Survivin degraders for targeted cancer treatment

Abstract

Survivin degrader compounds, and methods of making and using the same, are described. Certain survivin degrader compounds are useful for treating cancers or inhibiting growth of cancer cells.

Description

64594-WO-PCT / TECH-2024-07 TITLE Survivin Degraders for Targeted Cancer Treatment RELATED APPLICATIONS

[0001] This application claims priority to United States Provisional Application No.63 / 569,842 filed under 35 U.S.C. § 111(b) on March 26, 2024, the disclosure of which is incorporated herein by reference in its entirety. SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy, created on March 14, 2025, is named 420_64594_Seq_Listing_TECH-2024-07.xml and is 4,620 bytes in size. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0003] This invention was made with government support under Grant Number GM127656 awarded by the National Institutes of Health. The government has certain rights in this invention. BACKGROUND

[0004] Cancer is a difficult-to-treat disease, and it evolves to evade therapy. New drugs are constantly needed and being developed. Prostate cancer is one of the most common cancers and the second-most lethal cancer among men in the United States. While the response to standard androgen deprivation therapy (ADT) is often dramatic, most prostate cancer patients develop resistance to ADT, leading to castration-resistant prostate cancer (CRPC). Unfortunately, many patients with CRPC experience distant metastases, resulting in a median survival of about one year for these patients. Enzalutamide and docetaxel have emerged as first-line treatments for metastatic CRPC (mCRPC) in recent years. However, they only provide a modest increase in overall survival, extending it by a median of 4-5 months. Furthermore, a notable percentage of patients show no response to these medications, and resistance eventually develops in all patients. Thus, there is a critical unmet need to explore new strategies to improve outcomes and overall survival rates for individuals with mCRPC.

[0005] Survivin (BIRC5) is a homo-dimeric protein of 16.5-kDa containing a single Baculovirus IAP Repeat (BIR) domain, a zinc-finger fold, and an extended C-terminal helical coiled coil, and is a member of the inhibitor of apoptosis protein (IAP) family that is expressed only in cancer cells but not in adult normal tissues. Survivin functions majorly to inhibit apoptosis via coordinating with other IAPs by deactivating64594-WO-PCT / TECH-2024-07 caspases. Survivin coordinates with other IAPs such as X-linked IAP (XIAP) and cellular IAP1 / 2 (c- IAP1 / 2) to inhibit the activation of caspases and consequent spontaneous or drug-induced apoptosis. Survivin is up-regulated in most cancers including prostate cancer, but is absent in most adult normal tissues. Thus, survivin has been considered an ideal target for cancer drug discovery. However, survivin is also considered an “undruggable” target because it lacks enzymatic activity or a proper binding pocket for small molecular inhibitors. Thus, both pharmaceutical companies and academic laboratories have been targeting upstream regulators of its expression, not the protein itself, leading to the discovery of YM155 and Terameprocol, which have been tested in clinical trials. However, this strategy has proven to be unsuccessful as evidenced by YM155, due to a variety of reasons including a lack of specificity of the upstream target and the upstream regulators having too many downstream target genes. There remains a need in the art for compositions and methods for inhibiting survivin protein directly. SUMMARY

[0006] Provided is a composition comprising a compound having Formula I: Formula I wherein each R is independentlyor triple substitution with -CCl3, -CN, - COR1wherein R1is H or alkyl, -SO3H, -SO2CF3, or -NR23+wherein R2is alkyl. Also provided are salts, stereoisomers, racemates, hydrates, solvates, and polymorphs of Formula I.

[0007] In certain embodiments, each R is independently selected from a phenyl having one or more halogen substitutions, a phenyl having a trifluoromethyl substitution, or a phenyl having one or more methyl substitutions.

[0008] In certain embodiments, each R is the same.

[0009] In certain embodiments, each R is independently selected from a halo-substituted phenyl, a trifluoromethyl substituted phenyl, or a methyl-substituted phenyl.

[0010] In certain embodiments, each R is the same, and each R comprises a halo-substituted phenyl, a trifluoromethyl substituted phenyl, or a methyl-substituted phenyl.

[0011] In certain embodiments, each R is independently selected from a fluoro-substituted phenyl; a difluoro-substituted phenyl; a trifluoro-substituted phenyl; a chloro-substituted phenyl; a bromo-substituted phenyl; an iodo-substituted phenyl; a trifluoromethyl-substituted phenyl; a chloro-, fluoro-substituted64594-WO-PCT / TECH-2024-07 phenyl; a di-bromo-substituted phenyl; a bromo-, fluoro-substituted phenyl; a bromo-, chloro-substituted phenyl; a bromo-, difluoro-substituted phenyl; methylphenyl; or trimethylphenyl.

[0012] In certain embodiments, each R is the same, and each R comprises a fluoro-substituted phenyl; a difluoro-substituted phenyl; a trifluoro-substituted phenyl; a chloro-substituted phenyl; a bromo- substituted phenyl; an iodo-substituted phenyl; a trifluoromethyl-substituted phenyl; a chloro-, fluoro- substituted phenyl; a di-bromo-substituted phenyl; a bromo-, fluoro-substituted phenyl; a bromo-, chloro- substituted phenyl; a bromo-, difluoro-substituted phenyl; methylphenyl; or trimethylphenyl.

[0013] In certain embodiments, the compound is 7I-10:(7I-10)

[0014] In certain embodiments, the compound is 7I-14:

[0015] In certainfrom the group consisting of: ,64594-WO-PCT / TECH-2024-07 , ,

[0017] Further provided is a method of degrading survivin in a cell, the method comprising administering to a cell an effective amount of a survivin degrader compound and degrading survivin in the cell, wherein the survivin degrader compound comprises Formula I: Formula I wherein each R is independently aor triple substitution with a halogen, -NO2, - CF3, -CCl3, -CN, -COR1wherein R1is H or alkyl, -SO3H, -SO2CF3, or -NR23+wherein R2is alkyl; or a salt,64594-WO-PCT / TECH-2024-07 stereoisomer, racemate, hydrate, solvate, or polymorph thereof.

[0018] In certain embodiments, the cell is a cancer cell. In particular embodiments, the cancer cell is a prostate cancer cell.

[0019] In certain embodiments, the cancer is breast cancer, colon cancer, lung cancer, pancreatic cancer, prostate cancer, ovarian cancer, or leukemia.

[0020] In certain embodiments, the survivin degrader compound is 7I-10:

[0021] In certain 14:

[0022] Furthersubject having a cancerous tumor, the method comprising administering to the subject having a cancerous tumor an effective amount of a survivin degrader compound and suppressing tumor growth of the cancerous tumor in the subject, wherein the survivin degrader compound comprises Formula I: I64594-WO-PCT / TECH-2024-07 wherein each R is independently a phenyl having a mono, dual, or triple substitution with a halogen, -NO2, - CF3, -CCl3, -CN, -COR1wherein R1is H or alkyl, -SO3H, -SO2CF3, or -NR23+wherein R2is alkyl; or a salt, stereoisomer, racemate, hydrate, solvate, or polymorph of Formula I.

[0023] In certain embodiments, the cancerous tumor comprises prostate cancer.

[0024] In certain embodiments, the survivin degrader compound is 7I-10:

[0025] In certain 14:

[0026] Furtherthe method comprising reacting 2,3-dichloroquinoxaline with a substituted aniline to replace each chlorine atom in the 2,3-dichloroquinoxaline with an R-substituted amine, wherein R comprises phenyl with one, two, or three substituents, the substituents being any combination selected from the group consisting of F, Cl, Br, I, and CF3. In certain embodiments, the reaction is conducted in EtOH under reflux. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0028] FIGS.1A-1B: FIG.1 shows an illustration of survivin homo-dimerization being targeted and64594-WO-PCT / TECH-2024-07 induced degradation by a dimerization inhibitor. FIG.1B shows 3D and 2D interactions of 7I with the dimeric interface of survivin using docking. The two benzene rings in 7I were designated as ring I and ring II, respectively.

[0029] FIGS.2A: Previous survivin inhibitors (FIG.2A), and non-limiting example survivin degrader compounds in accordance with the present disclosure (FIG.2B).

[0030] FIG.3: Scheme 1, showing drug design and synthesis of ten survivin degrader compounds in accordance with the present disclosure.

[0031] FIGS.4A-4B: Cytotoxicity of 7I analogs 7I-1 to 7I-10. FIG.4A shows a survival assay of C4-2 and PC-3 cells in the presence of different concentrations of 7I and its analogs 7I-1 to 7I-10. FIG.4B shows IC50’s of 7I and 7I-1 to 7I-10 derived from survival curves shown in FIG.4A. The IC50’s of 7I-3, 7I- 5, 7I-7, 7I-8, and 7I-9 could not be generated due to lack of significant cytotoxicity. ***p < 0.001 compared with 7I.

[0032] FIGS.5A-5C: Analogs with mono-halogen substitutions at the 4-position on benzene rings and cytotoxicity. FIG.5A shows the chemical structures of 7I-11 to 7I-14. FIG.5B shows results of a cell viability assay of 7I-11, 7I-12, 7I-13, and 7I-14 compared with 7I in C4-2 and PC-3 cells. FIG.5C shows the IC50’s of 7I and 7I-1 to 7I-10 derived from survival curves shown in FIG.5B. *p<0.05, **p<0.01, ***p<0.001 compared with 7I.

[0033] FIGS.6A-6C: Analogs with double halogen substitutions at 3,4-positions on benzene rings and their cytotoxicity. FIG.6A shows the chemical structures of 7I-15 to 7I-20. FIG.6B shows the results of a cell viability assay of 7I-10 to 7I-14 compared to 7I in PC-3 and C4-2 cells. FIG.6C shows IC50’s of 7I-4 and 7I-15 to 7I-20 derived from survival curves shown in FIG.6B. *p<0.05, **p<0.01, ***p<0.001 compared with 7I-4.

[0034] FIGS.7A-7B: Analogs with double halogen substitutions at 3,5- and triple at 3,4,5-positions of two benzene rings and their cytotoxicity. FIG.7A shows the chemical structures of 7I-21 to 7I-23. FIG. 7B shows a cell viability assay of 7I-21 to 7I-23 in C4-2 and PC-3 cells.

[0035] FIGS.8A-8B: FIG.8A shows the effects of 7I analogs on survivin expression. C4-2 and PC-3 cells were treated with 1 μM 7I or its analogs for 48 hours followed by Western blot analysis of survivin and actin. FIG.8B shows that 7I-10 and 7I-14 have improved potency. C4-2 (left) and PC-3 (right) cells were treated by each compound at the denoted concentrations for 48 hours, and their survivin expressions were analyzed by Western blots. D: DMSO vehicle control; 10: 7I-10; 14: 7I-14. β-actin was used as the loading control.

[0036] FIGS.9A-9C: Effect of –CH3substitution of –F in 7I-10 or –CF3in 7I-14 on cytotoxicity and survivin expression. FIG.9A shows the chemical structures of 7I-24 and 7I-25. FIG.9B shows the cytotoxicity and IC50of 7I-24 and -25 in C4-2 and PC-3 cells. FIG.9C shows the effect of 7I-24 and 7I-2564594-WO-PCT / TECH-2024-07 on survivin expression in C4-2 and PC-3 cells. C4-2 and PC-3 cells were treated with 7I-10 or 7I-14 at 1 μM, or 7I-24 and 7I-25, at various concentrations for 48 hours followed by Western blot analyses of survivin and actin control.

[0037] FIGS.10A-10B: Dose-dependent reduction of survivin protein in CRPC cells by 7I-10. FIG.10A shows a western blot analysis of survivin and actin control in C4-2, PC-3, DU-145, and 22Rv-1 cells following treatments with different concentrations of 7I-10 for 48 hours. FIG.10B shows a quantification of survivin level from FIG.10A of three independent experiments. One sample t-test was used to test for statistical significance, *p<0.05, **p<0.01, ***p<0.001.

[0038] FIG.11A-11B: Dose-dependent reduction of survivin protein in CRPC cells by 7I-14.

[0039] FIG.12: Cytotoxicity IC50 of 7I-10 and 7I-14 in DU-145 (top left) and 22Rv-1 (bottom left) cells, and Pearson correlation analysis between cytotoxicity IC50 and the IC50 in reducing survivin expression of 7I-10 (top right) or 7I-14 (bottom right) in four CRPC cell lines. Correlation coefficient r and p-value were displayed.

