRbeta2, then the population may be considered neoplastic.

[0061] In another aspect there is provided a method of diagnosing a subject with a disease or disorder associated with T-cell monotypia, comprising: i) providing a biological sample obtained from a subject; ii) using one or more antibody or antigen-binding fragment thereof of the invention to detect cells expressing TCRbetal, and one or more antibody or antigen-binding fragment thereof of the invention to detect cells expressing TCRbeta2 in the sample, or in a subset of the sample, wherein the one or more antibody or antigen-binding fragment thereof which detects TCRbetal does not detect TCRbeta2, and the one or more antibody or antigenbinding fragment thereof which detects TCRbeta2 does not detect TCRbetal; iii) determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal; wherein if more than 50%, such as more than about 60%, more than about 70%, more than about 80%, or more than about 90%, of the T-cells in the sample, or subset of the sample, express the same TCRbeta constant chain, then the T-cells are defined as monotypic, and the subject is diagnosed with a disease or disorder associated with T-cell monotypia. Preferably, the disease or disorder associated with T-cell monotypia is a neoplasm, such as a T-cell leukaemia or T-cell lymphoma.

[0062] In another aspect, there is provided a method of determining a) the percentage of the total T cells in a sample, or in a subset of the total T cells in a sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in a sample, or in a subset of a sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal comprising: i) obtaining a solid or liquid tissue sample or a cell sample from a subject, wherein the subject and / or the sample are suspected of having neoplastic T-cells; ii) contacting the solid or liquid tissue sample or the cell sample with one or more antibody or antigen-binding fragment thereof of the invention to detect cells expressing TCRbetal, and / or one or more antibody or antigen-binding fragment thereof of the invention to detect cells expressing TCRbeta2; iii) detecting a recognition of the TCRbetal and / or TCRbeta2; iv) determining a) the percentage of the total T cells in the sample, or a subset of the total T cells of the sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal.

[0063] In any method of the invention, the method may comprise a first step of manufacturing one or more antibody or antigen-binding fragment thereof of the invention.

[0064] In any method of the invention, the method may comprise an additional step in which the subject is to be treated with one or more of radiotherapy, chemotherapy, bone marrow transplantation, immunotherapy, biological therapy or other appropriate treatments, when more than 50%, such as more than about 60%, more than about 70%, more than about 80%, or more than about 90%, of the T-cells in the sample, or subset of the sample, express the same TCRbeta constant chain.

[0065] In another aspect, the invention provides a method of providing a prognosis for a subject who has been diagnosed with a disease or disorder associated with T-cell monotypia, wherein the method comprises: i. providing a biological sample obtained from the subject; ii. using one or more antibody or antigen-binding fragment thereof of the invention to detect cells expressing TCRbeta2 in the sample, or in a subset of the sample; iii. determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal before treatment, or at intervals between treatments, or at time intervals in the absence of treatment; iv. determining that the patient has a poor prognosis when the ratio of T-cells expressing TCRbetal:TCRbeta2 or TCRbeta2:TCRbetal does not begin to reverse, or the percentage of cells expressing either TCRbetal or TCRbeta2 (whichever the monotypic cells express) does not begin to reduce in equivalent samples after treatment, or between treatment intervals, or at time intervals in the absence of treatment.

[0066] Optionally, levels of other biological markers may be looked at to confirm the prognosis. For example, a high proportion of T-cells in the sample, or subset of the sample, which express Ki67 (or other proliferative markers) may indicate a poor prognosis. Similarly, a loss of T cell antigens such as, but not limited to, CD2, CD3, CD4, CD8, CD5 or CD7, in T-cells of the sample, or a subset of the sample, may indicate a poor prognosis.

[0067] A poor prognosis may refer to an increased likelihood of developing widely disseminated disease, and / or or of greater morbidity, and / or a reduced chance of survival of the subject.

[0068] In contrast, a good prognosis may be provided if in step iv. of the method above, the ratio of T-cells expressing TCRbetal :TCRbeta2 or TCRbeta2:TCRbetal does begin to reverse, or the percentage of cells expressing either TCRbetal or TCRbeta2 (whichever the monotypic cells express) does begin to reduce in equivalent samples after treatment, or between treatment intervals, or at time intervals in the absence of treatment. A good prognosis may refer to a reduced likelihood of developing widely disseminated disease, and / or or of greater morbidity, and / or an increased chance of survival of the subject.

[0069] In any aspect, any method or use of one or more antibody or antigen binding fragment thereof of the invention, may refer to the use of one or more antibody or antigen binding fragment thereof which binds to TCRbetal, and one or more antibody or antigen binding fragment thereof which binds to TCRbeta2.

[0070] In any aspect, the percentage of T cells in a sample, or in a subset of a sample, may be defined as monotypic when over 50%, such as about 60% or more, 70% or more, 80% or more, or 90% or more of the T-cells express TCbetal or TCR beta2. If the T-cells or subset of T-cells are defined as monotypic, they can be classified as neoplastic.

[0071] The skilled person will understand that given the mutual exclusivity of TCRbetal or TCRbeta2 expression in alpha-beta T-cells, a percentage of alpha-beta T-cells in a sample, or subset of a sample, which express one of those proteins will result in the remainder of the 100% (or almost all of the remainder of the 100%) expressing the other of the two proteins. For example, if 80% of alpha-beta T-cells in a sample, or subset of a sample, express TCRbetal, the remainder (or almost all of the remainder of the 100%) will express TCRbeta2.

[0072] Synonymously with the use of percentages above, ratios may be used to determine expression of TCRbetal to TCRbeta2 in a sample, or subset of a sample. The skilled person will understand that 50% of expression of either TCRbetal to TCRbeta2 will result in 50% of the remainder expressing the other, which equates to a ratio of 1 : 1. Likewise, 60% of expression of either TCRbetal to TCRbeta2 will result in 40% of the remainder expressing the other, which equates to a ratio of 3 :2, and so on. Any scalable ratio may be used when converting percentages to a ratio in this situation.

[0073] In any aspect, only one of TCRbetal or TCRbeta2 may be required to be detected.

[0074] In any method disclosed herein, the treatment referred to may refer to any known treatment for a specific disease or disorder associated with monotypia or where it may be beneficial to target TCRbetal or TCRbeta2-expressing T cells selectively.

[0075] In any method, the method may be performed in vitro or ex vivo.

[0076] In any aspect, a disease or disorder associated with T-cell monotypia may be a cancer. The cancer may be a T-cell cancer, such as T-cell lymphoma or T-cell leukaemia. The cancer may be any tumour with aberrant expression of the T-cell receptor, such as a histiocytosis, B-cell leukaemia, monocyte leukaemia myeloid leukaemia, or a lymphoma or leukaemia of indeterminate or more than one lineage. Additionally, a disease or disorder associated with T-cell monotypia or where it may be beneficial to target TCRbetal or TCRbeta2-expressing T cells selectively, may include an autoimmune disease, inflammation, infection, hypersensitivity including allergy, transplantation rejection, or graft versus host disease (GVHD) or other T cell associated disease.

[0077] A biological sample as referred to herein may be all or part of a tissue or fluid or suspension from a subject or of a blood sample, lymph node aspirate or bone marrow aspirate specimen. A sample may be a piece of a tissue. A sample may be tissue from a biopsy. A sample may be part or all of a tissue, lymph node or part or all of a lump, swelling or tumour. The sample may be from a tissue or part of a tissue that appears macroscopically normal. The tissue may be any tissue sample, or blood sample or bone marrow sample or a part thereof. The tissue may be part or all of a lymph node. The tissue may, for example, be skin, gastrointestinal tract, bone marrow, lung, liver, spleen, fat, kidney or blood. Since lymphomas, leukaemias and inflammatory T cell infiltrates can occur anywhere in the body the tissue may be any tissue and the sample may be a solid or fluid sample from any tissue.

[0078] TCRbetal and / or TCRbeta2 may be detected in the population of T cells that are within a tissue sample (as described above). TCRbetal and / or TCRbeta2 may be detected in a population of T cells that have been separated from the tissue before testing TCRbetal and / or TCRbeta2 protein may be detected in a sample extracted from a sample or a population of T cells.

[0079] A tissue biopsy may be Formalin-Fixed, Paraffin-Embedded (FFPE). For example, a sample may be of frozen tissue or a sample that has been fixed using a fixative other than formalin, including, but not limited to zinc-based fixatives.

[0080] In any aspect, using one or more antibody or antigen-binding fragment thereof of the invention to detect TCRbeta2 in the sample, or in a subset of the sample, may comprise utilising immunohistochemistry on FFPE material or fresh, frozen tissue or other fixed tissue; flow cytometry, Western blot and related protein detection technologies, ELISA, spatial transcriptomics, Cytof. Preferably, in any aspect, using one or more antibody or antigenbinding fragment thereof of the invention to detect TCRbeta2 in the sample, or in a subset of the sample, may comprise utilising FFPE material.

