Hybrid lipid nanoparticles for targeted delivery

Abstract

The present invention relates to the field of drug delivery, and, more specifically, to hybrid lipid nanoparticles and oligonucleotide structures for targeted and multifunctional drug delivery. The present invention concerns a novel hybrid nanoparticle, combining features of lipid nanoparticles (LNPs) and polynucleotide structures, methods for preparation, and various applications thereof. This novel technology combines the advantages of both lipid LNPs and oligonucleotide elements to create a versatile and stable platform for delivering therapeutic agents, especially in applications such as cancer treatment, gene therapy, and vaccination.

Description

[0001] HYBRID LIPID NANOPARTICLES FOR TARGETED DELIVERY

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to the field of drug delivery, and, more specifically, to hybrid lipid nanoparticles and oligonucleotide structures for targeted and multifunctional drug delivery. The present invention concerns a novel hybrid nanoparticle, combining features of lipid nanoparticles (LNPs) and polynucleotide structures, methods for preparation, and various applications thereof. This novel technology, referred to as "Lipigami", combines the advantages of both lipid LNPs and oligonucleotide elements to create a versatile and stable platform for delivering therapeutic agents, especially in applications such as cancer treatment, gene therapy, and vaccination.

[0004] BACKGROUND OF THE INVENTION

[0005] Lipid nanoparticles (LNPs) are nanoscale particles composed of lipids, which have gained significant attention in recent years due to their biocompatibility, biodegradability, and ability to encapsulate a wide range of therapeutic agents. LNPs may comprise various lipid components, including ionizable lipids, phospholipids, cholesterol, and polyethylene glycol (PEG)-lipids, which together create a stable and protective environment for the encapsulation of nucleic acids, small molecules, and other therapeutic agents.

[0006] LNPs have been successfully used in drug development, most notably in the delivery of mRNA in the Covid- 19 vaccines developed by Pfizer-BioNTech and Moderna. These vaccines employ LNPs as carriers for mRNA, which instructs the recipient's cells to produce a viral protein that subsequently triggers an immune response against the virus. The success of these mRNA vaccines has accelerated the acceptance and application of LNPs in various therapeutic areas.

[0007] Other approved LNP formulations include Onpattro (patisiran, see, e.g., Akinc et al., Nat. Nanotechnol., 2019, 14: 1084-1087; US 8,168,775B2), which was the first FDA-approved RNA interference (RNAi) therapeutic, designed to treat hereditary transthyretin-mediated amyloidosis. Onpattro utilizes LNPs to deliver small interfering RNA (siRNA) molecules that specifically target and degrade disease-causing mRNA. The LNP achieves targeting through a combination of specific (PEG) lipids on its surface. This ground-breaking treatment has paved the way for the development of other RNAi-based therapies using LNPs.

[0008] Liang et al. (Nat. Med., 2015, 21 (3): 288-294) describe an LNP including DNA aptamers for cell targeting. The aptamer CH6 was screened by SELEX. A CH6 aptamer-functionalized lipid nanoparticle (LNP) encapsulating osteogenic pleckstrin homology domain-containing family O member 1 (Plekhol) siRNA was investigated. The aptamer is conjugated to DSPE-PEG-CH6 lipid via thiol / maleimide chemistry. First, siRNA loaded lipid nanoparticles were prepared, and only then further the PEG-aptamer component was incubated with the already prepared LNPs, i.e., the aptamer has to be attached to the LNPs in a post modification step. However, PEG is disadvantageous for attaching targeting moieties, as it undergoes desorption / cleavage from LNPs right after being injected; and the necessity for an additional post modification step is cumbersome and may negatively influence the final particle, e.g., in terms of precise stoichiometry control.

[0009] Wang et al. (Nat. Prot., 2023, 18: 265-291) describe that the charge of the LNPs therein can be tuned by adding additional lipid components. These “SORT” lipids then provide targeted delivery of the LNPs.

[0010] There have also been some studies combining lipids and DNA origami for the purpose of shaping / disrupting biological membranes. Yet, these structures were not designed for the targeted delivery of nanoparticles or delivery of any therapeutic components but rather for biophysical studies. For instance, in Bian et al. (Nat. Chem. Biol, 2019, 15(8): 830-837), a programmable DNA-origami platform for studying lipid transfer between bilayers was investigated. The authors constructed a DNA-based scaffold capable of holding two DNA rings, optionally harboring liposomes, at a precisely defined distance. Further, Julin et al. (Angew. Chem. hit. Ed., 2021 , 60: 827) describe DNA origami templated growth of multilamellar lipid assemblies (DNA-based circular shaped scaffolds, liposome cages), connected with a tubular shaped DNA origami intended for tuning the distance between liposomes. DNA were attached to a lipid component, however, through maleimide chemistry (e.g., covalent bond occurs in between thiol modified oligonucleotides, -SH, and the maleimide group, (-C=C-C(=O)-NH-), of the lipid). In contrast to the present invention, the purpose was to provide DNA-based templates used in construction of cell-membrane associated components.

[0011] Stewart et al. (WO / 2019 / 067999) relates to delivery of mRNA with lipid nanoparticles into stem cells, such as HSPCs, and for delivering gene editing components to such cells in vitro. For example, the disclosure relates to modifying a gene sequence using a CR1 SPR-Cas9 complex in HSPCs, and methods and delivery systems for achieving such gene modification in HSPCs. However, the gRNA is not structurally incorporated to the lipid nanoparticles.

[0012] Prieve et al. (US20180221402) relates to a hybrid structure (lipid nanoparticle and polymer) that can deliver antibody or peptide aptamers, small molecules, mRNAs, short RNAs, DNAs, and simple or complex carbohydrates. Here, the polymer component includes methacrylated structures raising a concern in terms of toxicity.

[0013] Scientific studies have also demonstrated the potential of LNPs for the delivery of gene-editing tools, such as CRISPR / Cas9, to target specific genes and correct genetic mutations. This opens up new possibilities for treating genetic disorders and advancing personalized medicine.

