Recombinant plasmid containing stuffer DNA

Abstract

The present invention provides a recombinant plasmid which includes: (a) an adeno-associated virus (AAV) genome that includes two AAV ITR sequences and a target gene sequence flanked by the AAV ITR sequences; and (b) stuffer DNA which comprises a nucleotide sequence that does not include an inverted repeat sequence capable of forming a stem loop.

Description

Recombinant plasmid containing stuffer DNA

[0001] The present invention relates to a method for producing a non-enveloped virus vector, preferably an adeno-associated virus (hereinafter, abbreviated as AAV) vector.

[0002] AAV can infect cells of a wide range of species, including humans, and can also infect non-dividing cells that have completed differentiation, such as blood cells, muscles, and nerve cells. Furthermore, AAV has low pathogenicity to humans, so there is little concern about side effects. Furthermore, AAV is physicochemically stable. For these reasons, AAV has recently attracted attention as a gene transfer vector for gene therapy for congenital diseases, cancer, infectious diseases, and the like, and its clinical application is progressing.

[0003] In general, recombinant viral vectors are produced by separating the elements essential for viral particle formation, those that require cis supply, and those that can be supplied in trans, and then introducing them into host cells. This prevents the production of wild-type virus and the autonomous replication of the recombinant virus in the infected host. Typically, the elements essential for viral particle formation are introduced into cells in the form of a nucleic acid construct, and cells capable of producing viruses (hereinafter referred to as virus-producing cells) are produced. When the cells are cultured and all elements essential for viral particle formation are expressed within the cells, viral vectors are produced.

[0004] The virus-producing cells in which virus production has been achieved are then collected and disrupted. Alternatively, if the viral vector leaks into the medium during the culture of the virus-producing cells, the viral vector can also be produced from the supernatant of the culture medium. The resulting cell lysate, supernatant, or a mixture thereof is subjected to appropriate processes such as filtration, ultracentrifugation, chromatography, and ultrafiltration to purify the recombinant viral vector into the final product.

[0005] To reduce the cost of clinically used AAV vector-based gene therapy drugs, it is necessary to reduce manufacturing costs. Furthermore, clinical administration of AAV vectors requires the preparation of large quantities of AAV vectors. Therefore, the development of a system capable of producing greater amounts of AAV vectors than current systems is desirable. Furthermore, current systems produce large quantities of "AAV empty particles" and "AAV partial particles" in addition to "AAV full particles." It has been pointed out that administering nonfunctional "AAV empty particles" and "AAV partial particles" does not improve therapeutic efficacy and may even cause adverse events. As a result, a very strict purification process for "AAV full particles" is required, which is an obstacle to reducing the cost of gene therapy drugs. Therefore, a system capable of efficiently producing "AAV full particles" containing the full-length AAV genome is needed.

[0006] Various methods have been developed to efficiently produce AAV full particles. Among these, a method using a stuffer sequence (also called "stuffer DNA" or "filler sequence") is known. A stuffer sequence is a sequence for adjusting the size of any nucleic acid construct to an appropriate length.

[0007] It has been shown that the length of the AAV genome packaged into AAV particles is limited to approximately 5 kilobases (kb) or less, and that when packaging an AAV genome larger than 5 kb, a partial AAV genome is likely to be packaged (Non-Patent Document 1). That is, adjusting the size of the AAV genome to an appropriate length by positioning a stuffer sequence inside the two ITR sequences of AAV is useful for producing full AAV particles. It is also useful to position a stuffer sequence outside the two ITR sequences of AAV to prevent the mistaken packaging of regions that should not be packaged.

[0008] WO2014 / 007858 (Patent Document 1) discloses a stuffer sequence comprising a nucleic acid having a length of 3300 to 4200 nucleotides and having at least 90% identity to a predetermined nucleotide sequence.

[0009] WO2014 / 144486 (Patent Document 2) discloses a combination of a first stuffer sequence located inside two AAV ITR sequences and a second stuffer sequence located outside two AAV ITR sequences.

[0010] WO 2017 / 161273 (Patent Document 3) discloses stuffer sequences in which CpG motifs are reduced or minimized to reduce immune responses of transfected cells. Patent Document 3 also discloses stuffer sequences in which the number of ATG codons is reduced and stuffer sequences that do not contain known active elements such as enhancer sequences. These sequences are named "safe" stuffer sequences.

[0011] WO2022 / 235614 (Patent Document 4) discloses novel inert, non-coding stuffer sequences comprising a predetermined nucleotide sequence or a fragment thereof.

[0012] Thus, various stuffer sequences have been developed to efficiently produce full AAV particles, but it is clear that further improvements are needed.

[0013] International Publication No. WO2014 / 007858 International Publication No. WO2014 / 144486 International Publication No. WO2017 / 161273 International Publication No. WO2022 / 235614

[0014] Mol Ther. 2010 Jan;18(1):80-6.

[0015] As mentioned above, the stuffer sequence needs to be further improved in order to efficiently produce full AAV particles.

[0016] As a result of intensive research aimed at solving the above-mentioned problems, the present inventors have found that AAV full particles can be efficiently produced by using a recombinant plasmid containing (a) an AAV genome containing two ITR sequences of adeno-associated virus (AAV) and a gene sequence of interest sandwiched between them, and (b) stuffer DNA consisting of a nucleotide sequence that does not contain an inverted repeat sequence that can form a stem loop, and have completed the present invention.