[0040] FIGS.13A-13B: 7I-10 and 7I-14 did not reduce IAP expressions. FIG.13A shows protein expressions of IAPs and 14-3-3σ in C4-2 and PC-3 cells determined by Western blots. Cells were treated by 7I-10 or 7I-14 at 1 μM for 48 hours. β-Actin was used as the loading control. D: DMSO vehicle control; 10: 7I-10; and 14: 7I-14. FIG.13B shows a western blot semi-quantification of C4-2 (top) and PC- 3 (bottom) protein expressions from FIG.13A was performed on three independent experiments and summarized in the bar graphs. The densitometry of each protein band was first normalized to the corresponding β-actin and second to DMSO. The error bars represented ± SD. ns p > 0.05 and ****p ≤ 0.0001.

[0041] FIGS.14A-14D: Survivin overexpression decreased the sensitivity of 7I-10 and 7I-14. FIGS.14A-14B show survivin-transfected C4-2 cells (FIG.14A) showed resistant to 7I-10 or 7I-14 (FIG. 14B) than vector-transfected cells. FIGS.14C-14D show docetaxel-resistant DU145 cells (FIG.14C) showed resistance to 7I-10 or 7I-14 (FIG.14D) than parental DU145 cells. **, ***, p < 0.01, 0.001, respectively.

[0042] FIGS.15A-15B: Survivin-null cell line MC3T3-E1 is insensitive to survivin inhibition. FIG.15A shows the Western blot analyses of survivin and actin control in PC-3, C4-2, and MC3T3-E1 cells. FIG.15B shows 7I-10 and 7I-14 IC50values in these cell lines of 3 independent experiments.

[0043] FIGS.16A-16D: Survivin half-life. FIGS.16A-16B show the Western blot analyses of survivin and actin control in C4-2 (FIG.16A) and PC-3 (FIG.16B) cells following pre-treatments with 10 μM cycloheximide (CHX) and then treatments with 2 μM 7I-10 or 4 μM 7I-14 for different times. FIG. 16C shows relative survivin level (%) from FIGS.16A-16B. FIG.16D shows survivin half-life (t1 / 2) in C4-2 and PC-3 cells determined from FIG.16C of 3 independent experiments. (*p ≤ 0.05).64594-WO-PCT / TECH-2024-07

[0044] FIGS.17A-17B: The effect of 7I-10 and 7I-14 on survivin mRNA level. The figures show a western blot (FIG.17A) and RT-PCR analysis (FIG.17B) of survivin and actin control in C4-2 and PC-3 cells following treatment with 8 μM 7I-10 or 7I-14 for 6 hours. The bar graphs in FIG.17B show fold change in survivin mRNA level.

[0045] FIGS.18A-18B: Western blot analyses (FIG.18A) and quantification (FIG.18B) of survivin level in C4-2 and PC-3 cells following a pre-treatment with proteasome inhibitors, of MG132 (10 μM) or bortezomib (70 nM) for 1 hour and then co-treatment with 1 μM of 7I-10 (left) or 7I-14 (right) for 24 hours co-treatment. β-Actin was used as a loading control. (p > 0.05, *p < 0.05, ***p < 0.001).

[0046] FIG.19: Mammalian two-hybrid assay. PC-3 cells harboring SEAP reporter as well as plasmids expressing survivin-VP16 and survivin-GAL4 fusion proteins or control vector plasmids were treated by DMSO (D) vehicle, 7I-10, or 7I-14 before collecting conditioned media for SEAP assay (**p < 0.01 and ****p < 0.0001).

[0047] FIGS.20A-20C: 7I-10 and 7I-14 induction of apoptosis. FIGS.20A-20B show Caspase-Glo 3 / 7 activity assay (Promega) in C4-2 (FIG.20A) and PC-3 (FIG.20B) cells following 7I-10 (left) or 7I-14 (right) treatments for 24 hours at indicated concentrations. FIG.20C shows Western blot analyses of full- length and cleaved PARP in C4-2 (left) and PC-3 (right) cells.

[0048] FIGS.21A-21D: Synergism between 7I-10 or 7I-14 with docetaxel in C4-2 cells. FIGS. 21A-21B shows the 2D (FIG.21A) or 3D (FIG.21B) maps of the synergistic effects between 7I-10 and docetaxel in C4-2 cell. FIGS.21C-21D show the 2D (FIG.21C) or 3D (FIG.21D) maps of the synergistic effects between 7I-14 and docetaxel in C4-2 cells. The 3D graphs were generated by the SynergyFinder+, displaying (x-axis) docetaxel (nM), (y-axis) 7I-10 or 7I-14 (nM), and (z-axis) HSA synergy scores. Positive scores (red) indicate synergism, and negative scores (green) indicate antagonism.

[0049] FIGS.22A-22D: Synergism between 7I-10 or 7I-14 with docetaxel in PC-3 cells. FIGS. 22A-22B show the 2D (FIG.22A) or 3D (FIG.22B) maps of the synergistic effects between 7I-10 and docetaxel in PC-3 cell. FIGS.22C-22D show the 2D (FIG.22C) or 3D (FIG.22D) maps of the synergistic effects between 7I-14 and docetaxel in PC-3 cell. The 3D graphs were generated by the SynergyFinder+, displaying (x-axis) docetaxel (nM), (y-axis) 7I-10 or 7I-14 (nM), and (z-axis) HSA synergy scores. Positive scores (red) indicate synergism, and negative scores (green) indicate antagonism.

[0050] FIGS.23A-23H: In-vivo activity of 7I-14 and its synergism with docetaxel. FIG.23A shows the effect of 7I-14, docetaxel (Doc), or a combination of the two (Combo) on the growth of PC-3 xenograft tumors and body weight (BW) of male NSG mice. FIG.23B shows the gross anatomy of dissected xenograft tumors. FIG.23C shows H&E staining of xenograft tumors. FIG.23D shows the final wet weight of xenograft tumors. FIG.23E shows tumor growth inhibition (%) by single agent or combination treatment. The calculated (Cal) combination inhibition was predicted from the observed64594-WO-PCT / TECH-2024-07 inhibition by the two single agent alone (see materials and methods in the examples). Obs, observed combination inhibition. FIG.23F shows a Western blot analysis of survivin, cleaved caspase 3 (cCas3), and actin loading control in xenograft tumors. FIGS.23G-23H show the wet weight of liver and lung (FIG.23G) as well as white blood cell count and hemoglobin level (FIG.23H) in the mice. *p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001. DETAILED DESCRIPTION

[0051] Throughout this disclosure, various publications, patents, and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents, and published patent specifications are hereby incorporated by reference into the present disclosure in their entirety to more fully describe the state of the art to which this invention pertains.

[0052] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one of the ordinary skill in the art to which this disclosure belongs.

[0053] As used herein, the term “administering” refers to bringing a patient, tissue, organ or cells in contact with a compound. As used herein, administration can be accomplished in vitro, i.e., in a test tube, or in vivo, i.e., in cells or tissues of living organisms, for example, humans. In certain embodiments, the present disclosure encompasses administering the compounds useful in the present disclosure to a patient or subject. A “patient” or “subject”, used equivalently herein, refers to a mammal, preferably a human, that either: (1) has a disorder remediable or treatable by administration of the compound; or (2) is susceptible to a disorder that is preventable by administering the compound.

[0054] As used herein, the terms “effective amount” and “therapeutically effective amount” refer to the quantity of active therapeutic agent sufficient to yield a desired therapeutic response without undue adverse side effects such as toxicity, irritation, or allergic response. The specific “effective amount” will vary with such factors as the particular condition being treated, the physical condition of the patient, the type of animal being treated, the duration of treatment, the nature of concurrent therapy (if any), and the specific formulations employed and the structure of the compounds or its derivatives. The optimum effective amounts can be readily determined by one of ordinary skill in the art using routine experimentation.

[0055] Whereas survivin is conventionally thought to be “undruggable”, the homo-dimerization interface of survivin can be targeted to induce the degradation of survivin. Because survivin exists as a homo-dimer, a small molecule compound that inhibits survivin dimerization may promote survivin degradation via proteasome and eliminate the protein, leading to spontaneous apoptosis. (FIG.1.) Provided herein are inhibitors (i.e., survivin degrader compounds) capable of accomplishing this and inhibiting tumor growth as a result. As shown in the examples herein, the survivin degrader compounds are64594-WO-PCT / TECH-2024-07 also synergistic in combination with docetaxel, which is a commonly used anticancer drug, both in cell lines and in animal models.

[0056] Previously, the present inventors disclosed certain inhibitors of the homo-dimerization interface of survivin in U.S. Patent No.10,517,871 B2 and U.S. Patent Application Publication No. 2021 / 0299123 A1, which are incorporated herein by reference. These previous survivin-degrading inhibitors are shown in FIG.2A. The present disclosure includes more potent inhibitors than those previously disclosed.

[0057] Previously, the critical hydrophobic core residues in the dimeric interface were targeted to inhibit survivin dimerization and induce spontaneous survivin degradation in the proteasome. Highly potent survivin inhibitors with two scaffolds represented by LQZ-7I (7I) and LQZ-7F1 (7F1) were identified (FIG. 2A). A study comparing 7I with another inhibitor, S12, targeting a cavity near the dimerization domain of survivin, showed that 7I is much more effective in suppressing neuroblastoma cells and works in vivo without toxicity using chorioallantoic membrane assay. Interestingly, compared with 7I, the analogs of the same scaffold including 7G, 7H, 7J, and 7K all with the same quinoxaline ring pharmacophore were much less cytotoxic and did not inhibit survivin dimerization. Structural analysis shows that 7I has two electron- withdrawing groups (EWGs) with a unique p-fluoro (–F) group on each of the two benzene rings (FIG.2A). The other analogs contain either only one p-fluorobenzyl group or electron-donating groups (EDGs) on the benzene rings although 7G and 7H also have amide instead of secondary amine as in 7I. In addition, the benzene ring was thought to form π-π stacking with Phe93and Phe101in survivin and EWGs usually facilitate π-π stacking by reducing adjacent electron density while EDGs undermine π-π stacking via increasing the electron hindrance. Thus, it is possible that the EWGs on the benzene rings may facilitate the binding of the compounds to survivin, leading to increased cytotoxicity.

[0058] As described in the examples herein, 25 analogs of 7I were synthesized by modifying the benzene ring with different EWGs at different positions, and their cytotoxicity and induction of survivin degradation were tested. It was found that EWG fluoro, at the 3,4,5-position of benzene I and 3’,4’,5’- position of benzene II, and trifluoromethyl group at the 4-position of benzene I and 4’-position of benzene II, dramatically enhanced the cytotoxicity and activity in inducing survivin degradation. On the other hand, an EDG at the same positions decreased cytotoxicity and activity in inducing survivin degradation. Thus, EWGs on the benzenes that form the π-stacking bond with survivin enhance interaction with survivin while EDGs reduce it.

[0059] In general, the survivin degrader compounds described herein have the following structural Formula I:64594-WO-PCT / TECH-2024-07 Formula I where the R groups are the groups. Each R is independently selectedfrom a phenyl having a mono, dual, or triple substitution with a halogen, -NO2, -CF3, -CCl3, -CN, -COR1wherein R1is H or alkyl, -SO3H, -SO2CF3, or -NR23+wherein R2is alkyl.

[0060] The present disclosure encompasses the use of any optically-active, racemic, polymorphic, or stereroisomeric form, or mixtures thereof, of Formula I which form possesses properties useful in the degradation of survivin as described herein. The present disclosure includes the use of pharmaceutically acceptable salts of amino-substituted compounds with organic and inorganic acids, for example, citric acid and hydrochloric acid. The present disclosure also includes N-oxides of the amino substituents of the compounds described herein.

[0061] One non-limiting example survivin degrader compound of Formula I is 7I-10, which has the following structural formula:

[0062] Another non-Formula I is 7I-14, which has the following structural formula:64594-WO-PCT / TECH-2024-07

[0063] As shown in the of degrading survivin byinhibiting survivin against prostate cancer cells. Many other survivin degrader compounds of Formula I are possible and encompassed within the scope of the present disclosure, specifically including all of the compounds shown in FIGS.3, 5A, 6A, 7A, and 9A.