[0014] Yet, despite their numerous advantages, LNPs face challenges in terms of functionalization possibilities and batch-to-batch comparability. The functionalization of LNPs, which involves attaching targeting ligands or other molecules to their surface, can enhance their specificity and efficacy in drug delivery. However, achieving precise and consistent functionalization can be challenging due to the inherent variability in lipid composition and the dynamic nature of lipid bilayers. Current strategies do not allow for precise positioning of moieties on the LNP surface, which diminishes their efficacy.

[0015] Furthermore, batch-to-batch comparability of LNPs is crucial for ensuring consistent quality and performance of these nanoparticles in drug delivery applications. Variability in lipid composition, size, and morphology can affect the encapsulation efficiency, stability, and pharmacokinetics of LNPs, which in turn may impact their therapeutic efficacy. A recent study shows, for example, that LNPs based on the ionizable lipid MC3 usually contain 2 molecules of mRNA, but 40%-80% do not carry any mRNA at all (Li et al., Nat. Commun., 2022, 13: 5561). Developing standardized manufacturing processes and quality control methods is essential for addressing these challenges and ensuring the reproducibility of LNP-based therapeutics.

[0016] Additionally, the low-resolution techniques commonly used to assess the biodistribution of LNPs do not provide sufficient information at the cellular level, making it challenging to evaluate the targeting performance of the modified LNPs.

[0017] DNA origami, on the other hand, is a powerful technique for designing and fabricating complex nanostructures using DNA as the building material. Developed by Paul Rothemund in 2006 (Rothemund, Nature, 440: 297-302), DNA origami relies on the self-assembly of a long, single-stranded DNA molecule (scaffold) and numerous short, synthetic DNA strands (staples) to create a wide variety of two-dimensional (2D) and three-dimensional (3D) structures with nanometer-scale precision. DNA origami structures offer a high degree of precision and programmability, enabling the creation of a wide variety of shapes and functionalities. Researchers have demonstrated the fabrication of diverse structures, such as DNA-based nanorobots, nanotubes, and even intricate 3D shapes like tetrahedrons, cubes, and buckyballs. This flexibility allows for the design of DNA origami structures tailored to specific applications, such as drug delivery, molecular sensing, and nanoscale electronics. The ability to design DNA origami structures with specific attachment points allows forthe conjugation of various molecules, including drugs, imaging agents, and targeting ligands. This functionalization can be achieved, for example, through the incorporation of specific DNA sequences, known as aptamers, which can bind to target molecules with high affinity and specificity. Additionally, DNA origami structures can be functionalized with other biomolecules, such as proteins or peptides, by using chemically modified DNA strands or bioorthogonal conjugation techniques.

[0018] Despite the potential of DNA origami, several challenges need to be addressed before this technology can be effectively translated into clinical applications. One of the main limitations is the inherent instability of DNA structures in biological environments, caused by the digestion of DNA by nucleases and the need for high salt concentrations to keep the DNA structures intact. Efforts have been made to increase the stability of DNA origami structures by using chemically modified DNA or by coating the structures with protective materials, such as polymers, lipids, or inorganic materials like silica.

[0019] Another challenge is the high cost and complexity associated with the synthesis of long, single-stranded DNA scaffolds and the large number of synthetic DNA staples required for assembly. To mitigate this issue, researchers have explored the use of alternative scaffold materials, such as RNA, as well as the development of more efficient assembly methods and optimization algorithms.

[0020] Molbay, M. et al. bioRxiv (2023): 2023-07 (DOI: 10.1101 / 2023.07.24.550304) describe E.coli-produced rodshaped DNA scaffolds including ten helix bundle in honeycomb lattice packing based on a single-stranded 2581 bases long DNA scaffold and 21 single-stranded DNA staples with an average length of 115 bases. Unlike the present invention, they are solely made of DNA staples. DNA nanorods presented here, and all other DNA-origami constructs fall in short in oligonucleotide encapsulation. Franquelim H.G., et al. Nat Commun 9, 811 (2018) describe curved DNA origami structures designed to mimic the membrane-sculpting functions of BAR domain proteins. The DNA origami structures are precisely engineered in a complex manner at the nanoscale to have specific shapes to interact with lipid membranes in a controlled manner. While the study focuses on pure DNA origami structures designed to mimic membrane-sculpting proteins, no lipid-based components are incorporated. The origami structure is engineered to bind to and deform lipid membranes. The surface density of the DNA strands very high as it is fully made of DNA strands, which would likely induce immunogenic effects when administered to the body. While these curved DNA origami scaffolds offer potential applications in synthetic biology and nanotechnology, further strategies would be needed to achieve a good nucleic acid therapeutics loading capacity.

[0021] Oktay, E. et al. Commun BioI Q, 308 (2023) describe a pure DNA origami structure to present the receptorbinding domain (RBD) of SARS-CoV-2 and CpG adjuvants, without integrating lipid components. Guan, C. et al. Biomolecules 2021 , 11 , 1855 describes hybrid nanoparticles templated by oligonucleotide chains, but does not use self-assembly techniques or DNA staples. Perrault, S. D., & Shih, W. M. (2014). ACS nano, 8(5), 5132-5140 describe encapsulated DNA nanostructures within a lipid bilayer, resembling virus particles for protection and reduced immune response. Yet, no hybrid of lipid nanoparticles and hydrophobically-modified oligonucleotide strands, potentially including complex polynucleotide structures, is described.

[0022] Additionally, the potential immunogenicity of DNA origami structures is a concern for their application in drug delivery and other clinical settings. Studies investigating the immunological response to DNA origami have reported varying results, with some structures eliciting an immune response and others remaining inert.

[0023] The present invention thus aims to overcome one or more of the above drawbacks, and provide a novel class of nanoparticles useful as a platform technology for targeted delivery. In particular, it is desirable to provide novel tools for cell level imaging and / or drug delivery that are can be more targeted in the body.

[0024] SUMMARY OF THE INVENTION

[0025] The present invention concerns a novel hybrid nanoparticle, combining features lipid nanoparticles (LNPs) and polynucleotide structures. The new hybrid nanoparticle is generally termed “Lipigami”.