[0017] That is, the present invention provides: [1] a recombinant plasmid comprising (a) an AAV genome comprising two ITR sequences of adeno-associated virus (AAV) and a target gene sequence sandwiched therebetween, and (b) a stuffer DNA consisting of a nucleotide sequence not containing an inverted repeat sequence capable of forming a stem-loop; [2] the recombinant plasmid according to [1], wherein the AAV genome of (a) has a chain length of 3.0 to 5.5 kb; [3] the recombinant plasmid according to [1] or [2], wherein the chain length of the recombinant plasmid excluding (a) is 5.0 kb or more; [4] the recombinant plasmid according to any of [1] to [3], wherein the stuffer DNA of (b) is DNA comprising a sequence obtained by modifying the nucleotide sequence of a naturally occurring nucleic acid; and [5] the recombinant plasmid according to [4], wherein the stuffer DNA of (b) is DNA comprising a sequence obtained by modifying the nucleotide sequence of a nucleic acid derived from an intron of the human HPRT1 gene. [6] A recombinant plasmid according to any one of [1] to [5], which is replicable in Escherichia coli; [7] A method for producing a recombinant plasmid, comprising inserting into a plasmid vector (a) an AAV genome containing two ITR sequences of adeno-associated virus (AAV) and a target gene sequence sandwiched therebetween, and (b) a stuffer DNA consisting of a base sequence not containing an inverted repeat sequence capable of forming a stem-loop; [8] A method for producing a recombinant plasmid according to [7], wherein the AAV genome of (a) has a chain length of 3.0 to 5.5 kb; [9] A method for producing a recombinant plasmid according to [7] or [8], wherein the chain length of the recombinant plasmid excluding (a) is 5.0 kb or more;

[10] A method for producing a recombinant plasmid according to any one of [7] to [9], wherein the stuffer DNA of (b) is DNA containing a sequence obtained by modifying the base sequence of a naturally occurring nucleic acid;

[11] The method for producing a recombinant plasmid according to

[10] , wherein the stuffer DNA (b) is DNA containing a sequence obtained by modifying a base sequence of a nucleic acid derived from an intron of the human HPRT1 gene;

[12] The method for producing a recombinant plasmid according to any one of [7] to

[11] , wherein the plasmid is a plasmid that can be replicated in Escherichia coli.

[0018] The present invention provides a recombinant plasmid for obtaining an AAV vector with an improved ratio of AAV full particles, a method for producing the recombinant plasmid, cells transduced with the recombinant plasmid, and a method for producing a recombinant AAV vector comprising culturing the cells.

[0019] The use of the recombinant plasmid of the present invention reduces erroneous packaging during the process of producing a recombinant AAV vector. Furthermore, since the recombinant plasmid of the present invention does not contain sequences of unknown origin, even if a part of the plasmid is inserted into the genome of a subject after gene therapy, oncogenesis due to sequences of unknown origin will not occur.

[0020] FIG. 1 shows the structure of the recombinant plasmid prepared in Example 1. FIG. 2 shows the ratio of the copy number of the ampicillin resistance gene to the copy number of the ITR in Example 3. FIG. 3 shows the expression rate of ZsGreen1 (infection efficiency of AAV vector) in Example 4. FIG. 4 shows the fluorescence brightness of ZsGreen1 in Example 4. FIG. 5 shows the ratio of AAV full particles in Example 5. FIG. 6 shows the ratio of the copy number of the ampicillin resistance gene to the copy number of the ITR in Example 8 (AAVRKO cells). FIG. 7 shows the ratio of the copy number of the ampicillin resistance gene to the copy number of the ITR in Example 8 (VPC2.0 cells). FIG. 8 shows the ratio of AAV full particles in Example 9 (AAVRKO cells). FIG. 9 shows the ratio of AAV full particles in Example 9 (VPC2.0 cells).

[0021] The present invention will be described in detail below. <Definitions>

[0022] As used herein, the term "vector" encompasses any viral vector, plasmid vector, cosmid vector, phage vector, and binary vector capable of transforming a prokaryotic or eukaryotic host.

[0023] As used herein, the term "AAV vector" refers to an AAV having vector function.

[0024] As used herein, the term "AAV particle" refers to a viral particle composed of at least one AAV capsid protein. If the particle contains a heterologous polynucleotide (i.e., a polynucleotide not derived from the wild-type AAV genome), it is called a "recombinant AAV (rAAV)."

[0025] As used herein, the term "recombinant" means produced using genetic recombination techniques. For example, recombinant AAV means AAV produced using genetic recombination techniques, and recombinant DNA means DNA produced using genetic recombination techniques.

[0026] As used herein, the term "AAV genome" refers to DNA that can be packaged into AAV particles. It encompasses, for example, genomic DNA derived from various AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9, as well as modified versions thereof, and artificially designed DNA based on the sequences of these DNAs. AAV genomes derived from wild-type viruses may be partially deleted or may contain any nucleic acid sequence inserted therein. Preferably, the AAV genome contains functional ITR sequences required for viral replication and packaging.

[0027] As used herein, the term "capsid" refers to an outer shell made of proteins that surrounds the viral genome in a virus particle. The AAV capsid is composed of three types of capsid proteins (VP1, VP2, and VP3), which are encoded by the cap gene possessed by AAV. As used herein, VP1, VP2, and VP3 are all included in the capsid protein.

[0028] As used herein, the term "AAV full particles" refers to AAV particles having a full-length AAV genome, i.e., single-stranded DNA flanked by the 5' ITR and 3' ITR. "AAV full particles" are also called "AAV full capsids," "AAV complete particles," "AAV vector particles," or "AAV virions."

[0029] As used herein, the term "AAV partial particles" refers to AAV particles that have nucleic acid, but the nucleic acid is not a full-length AAV genome. "AAV partial particles" are also called "AAV partial capsids."

[0030] There are various types of nucleic acids encapsulated in AAV partial particles, including, for example, fragments of nucleic acids derived from the AAV genome retained in AAV-producing cells and nucleic acids not derived from the AAV genome. Nucleic acids encapsulated in AAV partial particles that are not derived from the AAV genome may be referred to as "contaminating nucleic acids" in this specification. Examples of the contaminating nucleic acids include nucleic acids derived from host cells and nucleic acids derived from recombinant plasmids (e.g., nucleic acids encoding replication origins, selection markers, etc.).

[0031] As used herein, the term "AAV empty particles" refers to AAV particles that do not contain nucleic acid. "AAV empty particles" are also called "AAV empty capsids," "AAV hollow particles," or "AAV empty capsid particles."