[0064] The survivin degrader compounds of Formula I can be prepared by, for example, reacting 2,3-dichloroquinoxaline with a substituted aniline to replace each chlorine atom in the 2,3- dichloroquinoxaline with an R-substituted amine, where R is a phenyl with one, two, or three substituents and the substituents are any combination selected from the group consisting of F, Cl, Br, I, and CF3. The reaction may be conducted in ethanol under reflux. However, many other methods are possible and encompassed within the scope of the present disclosure.

[0065] Pharmaceutical compositions of the present disclosure may comprise an effective amount of a survivin degrader compound described herein, and / or additional agents, dissolved or dispersed in a pharmaceutically acceptable carrier. Pharmaceutically acceptable salts can also be prepared from the compounds by treatment with organic or inorganic acids, such as methanesulfonic acid, and hydrochloric acid. As used herein, the term “pharmaceutically acceptable salt” refers to a compound formulated from a base compound which achieves substantially the same pharmaceutical effect as the base compound. In addition, the present disclosure further includes methods utilizing hydrates of the survivin degrader compounds. The term “hydrate” includes but is not limited to hemihydrates, monohydrates, dihydrates, trihydrates and the like. The preparation of a pharmaceutical composition will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington’s Pharmaceutical Sciences, 2003, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it is understood that preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by the FDA Office of Biological Standards.

[0066] A composition disclosed herein may comprise different types of carriers depending on whether it is to be administered in solid, liquid, or aerosol form, and whether it needs to be sterile for such64594-WO-PCT / TECH-2024-07 routes of administration as injection. Compositions disclosed herein can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, intraosseously, periprosthetically, topically, intramuscularly, subcutaneously, mucosally, intraosseosly, periprosthetically, in utero, orally, topically, locally, via inhalation (e.g., aerosol inhalation), by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the foregoing as would be known to one of ordinary skill in the art (see, for example, Remington’s Pharmaceutical Sciences, 2003, incorporated herein by reference).

[0067] Pharmaceutical compositions may be liquids or lyophilized or otherwise dried formulations and may include diluents of various buffer content (e.g., Tris-HCl, acetate, phosphate), pH and ionic strength, additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), solubilizing agents (e.g., glycerol, polyethylene glycerol), anti- oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), bulking substances or tonicity modifiers (e.g., lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to the protein, complexation with metal ions, or incorporation of the material into or onto particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, hydrogels, etc., or onto liposomes, microemulsions, micelles, milamellar or multilamellar vesicles, erythrocyte ghosts, or spheroplasts. Such compositions will influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance. Controlled or sustained release compositions include formulation in lipophilic depots (e.g., fatty acids, waxes, oils).

[0068] The actual dosage amount of a composition disclosed herein administered to an animal or human patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient, and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and / or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.

[0069] In certain embodiments, a composition herein and / or additional agent is formulated to be administered via an alimentary route. Alimentary routes include all possible routes of administration in which the composition is in direct contact with the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered orally, buccally, rectally, or sublingually. As such, these compositions may be formulated with an inert diluent or with an assimilable edible carrier, or they may be enclosed in hard- or soft-shell gelatin capsules, they may be compressed into tablets, or they may be incorporated directly with the food of the diet.64594-WO-PCT / TECH-2024-07

[0070] In further embodiments, a composition described herein may be administered via a parenteral route. As used herein, the term “parenteral” includes routes that bypass the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered, for example but not limited to, intravenously, intradermally, intramuscularly, intraarterially, intrathecally, subcutaneous, or intraperitoneally (U.S. Patents 6,753,514, 6,613,308, 5,466,468, 5,543,158; 5,641,515, and 5,399,363 are each specifically incorporated herein by reference in their entirety).

[0071] Solutions of the compositions disclosed may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In some cases, the form should be sterile and should be fluid to the extent that easy injectability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and / or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and / or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, such as, but not limited to, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In some cases, it may be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption such as, for example, aluminum monostearate or gelatin.

[0072] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, “Remington’s Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.64594-WO-PCT / TECH-2024-07

[0073] Sterile injectable solutions are prepared by incorporating the compositions in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized compositions into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.

[0074] In other embodiments, the compositions may be formulated for administration via various miscellaneous routes, for example, topical (i.e., transdermal) administration, mucosal administration (intranasal, vaginal, etc.), and / or via inhalation.

[0075] Pharmaceutical compositions for topical administration may include the compositions formulated for a medicated application such as an ointment, paste, cream, or powder. Ointments include all oleaginous, adsorption, emulsion, and water-soluble based compositions for topical application, while creams and lotions are those compositions that include an emulsion base only. Topically administered medications may contain a penetration enhancer to facilitate the adsorption of the active ingredients through the skin. Suitable penetration enhancers include glycerin, alcohols, alkyl methyl sulfoxides, pyrrolidones, and laurocapram. Possible bases for compositions for topical application include polyethylene glycol, lanolin, cold cream, and petrolatum, as well as any other suitable absorption, emulsion, or water-soluble ointment base. Topical preparations may also include emulsifiers, gelling agents, and antimicrobial preservatives as necessary to preserve the composition and provide for a homogenous mixture. Transdermal administration of the compositions may also comprise the use of a “patch.” For example, the patch may supply one or more compositions at a predetermined rate and in a continuous manner over a fixed period of time.

[0076] In certain embodiments, the compositions may be delivered by eye drops, intranasal sprays, inhalation, and / or other aerosol delivery vehicles. Methods for delivering compositions directly to the lungs via nasal aerosol sprays has been described in U.S. Patents 5,756,353 and 5,804,212 (each specifically incorporated herein by reference in their entirety). Likewise, the delivery of drugs using intranasal microparticle resins (Takenaga et al., 1998) and lysophosphatidyl-glycerol compounds (U.S. Patent 5,725,871, specifically incorporated herein by reference in its entirety) are also well-known in the pharmaceutical arts and could be employed to deliver the compositions described herein. Likewise, transmucosal drug delivery in the form of a polytetrafluoroethylene support matrix is described in U.S. Patent 5,780,045 (specifically incorporated herein by reference in its entirety), and could be employed to deliver the compositions described herein.

[0077] It is further envisioned the compositions disclosed herein may be delivered via an aerosol. The term aerosol refers to a colloidal system of finely divided solid or liquid particles dispersed in a liquefied or pressurized gas propellant. The typical aerosol for inhalation consists of a suspension of active64594-WO-PCT / TECH-2024-07 ingredients in liquid propellant or a mixture of liquid propellant and a suitable solvent. Suitable propellants include hydrocarbons and hydrocarbon ethers. Suitable containers will vary according to the pressure requirements of the propellant. Administration of the aerosol will vary according to the subject’s age, weight, and the severity and response of the symptoms.

[0078] In particular embodiments, the compounds and compositions described herein are useful for treating cancers or inhibiting growth of cancer cells. The survivin degrader compounds may be useful for treating a cancer such as, but not limited to, breast cancer, colon cancer, lunger cancer, pancreatic cancer, prostate cancer, ovarian cancer, or leukemia. The survivin degrader compounds may be useful to overcome docetaxel resistance in prostate cancers by targeting survivin. The survivin degrader compound(s) may be administered to the subject orally, topically, nasally, parenterally, paracancerally, transmucosally, transdermally, intramuscularly, intravenously, intradermally, subcutaneously, intraperitoneally, intraventricularly, intracranially, intratumorally, or by pulmonary delivery.

[0079] As described herein, the compounds and compositions herein can be used in combination therapies. That is, the compounds and compositions can be administered concurrently with, prior to, or subsequent to one or more other desired therapeutic or medical procedures or drugs. The particular combination of therapies and procedures in the combination regimen will take into account compatibility of the therapies and / or procedures and the desired therapeutic effect to be achieved. Combination therapies include sequential, simultaneous, and separate administration of the active compound in a way that the therapeutic effects of the first administered procedure or drug is not entirely disappeared when the subsequent procedure or drug is administered.

[0080] In some embodiments, the survivin degrader compound is part of a combination therapy with a chemotherapeutic agent. Suitable chemotherapeutic agents include, but are not limited to: taxane compounds, such as paclitaxel; platinum coordination compounds; topoisomerase I inhibitors, such as camptothecin compounds; topoisomerase II inhibitors, such as anti-tumor podophyllotoxin derivatives; anti- tumor vinca alkaloids; anti-tumor nucleoside derivatives; alkylating agents; anti-tumor anthracycline derivatives; HER2 antibodies; estrogen receptor antagonists or selective estrogen receptor modulators; aromatase inhibitors; differentiating agents, such as retinoids, and retinoic acid metabolism blocking agents (RAMBA); DNA methyl transferase inhibitors; kinase inhibitors; farnesyltransferase inhibitors; HDAC inhibitors, or other inhibitors of the ubiquitin-proteasome pathway; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimethylomelamine; acetogenins; camptothecins, such as the synthetic analog topotecan; cryptophycins; nitrogen mustards, such as chlorambucil; nitrosoureas; bisphosphonates; mitomycins; epothilones; maytansinoids; trichothecenes;64594-WO-PCT / TECH-2024-07 retinoids, such as retinoic acid; pharmaceutically acceptable salts, acids and derivatives of any of the above; and combinations thereof. Non-limiting examples of specific chemotherapeutic agents include erlotinib (TARCEVA®, Genentech / OSI Pharm.), docetaxel (TAXOTERE®, Sanofi-Aventis), 5-FU (fluorouracil, 5- fluorouracil, CAS No.51-21-8), gemcitabine (GEMZAR®, Lilly), PD-0325901 (CAS No.391210-10-9, Pfizer), cisplatin (cis-diamine, dichloroplatinum(II), CAS No.15663-27-1), carboplatin (CAS No.41575- 94-4), paclitaxel (TAXOL®, Bristol-Myers Squibb Oncology), temozolomide (4-methyl-5-oxo-2,3,4,6,8- pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide, CAS No.85622-93-1, TEMODAR®, TEMODAL®, Schering Plough), tamoxifen ((Z)-2-[4-(1,2-diphenylbut-1-enyl)phenoxy]-N,N-dimethyl- ethanamine, NOLVADEX®, ISTUBAL®, VALODEX®), doxorubicin (ADRIAMYCIN®), Akti-1 / 2, HPPD, rapamycin, lapatinib (TYKERB®, Glaxo SmithKline), oxaliplatin (ELOXATIN®, Sanofi), bortezomib (VELCADE®, Millennium Pharm.), sutent (SUNITINIB®, SU11248, Pfizer), letrozole (FEMARA®, Novartis), imatinib mesylate (GLEEVEC®, Novartis), XL-518 (MEK inhibitor, Exelixis, WO 2007 / 044515), ARRY-886 (MEK inhibitor, AZD6244, Array BioPharma, Astra Zeneca), SF-1126 (PI3K inhibitor, Semafore Pharmaceuticals), BEZ-235 (PI3K inhibitor, Novartis), XL-147 (PI3K inhibitor, Exelixis), ABT-869 (multi-targeted inhibitor of VEGF and PDGF family receptor tyrosine kinases, Abbott Laboratories and Genentech), ABT-263 (Bcl-2 / Bcl-xL inhibitor, Abbott Laboratories and Genentech), PTK787 / ZK 222584 (Novartis), fulvestrant (FASLODEX®, AstraZeneca), leucovorin (folinic acid), lonafamib (SARASAR™, SCH 66336, Schering Plough), sorafenib (NEXAVAR®, BAY43-9006, Bayer Labs), gefitinib (IRESSA®, AstraZeneca), irinotecan (CAMPTOSAR®, CPT-11, Pfizer), tipifamib (ZARNESTRA™, Johnson & Johnson), capecitabine (XELODA®, Roche), ABRAXANE™ (Cremophor- free), albumin-engineered nanoparticle formulations of paclitaxel (American Pharmaceutical Partners, Schaumberg, Ill.), vandetanib (rINN, ZD6474, ZACTIMA®, AstraZeneca), chloranmbucil, AG1478, AG1571 (SU 5271; Sugen), temsirolimus (TORISEL®, Wyeth), pazopanib (GlaxoSmithKline), canfosfamide (TELCYTA®, Telik), thioTepa and cyclosphosphamide (CYTOXAN®, NEOSAR®), bullatacin, bullatacinone, bryostatin, callystatin, CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogs), cryptophycin 1, cryptophycin 8, dolastatin, duocarmycin (including the synthetic analogs, KW-2189 and CB1-TM1), leutherobin, pancratistatin, sarcodictyin, spongistatin, chlomaphazine, chlorophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard, carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimnustine, clodronate, esperamicin, neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores, aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin,64594-WO-PCT / TECH-2024-07 idarubicin, marcellomycin, mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, porfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin, methotrexate, 5-fluorouracil (5-FU), denopterin, methotrexate, pteropterin, trimetrexate, fludarabine, 6-mercaptopurine, thiamiprine, thioguanine, ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone, aminoglutethimide, mitotane, trilostane, frolinic acid, aceglatone, aldophosphamide glycoside, aminolevulinic acid, eniluracil, amsacrine, bestrabucil, bisantrene, edatraxate, defofamine, demecolcine, diaziquone, elformithine, elliptinium acetate, etoglucid, gallium nitrate, hydroxyurea, lentinan, lonidainine, maytansine, ansamitocins, mitoguazone, mitoxantrone, mopidanmol, nitraerine, pentostatin, phenamet, pirarubicin, losoxantrone, podophyllinic acid, 2- ethylhydrazide, procarbazine, PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.), razoxane, rhizoxin, sizofuran, spirogermanium, tenuazonic acid, triaziquone, 2,2′,2″-trichlorotriethylamine, T-2 toxin, verracurin A, roridin A, anguidine, urethane, vindesine, dacarbazine, mannomustine, mitobronitol, mitolactol, pipobroman, gacytosine, arabinoside (“Ara-C”), cyclophosphamide, thioTepa, 6- thioguanine, mercaptopurine, vinblastine, etoposide (VP-16), ifosfamide, mitoxantrone, vincristine, vinorelbine (NAVELBINE®), novantrone, teniposide, edatrexate, daunomycin, aminopterin, ibandronate, CPT-11, topoisomerase inhibitor RFS 2000, and difluoromethylomithine (DFMO), paclitaxel, 5- fluorouracil, abraxane (paclitaxel albumin-stabilized nanoparticle formulation), afinitor (everolimus), erlotinib hydrochloride, everolimus, gemcitabine hydrochloride, oxaliplatin (eloxatin), capecitabine (xeloda), cisplatin, irinotecan (camptosar), colinic acid (leucovorin), folfox (folinic acid, 5-fluorouracil, and oxaliplatin), folfirinox (folinic acid, 5-fluorouracil, irinotecan, and oxaliplatin), nab-paclitaxel with gemcitabine, metformin, digoxin, and simvastatin.