[0081] In any aspect, a sample, or subset of a sample, will contain T-cells. In any aspect, a subset of a sample will contain alpha-beta T-cells. Therefore, in any aspect, the cells of a sample may refer to either all cells in the sample, or only the alpha-beta T-cells in the sample.

[0082] In any aspect, the subset of a sample may refer to only the alpha-beta T-cells within the sample. In any aspect, the subset of a sample may refer to a specific cell type within the sample, such as CD4+ T-cells, CD8+ T-cells or CD4+CD8+ T-cells, NKT cells, or CD4-CD8- T cells.

[0083] TCRbetal and / or TCRbeta2 protein may be detected in situ in T cells in a tissue sample, section or cell culture, or in any preparation on a slide produced from a cytological sample. TCRbetal and / or TCRbeta2 protein may be detected in situ, for example in a tissue section, using antibodies or antigen binding fragments thereof of the invention. The antibodies or antigen binding fragments thereof may be directly or indirectly labelled. A label used to facilitate detection may include any known label, including fluorescent, luminescent, light scattering and / or colorimetric labels. Suitable labels include enzymes, and fluorescent and chromogenic moieties, as well as radionucleotides, substrates, cofactors, inhibitors, magnetic particles and the like If the label is an enzyme it may be horse radish peroxidase, alkaline phosphatase, beta-galactosidase, glucose oxidase and the like, as well as various proteases and phospholipases. Other labels include fluorophores or haptens such as digoxygenin or dinitrophenyl / dinitrophenol. The binding of antibodies be detected “by eye” or using digital pathology analytical techniques. Digital pathology analytical techniques may be used to assess tissue sample or sections labelled with antibodies of the invention, each of which specifically recognises one of the constant chains. For example, the digital pathology analytical techniques may count the number of cells that are labelled with an antibody of the invention and may calculate the percentage of T cells expressing a particular constant region. Digital pathology analytical techniques may also process an image, for example of a stained tissue section in order to assess the distribution of T cells labelled with an antibody of the invention that specifically recognises one of the T cell receptor constant chains. Digital pathology analysis may also decide whether or not individual cells should be regarded as positive for detection of a particular constant region, for example by counting numbers of dots associated with a cell, where dots represent positive staining or by analysing staining intensity. The skilled person will appreciate that, depending on the method used to detect the T cell constant region, different digital pathology analytical approaches will be appropriate and the examples above are not exhaustive.

[0084] TCRbetal and / or TCRbeta2 protein may be detected in cells using flow cytometry.

[0085] In addition TCRbetal and / or TCRbeta2, the expression of other markers may also be detected, particularly by means of immunohistochemistry, in situ hybridisation and flow cytometry, for example, but not limited to, CD2, CD3, CD5, CD4, CD7, CD8, CD25 or CD30, CD56, CD57, granzyme, perforin, Mib-1, Ki-67, PD 1, CD10, CXCL13 and bcl6. Detection of such other markers may be undertaken concurrently with the detection of TCRbetal and / or TCRbeta2.

[0086] An advantage of detecting TCRbetal and / or TCRbeta2 by in situ hybridisation, immunohistochemistry or flow cytometry is that other factors such as the cell morphology and immunophenotype and, in the case of in situ hybridisation and immunohistochemistry, the architectural distribution pattern of T cells expressing a particular constant region may also be detected at the same time.

[0087] Where a T-cells in a sample, or subset of a sample, are defined as monotypic using any method of the invention, the skilled person may seek to undertake further investigation using other indicators to determine whether a T cell neoplasm is present, or it may be used alone to diagnose a T-cell neoplasm definitively. For example further investigation may include one or more of: determining whether TCRbetal+ or TCRbeta2+ cells appear atypical / pleomorphic (for example these may have large or abnormal nuclei or mitoses); the location of the T cells (for example in the epidermis or dermis of skin biopsies); what percentage of the T cells in the population stain with other markers including, but not limited to, CD2, CD3, CD5, CD4, CD7, CD8, CD25 or CD30, CD56, CD57, granzyme, perforin, Mib-1, Ki-67, PD1, CD 10, CXCL13 and bcl6. Further, in any method, further investigation may relate to investigating altered DNA sequence(s), epigenetic data, metabolic data, or RNA expression from TCRbetal+ or TCRbeta2+ expressing cells.

[0088] In any method of the invention, where T-cells in a sample, or subset of a sample, are not defined as monotypic, they may be classified as “normal” inflammatory T-cells.

[0089] As used herein, antibody clones 009F06, 002F04, 019E02, and 009H09 refer to TCRbetal specific antibodies.

[0090] As used herein, antibody clones 025E10, 027G03, 036B07, and 028G10 refer to TCRbeta2 specific antibodies.

[0091] As used herein 0x7 and 009F06 are interchangeable. As used herein, Oxl l and 25E010 are interchangeable. As used herein 0x13 and 028G10 are interchangeable.

[0092] Table 1 - Sequences

[0093]

[0094] Humanised variants in which no new CDR has been identified in Table 1 are taken to have the same CDR sequences as the parent.

[0095] In any aspect, the subject may be a human or non-human mammal. The mammal may express a TCRbetal and / or TCRbeta2 orthologue. A non-human mammal may include one or more of a mouse, rat, cat, dog, sheep, goat, cow, horse, primate, alpaca or llama. Preferably, the subject is a human.

[0096] As used herein, TCRbetal refers to the T-cell Receptor beta constant 1 protein, which is encoded in humans by the TRBC1 gene, and in mice by the Trbcl gene.

[0097] As used herein, TCRbeta2 refers to the T-cell Receptor beta constant 2 protein, which is encoded in humans by the TRBC2 gene, and in mice by the Trbc2 gene.

[0098] The term “antibody” as referred to herein refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulphide bonds. Each heavy chain is comprised of a heavy chain variable region (VH) and a heavy chain constant region. Each light chain is comprised of a light chain variable region (VL) and a light chain constant region. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g effector cells) and the first component (Clq) of the classical complement system.

[0099] The term "antigen-binding fragment thereof’ of an antibody refers to one or more fragments of an antibody that retain the ability to selectively bind to an antigen. Antigen-binding fragments thereof may be, but are not limited to Fab, modified Fab, Fab’, modified Fab’, F(ab’)2, Fv, single domain antibodies (e g. VH or VL or VHH), scFv, bi, tri or tetra-valent antibodies, Bis-scFv, diabodies, triabodies, tetrabodies and epitope-binding fragments of any of the above (Holliger and Hudson, 2005, Nature Biotech. 23(9): 1126-1136; Adair and Lawson, 2005, Drug Design Reviews - Online 2(3), 209-217). The methods for creating and manufacturing these antigen-binding fragments are well known in the art (see for example Verma et al., 1998, Journal of Immunological Methods, 216, 165-181).

[0100] The term “Framework” or “FR” refers to variable domain residues other than hypervariable region residues. The FR of a variable domain generally consists of four FR domains: FR1, FR2, FR3, and FR4. Accordingly, the HVR and FR sequences generally appear in the following sequence in VH (or VL): FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.

[0101] Techniques for the production of antibodies and antigen binding fragments thereof are well known in the art. The term "antibody" also includes immunoglobulins (Ig's) of different classes (i.e. IgA, IgG, IgM, IgD and IgE) and subclasses (such as IgGl, lgG2 etc.). Illustrative examples of an antibodies or antigen binding fragments thereof include Fab fragments, F(ab')2, Fv fragments, single-chain Fv fragments (scFv), diabodies, domain antibodies or bispecific antibodies (Holt LJ et al., Trends Biotechnol. 21(11), 2003, 484-490). Examples also include a dAB fragment which consists of a single CH domain or VL domain which alone is capable of binding an antigen. An antibody or antigen binding fragment thereof may be chimeric, a nanobody, single chain and / or humanized. The antibody or antigen binding fragment thereof may be a human IgGl isotype or a human IgG4 isotype or other natural or modified isotype. Antibodies may be monoclonal (mAb) or polyclonal.

[0102] An antibody or antigen binding fragment thereof of the invention may be modified to change in vivo stability and / or half-life. The modification for example may be PEGylation.

[0103] The antibody or antigen binding fragment thereof may be an antibody-like molecule which includes the use of CDRs separately or in combination in synthetic molecules such as SMIPs and small antibody mimetics. Antibodies or antigen binding fragments thereof, nucleic acids, vectors or host cells of the invention can be formulated into pharmaceutical compositions using established methods of preparation (Gennaro, A.L. and Gennaro, A.R. (2000) Remington: The Science and Practice of Pharmacy, 20thEd., Lippincott Williams & Wilkins, Philadelphia, PA). To prepare the pharmaceutical compositions, pharmaceutically inert inorganic or organic excipients can be used. To prepare for example pills, powders, gelatin capsules or suppositories, lactose, talc, stearic acid and its salts, fats, waxes, solid or liquid polyols, natural and hardened oils are examples of pharmaceutically acceptable excipients which can be used. Suitable excipients for the production of solutions, suspensions, emulsions, aerosol mixtures or powders for reconstitution into solutions or aerosol mixtures prior to use include water, alcohols, glycerol, polyols, and suitable mixtures thereof as well as vegetable oils.