[0026] According to a first aspect, the present invention provides a hybrid nanoparticle (“lipigami”), comprising: one or more hydrophobically-modified oligonucleotide strands (“handles”), each comprising a oligonucleotide strand covalently attached to a hydrophobic moiety; and a lipid nanoparticle comprising one or more lipids, wherein the hydrophobic moiety anchors the handle to the lipid nanoparticle.

[0027] Preferably, the oligonucleotide strand of one or more of the handles hybridizes to a further oligonucleotide, which in turn, can be covalently attached to an imaging agent, a diagnostic probe, or a cell-targeting agent, e.g., an oligonucleotide, an aptamer, a peptide, an antibody, a nanobody, or a protein. Preferably, the above hybrid nanoparticle further comprises a two- or three-dimensional polynucleotide structure comprising a plurality of staple oligonucleotide strands; and optionally one or more, scaffold polynucleotide strands, wherein each staple oligonucleotide strand hybridizes to the one or more scaffold polynucleotide strands, if present, and / or to one or more of the other staple oligonucleotide strands, to form the polynucleotide structure.

[0028] The hybrid nanoparticle may also be used for passive targeting, e.g., in targeting based on specific organ distribution and / or protein binding resulting from the nanoparticle’s physical characteristics.

[0029] The hybrid nanoparticle may also be used for active targeting, e.g., by one or more targeting agents attached to further oligonucleotide strands hybridized to handles protruding from the nanoparticle.

[0030] The hybrid nanoparticle may comprise cargo molecule(s), e.g., one or more therapeutic agent(s), so it may be used in therapeutic applications; or may comprise imaging agents and / or diagnostic probes, so it may be used in diagnostic and imaging applications and / or may function as bionsensors.

[0031] According to a second aspect, the above-described hybrid nanoparticle is provided for use in a method of treatment of various diseases as described in detail hereinbelow, e.g., as a medicament in a therapeutic method, or in a method of prophylactic treatment, e.g., as a vaccine or as a vaccine component.

[0032] According to a third aspect, the present invention provides a method for screening the efficacy of the abovedescribed hybrid nanoparticle, comprising the steps of: synthesizing a library of hybrid nanoparticles with varying polynucleotide structures, lipid compositions, and cell-targeting agents; testing the hybrid nanoparticles for their cellular uptake, specificity, and therapeutic efficacy in vitro and / or in vivo; and selecting the optimal hybrid nanoparticle for a specific application based on the screening results.

[0033] According to a fourth aspect, the present invention provides a method for preparing a hybrid nanoparticle, preferably above-described hybrid nanoparticle, comprising the steps of steps (A) and (B): (A) preparing one or more hydrophobically-modified polynucleotide strands comprising a polynucleotide strand covalently attached to a hydrophobic moiety; (B) assembling a lipid nanoparticle comprising one or more lipids and the one or more hydrophobically-modified polynucleotide strands.

[0034] According to a second aspect, the above-described hybrid nanoparticle is provided for use in a method of treatment of various diseases as described in detail hereinbelow, e.g., as a medicament in a therapeutic method, or in a method of prophylactic treatment, e.g., as a vaccine or as a vaccine component.

[0035] BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIG. 1 : Composition and structure of an exemplary “Handle-Lipigami” particle.

[0037] FIG. 2: Manufacturing process of an exemplary “Handle-Lipigami” and “Full-Lipigami” particle. 1 : “Handle- Lipigami” formation. 2: “Full-Lipigami” assembly.

[0038] FIG. 3: Liver detargeting of a “Handle-Lipigami”. Shown with light sheet imaging of cleared mice and bioluminescence imaging. FIG. 4: Depiction of surface charge and the the size of the different “Handle-Lipigami” species.

[0039] FIG. 5: Isoelectric point of the protein corona formed on “Handle-Lipigami” species.

[0040] FIG. 6: Plot of the 10 must abundant proteins making the protein corona on different “Handle-Lipigami”.

[0041] FIG. 7: Common and unique proteins making up the protein corona of different “Handle-Lipigami” formulations. The dark-grey dots indicate proteins that only occur in this specific sample.

[0042] FIG. 8: Active targeting of “Handle-Lipigami” achieved by adding the targeting moieties with complementary DNA strands to the protruding DNA handles on the lipigami. Upper row: schematic. Lower row: hybridization of complementary DNA handles with functional aptamer shown by increase in nucleic acid concentration and decrease in surface charge.

[0043] FIG. 9: Stoichiometric and distance-controlled deployment of targeting moieties on a “Full-Lipigami”. In the scheme, 1 and 1* are complementary DNA handles, as are 2 and 2*. 1 and 2 do not have any complementary regions, so cross-reactions between the 2 different binding sites can be minimized.

[0044] FIG. 10: Exemplary coupling strategies for conjugating a targeting moiety to a complementary further oligonucleotide strand.

[0045] BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[0046] SEQ ID NO. 1 : Example lipigami handle DNA sequence used in Example 1

[0047] SEQ ID NO. 2: Scaffold strand from the M13 bacteriophage used for Full-Lipigami production in Example 1

[0048] SEQ ID Nos. 3-122: Staple strands used for Full-Lipigami production in Example 1 . Details of the sequences for a “Full-Lipigami” structure (stating scaffold and staple sequences to create an icosahedral shell) are provided in Table 3.

[0049] DETAILED DESCRIPTION

[0050] The new hybrid nanoparticle combines the multifunctionality and design-refinement possibilities of oligonucleotides, in particular DNA, with the in-vivo stability of LNPs. LNPs have become an important candidate for drug delivery in recent years (Onpratto (US8168775B2), Covid- 19-vaccines) but they lack functionalization possibilities, uniformity and colloidal stability. By adding oligonucleotide elements, we overcome these shortcomings and create a novel hybrid nanoparticle with great potential in future targeted drug delivery.

[0051] “Lipigami” nanoparticles can provide significant advancements over standard LNPs in multiple ways:

[0052] • The precise and defined molecular organization of lipigami particles provides superior control over the surface chemistry, which facilitates the precise attachment of targeting moieties in predetermined amounts. As the targeting moieties are not only randomly attached, but also in a defined structural arrangement, the targeting efficiency is improved.