[0081] In some embodiments, the survivin degrader compound is part of a combination therapy with an immunotherapeutic agent. Non-limiting examples of immunotherapeutic agents include nivolumab, pembrolizumab, rituximab, durvalumab, cemiplimab, and combinations thereof.

[0082] In some embodiments, the survivin degrader compound is part of a combination therapy with a hormonal therapeutic agent. Non-limiting examples of hormonal therapeutic agents include anastrozole, exemestane, letrozole, tamoxifen, raloxifene, fulvestrant, toremifene, goserelin, leuprolide, triptorelin, apalutamide, enzalutamide, darolutamide, bicalutamide, flutamide, nilutamide, abiraterone, ketoconazole, degarelix, medroxyprogesterone acetate, megestrol acetate, mitotane, and combinations thereof.

[0083] Advantageously, the survivin degrader compounds described herein are effective in suppressing tumor growth without apparent toxicity, and are easy to make with a one-step chemical synthesis. The survivin degrader compounds directly target the survivin protein without effects on other proteins and, thus, are less likely to cause side effects.64594-WO-PCT / TECH-2024-07

[0084] EXAMPLES

[0085] Synthesis and evaluation of quinoxaline-based dimerization inhibitors for targeted survivin degradation

[0086] It has previously been found that overexpression of survivin confers docetaxel resistance and the inhibition of survivin by a quinoxaline-based compound LQZ-7I (7I) can sensitize docetaxel and effectively suppress CRPC cells in vitro and in vivo. Structurally, 7I has a quinoxaline core linked with two 4-fluorobenzyl groups via two secondary amine bonds. In the present examples, a structural modification of 7I was conducted via a stepwise strategy, and effective analogs were identified, including 7I-10 and 7-14, which share the same quinoxaline pharmacophore but have two 3,4,5-trifluorobenzyl groups or two 4- trifluoromethylbenzyl groups, respectively. 7I-10 and 7I-14 possessed submicromolar IC50 values against CRPC cell lines C4-2 (0.24, 0.53 μM, respectively) and PC-3 (0.59, 1.05 μM, respectively), which was ~12- 20 folds or 7-9 folds lower than that of 7I (4.97 and 7.52 μM), respectively. 7I-10 and 7I-14 also synergized with docetaxel and selectively suppressed survivin expression by inhibiting survivin dimerization, leading to its degradation in the proteasome. Both 7I-10 and 7I-14 selectively cause survivin degradation without effect on other members of the IAP family. Furthermore, overexpression of ectopic survivin conferred resistance to both 7I-10 and 7I-14, indicating the on-target effects of both compounds. Finally, in the PC-3 cells xenograft model, 7I-14 effectively suppressed tumor growth and synergized with docetaxel without added toxicity to the animal. Thus, a series of survivin inhibitors (also referred to as survivin degraders) has been successfully generated with compositions of matter targeting the dimeric interface of survivin to induce its degradation, and these compounds are useful as cancer therapeutics.

[0087] Results

[0088] Effect of the number and position of fluoro groups in the benzene ring on cytotoxicity

[0089] The effect of the number and position of fluoro groups on the two benzene rings on cytotoxicity was first determined. For this purpose, ten analogs 7I-1 to 7I-10 (Scheme 1, FIG.3) were synthesized and their cytotoxicity was determined by measuring their IC50 values in prostate cancer cell lines C4-2 and PC-3. As shown in FIGS.4A-4B, 7I-1 and 7I-2 with mono-substitutions at different positions had similar IC50 as that of 7I, consistent with their equivalent electron-withdrawing potential.

[0090] However, different outcomes were observed with di- and tri-substitutions. Compounds with di- or tri-substitutions containing a 2-fluoro group had significantly reduced cytotoxicity with unmeasurable IC50(FIG.4A). These compounds include the ones with di-substitutions at 2,3 (7I-3), 2,4 (7I-5) or 2,5 (7I- 7), and tri-substitutions at 2,3,4 (7I-8) and 2,3,6 (7I-9). The IC50values of 7I-4 with 3,4-difluoro and 7I-6 with 3,5-difluoro are 3-7-fold and the IC50of 7I-10 with 3,4,5-trifluoro is more than 10-fold lower than that of 7I. These findings indicate that increasing the number of fluoro groups at specific positions on the two benzene rings generally increases the potency in cytotoxicity, consistent with the increase in electron-64594-WO-PCT / TECH-2024-07 withdrawing potential. It was also found that the position 2 is completely incompatible in the presence of fluoro groups at other positions.

[0091] It is also noteworthy that the fluoro group at position 2 in compounds with multiple fluoro groups appear to be least tolerable, which may be due to its negative influence on the π system of electrons in the presence of other EWGs on the same benzene ring.

[0092] Effect of mono-halogen substitution on cytotoxicity

[0093] It was next determined whether different halogen substitutions may affect cytotoxicity. For this purpose, the 4-fluoro in 7I was substituted with 4-chloro, 4-bromo, 4-iodo, or 4-trifluoromethyl, resulting in 7I-11, 7I-12, 7I-13, and 7I-14 (FIGS.5A-5C), respectively, and their IC50 in C4-2 and PC-3 cells was determined. As shown in FIGS.5B-5C, the IC50 values of 7I-11 with 4-choloro, 7I-12 with 4- bromo, 7I-13 with 4-iodo, and 7I-14 with 4-trifluoromethyl substitutions are lower than that of 7I in both C4-2 and PC-3 cells, and 7I-14 appears to be the most potent in both cells. This finding is consistent with the fact that the electron-withdrawing potential of -CF3 is much stronger than that of –F, –Cl, and –Br. Unexpectedly, while –F is a stronger EWG than –Cl, –Br or –I, 7I which has two –Fs is weaker than 7I-11, 7I-12, and 7I-13 in the term of cytotoxicity. It is also unclear why the 4-iodo substitution with the lowest electron-withdrawing potential of the halogens among 7I-11, 7I-12, and 7I-13, increased the cytotoxic potency although its size may affect affinity to survivin. Nevertheless, iodo substitutions are infrequently found among approved anticancer drugs and thus less drug-like in addition to its “heavy” nature, so iodo substitutions were not utilized further in these examples.

[0094] Effect of double substitutions at positions 3 and 4 with different halogens on cytotoxicity

[0095] Because 7I-4 with 3,4-difluoro has a significantly lower IC50 than that of 7I (FIG.4B), it was next determined if combinations of different halogens at these positions affect the cytotoxic potency. For this purpose, 7I4 analogs were synthesized with 3,4-disubstitutions with different halogens (FIG.6A) followed by analyses of their cytotoxicity in comparison with 7I-4. As shown in FIGS.6B-6C, all analogs are effective with good IC50 values. However, the compounds with the same halogens in positions 3 and 4 including 7I-15 with 3,4-dichloro and 7I-16 with 3,4-bromo substitutions generally performed worse than 7I-4 with 3,4–difluoro substitutions, consistent with reduced electron-withdrawing potential of –Cl and –Br compared with –F. Interestingly, compounds with mixed halogens in these positions had mixed outcomes. While the IC50values of 7I-17 with 4-chloro-3-fluoro, 7I-18 with 4-bromo-3-fluoro, and 7I-20 with 4- bromo-3-chloro substitutions are significantly decreased, the IC50of 7I-19 with 3-bromo-4-fluoro had little change or slightly higher in the two cell lines compared with 7I-4. Nevertheless, all analogs with 3,4- disubstitutions have better IC50than those with 3 or 4-monosubstitution. Thus, the 3,4-disubstitutions are more potent than 3- or 4-monosubstitution irrespective of the halogen in these positions, consistent with the above observations that increasing the number of halogens may increase potency.64594-WO-PCT / TECH-2024-07

[0096] Effect of hetero substitutions with different halogens at positions 3 and 5 or positions 3, 4, and 5 on cytotoxicity

[0097] Finally, three additional analogs were synthesized to investigate 3,5-disubstitutions and 3,4,5- trisubstitutions using different halogens based on 7I-6 with 3,5-difluoro and 7I-10 with 3,4,5-trifluoro substitutions. FIG.7A shows these analogs including 7I-21 with 3,5-dibromo, 7I-22 with 3-choloro-5- fluoro, and 7I-23 with 3-choloro-4,5-difluoro substitutions. These compounds were then tested for their cytotoxicity in C4-2 and PC-3 cells. As shown in FIG.7B, 7I-21 had higher IC50values of 4.3±1.2 µM in C4-2, and 7.4±2.3 µM in PC-3 cells than those of 7I-6, which is consistent with reduction of electron- withdrawing potential compared with 3,5-difluoro substitutions in 7I-6. Interestingly, 7I-22 and 7I-23 both completely lost their cytotoxicity. These findings indicate that the substitutions of –F with other halogens at 3,5- or 3,4,5-positions are unfavorable.

[0098] Effect of active 7I analogs on survivin expression

[0099] In the above studies, several 7I analogs that are more potent in cytotoxicity against CRPC cells than the parent 7I were identified. To determine if these analogs are also more effective in eliminating the target survivin protein, a Western blot analysis of survivin was performed following treatment of C4-2 and PC-3 cells with compounds 7I-6, 7I-10, 7I-14, 7I-18, and 7I-20 compared with 7I. As shown in FIG. 8A, all of these analogs at 1 μM (48 hours) reduced survivin expression. 7I-10 and 7I-14 are the most potent ones and completely eliminated survivin in both cell lines, which is consistent with their corresponding lowest IC50 values. Interestingly, the parent 7I at 1 μM was unable to reduce survivin expression at the current conditions. However, at higher concentrations (e.g., 4 or 10 μM), 7I was able to reduce survivin expression (FIG.8B), consistent with the observation that 7I was effective at 10 µM in eliminating survivin and less potent than the analogs in these examples. These findings indicate that the increased cytotoxicity of the newly synthesized analogs is likely due to their increased activity in reducing survivin expression.