[0032] As used herein, the term "base sequence" refers to a description of the bonding order of nucleotides that make up nucleic acids such as DNA and RNA, focusing on the types of organic bases that make up part of the nucleotides. "Base sequence" is also called "nucleotide sequence."

[0033] As used herein, the term "inverted repeat sequence" means that a nucleotide sequence and a nucleotide sequence complementary (or partially complementary) to the nucleotide sequence are present on the same strand, and these two sequences are referred to as inverted repeat sequences. These two sequences may be adjacent to each other, or may be separated by one or more bases. The inverted repeat sequences may preferably be present adjacent to each other.

[0034] As used herein, the term "stem-loop structure" refers to a structure formed by single-stranded RNA or DNA having an inverted repeat sequence, which consists of a double-stranded portion (stem) formed by hydrogen bonding between complementary sequences of the inverted repeat sequence and a single-stranded portion (loop) sandwiched between the stem and the loop. The hydrogen-bonded inverted repeat sequences may be completely complementary or partially complementary. A bulge may also be inserted in the stem region. Stem-loop structures can be predicted and confirmed using nucleic acid secondary structure prediction algorithms. Examples of this algorithm include Vienna RNA Package (Hofacker I et al., Nucleic Acids Research, Vol. 31(13), pp. 3429-31 (2003)) and MFOLD (Zuker M et al., Nucleic Acids Research, Vol. 31(13), pp. 3406-15 (2003)). The "stem-loop structure" is also called a "stem-loop," a "hairpin loop," or a "hairpin loop structure."

[0035] As used herein, the terms "3' end" and "3' side" mean located toward the 3' end of a sequence (region). Similarly, as used herein, the terms "5' end" and "5' side" mean located toward the 5' end of a sequence (region).

[0036] (1) Recombinant Plasmid of the Present Invention The present invention provides a recombinant plasmid comprising (a) an adeno-associated virus (AAV) genome comprising two AAV ITR sequences and a gene sequence of interest sandwiched between them, and (b) a stuffer DNA consisting of a nucleotide sequence that does not contain an inverted repeat sequence that can form a stem-loop.

[0037] Adeno-associated virus (AAV) is a non-enveloped virus classified in the genus Dependovirus of the family Parvoviridae. AAV has an icosahedral outer shell and a linear, single-stranded DNA genome of approximately 4.7 kb. AAV can infect primates, including humans, and other vertebrates. In the present invention, AAV includes wild-type viruses and their derivatives, including all serotypes and clades, unless otherwise specified.

[0038] The present invention is applicable to AAV of any known serotype. For example, at least one AAV selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, AAV-PHP.eB, and AAV-PHP.S can be used. The present invention is also applicable to self-complementary AAV (scAAV). Note that, when the serotype of rAAV is referred to herein, the serotype from which the capsid protein is derived is used as the basis. In other words, the serotype of rAAV is determined according to the origin of the cap gene used in preparing the rAAV, and is not dependent on the AAV genome encapsulated in the rAAV particle. For example, when the capsid protein is derived from AAV6 and the ITRs in the AAV genome packaged in the rAAV particle are derived from AAV2, the rAAV particle is herein referred to as serotype 6. Furthermore, the present invention can also be applied to AAVs containing mutants of the AAV capsid proteins of each of the above serotypes.

[0039] For example, the AAV2 genome is 4680 nucleotides long and contains two open reading frames (ORFs). The first ORF encodes nonstructural Rep proteins (Rep40, Rep52, Rep68, and Rep78). Rep proteins are involved in regulating replication and transcription and in the production of the AAV genome. Rep68 / 78 has NTP binding activity, DNA helicase activity, and RNA helicase activity. Rep proteins have a nuclear localization signal and several potential phosphorylation sites.

[0040] The AAV genome contains inverted terminal repeat (ITR) sequences, each about 145 nucleotides long, at both ends. The ITR located at the 5' end is called the 5'ITR, and the ITR located at the 3' end is called the 3'ITR. The ITRs are essential for replication and packaging of the AAV genome. The ITRs contain a Rep binding site (RBS), a terminal resolution site (TRS), and a palindromic sequence that enables T-shaped hairpin formation.

[0041] The nucleotide sequences of AAV ITRs are known. In the present invention, "AAV ITRs" do not need to be wild-type nucleotide sequences, and can be modified, for example, by nucleotide insertion, deletion, or substitution, as long as they function properly. Furthermore, the origin of AAV ITRs includes, but is not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV7, etc., and they may be derived from any serotype. Furthermore, the 5' ITR and 3' ITR do not necessarily need to be derived from the same serotype, as long as they function properly. In the present invention, the ITR sequence is preferably derived from AAV2.

[0042] As used herein, the term "gene of interest" refers to any gene desired to be introduced into a target cell. Examples of genes of interest include structural genes such as enzymes, transcription factors, reporter molecules, growth factors, structural proteins, receptors, and antigenic proteins, as well as regulatory genes such as genes encoding antisense DNA and functional RNA (antisense RNA, siRNA, miRNA, ribozymes, etc.). Furthermore, the gene of interest may contain regulatory elements that control transcription and / or translation, such as promoter sequences, enhancer sequences, poly(A) addition signal sequences, and terminator sequences. In other words, sequences that can express proteins or functional nucleic acids in cells can be used as the gene of interest.

[0043] In the present invention, the length of the gene sequence of interest is preferably less than 4.7 kb. In the present invention, the gene sequence of interest is located inside the two ITR sequences of AAV.

[0044] As used herein, the term "stuffer sequence" refers to a sequence for adjusting the size of any nucleic acid construct to an appropriate length. Examples of the nucleic acid construct include an AAV genome and / or a plasmid carrying an AAV genome. The stuffer sequence is also called "stuffer DNA" or "filler sequence."

[0045] In certain embodiments, the stuffer sequence is inert and harmless, having no function or activity, and in certain embodiments, the stuffer sequence is not a sequence encoding a protein or peptide, and the stuffer sequence is not a sequence encoding a gene of interest, an AAV ITR sequence, an expression control sequence, an origin of replication, or a selectable marker.