[0053] • The incorporation of DNA oligonucleotides allows for tunable zeta potential, which has a crucial effect on structural stability and circulation in the body.

[0054] • “Lipigami” hybrid nanoparticles exhibit excellent biocompatibility, which minimizes toxicity.

[0055] • The hybrid nanoparticles can be used for cell level whole mouse imaging to analyze targeting functionality of LNPs in whole body.

[0056] • The nanoparticle physical properties, and in particular the zeta potential, can be easily adjusted and surprisingly allow achieving advantageous / desired LNP tropism to be observed in the wholebody imaging.

[0057] • Different types of modified LNPs exhibit distinct biodistribution profiles throughout the entire animal body (e.g., mouse body) due to the applied modifications.

[0058] • Formation of varying protein corona compositions can be induced to form around modified LNPs.

[0059] In contrast to prior art systems, e.g., as in Wang et al. (Nat. Prot., 2023, 18: 265-291), in the present invention, the lipid component can be kept the same, while targeting is achieved through hydrophobically modified oligonucleotide strands. This ensures a better comparison with standard LNPs while avoiding the addition of extra parameters that might be influential on biodistribution.

[0060] Further, unlike prior art systems, e.g., as in Liang et al. (Nat. Med., 2015, 21 (3): 288-294), in the present invention the oligonucleotide handle is attached to a hydrophobic moiety (e.g., cholesterol) either directly or via a short linker (e.g., alkyl or alkylaminocarbonyl), without using PEG. This is advantageous for attaching / hybridizing further targeting moieties to the handles, as less desorption / cleavage from the LNPs may be achieved. And, importantly, no post modification step is needed to form the hybrid nanoparticles of the present invention. This is advantageous as it allows for a more efficient synthesis, and may positively influence the final particle, e.g., in terms of precise stoichiometry control.

[0061] Further, the nanoparticle structure according to the present invention is unique and unlike prior art systems, e.g., as in Bian et al. (Nat. Chem. Biol, 2019, 15(8): 830-837). There, the authors used DNA origami as a cage for liposomes, which exhibit an aqueous core and a lipid bilayer. In contrast, the lipid nanoparticles of the present invention do not necessarily have an aqueous core like liposomes. Further, the liposomes in said prior art study are composed of phospholipids only. The lack of ionizable lipid component in this formulation likely decreases the endosomal escape capability of the liposomes, which would result in lower protein expression levels. In contrast, the lipid nanoparticles of the present invention can be composed of wider range of lipids (ionizable lipid, helper lipid, phospholipid, etc.), and show high / improved mRNA to protein translation efficiency. Liposomes in that study were formed through lipid film hydration, followed by manual size extrusion. In contrary, the hybrid nanoparticles of the present invention are self-assembled into nanoparticles when two phases (i.e., lipid phase and aqueous phase containing mRNA cargo) are mixed. And, while the DNA origami is used in that study is merely used to control the distance between liposomes for studying the mechanism of lipid transfer (focusing on a fundamental biological process), the present invention combines lipid nanoparticles with hydrophobically modified oligonucleotide strands to create a hybrid nanoparticle amenable for various applications including drug delivery and diagnostics by positioning targeting ligands and cargo molecules.

[0062] Further, unlike other prior art systems, e.g., as in Franquelim H.G., et al. the lipigami-handle design which is a relatively simple and easy to prepare structure partially composed of self-assembled lipids.

[0063] When compared to standard LNPs, lipigamis can have larger size (as they include additional components, such as a polynucleotide structure) and increased nucleic acid content.

[0064] Detection where LNPs go after any modifications is a ground challenge. For example, surface modification of LNPs has the potential to position targeting moieties, such as polynucleotide strands, aptamers, antibodies, and peptides, in a defined number and arrangement. Without wishing to be bound by theory, this approach is contemplated to overcome the limitations associated with unmodified LNPs, while still retaining their benefits such as high mRNA encapsulation efficiency if they can be faithfully imaged. Thus, through precise visualization of the cargo molecule at a single-cell level on a whole-body scale, it is possible to identify the tropism of modified LNPs to their specific tissue targets, and identify hybrid nanoparticles providing particularly advantageous targeting selectivity.

[0065] Previously applied strategies face challenges related to the accurate identification and assessment of functionalization opportunities, as well as ensuring consistent functionalization across different batches. Any attempts to analyze the biodistribution and targeting of LNPs face with imaging limitations. Specifically, existing imaging techniques are unable to effectively visualize how any modification to LNPs impact their targeting trajectory. The present approach stands out in its ability to introduce more precision to the analysis of LNP modification in terms of biodistribution and targeting.

[0066] The present invention thus offers, inter alia, an unique ability to precisely visualize LNPs at the cellular level in large tissues after rendering them transparent. In a further step, such hybrid nanoparticles can be employed for the targeted delivery in vivo, e.g., of therapeutic agents. Therefore, in a first aspect of the invention, the hybrid nanoparticle (“lipigami”) of any one of claims 1-82 is provided.

[0067] Advantageously, hybrid nanoparticles of the present invention provide improved control over the positioning of targeting ligands, enabling the precise attachment of targeting moieties in predetermined amounts and orientations. This precision can be realized by introducing various modifications to the LNPs, such as the incorporation of protein fragments, antibodies, or nucleic acids (see, e.g., FIG. 8). Such modifications allow for interactions with any complementary moiety, provided that the targeting moiety has the required interacting group. Exemplary functionalization of the hybrid nanoparticles include targeting moieties such as an antibody (e.g., an anti CD5 antibody for targeting CD5 positive cells, showing accumulation of the nanoparticles in the lymph nodes) as well as a protein (e.g., a Spike protein targeting ACE2 positive cells, showing accumulation of the nanoparticles in the lung). Moreover, through modifications of the hybrid nanoparticle composition, the physical properties (e.g., the zeta potential) can be adjusted, which can subsequently influence the protein corona that envelops the LNPs in human or animal serum, leading to altered biodistribution profiles when comparing modified LNPs to their unmodified counterparts (see, e.g., FIG. 3-FIG. 7). As an additional showcase, accumulation of modified LNP particles in the lungs is observed upon introducing negatively charged functionalization.