[0100] Substitutions of fluoro by methyl (–CH3) group decreased cytotoxicity and survivin- eliminating activity

[0101] To provide more evidence that electron-withdrawing activity is important in survivin targeting, two additional analogs, 7I-24 and 7I-25 (FIG.9A), were synthesized with substitutions of the three fluoro groups in 7I-10 or two trifluoromethyl groups in 7I-14 by 3 methyl groups, a representative EDG. As shown in FIG.9B, 7I-24 displayed IC50values of 22.7 ± 2.5 μM in C4-2 and >60 μM in PC-3 cells, and 7I-25 displayed IC50values of 9.0 ± 1.0 μM in C4-2 and 18.4 ± 2.2 μM in PC-3 cells. These IC50values are dramatically higher than those of their parent analogs 7I-10 and 7I-14 and that of the original 7I which has a strong fluoro group. Furthermore, both 7I-24 and 7I-25 are also much less effective than their parent compounds in reducing survivin expression even at 5 μM whereas 7I-10 and 7I-14 at 1 µM64594-WO-PCT / TECH-2024-07 completely eliminated survivin in both C4-2 and PC-3 cells (FIG.9C). These findings confirm that EWGs likely contribute to the activity of these survivin inhibitors in binding to and inducing survivin degradation.

[0102] Dose-dependent effects of 7I-10 and 7I-14 on survivin expression

[0103] Since 7I-10 and 7I-14 could inhibit cell growth and reduce survivin expression in C4-2 and PC-3, to further examine their therapeutic potentials in CPRC, two other cell lines (DU-145 and 22Rv-1) were included. DU-145 was isolated from a brain metastasis, and 22Rv-1 was derived from a xenograft tumor of CWR22R. The CWR22R was also from a relapsed xenograft tumor after castration. DU-145 does not express PSA or AR (or a low amount AR), while 22Rv-1 expresses PSA mRNA and AR H874Y mutant.

[0104] All four cell lines were subject to treatment of 7I-10 or 7I-14 at 5 concentrations for 48 hours, and then survivin expression was analyzed by Western blots (FIG.9C). This setup helped narrow the effective concentration where survivin expression started to reduce upon treatment. By Western blot semi- quantification, it became clear that 7I-10 dramatically reduced survivin expression at 0.5 µM and 7I-14 at 1 µM in a dose-dependent manner, with a slight variation among cell lines. These results indicated that 7I-10 and 7I-14 did not discriminate CRPC cell lines despite the variation of PSA and AR expression pattern among them, and the two compounds remained effective on the androgen-independent CRPC cell lines tested here.

[0105] Selectivity of 7I-10 and 7I-14

[0106] Survivin is one of the IAPs, and they share structural and functional commonalities. 7I-10 and 7I-14 have been shown to greatly reduce survivin protein in C4-2 and PC-3 cells, hence, it was important to test the effects on other IAPs. As shown in FIGS.13A-13B, among the tested IAPs, survivin protein expression was consistently inhibited by 7I-10 and 7I-14 in 48-hour treatment, while XIAP, Livin, and c-IAP1 / 2 protein expressions were not reduced. 14-3-3σ, a homodimerizing protein with a hydrophobic dimer interface like survivin, was tested as well, and neither was its expression affected. The results indicated that 7I-10 and 7I-14 are selective to survivin.

[0107] To validate the above conclusion, C4-2 cells with ectopic survivin overexpression (C4-2 / Sur) were taken advantage of, and the cytotoxicity of 7I-10 and 7I-14 as representative analogs was tested in comparison with the vector-transfected control cells (C4-2 / Vec). It was believed that ectopic survivin overexpression should confer resistance to 7I-10 and 7I-14 if survivin is the target. FIG.14A shows the ectopic overexpression of survivin in C4-2 / Survivin cells compared with C4-2 / Vec control cells. FIG.14B shows that the C4-2 / Survivin cells are significantly more resistant to both 7I-10 and 7I-14 compared with the control C4-2 / Vec cells, indicating that survivin likely mediates the cytotoxicity of 7I-10 and 7I-14.

[0108] To further validate the above conclusion, a docetaxel-resistant DU145 cell line (DU145Doc) was generated by stepwise selection of DU145 cells using docetaxel. As shown in FIG.14C, DU145Doc64594-WO-PCT / TECH-2024-07 cells express higher level of endogenous survivin compared with DU145 cells. Interestingly, DU145Doccells are also significantly more resistant to 7I-10 and 7I-14 (FIG.14D). These observations together indicate that survivin is likely the target and mediates the cytotoxicity of 7I-10 and 7I-14.

[0109] Finally, the cytotoxicity of 7I-10 and 7I-14 was tested using MC3T3-E1, which does not express survivin (FIG.15A). This cell line has an alternative pathway to survive and is not dependent on survivin. Thus, a survivin-selective inhibitor should have low cytotoxicity to this cell line. Indeed, as shown in FIG.15B, the IC50s of 7I-10 and 7I-14 in MC3T3-E1 cells are >5-fold higher than that of C4-2 and PC-3 cells. This finding indicates that 7I-10 and 7I-14 not only are selective to survivin but may also have low toxicity to normal tissues that do not express survivin.

[0110] 7I-10 and 7I-14 reduce survivin stability

[0111] As shown above, these inhibitors selectively induced survivin loss. To determine if this is due to the inhibitor-induced survivin degradation, a cycloheximide-chase experiment was performed to determine the inhibitor effect on survivin half-life. As shown FIGS.16A-16D, both 7I-10 and 7I-14 dramatically reduced survivin half-life. However, survivin mRNA was not changed by 7I-10 and 7I-14 under the same treatment condition (FIGS.17A-17B). Thus, 7I-10 and 7I-14 likely destabilize survivin and induce its degradation.

[0112] 7I-10 and 7I-14 induce proteasome-dependent degradation of survivin

[0113] Next, whether the inhibitor-induced survivin protein degradation occurs in proteasomes was examined by testing if proteasome inhibitors can rescue survivin from 7I-10- and 7I-14-induced degradation. As shown in FIGS.18A-18B, both proteasome inhibitors MG132 and bortezomib successfully reversed 7I-10 and 7I-14-induced survivin degradation. Thus, it is concluded that 7I-10 and 7I-14 likely induced survivin degradation in proteasomes.

[0114] 7I-10 and 7I-14 inhibits survivin dimerization

[0115] It is believed that 7I-10 and 7I-14 induce survivin degradation by inhibiting its dimerization. To test this, a mammalian two-hybrid assay in which survivin was fused to VP16 activation domain and to GAL4 DNA binding domain was conducted. Only upon survivin dimerization will VP16 bind to GAL4 to form an active transcription factor driving the expression of secreted alkaline phosphatase (SEAP) reporter. As shown in FIG.19, cells treated with 7I-10 or 7I-14 were unable to produce SEAP, indicating that survivin dimerization was inhibited.

[0116] 7I-10 and 7I-14 induce spontaneous apoptosis

[0117] Inhibition of survivin is known to induce spontaneous apoptosis. To ensure the elimination of survivin by 7I-10 and 7I-14 induces spontaneous apoptosis, caspase-3 / 7 activities were measured in C4-2 and PC-3 cells following 24-hour treatments with 7I-10 or 7I-14 at different concentrations. As shown in FIGS.20A-20B, the activities of caspase-3 / 7 in both cells were increased in a dose-dependent manner.64594-WO-PCT / TECH-2024-07 Furthermore, both 7I-10 and 7I-14 dose-dependently induced cleavage of PARP (FIG.20C), a substrate of executioner caspases during apoptosis. Based on these findings, it is apparent that 7I-10 and 7I-14 treatments induce spontaneous apoptosis of cancer cells.

[0118] Both 7I-10 and 7I-14 synergize with docetaxel

[0119] Docetaxel is one of the first line treatment for metastatic CRPC and survivin is known to contribute resistance to drugs including docetaxel. To investigate if 7I-10 and 7I-14 may synergize with docetaxel and help overcome docetaxel resistance by inducing survivin degradation, a combination survival study was performed and the synergy was analyzed using the maximum single drug response (HSA) model in a web-based portal SynergyFinder+. As shown in FIGS.21-22, strong synergism was observed between docetaxel and 7I-10 or 7I-14 in both C4-2 and PC-3 cells, indicating that both 7I-10 and 7I-14 may be used to overcome docetaxel resistance in combinational therapy.

[0120] In-vivo activity and synergism with docetaxel

[0121] Finally, the in-vivo activity and synergism with docetaxel were tested using 7I-14 as the representative lead in combination with docetaxel. For this purpose, PC-3 xenograft tumors were established in NSG mice, followed by treatments with 15 mg / kg 7I-14 twice a week, 5 mg / kg docetaxel once a week, or both in combination. As shown in FIG.23A, 7I-14 as a single agent significantly slowed the growth of the xenograft tumor similarly as docetaxel alone while the combination completely inhibited the tumor growth. The dissected tumors at the end of the treatments are significantly less in size, wet weight, and density of cancer cells in the tumors of the combination treatment (FIGS.23B-23D), confirming the above conclusion. Further analysis of the inhibitory effect of the combination using the Bliss independence model revealed significant synergism between docetaxel and 7I-14 in the combination in inhibiting tumor growth (FIG.23E), consistent with the cell-based observations (FIGS.21-22).

[0122] To determine the in-vivo target inhibition, Western blot analyses of survivin in the xenograft tumors was performed. As shown in FIG.23F, 7I-14 successfully reduced survivin expression as a single agent or in combination with docetaxel, indicating the effect of 7I-14 on xenograft tumors is likely due to 7I-14-induced survivin degradation in the tumors.

[0123] Finally, the potential toxicity of 7I-14 was analyzed. As shown in FIG.23A, the body weight (BW) of mice did not change significantly in the treatment groups compared with the control group, indicating that no significant toxicity was observed in the treatment groups including the combination. This conclusion is corroborated by the finding that the wet weight of the liver and lung also did not change (FIG. 23G). Furthermore, the white blood cell counts and hemoglobin level remained similar between the treatment and control groups (FIG.23H). Thus, 7I-14 at 15 mg / kg twice a week and its combination with docetaxel does not cause significant toxicity to mice.

[0124] Discussion and conclusion64594-WO-PCT / TECH-2024-07

[0125] Previously, survivin inhibitors of two different scaffolds were identified to inhibit survivin dimerization and induce spontaneous degradation of survivin in proteasome as an approach to target the “undruggable” survivin. One of the scaffolds was quinoxaline-based with space for improvement. In these examples, it is shown that substitutions with more and stronger EWGs increased the activity while substitutions with EDGs reduced the activity. These findings are consistent with findings that the benzene rings may interact with Phe93and Phe101in the dimeric interface of survivin via π-π stacking and that EWGs reduce the electron density of the aromatic rings, allowing more favorable π-π stacking interactions. These modifications by increasing π-π stacking resulted in two improved compounds, 7I-10 and 7I-14, which not only inhibited the survival of two different prostate cancer cell lines with IC50 values ranging 0.24-1.09 µM, but were also able to completely eliminate survivin at 1 µM. Ectopic survivin overexpression and increased endogenous survivin expression both elicited cellular resistance to 7I-10 and 7I-14, further supporting the conclusion that these inhibitors induce cytotoxicity by targeting survivin.

[0126] While increasing the electron-withdrawing potential of the substitutions in the benzene rings increases the activity in general, there are exceptions to this rule. First, the position of the EWGs on the benzene ring also influences the activity. The addition of EWGs in position 2 of the benzene rings with EWGs already in other positions is inhibitory rather than stimulatory to the activity. Interestingly, a single EWG in position 2 is not different in activity from a single EWG in other positions of the benzene rings. This is unexpected, and it is not currently known what causes this exception. However, a docking analysis indicates that one of the secondary amines may form a hydrogen bond with Glu94in survivin. It is possible that the EWG in position 2 adjacent to the secondary amine may negatively impact the hydrogen bond formation in the presence of other EWGs. In the absence of EWGs in other positions, the EWG in position 2 may rotate away from the secondary amine, reducing the negative effect.