[0104] A pharmaceutical composition of the invention may be administered via any parenteral or non-parenteral (enteral) route that is therapeutically effective. Parenteral application methods include, for example, intracutaneous, subcutaneous, intramuscular, intratracheal, intranasal, intravitreal or intravenous injection and infusion techniques, e.g. in the form of injection solutions, infusion solutions or mixtures, as well as aerosol installation and inhalation, e.g. in the form of aerosol mixtures, sprays or powders. A pharmaceutical composition of the invention can be administered systemically or topically in formulations containing conventional non-toxic pharmaceutically acceptable excipients or carriers, additives and vehicles as desired. A combination of intravenous and subcutaneous infusion and / or injection might be most convenient in case of compounds with a relatively short or long serum halflife or needing rapid onset of action. Preferably, the pharmaceutical composition is administered subcutaneously or intravenously. The pharmaceutical composition may be an aqueous solution, an oil-in water emulsion or a water-in-oil emulsion.

[0105] For intravenous injection, or injection at the site of affliction, or other site of administration, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using for example, isotonic vehicles such as Sodium Chloride Injection, Ringer’s Injection, Lactated Ringer’s Injection. Preservatives, stabilisers, buffers, antioxidants and / or other additives may be included, as required.

[0106] The compositions are preferably administered to an individual in a “therapeutically effective amount”, this being sufficient to show benefit to the individual. The optimal dosage will depend on the biodistribution of the antibody or antigen binding fragment thereof, the mode of administration, the severity of the disease / disorder being treated as well as the medical condition of the patient. If desired, the antibody or antigen binding fragment thereof may be given in a sustained release formulation, for example liposomal dispersions or hydrogelbased polymer microspheres, like PolyActiveTM or OctoDEXTM (cf. Bos et al., Business Briefing: Pharmatech 2003: 1-6). Other sustained release formulations available are for example PLGA based polymers (PR pharmaceuticals), PLA-PEG based hydrogels (Medincell) and PEA based polymers (Medivas). Prescription of treatment, e.g., decisions on dosage etc, is within the responsibility of a medical practitioner, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners.

[0107] The pharmaceutical composition may also contain additives, such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect. The latter is that fusion proteins may be incorporated into slow or sustained release or targeted delivery systems, such as liposomes and microcapsules.

[0108] The percent identity of two amino acid sequences or of two nucleic acid sequences is generally determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in the first sequence for best alignment with the second sequence) and comparing the amino acid residues or nucleotides at corresponding positions. The "best alignment" is an alignment of two sequences that results in the highest percent identity. The percent identity is determined by comparing the number of identical amino acid residues or nucleotides within the sequences (i.e., % identity = number of identical positions / total number of positions x 100).

[0109] The determination of percentage identity between two sequences can be accomplished using a mathematical algorithm known to those of skill in the art. An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul, 1990, PNAS, 87(6):2264-8, modified as in Karlin and Altschul, 1993, PNAS, 90(12):5873-5877 The NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol., 215:403-10 have incorporated such an algorithm. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, word length = 3 to obtain amino acid sequences homologous to a protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997). Alternatively, PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules (Id.). When utilizing BLAST, GappedBLAST, and PSI- Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http: / / www.ncbi.nlm.nih.gov. Another example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller. The ALIGN program (version 2.0) which is part of the GCG sequence alignment software package has incorporated such an algorithm. Other algorithms for sequence analysis known in the art include ADVANCE and ADAM as described in Torellis and Robotti (1994); and FASTA described in Pearson and Lipman (1988). Within FASTA, ktup is a control option that sets the sensitivity and speed of the search.

[0110] An antibody or antigen binding fragment thereof of the invention may comprise one or more mutated amino acid residues. The terms "mutated", "mutant" and "mutation" in reference to a nucleic acid or an antibody or antigen binding fragment thereof of the invention refers to the substitution, deletion, or insertion of one or more nucleotides or amino acids, respectively, compared to the "naturally" occurring nucleic acid or polypeptide, i.e. to a reference sequence that can be taken to define the wild-type.

[0111] The amino acid variations in the CDR sequences may be conservative amino acid substitutions.

[0112] A mutation may be a substitution wherein the substitution is a conservative substitution. Conservative substitutions are generally the following substitutions, listed according to the amino acid to be mutated, each followed by one or more replacement(s) that can be taken to be conservative: Ala — > Gly, Ser, Vai; Arg — > Lys; Asn — > Gin, His; Asp — ► Glu; Cys — > Ser; Gin — > Asn; Glu — > Asp; Gly — ► Ala; His — > Arg, Asn, Gin; lie — > Leu, Vai; Leu — > He, Vai; Lys — Arg, Gin, Glu; Met — > Leu, Tyr, He; Phe — Met, Leu, Tyr; Ser —>■ Thr; Thr —>■ Ser; Trp — > Tyr; Tyr — > Trp, Phe; Vai — > He, Leu. Other substitutions are also permissible and can be determined empirically or in accord with other known conservative or nonconservative substitutions.

[0113] 1, 2 or 3 conservative substitutions may be made in the CDRs of the antibody or antigen binding fragment thereof of the invention.

[0114] All of the features disclosed in this specification may be combined in any combination, including with any aspect or any embodiment.

[0115] Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0116] Figure 1 shows that antibodies of the invention are TCRbetal or TCRbeta2 specific using flow cytometry. Jurkat (TCRbetal cell surface expressing cells) and M0LT4 (TCRbeta2 intracellular expressing cells) were stained with supernatant of 9F06 (TCRbetal- specific) and 25E10 / 27G03 / 28G10 (TCRbeta2-specific), and secondary anti-rabbit antibody.

[0117] Figure 2 shows that antibodies of the invention are TCRbetal or TCRbeta2 specific using western blot. Antibody supernatants 9F06 (A) and 25E10 (B) of lysates from cell lines Jurkat (TCRbetal), CEM (T cell line, TCR low expression), M0LT4 (TCRbeta2) and Daudi (B cell line).

[0118] Figure 3 shows that antibodies of the invention are TCRbetal or TCRbeta2 specific on FFPE staining. FFPE cell pellets of Jurkat (TCRbetal), CEM (TCR low), M0LT4 (TCRbeta2) and Daudi (B cell) lines stained with supernatants 9F06 (TCRbetal -specific), 25E10 (TCRbeta2-specific), 27G03 (TCRbeta2-specific) and detected using anti-rabbit secondary antibody.

[0119] Figure 4 shows that antibodies of the invention are TCRbetal or TCRbeta2 specific On FFPE lymph node paracortex or tonsil tissue. A Tissue was stained with anti-CD3 antibody, and supernatants 9F06, 25E10 and 27G03 (B) Tissue was stained with anti-CD3 antibody, and supernatants 9F06 and 25E10 (C) Staining of cell pellets with the antibody clones shown on the left hand side. Daudi B cells are negative with all antibodies as expected. All 3 T-cell lines (Jurkat, M0LT4 and CEM) show positive staining with anti-CD3 and TCRbetaFl . 09F06 gives positive staining on Jurkat (TCRbetal -expressing cells), but not on M0LT4 or CEM (TCRbeta2-expressing cells) or Daudi B cells. 25E10 and 27G03 give positive staining on M0LT4 or CEM (TCRbeta2-expressing cells), but not on Jurkat (TCRbetal -expressing cells) or Daudi B cells. All staining was performed on the Leica Bond Rx platform with 20 minutes heat pretreatment in acid buffer, ER1 (Leica), except for TCRbetaFl, for which the slide underwent 10 minutes pretreatment with proteinase K (Leica).

[0120] Figure 5 shows two T-cell lymphomas immunostained with clones 09F06 and 25E10. A and B show a TCRbeta-1 restricted T-cell lymphoma (PQ 14-03764, a lymph node-based CD4+ peripheral T-cell lymphoma), in which the larger cells (which represent the lymphoma) are strongly TRBC1+, as demonstrated by positive 09F06 and negative 25E10 immunostaining, while the smaller tumour-infiltrating lymphocytes express low levels of TCRbetal or TCRbeta2. C and D show a TCRbeta2-restricted cutaneous T-cell lymphoma (PS 15-16576, a CD8+ cutaneous T-cell lymphoma of acral sites). TCRbeta2-restriction is demonstrated by positive 25E10 and negative 09F06 immunostaining.