[0068] The hybrid nanoparticles of the present invention, even those involving DNA origami structures ("Full- Lipigami"), are contemplated as having low immunogenicity. Since the Lipigami structure enables clear detargeting of vital organs (e.g., liver), as shown in the examples, it may be considered to have lower dose dependent toxicity. Additionally, as the hybridization method of the invention does not require traditional chemical coupling (exemplified but not limited to Maleimide and click chemistry coupling), it will have a lower toxicity than shown by these methods (Zaleski et al., Adv. Matter, 2025, 37(5): e2409945, doi: 10.1002 / adma.202409945).

[0069] By integrating the design flexibility and multifunctionality of polynucleotide structure (e.g., as in DNA origami) with the in-vivo stability and biocompatibility of LNPs, the lipigami technology offers a promising platform for targeted drug delivery. This hybrid nanoparticle system can overcome the limitations of traditional LNPs while retaining their advantages, leading to a highly adaptable and efficient drug delivery platform.

[0070] Thus, in a particularly preferred embodiment, the hybrid nanoparticle of any one of claims 9-22 is provided.

[0071] Nanoparticles of the present invention can self-assemble together with the cargo. Oligonucleotide structures in the present invention serve more than a mere structural control tool; they enable precise surface modification, combining the advantages of precise oligonucleotide interactions and the lipid nanoparticles. With the present invention, it is contemplated that better enzymatic stability, better oligonucleotide encapsulation, prolonged stability in the circulation compared to DNA origami structure presented in the prior art, e.g., as in Molbay, M. et al. bioRxiv (2023).

[0072] Further, unlike prior art systems, e.g., as in Franquelim H.G., et al. the hybrid nanoparticles of the present invention provide multiple structural and functional differences and advantages.

[0073] Lipigami is designed to carry therapeutic cargo molecules which can be tailored to be transported to different regions of interests in the body with a high performance. Furthermore, Lipigami supports both active and passive targeting mechanism. As regards functionality and interaction with Membranes, lipigamis, can interact with cell membranes to be taken up by cells and deliver their cargo molecules, rather than inducing specific structural changes in the membrane. As regards immunogenicity, the present invention allows for using a relatively low surface density DNA strands, which induces reduced immunogenic effects when administered to the body. Lipigami nanoparticles achieve improved achieve a nucleic acid therapeutics loading capacity. As regards applications, lipigami nanoparticles have potential for in vivo application. While it is very likely that the origami structures of the prior art will undergo a nuclease mediated degradation, the Lipigami nanopartivles will be better protected due to their structure mainly composed of lipids. The hybrid nanoparticle of the present invention provides further differences and advantages over prior art systems, e.g., as in Oktay, E. et al. The present invention combines lipid nanoparticles with hydrophobically- modified oligonucleotide strands, creating a hybrid structure. As regards antigen Presentation and Immune Activation, while the DNA-NP in Oktay et al. specifically target immune responses through a trimeric form of the SARS-CoV-2 RBD and CpG adjuvants to stimulate a strong and protective immune response, Lipigami is a universal LNP concept that incorporates oligonucleotide strands for functionalization with various agents (e.g., imaging, diagnostic, or cell-targeting agents) but emphasizes the hybrid nature for diverse applications beyond immunization. As regards construction and Assembly, while he DNA-NP vaccine is constructed using DNA origami techniques and the targeting moiety attachment is ensured through hybridization with free strands available at the construct, Lipigami involves the assembly of lipid nanoparticles with hydrophobically-modified polynucleotide strands, by utilizing a different assembly process that combines lipid and nucleotide components.

[0074] The present invention (full-lipigami) uses a self-assembly technique involving oligonucleotide (DNA) staples. A polynucleotide (DNA) template is used to position cargo molecules or targeting agents, not as a particle template. Additionally, as here oligonucleotide (DNA) strands are used as one of the nanoparticleforming components, they present in the particle structure even after the components that may desorb (such as PEG) dissociate during circulation.

[0075] The present invention provides further differences and advantages over prior art systems, e.g., as in Perrault and Shih. In terms of Mechanism for Stability and Immune Evasion, Perrault and Shih use mimicry of viral particles to evade immune detection and protect DNA from degradation. In contrast, Lipigami utilizes lipid nanoparticles for improved stability but primarily focuses on the functional integration of lipid and DNA components for targeted applications. In terms of Design and Assembly: Perrault and Shih wildframe DNA nanostructures encapsulated by a lipid bilayer, leveraging biological mimicry. Lipigami assembles lipid nanoparticles with hydrophobically-modified oligonucleotides, focusing on the hybrid nature for specific targeting and functionalization. In terms of Functionalization and Targeting: Perrault and Shih emphasize on the structural mimicry for protection and stability, with less focus on specific targeting functionalities. In contrast, Lipigami allows for the attachment of various targeting agents, therapeutic molecules, or diagnostic probes to the oligonucleotide strands, enabling active targeting and multifunctionality. In terms of Pharmacokinetics and Immune Response:, the particles of the present invention are designed to improve pharmacokinetics and decrease immune activation based on the virus-like structure. While incorporating lipid nanoparticles for stability, the focus of Lipigami is more on the versatility and functionality of the hybrid structure rather than specifically on pharmacokinetics or immune response modulation.

[0076] The hybrid nanoparticle of the present invention may also be used for passive targeting in vivo or ex vivo / postmortem, e.g., in targeting based on specific organ distribution and / or protein binding resulting from the nanoparticle’s physical characteristics. Preferably, this can achieved by modulating the charge (zeta potential) and / or hydrodynamic diameter of the particles, thereby inducing specific adsorption of different serum proteins. The hybrid nanoparticle may be advantageously used for active targeting in vivo or ex vivo / postmortem, e.g., by one or more targeting agents attached to further oligonucleotide strands hybridized to handles protruding from the nanoparticle, preferably wherein each targeting agent is selected an oligonucleotide, an aptamer, a peptide, an antibody, a nanobody, and a protein.