[0127] It is also unclear why having mixed halogens for 3,4-disubstitutions using either –F, –Cl, or – Br increased the potency compared with 7I-4 with 3,4–difluoro substitutions despite these mixed halogens having less electron-withdrawing potentials compared with 3,4–difluoro substitutions. However, without wishing to be bound by theory, it is believed that compared to the 3,4-difluoro substitutions, the hetero- disubstitutions may render these compounds distinct 3D conformations due to different atom sizes or electron configuration of atomic orbital, resulting in different interactions and bonding with survivin. Similarly, 7I-13 with 4-iodo is more active than 7I with 4-fluoro also possibly due to its size, posing a different conformation and leading to different binding and affinity to survivin through the semidirectional halogen-bonding effect. The strong activity of 7I-14 with 4-trifluoromethyl may also be due to its size in addition to its strong electron-withdrawing potential.

[0128] Other factors, except for electron-withdrawing ability or electronegativity, such as the atom size, and electron configuration of atomic orbital, may also contribute to their affinity to survivin or64594-WO-PCT / TECH-2024-07 cytotoxicity. Other EWGs such as nitric dioxide (–NO2) and nitrile (–CN) decreased the cytotoxicity significantly as compared to that of –F.

[0129] In addition to the above findings on substitutions at 2-position, it was also found that, for 3,4- disubstitutions, –Cl and –Br are tolerable at the 4-position if a –F is at 3-position as shown in compound 7I- 17 and 7I-18. However, when –Br is at the 4-position, -Br is intolerable at the 3-position (7I-19) although – Cl (7I-20) is tolerable. Thus, it is possible that bigger halogens than fluoro may not coexist on the same benzene ring. It is also noteworthy that 3,5- or 3,4,5-positions are tolerable to –F, but not to –Cl or –Br, and that a halogen at the 3-position synergizes with additional EWGs at other positions except the 2-position on both benzene rings.

[0130] In addition, other EWGs such as nitric dioxide (–NO2) and nitrile (–CN) were tested; however, both decreased the cytotoxicity significantly as compared to that of –F. It is also apparent that many EWGs, majorly the combination of more than one at different positions, especially those having the 2-position modification, can reduce cytotoxicity. Without wishing to be bound by theory, it is believed that the interactions among those EWGs, and / or the congestion condition, may worsen the π-π stacking with survivin.

[0131] 7I-10 and 7I-14 selectively act on survivin and induce its degradation in proteasome by inhibiting its dimerization. This selectivity is consistent with its lack of toxicity when tested in animal models. Interestingly, these inhibitors also synergize with docetaxel, one of the first line drugs for treating metastatic castration resistant prostate cancers, indicating that they can be utilized as a combinational therapy for cancer patients.

[0132] Materials and methods

[0133] All chemicals (reagent grade) and solvents (analytical grade) used were purchased from Sigma or Fisher Scientific. Column chromatography was generally performed on silica gel (200-300 mesh) and reactions were monitored by thin layer chromatography on an aluminum sheet coated with silica gel with fluorescent indicator (GF254) using UV light. High resolution mass spectrometry (HRMS) samples were run on electrospray ionization (ESI)-quadrupole time-of-flight (Q-TOF) mass spectrometer.1H-NMR,13C-NMR and31P-NMR spectra were recorded on a 600 MHz spectrometer (Bruker Avance) in DMSO. Chemical shifts are given in ppm (δ) referenced to DMSO with 2.50 for1H and 39.52 for13C.

[0134] The antibody against survivin (#2808) was purchased from Cell Signaling Technology. Cell culture media and fetal bovine serum were from Corning and Applied Biosystems-Life Technologies, respectively.

[0135] Cell lines

[0136] The human prostate cancer cell lines PC-3 and C4-2 were purchased from and authenticated by ATCC. All cell lines were maintained at 37 ℃ in 5% CO2and grown in RPMI with 10% fetal bovine64594-WO-PCT / TECH-2024-07 serum.

[0137] Methylene blue assay

[0138] 2,000-4,000 cells / well were seeded in a 96-well plate, and cultured for 24 h before adding seven gradient concentrations of each compound for another 72 h. The medium was then removed, and cells were fixed with methanol for 30 min and subsequently stained with 100 μL of 1% methylene blue (diluted in 10 mM borate buffer) for 30 min. The cells were washed 3 times with 10 mM borate buffer followed by addition of 100 μL 100% ethanol / 0.1 M HCl (1:1) to each well to dissolve the methylene blue stain and measurement of OD650 nm. The data generated was analyzed using GraphPad Prism 7.0 software (San Diego, CA) to generate fitted curves and IC50.

[0139] For the combination of 7I-10 or 7I-14 with docetaxel, the IC50 values of 7I-10 and 7I-14 with docetaxel against PC-3 and C4-2 cells using methylene blue assay were firstly determined. Next, CRPC cells were treated with the combination of 7I-10 or 7I-14 with docetaxel at the three ratios, including 1:1, 1:3 and 3:1. And new IC50 of each compound was calculated. The CI was calculated with the formula: CI = IC50(combination / 7I-10) / IC50(7I-10) + IC50(combination / docetaxel) / IC50(docetaxel).

[0140] Western blotting assay

[0141] PC-3 or C4-2 cells were treated with compounds at 1 µM for 48 h, and then the cells were washed with ice-cold PBS and harvested by rubber policeman. Cells were then lysed in a modified RIPA buffer (150 mM NaCl, 50 mM Tris pH 7.4, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate, 5 mM EDTA pH 8.0) with a protease inhibitor cocktail and a phosphatase inhibitor cocktail (Roche, Indianapolis, IN, USA) for 30 min on ice. The cell debris was removed by centrifugation at 16,000 × g for 15 min at 4 ℃. The concentration of proteins was measured using the Bio-Rad Protein Assay (Bio-Rad, herculues, USA). Protein lysates were analyzed by standard SDS-PAGE and transferred to PVDF membranes. Subsequently, the membranes were blotted with specific primary antibodies for 2 hours at 4 ℃ and then incubated with appropriate horseradish peroxidase-conjugated secondary antibodies, followed by the ECL detection using Western Bright Quantum HRP substrate (Advansta, San Jose, USA). The intensity of bands on western blots was quantified by Image J.

[0142] Docking study

[0143] A docking study using UCSF DOCK was performed and analyzed. Briefly, 3D structures of 7I-10 and 7I were prepared via the default protocol. The crystal structures of human survivin (PDB ID code: 1F3H) was optimized by removing waters, heteroatoms, and minimizing energy. The binding pocket was constrained within the dimeric interface according. The docking experiments were performed by the default protocol.64594-WO-PCT / TECH-2024-07

[0144] Mammalian two-hybrid reporter assay

[0145] The two-hybrid mammalian reporter assay was established previously. Briefly, the assay was performed by using the Matchmaker™ Mammalian Assay Kit 2 (Takara Bio). During the establishment of the vectors, the coding region of survivin was cloned into the pM plasmid fusing with the GAL4-DNA binding domain (pM-Survivin) and into the pVP16 plasmid fusing with an activation domain (pVP16- Survivin). Validation of the plasmids was done by enzymatic digestion according to the user manual, and visualized on agarose gels.

[0146] Specifically, pM-Survivin was digested by XbaI and NdeI or by EcoRI-HF and PvuII; pVP16-Survivin was digested by XbaI and NheI-HF or by EcoRI-HF and PvuII. Survivin coding region contains PvuII cutting sites, but the vectors do not. The reporter plasmid pG5SEAP was linearized by KpnI-HF and its correct size was confirmed.

[0147] For preparation of plasmids, PureLink® HiPure Plasmid Filter Purification Kits Midi Prep (Invitrogen™) was used and its protocols followed. DNA concentrations were measure by a NanoDrop™ 2000 Spectrophotometer (Thermo Scientific™).

[0148] For the reporter assay, four plasmids (pM-Vector / Survivin, pVP16-Vector / Survivin, pG5SEAP, and pRL Renilla) were transfected into PC-3 cells simultaneously. They maintained a ratio of 5:5:1:0.1 respectively, in total DNA quantity of 1 μg / well of 6-well plate. pRL Renilla (TK promoter, Promega) was used as a transfection efficiency control, and its luciferase activity was measured by Renilla Luciferase Assay System (Promega) according to manufacturer’s protocol. Lipofectamine™ 3000 Reagent (Invitrogen™) was used for transfection, and its procedure and scaling were followed.

[0149] During the experiment, PC-3 cells were plated in 6-well plate at 0.8 × 106cells / well for 24 hours. After medium replenishment, cells were transfected with the above four plasmids for 24 hours. Empty vectors were used as negative controls in replacement of survivin. Then, cells were replenished with serum-free medium, containing 2 μM of 7I-10 or 7I-14, or equal volume of DMSO as control, for 24 hours treatment. When assaying, the SEAP activity was measured by using Great EscAPe™ SEAP Chemiluminescence Kit 2.0 (Takara Bio) and following the manufacturer’s protocol. Briefly, serum-free conditioned medium was collected and centrifuged to remove all cells. Supernatant was mixed with the assay dilution buffer. The mixture was heated on dry heat block at 65 ºC for 30 minutes and cooled down to room temperature. SEAP reaction substrate was added to the mixture and incubated for 1 hour in the dark at room temperature. Luminescent SEAP activity was measured by a tube luminometer (Sirius FB12 Luminometer, Berthold Technologies). Final results of relative SEAP activities were calculated by normalizing the SEAP activity to Renilla luciferase activity and normalizing again to the DMSO vehicle control of the vector:vector control.

[0150] RNA extraction and real-time PCR64594-WO-PCT / TECH-2024-07

[0151] C4-2 or PC-3 cells were plated at 3 × 106in 10 cm dishes overnight. The next day, 7I-10, 7I- 14, or the same volume of DMSO control was directly added to dishes to a final concentration of 4 μM. Cells were treated for 6 hours, and then RNA was extracted by using RNA PureLink™ RNA Mini Kit (Invitrogen™) according to its protocol. Briefly, cell pellets resuspended in lysis buffer were passed through 21G x 11 / 2" needle 10 times, mixed with 70% ethanol, run through columns (with DNase treatment), and eluted in RNase-free water. RNA was quantified by a NanoDrop™ 2000 spectrophotometer (Thermo Scientific™), and 1.5μg RNA / sample was used for reverse transcription by High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™) in 20μL / reaction. Synthesized cDNA was diluted in 200μL nuclease-free water.

[0152] For real-time PCR, each 20 μL reaction was composed of 2 μL diluted cDNA, 2 μL primers (forward and backward), 6 μL nuclease-free water, and 10 μL SYBR Green qPCR Kit (Radiant™). Reaction conditions were set up according to the SYBR Green datasheet and melting curve analysis was conducted to verify specificity of the primers.

[0153] Survivin Forward 5’- TGACGACCCCATAGAGGAAC -3’ (SEQ ID NO: 1)

[0154] Survivin Reverse 5’- TGGCTCTTTCTCTGTCCAGTT -3’ (SEQ ID NO: 2)

[0155] β-Actin Forward 5’- TGGCACCCAGCACAATGAA -3’ (SEQ ID NO: 3)

[0156] β-Actin Reverse 5’- CTAAGTCATAGTCCGCCTAGAAGCA -3’ (SEQ ID NO: 4)

[0157] Cycloheximide chase assay

[0158] C4-2 or PC-3 cells were plated at 1 × 106in 10 cm dishes for two days. Upon treatment, 7I- 10, 7I-14, or the same volume of DMSO control was added to complete medium to a final concentration of 2 μM in a 50 mL tube. Medium in dishes was all replaced with the compound-containing medium. Cycloheximide (dissolved in serum-free RPMI 1640, 0.22 μm filtered) was added directly to each dish at 0, 0.5, 1, 2, 4, 6-hour timepoints to a final concentration of 10 μM. Cells were harvested altogether and subject to western blot analysis to determine survivin levels. After quantification and normalization of protein bands to 0-hour, survivin half-life t1 / 2 was calculated in GraphPad Prism 10 by equation: one phase decay.

[0159] Example 1

[0160] Chemical Synthesis and Methods

[0161] 7I analogs were synthesized as follows. Briefly, a mixture of 2,3-dichloroquinoxaline (1 equivalent) with corresponding halogen-substituted aniline (2.2 equivalents) in ethanol was refluxed for 18- 24 h. Then the solvent was removed under reduced pressure, after which, the solid was re-dissolved in ethyl acetate and washed with saturated NaHCO3and brine, dried over Na2SO4. Ethyl acetate was removed under reduced pressure to get the crude product which was then purified by column chromatograph.