[0046] The stuffer sequence can be placed at any desired position in the recombinant plasmid of the present invention as long as it does not impair the function of the recombinant plasmid of the present invention to supply the AAV genome into cells. In a specific embodiment, the stuffer sequence can be placed inside the two ITR sequences of the AAV genome. That is, the AAV genome contains a stuffer sequence. More specifically, the stuffer sequence is placed between the 5' ITR sequence and the gene sequence of interest, or between the gene sequence of interest and the 3' ITR sequence. In another embodiment, the stuffer sequence can be placed outside the two ITR sequences of the AAV genome. That is, the AAV genome does not contain a stuffer sequence. More specifically, the stuffer sequence is placed on the 5'-end side of the 5' ITR or on the 3'-end side of the 3' ITR. In yet another embodiment, the stuffer sequence can be placed within the gene sequence of interest. Preferably, the AAV genome does not contain a stuffer sequence, more preferably, the stuffer sequence is located outside the two ITR sequences of the AAV genome, and even more preferably, the stuffer sequence is located on the 5' end side of the 5' ITR.

[0047] The size of the stuffer sequence is not particularly limited. When the stuffer sequence is located between two ITR sequences of the AAV genome, the total length of the gene sequence of interest and the stuffer sequence is preferably 3.0 to 5.5 kb, 4.0 to 5.0 kb, or 4.3 to 4.8 kb. On the other hand, when the stuffer sequence in the recombinant plasmid of the present invention is located outside the two ITR sequences of the AAV genome, the total length of the portion of the plasmid excluding the AAV genome and the stuffer sequence is preferably 5.0 kb or more, 5.0 to 10.0 Kb, or 6.0 to 8.0 Kb.

[0048] The stuffer sequence used in the present invention desirably does not contain an inverted repeat sequence that can form a stem loop. More specifically, the stuffer sequence does not contain an inverted repeat sequence that can form a secondary structure having a stem of 12 base pairs or more, 11 base pairs or more, 10 base pairs or more, 9 base pairs or more, 8 base pairs or more, or 7 base pairs or more. Preferably, the stuffer sequence does not contain an inverted repeat sequence that can form a secondary structure having a stem of 8 base pairs or more.

[0049] Furthermore, when all of the 18 consecutive nucleotide sequences in the stuffer sequence and its complementary sequence are compared with each other, it is desirable that there are no sequences that match for 17 or more, 16 or more, 15 or more, 14 or more, or 13 or more nucleotides. Preferably, the number of matching nucleotides is 15 or less.

[0050] The stuffer sequence can be prepared by selecting a naturally occurring nucleotide sequence of an appropriate size and reducing the number of inverted repeat sequences therefrom. More specifically, all 18-nucleotide sequences in the target sequence and its complementary sequence are compared with each other, and if the complementary sequence contains 18 consecutive nucleotides that match, for example, 16 or more nucleotides with the 18 consecutive nucleotides in the target sequence, base substitutions are introduced into one of the pair of inverted repeat sequences in the target sequence so that the number of matching nucleotides is 15 or less. Note that if the target sequence encodes a protein, base substitutions are selected so that the encoded amino acid is not changed.

[0051] Alternatively, a sequence that cannot form a stem loop can be artificially designed as a stuffer sequence.

[0052] Furthermore, the stuffer sequence may be modified to reduce the number of direct repeats. As used herein, the term "direct repeat" is used to distinguish it from an inverted repeat and refers to a sequence repeated in the same direction.

[0053] The stuffer sequence used in the present invention is preferably a sequence derived from an intron of the human hypoxanthine phosphoribosyltransferase 1 (HPRT1) gene, and more preferably a sequence (SEQ ID NO: 3) obtained by reducing the number of inverted repeats from a sequence (SEQ ID NO: 2) derived from an intron of the human HPRT1 gene.

[0054] In certain embodiments, the stuffer sequence may be a sequence having at least 90% identity to SEQ ID NO: 3. In certain embodiments, the stuffer sequence has at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity to SEQ ID NO: 3.

[0055] The recombinant plasmids of the present invention may further comprise a second (third, fourth, etc.) stuffer sequence. In certain embodiments, the first stuffer sequence is located inside the two ITR sequences of the AAV genome, and the second stuffer sequence is located outside the two ITR sequences of the AAV genome.

[0056] In the recombinant plasmid of the present invention, regions other than the stuffer sequence, such as the gene of interest, may be modified to reduce the number of inverted repeat sequences present therein. If the gene of interest encodes a protein, the base sequence can be altered without changing the encoded amino acid sequence by utilizing codon degeneracy. Furthermore, the ITRs may also be modified to reduce the number of inverted repeat sequences present therein. It goes without saying that inverted repeat sequences important for the function of each region should not be modified in a way that impairs that function.

[0057] Furthermore, the gene of interest, ITR, or other region may be modified to reduce the number of direct repeat sequences. If the gene of interest encodes a protein, the base sequence can be altered without changing the encoded amino acid sequence by utilizing codon degeneracy. Of course, modifications that impair the function of each region should not be made.

[0058] The recombinant plasmid of the present invention may contain additional elements. In certain embodiments, the recombinant plasmid contains an expression control sequence involved in the transcription of the gene sequence of interest, a sequence encoding a selection marker, and / or an origin of replication. Expression control sequences include, for example, promoters, polyA addition sequences, enhancers, and tissue-specific expression control elements. Selection markers include, for example, proteins that confer antibiotic resistance, such as kanamycin resistance.

[0059] As used herein, the term "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) composed of nucleotides containing a sugar, a phosphate, and a base that is either a purine or a pyrimidine. In the present invention, the nucleic acid is preferably DNA. The nucleic acid may be a double-stranded nucleic acid formed by annealing two complementary nucleic acid molecules, or a single-stranded nucleic acid molecule. Alternatively, a portion of the nucleic acid may be a double-stranded nucleic acid and the remainder may be a single-stranded nucleic acid. For example, a portion of the ITR sequence may be a double-stranded nucleic acid, and the remaining ITR sequence and the target gene sequence may be single-stranded nucleic acids.