[0121] Figure 6 shows Photomicrographs of FFPE sections of T-cell lymphomas immunostained with 09F06 (ROX7) (anti-TCRbetal, left hand panels) and 25E10 (ROX11) (anti- TCRbetal, right hand panels). A and B. Cutaneous lymphoma (transformed mycosis fungoides) in scrotal skin (case 16) in A and B, showing clear TCRbetal-restriction. C and D. Peripheral T-cell lymphoma, NOS, in a lymph node (case 11), showing clear TCRbeta2- restriction. E and F. Peripheral T-cell lymphoma, NOS, in a lymph node (case 9), showing clear well defined membranous TCRbetal expression, with some weaker cytoplasmic TCRbeta2 co-expression. All results were corroborated by Q-PCR (Table 4). Scale bars are 20 microns. BaseScope™ corroboration is included in Figure 8, with Q-PCR data in Table 4.

[0122] Figure 7 shows Photomicrographs of FFPE sections of T-cell lymphomas immunostained with 09F06 (ROX7) (anti-TCRbetal, left hand panels) and 25E10 (ROX11) (anti- TCRbetal, right hand panels). A and B. Unclassifiable CD4+ cutaneous T-cell lymphoma (case 13) showing TCRbetal-restriction. C and D. Cutaneous T cell lymphoma (transformed mycosis fungoides) (case 17), showing TCRbeta2 restriction, although at transcript level, there is cytoplasmic TRBC2, as seen in all the other cases examined, but very strong nuclear TRBC1 (Figure 9, panels C and D). E and F. CD8 positive cutaneous T cell lymphoma, possibly acral lymphoma (case 21), showing clear TCRbeta2 -restriction. Scale bars are 20 microns. BaseScope™ corroboration is included in Figure 9 with Q-PCR data in Table 4. Ep, epidermis.

[0123] Figure 8 - Photomicrographs of BaseScopeTM staining of FFPE sections for TRBC1 (left hand panels) and TRBC2 (right hand panels). A and B. Cutaneous lymphoma (transformed mycosis fungoides) in scrotal skin (case 16) in A and B, showing limited RNA preservation, but clear TRBC1 -restriction. C and D. Peripheral T-cell lymphoma, NOS, in a lymph node (case 11), showing clear TCRbeta2-restriction. E and F. Peripheral T-cell lymphoma, NOS, in a lymph node (case 9), showing predominant TRBC1 expression, with weaker TRBC2 coexpression. Scale bars is 10 microns and pertains to all panels.

[0124] Figure 9 shows Photomicrographs of BaseScopeTM staining of FFPE sections for TRBC1 (left hand panels) and TRBC2 (right hand panels). A and B. Unclassifiable CD4+ cutaneous T-cell lymphoma (case 13) showing clear TRBC1- restriction. C and D. Cutaneous T-cell lymphoma (transformed mycosis fungoides) (case 17), showing TCRbeta2 restriction, although at transcript level, there is cytoplasmic TRBC2, as seen in all the other cases examined, but very strong nuclear TRBC1. E and F. CD8 positive cutaneous T-cell lymphoma, possibly acral lymphoma (case 21), showing clear TCRbeta2-restriction. Scale bars are 10 microns.

[0125] Figure 10 - 0X7 humanized variants - TCRbetal reactive. Jurkat and HPB-ALL cells were stained with 0X7 parent (rabbit variable on human IgGl backbone) and humanized variants, with detection using a secondary fluorescent anti-human antibody detected using flow cytometry.

[0126] Figure 11- Figure 2 0X11 humanized variants - TCRbeta reactive. Jurkat and HPB-ALL cells were stained with 0X11 parent (rabbit variable on human IgGl backbone) and humanized variants, with detection using a secondary fluorescent anti-human antibody detected using flow cytometry.

[0127] Figure 12- Figure 3 0X13 humanized variants - TCRbetal reactive. Jurkat and HPB-ALL cells were stained with 0X13 parent (rabbit variable on human IgGl backbone) and humanized variants, with detection using a secondary fluorescent anti-human antibody detected using flow cytometry.

[0128] Figure 13 - (A) 0X7 humanized variant titration staining of Jurkats and (B) 0X13 humanized variants titration staining of HPB-ALL. Binding was detected using a secondary fluorescent anti-human antibody and analyzed using flow cytometry.

[0129] Figure 14 - TCRbetal / 2-mediated activation. CD69 expression detected 18 hours after incubation of soluble antibodies with healthy donor PBMC and gating on CD2-positive cells.

[0130] MATERIALS AND METHODS

[0131] Flow cytometry surface staining

[0132] Prior to staining, cells were washed with Cell Staining buffer (Biolegend Cat# 420201) and then stained with 17uL of TRBC supernatant for 15 mins at 4 degrees Celsius.

[0133] Cells were then washed twice with Cell Staining Buffer before staining with secondary antibody (Alexa Fluor 647 donkey anti-rabbit IgG H+L, Invitrogen, Cat# A31573) diluted 1:500 in Cell Staining Buffer, along with either PE anti-human CD3 (Biolegend Cat# 317308) diluted 1: 100 or Brilliant Violet 605 anti-human CD2 (Biolegend Cat# 300224), and Zombie Violet Fixable Viability dye (Biolegend, Cat# 423113) diluted 1 : 1000, for 15 mins at 4 degrees Celsius. Cells were washed again in Cell staining buffer before acquiring on Attune NxT (Life Technologies) and analysed using FlowJo.

[0134] Positive control was performed using 17uL of 0.15mg / ml of primary mouse mAb TCR Beta Fl (abeam, Cat# ab 171088) and 1 :500 dilution of secondary antibody Alexa Fluor 647 goat anti-mouse IgG (H+L) (Invitrogen, Cat# A21236)

[0135] Flow cytometry intracellular staining:

[0136] Cells were washed with Cell Staining buffer (Biolegend Cat# 420201) and then stained with either PE anti-human CD3 (Biolegend Cat# 317308) diluted 1: 100 or Brilliant Violet 605 anti-human CD2 (Biolegend Cat# 300224), and Zombie Violet Fixable Viability dye (Biolegend, Cat# 423113) diluted 1: 1000 in Cell Staining buffer, for 15 mins at 4 degrees Celsius. Cells were then washed with Cell Staining Buffer before resuspended in 20uL of a 1: 1 mixture of Inside Fix buffer (Inside Stain kit, Miltenyi, Cat# 130-090-477) and Cell staining buffer, incubated in the dark for 20 minutes. Cells were washed in Cell Staining buffer and then resuspended in Inside Perm buffer (Inside Stain kit, Miltenyi, Cat# 130-090- 477) with 17uL of TRBC supernatant, incubated in the dark for 10 minutes at room temperature. Cells were washed twice in Cell staining buffer before staining with secondary antibody (Alexa Fluor 647 donkey anti-rabbit IgG H+L, Invitrogen, Cat# A31573) diluted 1:500 in Inside Perm buffer, for 10 minutes in the dark at room temperature. Cells were washed again in Cell staining buffer before acquiring on Attune NxT (Life Technologies) and analysed using FlowJo.

[0137] Positive control was performed using 17uL of 0.15mg / ml of primary mouse mAb TCR Beta Fl (abeam, Cat# ab 171088) and 1 :500 dilution of secondary antibody Alexa Fluor 647 goat anti-mouse IgG (H+L) (Invitrogen, Cat# A21236)

[0138] Immunohistochemical staining:

[0139] Jurkat (TCBRbetal-expressing), CEM (TCRbeta2 expressing), MOLT-4 (TCRbeta2 expressing) and Daudi (B-cell; negative for TCBRbetal and TCRbeta2) immortal lymphoid lines were grown in culture under standard conditions. Cells were centrifuged to form a pellet, labelled with different coloured inks to indicate their identity and then plasmin and thrombin were added to produce a clot to stabilise the pellet. The pellet was then fixed in formalin and processed to paraffin. 3 micron sections of the cell pellets were cut onto charged microscope slides and used for immunostaining, using standard techniques. In brief, slides were deparaffinised in xylene, rehydrated through different concentrations of ethanol and pressure cooked for 20 minutes in citrate buffer. Blocking was performed for 20 minutes with normal horse serum and then primary antibodies were added in Bond Primary Antibody Diluent (Leica). Following washing in phosphate buffered saline, detection was undertaken using the ImmPRESS HRP Horse Anti-Rabbit IgG Polymer Kit (Vector). Slides were counterstained with Meyer’s haematoxylin, dehydrated to xylene and mounted in DPX mounting medium (Sigma).

[0140] Immunostaining was also performed on Leica Bond Rx platform with 20 minutes heat pretreatment in acid buffer, ER1 (Leica), except for TCRbetaFl, for which the slide underwent 10 minutes pretreatment with proteinase K (Leica). The staining protocol was otherwise as per the manufacturer’s instructions.