[0162] N2,N3-bis(3-fluorophenyl)quinoxaline-2,3-diamine (7I-1)64594-WO-PCT / TECH-2024-07

[0163] 1H NMR (600 MHz, DMSO-d6) δ 9.22 (s, 2H), 8.02 – 7.97 (m, 2H), 7.65 – 7.57 (m, 4H), 7.46 – 7.37 (m, 4H), 6.92 – 6.85 (m, 2H).13C NMR (151 MHz, DMSO-d6)) δ 163.50, 161.90, 142.56, 142.49, 141.41, 136.50, 130.58, 130.51, 126.21, 126.07, 116.43, 116.42, 109.30, 109.16, 107.35, 107.17. HRMS: (M + H)+= C20H14F2N4= 349.1265, found 349.1282.

[0164] N2,N3-bis(2-fluorophenyl)quinoxaline-2,3-diamine (7I-2)

[0165] 1H NMR (600 MHz, DMSO-d6) δ 9.22 (s, 2H), 7.99 (dt, J = 12.1, 2.2 Hz, 2H), 7.67 – 7.55 (m, 4H), 7.48 – 7.35 (m, 4H), 6.94 – 6.84 (m, 2H).13C NMR (151 MHz, DMSO-d6) δ 163.49, 161.90, 142.56, 142.49, 141.43, 136.49, 130.60, 130.53, 126.23, 126.08, 116.44, 116.42, 109.31, 109.17, 107.34, 107.17. HRMS (m / z): [M + H]+for C20H15F2N4 calculated 349.1265, found 349.1255.

[0166] N2,N3-bis(2,3-difluorophenyl)quinoxaline-2,3-diamine (7I-3)

[0167] 1H NMR (400 MHz, CF3COOD) δ 7.50 (s, 4H), 7.38 – 7.22 (m, 6H).13C NMR (101 MHz, CF3COOD) δ 153.05, 152.94, 150.53, 150.43, 146.75, 146.60, 144.22, 144.07, 142.52, 129.39, 125.86, 125.81, 125.79, 125.74, 124.68, 123.03, 122.93, 121.41, 121.37, 118.95, 118.78, 118.59. HRMS (m / z): [M + H]+for C20H13F4N4 calculated 385.1076, found 385.1081.

[0168] N2,N3-bis(3,4-difluorophenyl)quinoxaline-2,3-diamine (7I-4)

[0169] 1H NMR (600 MHz, DMSO-d6) δ 9.15 (s, 2H), 8.16 (ddd, J = 13.5, 7.5, 2.6 Hz, 2H), 7.61 – 7.52 (m, 4H), 7.44 (dt, J = 18.5, 9.2 Hz, 2H), 7.39 – 7.34 (m, 2H).13C NMR (151 MHz, DMSO-d6) δ 150.24, 150.15, 148.63, 148.54, 146.10, 146.01, 144.50, 144.42, 141.28, 137.77, 137.75, 137.71, 137.69, 136.43, 126.10, 126.00, 117.70, 117.59, 116.94, 116.92, 116.90, 116.88, 109.62, 109.47. HRMS (m / z): [M + H]+for C20H13F4N4 calculated 385.1076, found 385.1053.

[0170] N2,N3-bis(2,4-difluorophenyl)quinoxaline-2,3-diamine (7I-5)

[0171] 1H NMR (600 MHz, DMSO-d6) δ 8.83 (s, 2H), 7.83 (td, J = 8.9, 6.2 Hz, 2H), 7.43 (dd, J = 6.1, 3.5 Hz, 2H), 7.42 – 7.38 (m, 2H), 7.30 (dd, J = 6.2, 3.4 Hz, 2H), 7.19 – 7.14 (m, 2H).13C NMR (151 MHz, DMSO-d6) δ 160.14, 158.53, 158.45, 156.93, 155.28, 155.20, 142.05, 136.97, 132.06, 127.53, 127.47, 125.94, 125.77, 124.30, 123.30, 111.82, 111.68, 105.07, 104.91, 104.73. HRMS (m / z): [M + H]+for C20H13F4N4 calculated 385.1076, found 385.1080.

[0172] N2,N3-bis(3,5-difluorophenyl)quinoxaline-2,3-diamine (7I-6)

[0173] 1H NMR (600 MHz, DMSO-d6) δ 9.37 (s, 2H), 7.69 – 7.46 (m, 6H), 7.50 – 7.43 (m, 2H), 6.90 (tt, J = 9.3, 2.3 Hz, 2H).13C NMR (151 MHz, DMSO-d6) δ 163.77, 163.67, 162.17, 162.07, 143.37, 141.35, 136.49, 126.81, 126.34, 103.11, 103.06, 102.95, 102.91, 97.89, 97.72, 97.54. HRMS (m / z): [M + H]+for C20H13F4N4calculated 385.1076, found 385.1071.

[0174] N2,N3-bis(2,5-difluorophenyl)quinoxaline-2,3-diamine (7I-7)

[0175] 1H NMR (600 MHz, DMSO-d6) δ 9.24 (s, 2H), 8.42 (dd, J = 6.9, 2.6 Hz, 2H), 8.10 (ddd, J = 9.0, 4.3, 2.7 Hz, 2H), 7.67 – 7.65 (m, 2H), 7.50 – 7.46 (m, 2H), 7.44 – 7.41 (m, 2H).13C NMR (151 MHz,64594-WO-PCT / TECH-2024-07 DMSO-d6) δ 159.07, 157.50, 157.49, 151.46, 151.45, 149.87, 149.85, 148.54, 141.70, 137.66, 136.00, 128.76, 128.68, 128.60, 127.21, 126.55, 126.35, 126.20, 116.68, 116.62, 116.54, 116.47, 110.66, 110.61, 110.50, 110.45, 110.37, 110.18. HRMS (m / z): [M + H]+for C20H13F4N4calculated 385.1076, found 385.1070.

[0176] N2,N3-bis(2,3,4-trifluorophenyl)quinoxaline-2,3-diamine (7I-8)

[0177] 1H NMR (400 MHz, CF3COOD) δ 7.46 (p, J = 4.9 Hz, 4H), 7.34 – 7.23 (m, 2H), 7.15 (q, J = 8.3 Hz, 2H).13C NMR (101 MHz, CF3COOD) δ 142.36, 128.98, 125.03, 120.80, 120.76, 120.72, 120.68, 119.61, 119.57, 119.51, 119.47, 118.66, 113.55, 113.51, 113.35, 113.32. HRMS (m / z): [M + H]+for C20H11F6N4 calculated 421.0887, found 421.0880.

[0178] N2,N3-bis(2,3,6-trifluorophenyl)quinoxaline-2,3-diamine (7I-9)

[0179] 1H NMR (400 MHz, CF3COOD) δ 7.48 (s, 4H), 7.11 (ddt, J = 7.7, 4.8, 2.6 Hz, 2H), 7.00 (ddt, J = 13.4, 6.3, 3.0 Hz, 2H).13C NMR (101 MHz, CF3COOD) δ 141.48, 128.63, 125.38, 118.83, 107.80, 107.53, 105.59, 105.38, 105.31, 105.10. HRMS (m / z): [M + H]+for C20H11F6N4 calculated 421.0887, found 421.0886.

[0180] N2,N3-bis(3,4,5-trifluorophenyl)quinoxaline-2,3-diamine (7I-10)

[0181] 1H NMR (600 MHz, DMSO-d6) δ 9.28 (s, 2H), 7.82 (dd, J = 10.5, 6.4 Hz, 4H), 7.66 (dd, J = 6.1, 3.4 Hz, 2H), 7.44 (dd, J = 6.2, 3.4 Hz, 2H).13C NMR (151 MHz, DMSO-d6) δ 151.31, 151.27, 151.24, 151.21, 149.70, 149.66, 149.63, 149.60, 141.06, 137.14, 137.08, 137.06, 137.00, 136.31, 135.31, 135.20, 135.10, 133.69, 133.59, 133.48, 126.62, 126.21, 104.45, 104.42, 104.29. HRMS (m / z): [M + H]+for C20H11F6N4 calculated 421.0887, found 421.0875.

[0182] N2,N3-bis(4-chlorophenyl)quinoxaline-2,3-diamine (7I-11)

[0183] 1H NMR (600 MHz, DMSO-d6) δ 9.13 (s, 2H), 7.95 – 7.91 (m, 4H), 7.57 (dd, J = 6.1, 3.4 Hz, 2H), 7.46 – 7.43 (m, 4H), 7.37 (dd, J = 6.1, 3.4 Hz, 2H).13C NMR (151 MHz, DMSO-d6) δ 141.49, 139.64, 136.54, 128.95, 126.44, 125.96, 122.35. HRMS (m / z): [M + H]+for C20H15Cl2N4 calculated 381.0673, found 381.0662.

[0184] N2,N3-bis(4-bromophenyl)quinoxaline-2,3-diamine (7I-12)

[0185] 1H NMR (600 MHz, DMSO-d6) δ 9.13 (s, 2H), 7.91 – 7.85 (m, 4H), 7.58 (dt, J = 3.4, 2.2 Hz, 6H), 7.38 (dd, J = 6.1, 3.4 Hz, 2H).13C NMR (151 MHz, DMSO-d6) δ 141.47, 140.06, 136.54, 131.85, 126.00, 125.96, 122.75, 114.40. HRMS (m / z): [M + H]+for C20H15Br2N4calculated 468.9963, found 468.9967.

[0186] N2,N3-bis(4-iodophenyl)quinoxaline-2,3-diamine (7I-13)

[0187] 1H NMR (600 MHz, DMSO-d6) δ 9.10 (s, 2H), 7.79 – 7.70 (m, 8H), 7.57 (dd, J = 6.1, 3.4 Hz, 2H), 7.41 – 7.35 (m, 2H).13C NMR (151 MHz, DMSO-d6) δ 141.44, 140.54, 137.66, 136.53, 126.00, 125.96, 123.08. HRMS (m / z): [M + H]+for C20H15I2N4calculated 564.9386, found 564.9388.64594-WO-PCT / TECH-2024-07

[0188] N2,N3-bis(4-(trifluoromethyl)phenyl)quinoxaline-2,3-diamine (7I-14)

[0189] 1H NMR (600 MHz, DMSO-d6) δ 9.43 (s, 2H), 8.12 (d, J = 8.5 Hz, 4H), 7.77 (d, J = 8.6 Hz, 4H), 7.68 – 7.63 (m, 2H), 7.49 – 7.42 (m, 2H).13C NMR (151 MHz, DMSO-d6) δ 144.44, 141.46, 136.62, 126.59, 126.38, 126.35, 126.24, 125.98, 124.18, 122.67, 122.46, 120.23. HRMS (m / z): [M + H]+for C22H15F6N4 calculated 449.1200, found 449.1196.

[0190] N2,N3-bis(3,4-dichlorophenyl)quinoxaline-2,3-diamine (7I-15)

[0191] 1H NMR (600 MHz, DMSO-d6) δ 9.24 (s, 2H), 8.28 (s, 2H), 7.62 (d, J = 8.8 Hz, 2H), 7.60 (s, 2H), 7.42 (s, 2H).13C NMR (151 MHz, DMSO-d6) δ 141.22, 140.84, 136.43, 131.26, 130.88, 126.47, 126.11, 124.01, 121.53, 120.49. HRMS (m / z): [M + H]+for C20H13Cl4N4 calculated 448.9894, found 448.9910.

[0192] N2,N3-bis(3,4-dibromophenyl)quinoxaline-2,3-diamine (7I-16)

[0193] 1H NMR (600 MHz, DMSO-d6) δ 9.23 (s, 2H), 8.39 (d, J = 2.5 Hz, 2H), 7.87 (dd, J = 8.8, 2.5 Hz, 2H), 7.75 (d, J = 8.8 Hz, 2H), 7.60 (dd, J = 6.1, 3.4 Hz, 2H), 7.43 (dd, J = 6.1, 3.4 Hz, 2H).13C NMR (151 MHz, DMSO-d6) δ 141.35, 141.25, 136.44, 133.98, 126.54, 126.13, 124.72, 123.95, 121.19, 116.02. HRMS (m / z): [M + H]+for C20H13Br4N4 calculated 624.7874, found 624.7896.