[0060] In the present invention, "nucleic acid" includes natural nucleic acids, chemically modified nucleic acids, artificial nucleic acids, nucleic acid analogs, and combinations thereof. Natural nucleic acids are DNA and RNA in which only naturally occurring nucleotides are linked. Chemically modified nucleic acids are nucleic acids that have been artificially chemically modified, and examples include methylphosphonate DNA / RNA, phosphorothioate DNA / RNA (PS-modified DNA / RNA), phosphoramidate DNA / RNA, and 2'-O-methyl DNA / RNA. Artificial nucleic acids are nucleic acids that contain non-natural nucleic acids as part of natural nucleic acids, or nucleic acids in which only non-natural nucleic acids are linked.

[0061] The size of the AAV genome contained in the recombinant plasmid of the present invention is not limited as long as it can be encapsulated in an AAV particle, but is usually 5 kb or less. Furthermore, the recombinant plasmid does not have an AAV genome sequence that exists in nature. Furthermore, the recombinant plasmid usually lacks the sequences of the AAV Rep gene and / or the AAV Cap gene.

[0062] The recombinant plasmid of the present invention can be prepared by known methods. For example, the recombinant plasmid can be prepared in vitro by a nucleic acid amplification reaction such as PCR or by chemical synthesis. Alternatively, the recombinant plasmid can be prepared by extracting and / or purifying a plasmid produced in a eukaryotic or prokaryotic cell.

[0063] The recombinant plasmids of the present invention can be extracted and / or purified using known methods and commercially available products, such as extraction with a phenol / chloroform mixture, alcohol precipitation, column purification, filtration, and purification by agarose gel electrophoresis.

[0064] (2) Cells of the Present Invention The present invention provides cells transduced with the recombinant plasmid.

[0065] The recombinant plasmid of the present invention is introduced into cells that produce AAV empty particles. Examples of such cells include various eukaryotic cells, such as mammalian cells, including mouse cells and primate cells (e.g., human cells), and insect cells. Cells include, but are not limited to, primary cells and cell lines. Examples of mammalian cell lines include HEK293 cells, 293EB cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1 / 2 fibroblasts, CHO cells, and cells derived therefrom. Examples of insect cell lines include Sf9 cells and cells derived therefrom. Note that, herein, cells that produce AAV empty particles or AAV particles may be referred to as "host cells," "packaging cells," or "producer cells."

[0066] As packaging cells, cells expressing rep gene products and cap gene products are used. The rep gene and cap gene may be stably integrated into the genome of the cell, or may be carried on a vector that is introduced into the cell before, simultaneously with, or after the introduction of the recombinant plasmid. When the rep gene and cap gene are carried on a vector, the rep gene and cap gene may be carried on the same vector, or each may be carried on a different vector. The rep gene and cap gene may be sequences derived from any serotype of AAV. Furthermore, the rep gene and cap gene may be sequences derived from AAV of the same serotype, or sequences derived from AAV of different serotypes.

[0067] As a vector carrying the rep gene and / or cap gene, any vector suitable for packaging cells can be used as long as it is capable of expressing the genes. Examples of such vectors include plasmids, phages, transposons, cosmids, episomal DNA, viral genomes, and artificial chromosomes. Furthermore, the rep gene and cap gene may be placed under the control of an appropriate expression system so that they can be expressed in cells. As used herein, the term "expression system" refers to a system that contains at least one pair of expression control sequences required for gene expression and the gene to be expressed in a functional state. Examples of expression control sequences include promoters, enhancers, terminators, and poly(A) addition signals.

[0068] Helper functions can also be introduced into packaging cells. Helper functions are also called helper virus functions or accessory functions. Adenoviruses are commonly used to introduce helper functions, but herpes simplex virus type 1 or 2, vaccinia virus, etc. can also be used. These are also called helper viruses. When a helper virus is used to introduce helper functions, the packaging cells are infected with the helper virus. Since only the early genes of adenovirus are required for helper function, adenoviruses deficient in late gene expression can be used as the helper virus. Examples of adenoviruses deficient in late gene expression include ts100K and ts149 adenovirus mutants. Alternatively, nucleic acids providing helper functions isolated from helper viruses or artificially produced nucleic acids providing helper functions can be introduced into packaging cells. Examples of nucleic acids providing helper functions include nucleic acids encoding adenovirus-derived E1A, E1B, E2A, VA, and E4orf6. The nucleic acid providing the helper function is introduced into the packaging cell in the form of, for example, a plasmid, a phage, a transposon, a cosmid, episomal DNA, a viral genome, an artificial chromosome, or the like.

[0069] Methods for introducing recombinant plasmids into packaging cells include, for example, the calcium phosphate method, lipofection, DEAE-dextran method, polyethyleneimine method, electroporation, direct microinjection, and high-velocity particle bombardment. Alternatively, commercially available reagents such as TransIT (registered trademark)-293 Reagent, TransIT (registered trademark)-2020 (all manufactured by Mirus), Lipofectamine 2000 Reagent, Lipofectamine 2000CD Reagent (all manufactured by Life Technologies), FuGene (registered trademark) Transfection Reagent (manufactured by Promega), and PEI max (manufactured by Cosmo Bio) may also be used.

[0070] Although the present invention is not particularly limited, in the production of the cells of the present invention,６ The recombinant plasmid is introduced at an amount of 1 ng to 10 μg, preferably 5 ng to 1 μg, and more preferably 10 ng to 500 ng per packaging cell.

[0071] (3) Method for Producing the Recombinant AAV Vector of the Present Invention The present invention provides a method for producing a recombinant AAV vector by culturing cells into which the recombinant plasmid has been introduced.

[0072] Packaging cells into which the recombinant plasmid of the present invention has been introduced can be cultured under known culture conditions depending on the type of cell, for example, at a temperature of 30 to 37°C, humidity of 95%, and CO ２ Although culture at a concentration of 5 to 10% is exemplified, the present invention is not limited to such conditions. As long as the desired cell growth and / or recombinant AAV vector production can be achieved, any temperature, humidity, CO2 concentration, etc. outside the above ranges can be used. ２ It may also be carried out in concentration.