[0141] Histological patient material (lymphomas and benign material) was obtained from the Cambridge University Hospitals NHS Foundation Trust Human Research Tissue Bank (HTRB) with full ethical approval (IRAS: 162057; PI: Professor E. Soilleux) and was immunostained as described above.

[0142] BaseScope™ RNA in situ hybridisation

[0143] Detection of TRBC1 / TRBC2 targets, as well as positive and negative control targets, was performed on FFPE sections using Advanced Cell Diagnostics (ACD) BaseScope™ LS Reagent Kit (Cat. No: 323600) and various BaseScope LS probes (BA-hSequexBSl-3zz-st- C1 and BA-hSequexBS2-3zz-st-Cl, cat. Nos 1139338-C1 and 1139338-C1, respectively, designed against the 3’ UTRs of TRBC1 and TRBC2 (Genbank accession numbers: M12887.1 and M12888.1)), together with PPIB (Genbank: NP 000933.1) positive and DapB (Genbank: EF191515.1) negative control probes (BA-Hs-PPIB-3zz (cat. No. 70-10-38) and BA-DapB- 3zz (cat. No. 70-10-18), espectively (ACD, Hayward, CA, USA)). Briefly, sections were cut at 3um and baked for 1 hour at 60°C before loading onto a Bond RX instrument (Leica Biosystems). Slides were deparaffinized and rehydrated on the instrument before pretreatments using Epitope Retrieval Solution 2 (Cat No. AR9640, Leica Biosystems) at 95°C for 15 minutes, and ACD Enzyme from the LS Reagent kit at 40°C for 15 minutes. Probe hybridisation and signal amplification were performed according to the manufacturer’s instructions. Fast red detection of each target was performed on the Bond Rx using the Bond Polymer Refine Red Detection Kit (Leica Biosystems, Cat. No. DS9390) according to ACD’s protocol. Slides were then removed from the Bond Rx and were heated at 60°C for 1 hour, dipped in Xylene and mounted using EcoMount Mounting Medium (Biocare Medical, CA, USA. Cat No. EM897L). The slides were imaged on the Aperio AT2 (Leica Biosystems) to create whole slide images. Images were captured at 40x magnification, with a resolution of 0.25 microns per pixel. Quantitative real-time reverse transcription PCR

[0144] RNA was extracted from FFPE tissue, using the RNeasy®Micro Kit (Qiagen) and cDNA was synthesized, using SuperScript® III First- Strand Synthesis System (Life Technologies) according to the manufacturers’ instructions. 7 fresh frozen tissue samples were also obtained from the Cambridge University Hospitals NHS Foundation Trust Human Research Tissue Bank (HTRB), with full ethical approval (IRAS: 162057; PI: Professor E. Soilleux) and RNA was extracted using the RNeasy® Plus Mini kit (Qiagen), as per the manufacturer’s instructions, with cDNA synthesis as above. Real time PCR reactions were performed using the Power SYBR® Green PCR Master Mix (Applied Biosystems) in a Quantstudio 6 (Thermo Fisher Scientific, Waltham, MA, USA) with the following primer sets: TRBC1- forward CTTGTGTTGATGGCCATGGT, TRBC1 -reverse.

[0145] AGCGCTGGCAAAAGAAGAATG; T 5C2-forward TGGTCAAGAGAAAGGATTCCAG, TRBC2-KNCKC AGGAACACAGATTGGGAGCA; PPIB-forward

[0146] AGATGTAGGCCGGGTGATCT, PPIB-reverse CTCCGCCCTGGATCATGAAG PCR in lOpl mixtures containing which 5 pl of iTaq SYBR® Green Supermix, 0.5pl of forward and reverse primers, 2pl of cDNA template and 2pl of nuclease-free water, with the following conditions: initial denaturation at 95°C for 30 seconds, then 40 cycles of 95°C for 15 sec and 63°C for 1 minute. To confirm that identical amounts of TRBC1 and TRBC2 template would give very similar Q-PCR results (i.e., to confirm relative PCR efficiencies were very similar), a construct was synthesized in the pUCIDT (KanR) vector, for use as PCR template (Thermo Fisher, Bishop’s Stortford, UK). The insert comprised the 3’UTR of TRBC1, then a 24 base random spacer sequence in which there was an ECORI site, followed by the 3’UTR of TRBC2. For tissue samples, Sanger sequencing of a selection of amplicons was used to confirm amplicon specificity.

[0147] Bioinformatic analysis of RNAseq data

[0148] TRB RNAseq data were obtained from two sources: We used in-house data from our study of duodenal biopsies from 12 patients with coeliac disease and 8 healthy donors. Briefly, fluorescence activated cell sorting (FACS) was performed to separate the lymphocytes into CD4+ and CD8+ T-cell subsets, prior to sequencing, using amplicon-rescued multiplex (ARM)-PCR (iRepertoire, Inc., USA). We also analysed data from a study of peripheral blood CD4+ T cells from 5 healthy donors, which had undergone flow cytometric sorting into 8 T- cell subsets, following which bulk TCRbeta repertoire sequencing was undertaken using the Milaboratories system (Milaboratories, Sunnyvale CA, USA. We used MiXCR to analysis the read count and C segment usage of each unique clonotype. We thus calculated (a) the mRNA transcript TRBC1.TRBC2 ratio and (b) the ratio of TRBC1 -restricted cells: TRBC2- restricted cells. For the latter ratio, given the huge diversity of the TCR repertoire, the assumption was made that each a unique TCR sequence in the sample was likely to represent a single T cell, and thus the read count for each unique clonotype was normalized to 1.

[0149] EXAMPLES

[0150] Example 1

[0151] Rabbits were immunized with relevant immunogens and B cells were isolated and enriched for reactivity, a process which allows selection of rare specific reactivities from a large B cell repertoire. In order to investigate reactivity of rabbit antibody supernatants for TCRbetal or TCRbeta2 derived peptides, ELISA was first used to investigate binding to corresponding peptides coated on plates. Data from rare supernatants unexpectedly showed specific reactivity to TCRbetal or TCRbeta2 derived peptides, whilst the majority were largely cross- reactive to both TCRbetal and TCRbeta2.

[0152] Example 2

[0153] While encouraging, peptide-based ELISA may not reflect binding to the relevant TCR sites on live T cells because of conformational changes, site occlusion by associated molecules (e.g. CD3 subunits), glycosylation and other factors. Therefore rabbit antibody supernatants were tested for binding cell lines naturally expressing TCRbetal (Jurkat, surface TCR) or TCRbeta2 (M0LT4, intracellular TCR) using flow cytometry. Four supernatants were demonstrated to be specific for TCRbetal or TCRbeta2 on cell lines, namely 9F06 (TCRbetal-specific) and 25E10 / 27G03 / 28G10 (TCRbeta2-specific) (Figure 1). These antibodies may have utility in diagnosis, monitoring, prognosis and companion diagnostics, as well as therapeutic applications.

[0154] Example 3

[0155] In order to further characterise the nature of the reactivity, three of the antibodies were tested using Western blot under reducing conditions. Reducing Western blot examines specificity and whether binding is influenced by the conditions. Antibody supernatants 9F06 and 25E10 showed specific reactivity to TCR derived from lysates of cell lines Jurkat (TCRbetal) and M0LT4 (TCRbeta2) (Figure 2). Antibody 27G03 did not react under the conditions tested. Collectively these data confirmed that supernatants 9F06 and 25E10 were able to bind TCR protein on Western blot.

[0156] Example 4

[0157] Formalin fixation is known to modulate antigen binding sites and consequently only a proportion of antibodies are still able to show specific binding after fixation. Such a capability has not previously been shown for TCRbetal and TCRbeta2-specific antibodies despite extensive attempts, but would be of enormous benefit to patients worldwide, as the vast majority of pathology specimens are formalin-fixed. Three supernatants were tested for ability to bind formalin-fixed cell pellets of T cell lines expressing TCRbetal or TCRbeta2. Surprisingly, all three showed specific reactivity to TCRbetal or TCRbeta2 (Figure 3), namely 9F06 was TCRbetal -specific and 25E10 / 27G03 were TCRbeta2-specific.

[0158] Example 5

[0159] Healthy lymph node tissue is known to contain a mixture of TCRbetal and TCRbeta2- expressing cells. Most human samples for diagnosis and prognosis are routinely processed as formalin-fixed paraffin-embedded sections and so antibodies which work under such conditions would carry major advantages. The capability of these three antibodies to stain formalin-fixed paraffin-embedded tissue sections from healthy lymph nodes and other tissues was next tested and showed reactivity to the expected proportions of T cells (figure 4A-C). Specifically, supernatants 9F06 and 25E10 / 27G03 showed reactivity to T cell subsets in fixed lymph node tissue and other cell samples. These data show that the antibodies are able to bind formalin-fixed tissue sections suggesting wide utility.