[0077] The hybrid nanoparticle may comprise cargo molecule(s), e.g., one or more therapeutic agent(s), so it may be used in therapeutic applications; or may comprise imaging agents and / or diagnostic probes, so it may be used in diagnostic and imaging applications and / or may function as bionsensors.

[0078] As mentioned above, the present invention offers, inter alia, an unique ability to precisely visualize LNPs at the cellular level in large tissues after rendering them transparent. Suitable methods for large tissue labeling, clearing and imaging (including rendering tissues transparent), and detection of nanoparticle distribution are disclosed, respectively, e.g., in Ertiirk et al., Nat. Prot., 2012, 7:1983-1995 or in international patent application published as WO 2018 / 224289 A1 , and in European patent application No. 23 166292.5, each of which is incorporated herein by reference in its entirety.

[0079] Accordingly, the uses of claims 83-88 are provided.

[0080] The hybrid nanoparticle may comprise cargo molecule(s), e.g., one or more therapeutic agent(s), so it may be used in therapeutic applications; or may comprise imaging agents and / or diagnostic probes, so it may be used in diagnostic and imaging applications and / or may function as bionsensors. The advantageous targeting properties, e.g., brought about by passive or active targeting mechanism(s), allow that hybrid nanoparticles described herein are advantageously employed for use in a method of treatment of various diseases as described in detail hereinbelow, e.g., as a medicament in a therapeutic method, or in a method of prophylactic treatment, e.g., as a vaccine or as a vaccine component. Accordingly, the medical uses of any one of claims 89-99 are provided.

[0081] Production of LNPs can require an extensive screening process to identify the stability of the product and achieve the desired structural organization. To address this, the method for screening according to claim 100 tailored to the present hybrid nanoparticles is provided.

[0082] Furthermore, there are also differences in the production process when compared with conventional LNPs: lipigami is a hybrid structure that is prepared in a simpler, more efficient manufacturing process (e.g., one- step) whereas the standard LNPs with targeting moieties generally require a second conjugation step. Furthermore, the oligonucleotide components are structurally incorporated to the lipigamis as they have cholesterol (or other major LNP component) modification, which constitutes one of the major components of the LNPs. Therefore, the method for preparing a hybrid nanoparticle according to any one of claims 101 to 108 is provided.

[0083] Definitions and abbreviations

[0084] All terms as used herein, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions for certain terms as used in the present application are as set forth below and are intended to apply uniformly throughout the description and claims unless an otherwise expressly set out definition provides a broader definition. Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word “comprise” encompasses the case of “consisting of’. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. Furthermore, the present invention covers all possible combinations of particular aspects and embodiments described herein.

[0085] In this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

[0086] If the term "about" as used in connection with a numerical value throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art. In general, such interval of accuracy is ± 15 %.

[0087] The terms "identical" or "sequence identity", in the context of two or more polypeptide or nucleic acid molecule sequences, means two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same over a specified region (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity), when compared and aligned for maximum correspondence over a comparison window, or designated region, as measured using methods known in the art. For example, a preferred algorithm suitable for determining percent sequence identity is the BLAST algorithm, described in Altschul et al., 1990. J Mol Biol. 215:403.

[0088] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form.

[0089] Numeric ranges are inclusive of the numbers defining the range. The headings provided herein are not limitations of the various aspects or embodiments of the disclosure.

[0090] The following abbreviations are used throughout the description:

[0091] Nucleic acids

[0092] The term "nucleic acid" as used herein, is a single or double stranded covalently-linked sequence of nucleotides in which the 3’ and 5’ ends on each nucleotide are joined by phosphodiester bonds. Sizes of nucleic acids, also referred to herein as "polynucleotides" or "oligonucleotides" are typically expressed as the number of base pairs (bp) for double stranded polynucleotides, or in the case of single stranded polynucleotides as the number of nucleotides (nt). One thousand bp or nt equal a kilobase (kb). Polynucleotides of less than around 100 nucleotides in length are typically called "oligonucleotides".

[0093] The polynucleotide or oligonucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. Nucleic acids may include DNA and RNA, and are typically manufactured synthetically, but may also be isolated from natural sources. Nucleic acids may further include modified DNA or RNA, for example DNA or RNA that has been methylated or that has been subject to chemical modification, for example 5’- capping with 7-methylguanosine, 3’-processing such as cleavage and polyadenylation, and splicing, or labelling with fluorophores or other compounds. Nucleic acids may also include synthetic nucleic acids (XNA), such as hexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), threose nucleic acid (TNA), glycerol nucleic acid (GNA), locked nucleic acid (LNA) and peptide nucleic acid (PNA).

[0094] Hence, where the terms "DNA" and "RNA" are used herein it should be understood that these terms are not limited to only include naturally occurring nucleotides.

[0095] As used herein, the terms 3' ("3 prime") and 5' ("5 prime") take their usual meanings in the art, i.e., to distinguish the ends of polynucleotides or oligonucleotides. A polynucleotide or oligonucleotide has a 5’ and a 3’ end and polynucleotide or oligonucleotide sequences are conventionally written in a 5’ to 3’ direction. The term "complements of a polynucleotide or oligonucleotide molecule" denotes a polynucleotide or oligonucleotide molecule having a complementary base sequence and reverse orientation as compared to a reference sequence.

[0096] The term "duplex" is used herein refers to double-stranded DNA, meaning that the nucleotides of two complimentary DNA sequences have bonded together and then coiled to form a double helix.

[0097] Lipid nanoparticles

[0098] "Lipid nanoparticles" (LNPs) are nanoparticles comprising, i.e., principally composed of, lipids. Lipid nanoparticles typically comprise a lipid shell (frequently referred to as a lipid membrane) and a hydrophobic or hydrophilic core. The lipid membrane or shell may be a lipid monolayer or a lipid bilayer.