[0073] Examples of culture media that can be used include DMEM, IMEM, Ham's F12, and RPMI-1640, which are commercially available. The culture medium may be a serum-free medium or a xeno-free medium, or may be a medium supplemented with fetal bovine serum (FBS), human serum albumin, or the like.

[0074] As the culture equipment, for example, cell culture equipment (containers) such as petri dishes, flasks, bags, shakers, large culture tanks, or bioreactors can be used. ２ Gas-permeable bags are preferred. If large quantities of cells are required, large fermentors may be used.

[0075] The culture period is not particularly limited, but is, for example, 12 hours to 10 days, preferably 24 hours to 7 days. During cell culture, the recombinant AAV vector is produced within the cells and / or in the culture supernatant.

[0076] In the present invention, recombinant AAV vectors can be obtained from cell culture supernatants, or from the supernatant obtained by centrifuging cells resuspended in a suitable buffer and lysing them. Alternatively, recombinant AAV vectors can be obtained from a mixture of cell culture supernatants and the supernatant obtained by lysing cells. For example, recombinant AAV vectors can be concentrated and purified by known methods such as filter filtration, CsCl density gradient centrifugation, chromatography, and ultrafiltration. The recombinant AAV vectors thus obtained can be stored by suitable methods such as freezing until they are used for the desired purpose.

[0077] The recombinant AAV vector produced by the method of the present invention has a high ratio of "AAV full particles" and a low ratio of "AAV partial particles" and "AAV empty particles." Furthermore, the recombinant AAV vector produced by the method of the present invention has a low content of contaminating nucleic acids. That is, the ratio of contaminating nucleic acids to the AAV genome contained in the recombinant AAV vector excluding empty particles is 10% or less, 5% or less, 3% or less, 2% or less, 1% or less, 0.5% or less, 0.3% or less, 0.2% or less, 0.1% or less, 0.05% or less, or 0.03% or less.

[0078] (4) Recombinant AAV Vector of the Present Invention The present invention provides a recombinant AAV vector obtained by the above-described method for producing a recombinant AAV vector.

[0079] The recombinant AAV vector of the present invention can be used in various methods and applications. In a specific embodiment, the method is for delivering a gene of interest to a subject or its cells, and comprises administering a recombinant AAV vector to the subject or its cells. This allows the gene sequence of interest to be delivered to the subject or its cells.

[0080] Subjects include human and non-human (e.g., primate) mammals. In certain embodiments, the subject will benefit from or require expression of a gene sequence of interest.

[0081] The recombinant AAV vectors of the present invention may be contained in compositions, which are useful for administering the recombinant AAV vectors to a subject.

[0082] The composition may contain a recombinant AAV vector as an active ingredient, as well as a carrier and / or other drugs. The composition may also contain two or more different recombinant AAV vectors. In this case, the capsid proteins constituting the capsids of the two or more different recombinant AAV vectors may be different from each other, and / or the encapsulated nucleic acids may be different from each other. For example, the composition may contain multiple recombinant AAV vectors targeting different cells. A carrier is a substance that facilitates the formulation and application of the composition to a living body without inhibiting or suppressing its function. Examples of carriers include, but are not limited to, excipients, binders, disintegrants, fillers, emulsifiers, flow regulators, and lubricants. In the present invention, it is preferable to use a pharmaceutically acceptable carrier.

[0083] The content of the recombinant AAV vector in the composition is not particularly limited and is determined taking into consideration the type and / or effective amount of nucleic acid encapsulated in the recombinant AAV vector, the subject or cells to which the recombinant AAV vector is delivered, the administration method, the form of the composition, the carrier, etc.

[0084] By using the recombinant AAV vector of the present invention or a composition containing the recombinant AAV vector, a gene of interest can be introduced into a subject or cells. Such a gene introduction method is also an embodiment of the present invention. Gene introduction into an animal, including a human, can be carried out by administering the composition of the present invention intratissuely (e.g., intramuscularly), intravenously, subcutaneously, or intraperitoneally. Gene introduction into cells can also be carried out by contacting the composition with cells in vitro.

[0085] The present invention will be explained in more detail with reference to the following examples, but the scope of the present invention is not limited to these examples.

[0086] Example 1: Preparation of recombinant plasmid A modified plasmid was prepared based on pAAV-ZsGreen1 (Takara Bio, #6231) by the following procedure. pAAV-ZsGreen1 contains an ampicillin resistance gene, two ITR sequences, a CMV promoter sequence, a sequence encoding ZsGreen1, and a poly(A) addition sequence (Figure 1).

[0087] First, SfiI recognition sites were introduced into the multiple cloning sites at both ends of the ZsGreen1-encoding sequence to allow for easy modification of the gene of interest (GOI). Next, a sequence encoding the degradation domain of mouse ornithine decarboxylase (SEQ ID NO: 1) was added downstream of ZsGreen1. This domain contains a PEST sequence that reduces protein stability, thereby reducing the effect of intracellular fluorescent protein accumulation on measurement of AAV vector infection efficiency. The resulting plasmid was named pAAV-ZsGreen1-DR. The 145-bp ITRs at both ends of the AAV genome have a hairpin structure. To reduce the production of virus particles with incomplete genomes (AAV partial particles), a nucleotide sequence capable of forming a stem-loop structure (hereinafter referred to as a repeat sequence) was searched for in the region (target sequence) other than the hairpin structure within the ITR sequence of pAAV-ZsGreen1-DR, and the repeat sequence was modified to one that would not form a stem-loop. More specifically, the following steps (1) to (4) were carried out in sequence.