[0160] Example 6

[0161] Two T-cell lymphomas were immunostained with clones 09F06 and 25E10 (Figure 5). A and Larger cells of a TCRbeta-1 restricted T-cell lymphoma (PQ14-03764, a lymph node-based CD4+ peripheral T-cell lymphoma) were demonstrably strongly positive for TCRbetal, while the smaller tumour-infiltrating lymphocytes are shown to express low levels of TCRbetal or TCRbeta2 (Figure 5A and B). A TCRbeta2-restricted cutaneous T-cell lymphoma (PS15- 16576, a CD8+ cutaneous T-cell lymphoma of acral sites) shows similar staining (Figure 5C and D).

[0162] Example 7

[0163] Antibodies of the invention were corroborated by quantitative real-time reverse transcription PCR (Q-PCR) and in situ hybridisation (ISH)

[0164] The TCRbeta2+:TCRbetal+ cell ratios in benign FFPE (routine clinical) tissue samples were corroborated by means of Q-PCR (Table 2) and gave TRBC2.TRBC1 transcript ratios between 0.73: 1 and 2.82: 1. In addition, 7 fresh frozen tissue samples were obtained and gave TRBC2.TRBC1 transcript ratios between 1.72: 1 and 4.01: 1 (Table 3). While these Q-PCR transcript ratios are an indication of likely ratios of TCRbeta2+:TCRbetal+ cell numbers, the results may be confounded by cell-to-cell variation in expression levels, pointing to the advantages of using tissue sections with associated architecture. Table 2 Analysis of ratios of numbers of TCRbeta2:TCRbetal expressing cells in immunostained FFPE tissue sections containing benign T-cell populations, with corroboration by Base Scope™ and Q-PCR.

[0165] Table 3 TRBC2. TRBC1 transcript ratios produced by Q-PCR on RNA extracted from fresh frozen tissue at the anatomical sites with the diagnoses shown. TCRbetal and TCRbeta2-specific antibodies were then applied to FFPE tissue samples ofT- cell lymphoma

[0166] The inventors then applied the 09F06 (R0X7) and 25E10 (ROX 11) (TCRbetal and TCRbeta2-specific respectively) antibodies to a selection of FFPE tissues containing T cell lymphomas (Figures 6 and 7, Table 4). As with benign samples, high quality staining was observed. Of the 13 lymphoma cases, 9 showed TCRbeta2-restriction, 3 showed TCRbetal- restriction and 1 showed dual expression, with strong membranous staining for TCRbetal and weaker cytoplasmic staining for TRCbeta2 (case 9, Figure 6 panels E and F). The direction of skewing was corroborated in all cases by Q-PCR results (Table 4). Of the 3 TCRbetal -restricted cases, two were TRBC1 -restricted at transcript level, with one showing dual transcript expression, but with a TRBC1 preponderance (case 19). Of the 9 TCRbeta2- restricted cases, seven were 77?7>C2-restricted at transcript level, and two showed dual transcript expression, one of them (case 15) showing dual cytoplasmic transcript expression. Monotypia can be regarded as a surrogate for monoclonality and, in this study, all the neoplastic T-cell populations showed either a TCRbetal :TCRbeta2 or TCRbeta2:TCRbetal immunohistochemical ratio of at least 10: 1, indicating that a TCRbeta2:TCRbeta 1 ratio cutoff outside of 0.18: 1 - 5.7: 1 for suspected T-cell lymphoma could be used in clinical practice for solid tissue samples. In addition, 1 case co-expressed TCRbetal and TCRbeta2 at protein level, but, because all the cells showed the same pattern of expression, they could also be defined as monotypic. Interpretation of TCRbetal / TCRbeta2 immunohistochemistry was significantly easier than interpretation of TRBCH TRBC2 BaseScope™, as, with the latter, determining which nucleus dots of staining were associated with was challenging, morphology was less well preserved due to cell pre-treatment methods and there was more dual expression at transcript than protein level. In summary, it would have been possible to determine, on the basis of TCRbetal and TCRbeta2 immunohistochemistry alone that the T cells were monotypic in all 13 lymphoma cases in this study, while neither Base Scope™ nor Q-PCR could have given a conclusive result about monotypia in all cases, although both results corroborated the direction of TCR expression skewing in all cases.

[0167] Table 4 Analysis of TCRbetal and TCRbeta2 immunostaining of tissue sections containing T-cell lymphomas, with BaseScope™ and Q-PCR corroboration. Ratios of immunohistochemical (IHC) and Base Scope™ staining were derived from a consultant pathologist estimating the percentage of positive cells with each stain to the nearest 10%. Representative images are shown in Figures 6 and 7 and Figures 8 and 9.

[0168] In summary, the inventors corroborated immunostaining results with BaseScope™ and Q- PCR analyses of relative TRBC1 / TRBC2 transcript expression, which also provides an opportunity to assess the comparative utility of these modalities as methods for determining whether a population of T cells is monotypic or polytypic. Q-PCR gave less TRBC1 / 2 skewing than was seen on TCRbetal / 2 immunohistochemistry, apparently for two reasons. Firstly, as no microdissection was undertaken, benign reactive T cells at the edges of the lymphomas were included and were likely to decrease the degree of skewing observed. This means that skewing was assessed in T-cell populations, beyond that suspected of being neoplastic. Secondly, TRBC transcript expression levels will have confounded the results, while immunohistochemically one assesses the numbers of positive cells to assess whether there is monotypia, not the expression level in any given cell.

[0169] Although quantifying and comparing TRBC1 / 2 transcript levels by both Q-PCR and BaseScope™ was broadly corroborative of the TCRbetal / 2 immunohistochemical results, neither technique is as powerful in separating benign and malignant T-cell populations as immunohistochemical staining. Q-PCR is confounded by the numbers of transcripts per cell, as well as by RNA derived from any benign lymphocyte populations in the pathological sample. Furthermore, use of Q-PCR is unable to capitalise on the spatial and morphological context of the transcript expression, thus removing important diagnostic clues. A minor challenge with BaseScope™ was determining which dot (each dot representing a transcript) should be ascribed to exactly which nucleus, but otherwise it afforded many of the advantages of immunohistochemistry. While BaseScope™ can helpfully assess the transcript ratio at the level of numbers of cells expressing TRBC1 or TRCB2, interpretation could be difficult because of dual TRBCH TRBC2 transcript expression. Dual TRBCH TRBC2 transcript expression appears to be more common in T-cell lymphomas (4 / 13 or 30.8% in the series) than kappa and lambda light chain co-expression in B-cell or plasma cell neoplasms. The only published studies assessing dual TRBC transcript expression relate to benign T cells and suggest that 1-7% express dual TCRbeta chains on the cell surface.

[0170] Overall, the data therefore demonstrate two important aspects of assessing TCRbeta ratios in the diagnosis of T-cell lymphoma. Firstly, it is critical to assess the ratio of cells that are positive for each receptor, not simply of expressed transcripts. Secondly, to avoid the confounding effects of dual transcript expression, it is important to assess the receptors at the protein level rather than the transcript level. TCRbeta immunohistochemistry with the isotype-specific antibodies in the invention achieves both of these.

[0171] Example 8

[0172] Having established anti-human TCRbetal and anti- human TCRbeta2 rabbit-derived antibodies which stained live cells, the inventors proceeded to humanize the candidate parent antibodies and test the humanized variants for their capacity to bind and activate live cells. 0X7 (anti-TCRbetal), 0X11 (anti-TCRbeta2) and 0X13 (anti-TCRbeta2) humanized variants were generated as shown in Table 1. These were tested for binding to Jurkat cells (TCRbetal-expressing) and HPB-ALL cells (TCRbeta2-expressing) using flow cytometry. As shown in figure 10, 10 0X7 humanized variants (0X7.3, 0X7.5, 0X7.6, 0X7.7, 0X7.8, 0X7.10, 0X7.13, 0X7.14, 0X7.15, 0X7.16) were able to bind Jurkat cells. 0X11 and 0X13 binders to HPB-ALL were less common and less brightly staining, but nevertheless, some variants showed staining (figures 11 and 12). Specifically, 0X11.14, 0X11.16, 0X13.16 were the best binders. Interestingly in some cases, the variants enhanced the binding as illustrated by a greater proportion of positive cells compared to the parent humanised antibody (0X11.14, 0X11.16, 0X13.16). The best binders were titrated on Jurkats and HPB- ALL to determine concentration at which staining reached background (figure 13).