[0194] N2,N3-bis(4-chloro-3-fluorophenyl)quinoxaline-2,3-diamine (7I-17)

[0195] 1H NMR (600 MHz, DMSO-d6) δ = 9.30 (s, 2H), 8.25 – 8.09 (m, 2H), 7.68 – 7.51 (m, 6H), 7.41 (dd, J = 6.8, 3.5, 2H).13C NMR (151 MHz, DMSO-d6) δ = 158.24, 156.63, 141.39, 141.32, 141.25, 136.45, 130.69, 126.49, 126.18, 117.47, 117.45, 112.25, 112.13, 108.50, 108.33. HRMS (m / z): [M + H]+for C20H13Cl2F2N4 calculated 417.0485, found 417.0486.

[0196] N2,N3-bis(4-bromo-3-fluorophenyl)quinoxaline-2,3-diamine (7I-18)

[0197] 1H NMR (600 MHz, DMSO-d6) δ = 9.33 (s, 2H), 8.15 (dd, J = 11.9, 2.5, 2H), 7.69 (t, J = 8.5, 2H), 7.64 (dd, J = 6.1, 3.5, 2H), 7.56 (dd, J = 8.8, 2.5, 2H), 7.43 (dd, J = 6.2, 3.5, 2H).13C NMR (151 MHz, DMSO-d6) δ = 159.33, 157.73, 142.06, 141.99, 141.30, 136.47, 133.48, 126.55, 126.21, 117.98, 117.96, 108.41, 108.23, 100.01, 99.87. HRMS (m / z): [M + H]+for C20H13Br2F2N4 calculated 504.9474, found 504.9477.

[0198] N2,N3-bis(3-bromo-4-fluorophenyl)quinoxaline-2,3-diamine (7I-19)

[0199] 1H NMR (600 MHz, DMSO-d6) δ 9.12 (s, 2H), 8.30 (d, J = 4.5 Hz, 2H), 7.92 – 7.84 (m, 2H), 7.57 (d, J = 4.6 Hz, 2H), 7.46 – 7.35 (m, 4H).13C NMR (151 MHz, DMSO-d6) δ 155.02, 153.43, 141.40, 138.15, 136.46, 126.18, 125.98, 124.79, 121.65, 121.61, 117.10, 116.95, 107.93, 107.78. HRMS (m / z): [M + H]+for C20H13Br2F2N4calculated 504.9474, found 504.9479.

[0200] N2,N3-bis(4-bromo-3-chlorophenyl)quinoxaline-2,3-diamine (7I-20)

[0201] 1H NMR (600 MHz, DMSO-d6) δ 9.23 (s, 2H), 8.28 (d, J = 1.7 Hz, 2H), 7.77 (dt, J = 18.8, 5.3 Hz, 4H), 7.60 (dd, J = 5.8, 3.5 Hz, 2H), 7.42 (dd, J = 5.9, 3.4 Hz, 2H).13C NMR (151 MHz, DMSO-d6)64594-WO-PCT / TECH-2024-07 δ 141.44, 141.25, 136.45, 134.06, 133.29, 126.53, 126.14, 121.50, 120.73, 113.61. HRMS (m / z): [M + H]+for C20H13Br2Cl2N4calculated 536.8884, found 536.8924.

[0202] N2,N3-bis(3,5-dibromophenyl)quinoxaline-2,3-diamine (7I-21)

[0203] 1H NMR (600 MHz, DMSO-d6) δ 9.30 (s, 1H), 9.22 (s, 1H), 8.49 (d, J = 1.7 Hz, 2H), 8.18 (d, J = 1.7 Hz, 1H), 7.67 (ddd, J = 7.9, 2.5, 1.5 Hz, 2H), 7.63 (dd, J = 6.1, 3.5 Hz, 1H), 7.54 – 7.41 (m, 4H).13C NMR (151 MHz, DMSO-d6) δ 148.60, 143.45, 143.08, 141.67, 141.13, 137.30, 136.41, 135.91, 127.22, 127.02, 126.96, 126.87, 126.49, 126.33, 126.25, 122.64, 122.51, 121.52, 121.35.

[0204] N2,N3-bis(3-fluoro-5-iodophenyl)quinoxaline-2,3-diamine (7I-22)

[0205] 1H NMR (600 MHz, DMSO-d6) δ 9.77 (s, 2H), 8.48 (t, J = 1.6 Hz, 2H), 8.24 (dd, J = 12.1, 2.1 Hz, 2H), 7.53 (dd, J = 8.3, 1.4 Hz, 2H), 7.31 – 7.27 (m, 2H), 7.26 – 7.22 (m, 2H).13C NMR (151 MHz, DMSO-d6) δ 163.06, 161.43, 151.70, 147.61, 142.93, 142.85, 132.09, 129.19, 126.18, 126.08, 124.60, 124.58, 124.07, 118.17, 118.01, 115.60, 106.45, 106.27, 94.55, 94.48. HRMS (m / z): [M + H]+for C20H13Cl2F2N4 calculated 417.0485, found 417.0501.

[0206] N2,N3-bis(3-choloroo-4,5-difluorophenyl)quinoxaline-2,3-diamine (7I-23)

[0207] 1H NMR (600 MHz, DMSO-d6) δ 9.27 (s, 2H), 8.08 (ddd, J = 12.8, 6.7, 2.6 Hz, 2H), 7.88 – 7.82 (m, 2H), 7.66 (dd, J = 6.1, 3.5 Hz, 2H), 7.46 (dd, J = 6.1, 3.4 Hz, 2H).13C NMR (151 MHz, DMSO) δ 151.11, 151.03, 149.49, 149.41, 142.57, 142.47, 141.29, 140.96, 140.86, 137.77, 137.75, 137.70, 137.67, 136.44, 126.75, 126.28, 121.26, 121.23, 121.16, 121.14, 116.69, 108.18, 108.04.

[0208] N2,N3-bis(3,4,5-trimethylphenyl)quinoxaline-2,3-diamine (7I-24)

[0209] 1H NMR (600 MHz, DMSO-d6) δ 8.77 (s, 2H), 7.55 (s, 4H), 7.51 (dd, J = 6.1, 3.5 Hz, 2H), 7.30 (dd, J = 6.1, 3.4 Hz, 2H), 2.29 (s, 12H), 2.13 (s, 6H).13C NMR (151 MHz, DMSO-d6) δ 141.59, 137.56, 136.57, 136.43, 129.45, 125.70, 125.20, 120.39, 21.05, 15.13. HRMS (m / z): [M + H]+for C26H29N4, calculated 397.2392, found 397.2392.

[0210] N2,N3-di-p-tolylquinoxaline-2,3-diamine (7I-25)

[0211] 1H NMR (600 MHz, DMSO-d6) δ 8.93 (s, 2H), 7.79 (d, J = 8.4 Hz, 4H), 7.52 (dd, J = 6.1, 3.4 Hz, 2H), 7.32 (dq, J = 6.6, 3.4 Hz, 2H), 7.22 (d, J = 8.2 Hz, 4H), 2.32 (s, 3H).13C NMR (151 MHz, DMSO-d6) δ 141.68, 138.05, 136.64, 132.04, 129.51, 125.72, 125.34, 121.24, 20.98. HRMS (m / z): [M + H]+for C22H21N4calculated 341.1766, found 341.1766.

[0212] Certain embodiments of the compositions and methods disclosed herein are defined in the above examples. It should be understood that these examples, while indicating particular embodiments of the invention, are given by way of illustration only. From the above discussion and these examples, one skilled in the art can ascertain the essential characteristics of this disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications to adapt the compositions and methods described herein to various usages and conditions. Various changes may be made and equivalents64594-WO-PCT / TECH-2024-07 may be substituted for elements thereof without departing from the essential scope of the disclosure. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the disclosure without departing from the essential scope thereof.

Claims

64594-WO-PCT / TECH-2024-07 CLAIMS What is claimed is:

1. A composition comprising a compound having Formula I: Formula I; wherein each R is mono, dual, or triple substitution with -CCl3, - CN, -COR1wherein R1is H or alkyl, -SO3H, -SO2CF3, or -NR23+wherein R2is alkyl; or a salt, stereoisomer, racemate, hydrate, solvate, or polymorph thereof.

2. The composition of claim 1, wherein each R is independently selected from a phenyl having one or more halogen substitutions, a phenyl having a trifluoromethyl substitution, or a phenyl having one or more methyl substitutions.

3. The composition of claim 1, wherein each R is the same.

4. The composition of claim 1, wherein each R is independently selected from a halo- substituted phenyl, a trifluoromethyl substituted phenyl, or a methyl-substituted phenyl.

5. The composition of claim 1, wherein each R is the same, and each R comprises a halo- substituted phenyl, a trifluoromethyl substituted phenyl, or a methyl-substituted phenyl.

6. The composition of claim 1, wherein each R is independently selected from a fluoro- substituted phenyl; a difluoro-substituted phenyl; a trifluoro-substituted phenyl; a chloro-substituted phenyl; a bromo-substituted phenyl; an iodo-substituted phenyl; a trifluoromethyl-substituted phenyl; a chloro-, fluoro-substituted phenyl; a di-bromo-substituted phenyl; a bromo-, fluoro-substituted phenyl; a bromo-, chloro-substituted phenyl; a bromo-, difluoro-substituted phenyl; methylphenyl; or trimethylphenyl.

7. The composition of claim 1, wherein each R is the same, and each R comprises a fluoro- substituted phenyl; a difluoro-substituted phenyl; a trifluoro-substituted phenyl; a chloro-substituted64594-WO-PCT / TECH-2024-07 phenyl; a bromo-substituted phenyl; an iodo-substituted phenyl; a trifluoromethyl-substituted phenyl; a chloro-, fluoro-substituted phenyl; a di-bromo-substituted phenyl; a bromo-, fluoro-substituted phenyl; a bromo-, chloro-substituted phenyl; a bromo-, difluoro-substituted phenyl; methylphenyl; or trimethylphenyl.

8. The composition of claim 1, wherein the compound is 7I-10:(7I-10).

9. The composition of claim 1, wherein the compound is 7I-14: .

10. The composition of claim 1, wherein each R is the same, and each R is selected from the group consisting of: ,64594-WO-PCT / TECH-2024-07 , ,11. The composition of claim 1, wherein each R is a difluoro-substituted phenyl.

12. A method of degrading survivin in a cell, the method comprising administering to a cell an effective amount of a survivin degrader compound and degrading survivin in the cell, wherein the survivin degrader compound comprises Formula I: Formula I; wherein each R ismono, dual, or triple substitution with a64594-WO-PCT / TECH-2024-07 halogen, -NO2, -CF3, -CCl3, -CN, -COR1wherein R1is H or alkyl, -SO3H, -SO2CF3, or -NR23+wherein R2is alkyl; or a salt, stereoisomer, racemate, hydrate, solvate, or polymorph of Formula I.

13. The method of claim 12, wherein the cell is a cancer cell.

14. The method of claim 13, wherein the cancer cell is a prostate cancer cell.

15. The method of claim 12, wherein the cancer is breast cancer, colon cancer, lung cancer, pancreatic cancer, prostate cancer, ovarian cancer, or leukemia.

16. The method of claim 12, wherein the survivin degrader compound is 7I-10: .

17. The method of claim 12, wherein the survivin degrader compound is 7I-14: .

18. A method of suppressing tumor growth in a subject having a cancerous tumor, the method comprising administering to the subject an effective amount of a survivin degrader compound and64594-WO-PCT / TECH-2024-07 suppressing tumor growth of the cancerous tumor in the subject, wherein the survivin degrader compound comprises Formula I: Formula I; wherein each R isdual, or triple substitution with a halogen, -NO2, -CF3, -CCl3, -CN, -COR1wherein R1is H or alkyl, -SO3H, -SO2CF3, or -NR23+wherein R2is alkyl; or a salt, stereoisomer, racemate, hydrate, solvate, or polymorph of Formula I.

19. The method of claim 18, wherein the cancerous tumor comprises prostate cancer.

20. The method of claim 18, wherein the survivin degrader compound is 7I-10: (7I-10).

21. The method of claim 18, wherein the survivin degrader compound is 7I-14:64594-WO-PCT / TECH-2024-07 .

22. A methodcomprising reacting 2,3-dichloroquinoxaline with a substituted aniline to replace each chlorine atom in the 2,3- dichloroquinoxaline with an R-substituted amine, wherein R comprises phenyl with one, two, or three substituents, the substituents being any combination selected from the group consisting of F, Cl, Br, I, and CF3.

23. The method of claim 22, wherein the reacting is conducted in EtOH under reflux.

Images