[0088] (1) All contiguous 8-nucleotide sequences in the target sequence are compared, and if there is another 8-nucleotide sequence that is a perfect match, base substitutions are introduced into one of the sequences so that the two sequences are different. This procedure is repeated until there are no more perfectly matching 8-nucleotide sequences. (2) All contiguous 18-nucleotide sequences in the target sequence are compared, and if there is a sequence that matches 16 or more nucleotides, base substitutions are introduced into one of the sequences so that the number of matching nucleotides is 15 or less. This procedure is repeated until there are no more 18-nucleotide sequences that match 16 or more nucleotides. (3) All contiguous 18-nucleotide sequences in the target sequence and its complementary sequence are compared, and if there is a contiguous 18-nucleotide sequence in the complementary sequence that matches 16 or more nucleotides with the 18 contiguous nucleotides in the target sequence, base substitutions are introduced into one of the pair of inverted repeat sequences in the target sequence so that the number of matching nucleotides is 15 or less. This procedure is repeated until there are no more sequences that meet the above conditions. (4) If the GC content of the target sequence is 70% or more, base substitutions are introduced so that the GC content is less than 70%. When the target sequence encodes a protein, bases are selected and substituted in (1) to (4) so ​​that the encoded amino acid does not change.

[0089] The resulting plasmid was designated pAAV-opti-ZsGreen1-DR. Using the same procedures as in (1) to (4) above, the repeat sequence within the ZsGreen1-encoding sequence of pAAV-opti-ZsGreen1-DR was also modified to eliminate the formation of a stem-loop without changing the amino acid sequence. The resulting plasmid was designated pAAV-opti-ZsGreen1-DR(opti). Furthermore, to address β-lactam and other restrictions, a kanamycin resistance gene was added to pAAV-opti-ZsGreen1-DR(opti), and a sequence (SEQ ID NO: 2) derived from the intron of the hypoxanthine phosphoribosyltransferase 1 (HPRT1) gene was added as a stuffer sequence to the outside of the ITR in the plasmid to prevent erroneous inclusion of contaminating nucleic acids derived from the plasmid during AAV production. The resulting plasmid was designated pAAV-opti-ZsGreen1-DR(opti)back stuff(Amp / Km). Furthermore, the repeat sequence within the stuffer sequence of pAAV-opti-ZsGreen1-DR(opti)back stuff(Amp / Km) was modified to one that would not form a stem loop, using the same procedures as in (1) to (4) above. The resulting plasmid was designated pAAV-opti-ZsGreen1-DR(opti)back opti-stuff(Amp / Km). The structure of the constructed plasmid is shown in Figure 1. The optimized nucleotide sequence derived from the intron of the human HPRT1 gene after the repeat sequence modification is shown in SEQ ID NO:3.

[0090] SEQ ID NO: 1: Nucleotide sequence encoding a degradation domain of mouse ornithine decarboxylase aagcttccgcggagccatggcttcccgccggcggtggcggcgcaggatgatggcacgctgcccatgtcttgtgcccaggagagcgggatggaccgtcaccctgcagcctgtgcttctgctaggatcaatgtg

[0091]

[0092]

[0093] Example 2 Production of AAV Vectors Either of the plasmids obtained in Example 1, pAAV2 / 9 Vector (Addgene, #112865) expressing AAV9 Cap and AAV2 Rep, and pAd5N (Agilent Technologies) were transfected into 293 EB cells (WO 2012 / 144446) using Polyethyleneimine "Max" (Cosmobio). 293EB cells were cultured in D-MEM medium (High Glucose) (Fujifilm Wako Pure Chemical Industries, Ltd., #048-29763) containing 1 / 100 volume of Gibco GlutaMax (Thermo Fisher Scientific, #35050061) at 37°C and 5% CO ２ The cells were cultured for 3 days under the conditions.

[0094] Example 3 Measurement of the encapsulation rate of contaminating nucleic acids derived from plasmids 2 μL of the culture supernatant of 293EB cells cultured in Example 2 and dH ２15 μL of 0, 2 μL of 10×DNase I buffer (Takara Bio, #6233), and 1 μL of DNase I (Takara Bio, #6233) were mixed and incubated at 37°C for 15 minutes to degrade free genomic DNA and plasmid DNA. The mixture was then treated at 95°C for 10 minutes to inactivate the DNase. Next, 20 μL of lysis buffer (Takara Bio, #6233) was added, and the mixture was incubated at 70°C for 10 minutes to lyse the AAV capsids and extract the DNA packaged in the AAV particles. Using this DNA as a template, quantitative PCR was performed using an ITR primer pair (ggaacccctagtgatggagtt (SEQ ID NO: 4) and cggcctcagtgagcga (SEQ ID NO: 5)), an ampicillin resistance gene primer pair (gttgccattgctacaggcatc (SEQ ID NO: 6) and actcgccttgatcgttggg (SEQ ID NO: 7)), and TB Green premix EX TaqII (Tli RNase H Plus) (Takara Bio Inc., #6233) to measure the copy numbers (copies / μL) of the two sequences contained in AAV particles. The ratio of the ampicillin resistance gene copy number to the ITR copy number is shown in Figure 2. Note that since the AAV genome contains two ITRs, two ITRs were counted as one copy in the calculation. As a result, it was shown that the copy number ratio of the ampicillin resistance gene (plasmid-derived contaminating nucleic acid) was reduced in AAV derived from a plasmid containing a stuffer sequence. In particular, when the stuffer sequence was modified so as not to form a secondary structure, the inclusion rate of the plasmid-derived contaminating nucleic acid was further reduced.

[0095] Example 4 Measurement of infection rate of AAV vector 1.0 x 10 ５ 293EB cells were seeded onto a 24-well plate. After 7 hours, the culture supernatant of the 293EB cells cultured in Example 2 (containing the AAV vector) was added to the wells at an ITR titer of 1.2 × 10 ５ 293EB cells were added at 1000 x g / cell. ２After culturing for 4 days, ZsGreen1 expression was observed using a fluorescence microscope. The ZsGreen1 expression rate (AAV vector infection rate) is shown in Figure 3. It was shown that there was no difference in infection rate between the AAV vectors derived from either plasmid. Figure 4 also shows the MFI (Mean Fluorescence Intensity) representing the fluorescence intensity of ZsGreen1. The highest intensity was observed in pAAV-opti-ZsGreen1-DR(opti)back opti-stuff (Amp / Km), which contains a stuffer sequence modified to prevent secondary structure.