[0173] It is commonly understood that binding of antibodies to the T cell receptor can activate the T cells. In some circumstances, this may be advantageous in order to “license” the T cells for effector function. However, in other circumstances, this may not be desirable as it may also reverse the pattern of killing, by licensing the target cells expressing TCRbetal or TCRbeta2 to “back-kill” healthy effector T cells The inventors then investigated the activation capacity of the best staining humanized antibodies on healthy human peripheral blood mononuclear cells (PBMC). This experiment showed that the existing anti-TCRbetal antibody JOVI-1 potently activates T cells, detected through T cells upregulating expression of CD69 (figure 5). However, our antibodies were not potent activators, in that they did not significantly induce upregulation of CD69 (figure 14). This means that the approach has discovered unusual antibodies which bind TCR, but do not markedly activate T cells. Such a characteristic can be particularly useful for delivery of payloads to T cells through antibody-drug conjugates (ADC). Furthermore, the T cell receptor is known to internalise rapidly on ligation which makes it a useful target for ADC. While JOVI-1 has been considered as a delivery tool for ADC (doi 10.1038 / s41 86-024-07233 -2) of TCRbetal- expressing tumours, the potent T cell activation induced by JOVI-1 would not be desirable, for example if the payload is an anti-inflammatory. Furthermore, use of Fc modified backbones which do not engage with FcR-expressing cells would reduce risk of “back- killing”. Here, the inventors have developed potential pairs of TCRbetal and TCRbeta2 targeting antibodies which have sustained binding despite humanization, with low levels of TCR-mediated T-cell activation and we anticipate that these will be of utility for patient therapy, including for malignancy and inflammation.

Claims

CLAIMS1. An antibody or antigen binding fragment thereof which is capable of specifically binding to TCRbetal or TCRbeta2.

2. The antibody or antigen binding fragment thereof of claim 1, wherein the antibody or antigen binding fragment thereof comprises: i) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 27, or a sequence having at least 80% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 30, or a sequence having at least 80% identity thereto; or j) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 3, or a sequence having at least 80% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 6, or a sequence having at least 80% identity thereto; or k) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 9, or a sequence having at least 80% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 12, or a sequence having at least 80% identity thereto; or l) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 15, or a sequence having at least 80% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 18, or a sequence having at least 80% identity thereto; or m) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 21, or a sequence having at least 80% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 24, or a sequence having at least 80% identity thereto; or n) a heavy chain variable region comprising a CDR3 with an amino acid sequence ofSEQ ID NO: 33, or a sequence having at least 80% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 36, or a sequence having at least 80% identity thereto; or o) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 39, or a sequence having at least 80% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 42, or a sequence having at least 80% identity thereto; orp) a heavy chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 45, or a sequence having at least 80% identity thereto; and / or a light chain variable region comprising a CDR3 with an amino acid sequence of SEQ ID NO: 48, or a sequence having at least 80% identity thereto.

3. The antibody or antigen binding fragment thereof of claim 1 or claim 2, wherein the antibody or antigen binding fragment thereof comprises: i) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 25, a CDR2 with an amino acid sequence of SEQ ID NO: 26, and a CDR3 with an amino acid sequence of SEQ ID NO: 27, or sequences having at least 80% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 28, a CDR2 with an amino acid sequence of SEQ ID NO: 29, and a CDR3 with an amino acid sequence of SEQ ID NO: 30, or sequences having at least 80% identity thereto; or j) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 1, a CDR2 with an amino acid sequence of SEQ ID NO: 2, and a CDR3 with an amino acid sequence of SEQ ID NO: 3, or sequences having at least 80% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 4, a CDR2 with an amino acid sequence of SEQ ID NO: 5, and a CDR3 with an amino acid sequence of SEQ ID NO: 6, or sequences having at least 80% identity thereto; or k) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 7, a CDR2 with an amino acid sequence of SEQ ID NO: 8, and a CDR3 with an amino acid sequence of SEQ ID NO: 9, or sequences having at least80% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 10, a CDR2 with an amino acid sequence of SEQ ID NO: 11, and a CDR3 with an amino acid sequence of SEQ ID NO: 12, or sequences having at least 80% identity thereto; orl) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 13, a CDR2 with an amino acid sequence of SEQ ID NO: 14, and a CDR3 with an amino acid sequence of SEQ ID NO: 15, or sequences having at least 80% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 16, a CDR2 with an amino acid sequence of SEQ ID NO: 17, and a CDR3 with an amino acid sequence of SEQ ID NO: 18, or sequences having at least 80% identity thereto; or m) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 19, a CDR2 with an amino acid sequence of SEQ ID NO: 20, and a CDR3 with an amino acid sequence of SEQ ID NO: 21, or sequences having at least 80% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 22, a CDR2 with an amino acid sequence of SEQ ID NO: 23, and a CDR3 with an amino acid sequence of SEQ ID NO: 24, or sequences having at least 80% identity thereto; or n) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 31, a CDR2 with an amino acid sequence of SEQ ID NO: 32, and a CDR3 with an amino acid sequence of SEQ ID NO: 33, or sequences having at least 80% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 34, a CDR2 with an amino acid sequence of SEQ ID NO: 35, and a CDR3 with an amino acid sequence of SEQ ID NO: 36, or sequences having at least 80% identity thereto; or o) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 37, a CDR2 with an amino acid sequence of SEQ ID NO: 38, and a CDR3 with an amino acid sequence of SEQ ID NO: 39, or sequences having at least 80% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 40,a CDR2 with an amino acid sequence of SEQ ID NO: 41, and a CDR3 with an amino acid sequence of SEQ ID NO: 42, or sequences having at least 80% identity thereto; or р) a heavy chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 43, a CDR2 with an amino acid sequence of SEQ ID NO: 44, and a CDR3 with an amino acid sequence of SEQ ID NO: 45, or sequences having at least 80% identity thereto; and / or a light chain variable region comprising: a CDR1 with an amino acid sequence of SEQ ID NO: 46, SEQ ID NO 119, or SEQ ID NO: 120, a CDR2 with an amino acid sequence of SEQ ID NO: 47, SEQ ID NO: 121 or SEQ ID NO: 122, and a CDR3 with an amino acid sequence of SEQ ID NO: 48, or sequences having at least 80% identity thereto.

4. The antibody or antigen binding fragment thereof of any of claims 1-3, wherein the antibody or antigen binding fragment thereof comprises: a) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 57, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 58, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or b) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 49, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 50, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or с) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 51, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 52, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; ord) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 53, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 54, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or e) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 55, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 56, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or f) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 59, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 60, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or g) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 61, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 62, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or h) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 63, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 64, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or i) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 65, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 66, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; orj) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 67, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 68, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or k) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 69, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 70, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or l) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 71, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 72, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or m) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 73, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 74, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or n) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 75, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 76, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or o) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 77, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 78, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; orp) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 79, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 80, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or q) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 81, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 82, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or r) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 83, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 84, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or s) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 85, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 86, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or t) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 87, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 88, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or u) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 89, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 90, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; orv) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 91, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 92, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or w) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 93, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 94, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or x) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 95, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 96, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or y) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 97, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 98, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or z) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 99, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 100, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or aa) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 101, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 102, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; orab) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 103, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 104, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or ac) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 105, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 106, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or ad) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 107, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 108, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or ae) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 109, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 110, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or af) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 111, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 112, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; or ag) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 113, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 114, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; orah) a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 1 15, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 116, or a sequence having at least 80%, 90%, 95%, 98%, 99% or 100% identity thereto; optionally wherein the antibody or antigen binding fragment thereof is a bispecific antibody, which further comprises a CD3 -targeting moiety and / or a PD-1 targeting moiety.

5. A nucleic acid encoding one or more antibody or antigen binding fragment thereof of any of claims 1-4.

6. A vector comprising the nucleic acid of claim 5.

7. A host cell comprising one or more antibody or antigen binding fragment thereof of any of claims 1-4, nucleic acid of claim 5, and / or vector of claim 6.

8. A CAR comprising an antibody or antigen binding fragment thereof of any of claims 1-4.

9. A cell comprising the CAR of claim 8; optionally wherein the cell is a CD8+ T-cell, CD4+ T-cell, NKT cell or NK-cell.

10. A pharmaceutical composition comprising one or more antibody or antigen binding fragment thereof of any of claims 1-4, nucleic acid of claim 5, vector of claim 6, host cell of claim 7, CAR of claim 8 or cell of claim 9, optionally together with one or more pharmaceutically acceptable excipients or diluents.

11. The antibody or antigen binding fragment thereof of any of claims 1-4, nucleic acid of claim 5, vector of claim 6, host cell of claim 7, CAR of claim 8, cell of claim 9, and / or pharmaceutical composition of claim 10, for use in medicine.