[0099] A "nanoparticle" is usually defined as a particle of matter that is between 1 and 100 nanometers (nm) in diameter.

[0100] Lipids

[0101] The term "lipids" as defined herein relates to fatty acids and their derivatives (including tri-, di-, monoglycerides, and phospholipids), as well as sterol-containing metabolites such as cholesterol.

[0102] More specifically, "Lipids" are a broad group of organic compounds which include fats, waxes, sterols, fatsoluble vitamins (such as vitamins A, D, E and K), monoglycerides, diglycerides, phospholipids, and others. The physiological functions of lipids include storing energy, signaling, and acting as structural components of cell membranes. In the context of the present invention, lipids are of primary importance in the construction of lipid nanoparticles and hydrophobic moiety anchors according to the invention. Lipid nanoparticles according to the present invention typically comprise one or more lipids selected from an ionizable lipid, a structural lipid, a membrane modulating lipid, a surface lipid, and mixtures of two or more thereof.

[0103] "Ionizable lipids" are a class of lipid molecules which remain neutral at physiological pH. They may be protonated at low pH, making them positively charged ('cationic lipids'"), or deprotonated at high pH, making them negatively charged 'anionic lipids"). As further elaborated hereinbelow, examples of ionizable lipids are Dlin-MC3-DMA, ALC-0315, Lipid H (SM-102), BAME-016B and A2-lso5-2DC18. In the context of the present invention and as shown below, Dlin-MC3-DMA is the most preferred ionizable lipid in the lipid nanoparticle.

[0104] In the context of lipid nanoparticles of the present invention, "structural lipids" as commonly understood in the art. Preferably, they belong to the group of phospholipids. Phospholipids can be subdivided into neutral phospholipids or zwitterionic phospholipids. For instance, common structural lipids are those of the group of glycerophospholipids: phosphatidylcholine (PtdCho), phosphatidylethanolamine (PtdEtn), phosphatidylserine (PtdSer), phosphatidylinositol (Ptdlns) and phosphatidic acid (PA). Preferred examples of structural lipids particularly useful in the present invention are distearoylphosphatidylcholine (DSPC) and dioleoylphosphatidylethanolamine (DOPE).

[0105] In the context of lipid nanoparticles of the present invention, "membrane modulating lipids" are suitable to affect the physical properties of the lipid membrane. For example, membrane modulating lipids may alter the stability of the membrane. In the context of the present invention, membrane modulating lipids preferably belong to the class or steroids, preferably the subgroup of sterols. Examples of membrane modulating lipids are cholesterol, DC-cholesterol, B-sitosterol and BHEM-cholesterol.

[0106] In the context of lipid nanoparticles of the present invention, "surface lipids" refer to PEG-containing lipids. Examples of surface lipids are PEG2000-DMG, DME-PEG2000-Maleimide, PEG2000-DSG

[0107] Additionally, the lipid nanoparticles may also comprise any further lipids known to the skilled person.

[0108] Further lipids which may be comprised in the lipid nanoparticles of the present invention are: ionizable lipids, in particular cationic lipids, for example, selected from 4-(dimethylamino)-butanoic acid, (10Z,13Z)-1-(9Z,12Z)-9,12-octadecadien-1-yl-10,13-nonadecadien-1-yl ester (Dlin-MC3-DMA), [(4-Hydroxybutyl)azanediyl]di(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315),

[0109] 9-Heptadecanyl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate or 1 -Octylnonyl 8-[(2- hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino]octanoate (Lipid H; SM-102), bis(2-(dodecyldisulfaneyl)ethyl) 3,3'-((3-methyl-9-oxo-10-oxa-13,14-dithia-3,6- diazahexacosyl)azanediyl)dipropionate (BAME-016B),

[0110] 1 H-lmidazole-2-carboxylic acid, 5,5-di-(8Z)-8-heptadecen-1-yl-2,5-dihydro-1-[3-(1-pyrrolidinyl)propyl]-, ethyl ester (A2-lso5-2DC18),

[0111] N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(1-(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3- dioleyloxy)propylamine (DODMA), 1 ,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1 ,2- Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1 ,2-Dilinoleylcarbamoyloxy-3- dimethylaminopropane (DLin-C-DAP), 1 ,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC),

[0112] 1 .2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1 ,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP),

[0113] 1 .2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3- dimethylaminopropane (DLin-2-DMAP), 1 ,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin- TMA.CI), 1 ,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.CI), 1 ,2-Dilinoleyloxy-3-(N- methylpiperazino)propane (DLin-MPZ), 3-(N,N-Dilinoleylamino)-1 ,2-propanediol (DLinAP), 3-(N,N- Dioleylamino)-1 ,2-propanedio (DOAP), 1 ,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin- EG-DMA), l,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4- dimethylaminomethyl-[1 ,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2- di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1 ,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1 ,1 '-(2-(4-(2- ((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1- yl)ethylazanediyl)didodecan-2-ol (Tech G1), and mixtures of two or more thereof; structural lipids, for example, selected from distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), 1 ,2-dioleoyl-sn-glycero-3- phosphoethanolamine or dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl- phosphatidylethanolamine 4-(N- maleimidomethyl)-cyclohexane-l- carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-0- monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, 1-stearoyl-2-oleoyl- phosphatidyethanolamine (SOPE), and mixtures of two or more thereof; membrane modulating lipids, for example, selected from cholesterol, DC-cholesterol, p-sitosterol, BHEM- cholesterol, and mixtures of two or more thereof; and surface lipids, for example, selected from polyethyleneglycol (PEG)-containing lipids including, without limitation, lipids selected from PEG2000-DMG, PEG2000-DSG, DME-PEG200-maleimide, and DMG- PEGnwherein n a number average number of EO units and is 12 to 45, PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG- DAA conjugate may be, for example, a PEG-dilauryloxypropyl (C12), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (C16), a PEG- distearyloxypropyl (C18) , and mixtures of two or more thereof;

[0114] Preferentially, the lipid nanoparticle comprises one or more lipids selected from an ionizable lipid, a structural lipid, a membrane modulating lipid, a surface lipid, and mixtures of two or more thereof as shown in Table 1 below.