[0096] Example 5 Measurement of the Proportion of AAV Full Particles Of the culture supernatants of 293EB cells cultured in Example 2, two types of culture supernatants using pAAV-ZsGreen1-DR and pAAV-opti-ZsGreen1-DR(opti)back opti-stuff (Amp / Km) were each subjected to an AAV Phytip column (Biotage, PTR-91-10-33) to purify the AAV vectors. The proportion of AAV full particles in each was measured using a Mass Photometer Refeyn TwoMP (Refeyn). The results are shown in Figure 5. The proportion of AAV full particles increased in the AAV vector derived from a stuffer-containing plasmid.

[0097] Example 6 Production of AAV Vector (AAVRKO Cells) AAVRKO cells (293EB cells in which the AAV receptor gene has been knocked out) were transfected with any of the plasmids obtained in Example 1, pAAV2 / 9 Vector (Addgene, #112865) expressing AAV9 Cap and AAV2 Rep, and pAd5N (Agilent Technologies) using Polyethyleneimine "Max" (Cosmobio). AAVRKO cells were cultured in D-MEM medium (High Glucose) (Fujifilm Wako Pure Chemical Industries, Ltd., #048-29763) containing 1 / 100 volume of Gibco GlutaMax (Thermo Fisher Scientific, #35050061) at 37°C and 5% CO ２ The cells were cultured for 10 days under the conditions.

[0098] Example 7 Production of AAV Vector (VPC2.0 Cells) Any of the plasmids obtained in Example 1, pAAV2 / 9 Vector (Addgene, #112865) expressing AAV9 Cap and AAV2 Rep, and pAd5N (Agilent Technologies) were transfected into VPC2.0 cells (Thermo Fisher Scientific, #A49784) using an AAV-MAX Transfection Kit (Thermo Fisher Scientific, #A50515). VPC2.0 cells were cultured in Viral Production Medium (Thermo Fisher Scientific, #4817901) containing 1 / 50 volume of GlutaMAX (Thermo Fisher Scientific, #35050061) at 37°C and 8% CO ２ The mixture was cultured for 10 days under the conditions of (1) with shaking (rotation speed: 120 rpm).

[0099] Example 8 Measurement of Inclusion Rate of Plasmid-Derived Contaminating Nucleic Acid (AAVRKO Cells, VPC2.0 Cells) The inclusion rate of plasmid-derived contaminating nucleic acid was measured using 2 μL of culture supernatant from each of the cells cultured in Examples 6 and 7, in the same manner as in Example 3. The ITR primer pair used was the primers included in the AAVpro® Titration Kit (for Real-Time PCR) Ver. 2 (Takara Bio Inc., #6233). The ratio of the ampicillin resistance gene copy number to the ITR copy number is shown in Figures 6 and 7. In both cells, the copy number ratio of the ampicillin resistance gene (plasmid-derived contaminating nucleic acid) was significantly reduced in AAV vectors derived from plasmids containing a stuffer sequence modified to prevent secondary structure.

[0100] Example 9 Measurement of the Proportion of AAV Full Particles (AAVRKO, VPC2.0 Cells) Using the culture supernatant of each of the cells cultured in Examples 6 and 7, the proportion of AAV full particles was measured in the same manner as in Example 5. The results are shown in Figures 8 and 9. In all cells, the proportion of AAV full particles increased when the AAV vector was derived from a plasmid containing a stuffer sequence modified so as not to form a secondary structure.

[0101] The method of the present invention allows for the production of AAV vectors with a high ratio of AAV full particles. The AAV vectors prepared by the method of the present invention and compositions containing the AAV vectors as active ingredients are highly useful as gene transfer methods in the fields of basic research and clinical application of gene therapy.

Claims

1. A recombinant plasmid comprising: (a) an adeno-associated virus (AAV) genome containing two AAV ITR sequences and a gene sequence of interest sandwiched between them; and (b) stuffer DNA consisting of a base sequence that does not contain an inverted repeat sequence that can form a stem loop.

2. The recombinant plasmid of claim 1, wherein the AAV genome of (a) has a chain length of 3.0 to 5.5 kb.

3. A recombinant plasmid according to claim 1 or 2, wherein the chain length of the recombinant plasmid excluding (a) is 5.0 kb or more.

4. A recombinant plasmid according to any one of claims 1 to 3, wherein the stuffer DNA (b) is a DNA containing a sequence obtained by modifying the base sequence of a naturally occurring nucleic acid.

5. The recombinant plasmid according to claim 4, wherein the stuffer DNA (b) is a DNA containing a sequence obtained by modifying the base sequence of a nucleic acid derived from an intron of the human HPRT1 gene.

6. A recombinant plasmid according to any one of claims 1 to 5, which is replicable in Escherichia coli.

7. A method for producing a recombinant plasmid, comprising the step of inserting into a plasmid vector: (a) an adeno-associated virus (AAV) genome containing two AAV ITR sequences and a target gene sequence sandwiched between them; and (b) stuffer DNA consisting of a base sequence that does not contain an inverted repeat sequence that can form a stem loop.

8. The method for producing a recombinant plasmid according to claim 7, wherein the AAV genome of (a) has a chain length of 3.0 to 5.5 kb.

9. A method for producing a recombinant plasmid according to claim 7 or 8, wherein the chain length of the recombinant plasmid excluding (a) is 5.0 kb or more.

10. A method for producing a recombinant plasmid according to any one of claims 7 to 9, wherein the stuffer DNA (b) is a DNA containing a sequence obtained by modifying the base sequence of a naturally occurring nucleic acid.

11. The method for producing a recombinant plasmid according to claim 10, wherein the stuffer DNA (b) is a DNA containing a sequence obtained by modifying the base sequence of a nucleic acid derived from an intron of the human HPRT1 gene.

12. The method for producing a recombinant plasmid according to any one of claims 7 to 11, wherein the plasmid is a plasmid that can replicate in E. coli.

Images