12. One or more antibody or antigen binding fragment thereof of any of claims 1-4, nucleic acid of claim 5, vector of claim 6, host cell of claim 7, CAR of claim 8, cell of claim 9, and / or pharmaceutical composition of claim 10, for use in the treatment or prevention of one or more disease or disorder associated with T-cell monotypia and / or T cell-associated inflammation in a subject13. One or more antibody or antigen binding fragment thereof of any of claims 1-4, nucleic acid of claim 5, vector of claim 6, host cell of claim 7, CAR of claim 8, cell of claim 9, and / or pharmaceutical composition of claim 10, for use in a method of diagnosis.

14. One or more antibody or antigen binding fragment thereof of any of claims 1-4, nucleic acid of claim 5, vector of claim 6, host cell of claim 7, CAR of claim 8, cell of claim 9, and / or pharmaceutical composition of claim 10, for use in the diagnosis of one or more disease or disorder associated with T-cell monotypia and / or T cell-associated inflammation in a subject.

15. A method of treating or preventing one or more disease or disorder associated with T-cell monotypia and / or T cell-associated inflammation in a subject, comprising administering to the subject an effective amount of one or more antibody or antigen binding fragment thereof of any of claims 1-4, nucleic acid of claim 5, vector of claim 6, host cell of claim 7, CAR of claim 8, cell of claim 9, and / or pharmaceutical composition of claim 10.

16. The use of one or more antibody or antigen binding fragment thereof of any of claims 1- 4, nucleic acid of claim 5, vector of claim 6, host cell of claim 7, CAR of claim 8, cell of claim 9, and / or pharmaceutical composition of claim 10 in the manufacture of a medicament for the treatment or prevention of one or more disease or disorder associated with T-cell monotypia and / or T cell-associated inflammation in a subject.

17. A method of monitoring treatment efficacy or disease status in a subject diagnosed with a disease or disorder associated with T-cell monotypia, comprising: i. providing a biological sample obtained from the subject; ii. determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal, before treatment, or at intervals between treatments, or at time intervals in the absence of treatment; iii. determining that the treatment is effective, or that the disease status is improving, if: a) the tumour volume is reduced after treatment or between treatment intervals or at time intervals in the absence of treatment; or if: b) the ratio of T-cells expressing TCRbetal :TCRbeta2 or TCRbeta2: TCRbetal begins to reverse, or the percentage of cells expressing either TCRbetal or TCRbeta2 (whichever the monotypic cells express) begins to reduce inequivalent samples after treatment, or between treatment intervals, or at time intervals in the absence of treatment; optionally wherein the percentage or ratio is determined using one or more antibody or antigen binding fragment thereof of any of claims 1-4.

18. A method of diagnosing a subject with a disease or disorder associated with T-cell monotypia, comprising: i. providing a biological sample obtained from the subject; ii. using one or more antibody or antigen-binding fragment thereof of any of claims 1-4 to detect cells expressing TCRbetal in the sample, or in a subset of the sample; iii determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbetal, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal; iv. comparing the percentage or ratio with a percentage or ratio in a positive or negative reference value; iv. determining that the subject has a disease or disorder associated with T-cell monotypia, if the percentage or ratio in the sample obtained from the subject, or in a subset of the sample obtained from the subject, is higher than the percentage or ratio in the negative reference value, or equal to or higher than the percentage or ratio in the positive reference value; optionally wherein the method also comprises using one or more antibody or antigenbinding fragment thereof of any of claims 1-4 to detect cells expressing TCRbeta2 in the sample obtained from the subject, or in a subset of the sample obtained from the subject.

19. A method of diagnosing a subject with a disease or disorder associated with T-cell monotypia, comprising: i. providing a biological sample obtained from the subject; ii. using one or more antibody or antigen-binding fragment thereof of any of claims 1-4 to detect cells expressing TCRbeta2 in the sample, or in a subset of the sample; iii. determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbeta2 to TCRbetal or TCRbetal to TCRbeta2; iv. comparing the percentage or ratio with a percentage or ratio in a positive or negative reference value; iv. determining that the subject has a disease or disorder associated with T-cell monotypia, if the percentage or ratio in the sample obtained from the subject, or in a subsetof the sample obtained from the subject, is higher than the percentage or ratio in the negative reference value, or equal to or higher than the percentage or ratio in the positive reference value, optionally wherein the method also comprises using one or more antibody or antigenbinding fragment thereof of any of claims 1-4 to detect cells expressing TCRbetal in the sample obtained from the subject, or in a subset of the sample obtained from the subject20. A method of diagnosing a subject with a disease or disorder associated with T-cell monotypia, comprising: i. providing a biological sample obtained from a subject; ii. using one or more antibody or antigen-binding fragment thereof of any of claims 1-4 to detect cells expressing TCRbetal, and one or more antibody or antigen-binding fragment thereof of any of claims 1-4 to detect cells expressing TCRbeta2 in the sample, or in a subset of the sample, wherein the one or more antibody or antigen-binding fragment thereof which detects TCRbetal does not detect TCRbeta2, and the one or more antibody or antigen-binding fragment thereof which detects TCRbeta2 does not detect TCRbetal; iii. determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal; wherein if more than 50% of the T-cells in the sample, or subset of the sample, express the same TCRbeta constant chain, then the T-cells are defined as monotypic, and the subject is diagnosed with a disease or disorder associated with T-cell monotypia.

21. A method of determining a) the percentage of the total T cells in a sample, or in a subset of the total T cells in a sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in a sample, or in a subset of a sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal, comprising: i. obtaining a solid or liquid tissue sample or a cell sample from a subject, wherein the subject and / or the sample are suspected of having neoplastic T-cells; ii. contacting the solid or liquid tissue sample or the cell sample with one or more antibody or antigen-binding fragment thereof of any of claims 1-4 to detect cells expressing TCRbetal, and / or one or more antibody or antigen-binding fragment thereof of any of claims 1-4 to detect cells expressing TCRbeta2; iii. detecting a recognition of the TCRbetal and / or TCRbeta2;iv. determining a) the percentage of the total T cells in the sample, or a subset of the total T cells of the sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal.

22. A method of providing a prognosis for a subject who has been diagnosed with a disease or disorder associated with T-cell monotypia, wherein the method comprises: i. providing a biological sample obtained from the subject; ii. using one or more antibody or antigen-binding fragment thereof any of claims 1-4 to detect cells expressing TCRbeta2 in the sample, or in a subset of the sample; iii. determining a) the percentage of the total T cells in the sample, or a subset of the total T cells in the sample, that express TCRbetal and / or TCRbeta2, or b) the ratio of T cells in the sample, or in a subset of the sample, that express TCRbetal to TCRbeta2 or TCRbeta2 to TCRbetal before treatment, or at intervals between treatments, or at time intervals in the absence of treatment; iv. determining that the patient has a poor prognosis when the ratio of T-cells expressing TCRbetal :TCRbeta2 or TCRbeta2:TCRbetal does not begin to reverse, or the percentage of cells expressing either TCRbetal or TCRbeta2 (whichever the monotypic cells express) does not begin to reduce in equivalent samples after treatment, or between treatment intervals, or at time intervals in the absence of treatment.

23. The one or more antibody or antigen binding fragment thereof, nucleic acid, vector, CAR, host cell and / or pharmaceutical composition for the use of claim 12 or claim 14; the method of claim 15; the use of claim 16; or the method of any of claims 17-19 or claim 22, wherein (a) the disease or disorder associated with T-cell monotypia is a cancer; optionally wherein the cancer is a T-cell cancer or any tumour with aberrant expression of the T-cell receptor; optionally wherein the cancer is T-cell lymphoma, a T-cell leukaemia, a histiocytosis, a B-cell leukaemia, a monocyte leukaemia or a myeloid leukaemia; or(b) the disease or disorder associated with cell inflammation is an autoimmune disease, inflammation, infection, hypersensitivity including allergy, transplantation rejection, or graft versus host disease (GVHD) or other T cell associated disease; optionally wherein the one or more antibody or antigen binding fragment thereof, nucleic acid, vector, host cell and / or pharmaceutical composition is to be administered with one or more other therapeutic agent, either simultaneously, sequentially or separately; optionally wherein the one or more other therapeutic agent is selected from the group comprising cytotoxic agents, immune activation agents such as checkpoint inhibitors or TLR agonists, anti-inflammatory agents such as steroids, CAR-T cells such as regulatory or cytolytic CAR-T cells, or other cells expressing or presenting one or more antibody or antigen binding fragment of the invention..

24. The method of any of claims 15-23, wherein the sample is a tissue sample, such as aFormalin-Fixed, Paraffin-Embedded (FFPE) tissue biopsy.

25. The method of any of claims 15-24, wherein the subset of a sample consists of alpha-beta T-cells, CD4+ T-cells, CD8+ T-cells or CD4+CD8+ T-cells, NKT cells, or CD4-CD8- T cells.

Citation Information

Patent Citations

  • Chimeric antigen receptor

    US20170066827A1

  • TRBC beta antibody conjugate

    US20230109275A1