[0115] Hydrophobic moieties

[0116] In an embodiment, the hybrid nanoparticle comprises one or more hydrophobically-modified oligonucleotide strands, each comprising a oligonucleotide strand covalently attached to a hydrophobic moiety. These hydrophobically modified oligonucleotide strands are also referred to as "handles" in the context of the present invention. However, a hydrophobic moiety as described herein may also be covalently attached to one or more of the staple strands as described herein.

[0117] able 1. Preferred lipids for the lipid nanoparticle of the invention.

[0118]

[0119] As used herein, the term "hydrophobically-modified" relates to the modification (joining, bonding or otherwise linking) of a polynucleotide strand with one or more hydrophobic moieties.

[0120] A "hydrophobic moiety" as defined herein is a hydrophobic organic molecule. The hydrophobic moiety may be any moiety comprising non-polar or low polarity aliphatic, aliphatic-aromatic or aromatic chains. Suitably, the hydrophobic moieties utilized in the present invention encompass molecules such as long chain carbocyclic molecules, polymers, block co-polymers, and lipids.

[0121] The hydrophobic moieties comprised within the embodiments of the present invention are capable of forming non-covalent attractive interactions with the lipid nanoparticles as described above. For example, the hydrophobic moieties may act as membrane anchors for oligonucleotides or an origami structure.

[0122] In an embodiment, the at least one hydrophobic moiety comprises a lipid.

[0123] Suitably, the lipid may be selected from the group consisting of: sterols; alkylated phenols; flavones; saturated and unsaturated fatty acids; and synthetic lipid molecules including dodecyl-beta-D-glucoside. Typically, the sterols may be selected from the group consisting of: cholesterol; derivatives of cholesterol; phytosterol; ergosterol; and bile acid; the alkylated phenols are selected from the group consisting of: methylated phenols; and tocopherols; the flavones are selected from the group consisting of: flavanone containing compounds; and 6-hydroxyflavone; the saturated and unsaturated fatty acids are selected from the group consisting of: derivatives of lauric acid; oleic acid; linoleic acid; and palmitic acids; and / or the synthetic lipid molecule is dodecyl-beta-D-glucoside.

[0124] Handle-lipigami version

[0125] In this embodiment, polynucleotides and / or oligonucleotides are combined with the lipid nanoparticle by anchoring the "handles", as described above, via their hydrophobic moieties (e.g., cholesterol moieties) to the lipid nanoparticle as described above. An exemplary nanoparticle of this type is shown in FIG. 1.

[0126] The oligonucleotide strand of each handle has a length of 5 or more, preferably 5-50, more preferably 10-40, even more preferably 20-30, yet more preferably 24-28, most preferably 26 nucleotides (nt). Handles shorter than 5 nt or longer than 50 could be less advantageous in terms of LNP stability.

[0127] Preferably, the oligonucleotide strand of each handle has a GC content of 10%-100%, preferably 20%- 80%, more preferably 30%-70%, even more preferably 40%-60%, most preferably 50%, or > 10%, preferably > 20%, more preferably > 30%, even more preferably > 40%, most preferably > 50%, expressed as molar percentage based on the total number of nt in the respective oligonucleotide strand.

[0128] The oligonucleotide strand of one or more of the handles preferably hybridizes to a further oligonucleotide. As used herein and unless specified otherwise, „hybridizes“ preferably means that at least a portion of one or more of the handles staple polynucleotide strands is capable of hybridizing to the one or more portion(s) of the further polynucleotide, a portion means a discontinuous or continuous (i.e., linear) subsequence of a polynucleotide strand, and is preferably a linear sequence of consecutive nucleotides, more preferably > 4, > 5, > 10, or > 15 nucleotides.

[0129] The oligonucleotide strand of each handle is covalently attached to a hydrophobic moiety HM, i.e., either through a single covalent bond or through a short linker L (< 10 atoms long) which does not comprise a poly(oxyalkylene) or oligo(oxyalkylene), such as PEG. The linker may be O-Cioalkylene or Ci- Cioalkyleneaminocarbonyl, preferably Ci-Cealkylene or Ci-Csalkyleneaminocarbonyl, more preferably Cealkylene or Cealkyleneaminocarbonyl, wherein each of the preceding groups may be optionally substituted, preferably optionally substituted by one or more groups selected from OH, oxo, COOH, CONH2, CN, halo, Ci-ioalkyl, Ci-ioheteroalkyl, Ci-iohaloalkyl, amino, and (Ci-ioalkyl)i-3amino.

[0130] The hydrophobic moiety comprises or is a group derived by removing a H atom from a lipid; preferably, a lipid selected from the group consisting of sterols, alkylated phenols, flavones, saturated and unsaturated fatty acids, and synthetic lipid molecules; more preferably a sterol; most preferably cholesterol.

[0131] The hydrophobic moiety is preferably attached at the 3’ end of the oligonucleotide strand, more preferably via a covalently modified terminal nucleotide, most preferably via a nucleotide covalently modified with the linker L (if present) and the hydrophobic moiety at its 1 ’ position, or via a prolinol derivative at its N atom. o

[0132] Suitable linkers L include: , preferably Suitable covalently modified terminal nucleotides or prolinol derivatives may be represented by the following structures:

[0133] Such covalently modified terminal nucleotides may be introduced through standard oligonucleotide synthesis protocols. For instance, controlled pore glass deoxyoligonucleotide solid-phase synthesis may be used, involving the following precursor (CPG: controlled pore glass, DMTr: dimethoxytrityl):

[0134] The further oligonucleotide may be covalently attached to a cell-targeting agent, an imaging agent or a diagnostic probe, preferably a cell-targeting agent, more preferably selected from an oligonucleotide, an aptamer, a peptide, an antibody, a nanobody, and a protein, thereby enabling particularly specific active targeting, as exemplified in FIG. 8. Each further oligonucleotide strand may have a length of 5 or more, preferably 5-50, more preferably 10-40, even more preferably 20-30, yet more preferably 24-28, most preferably 26 nt. In a particular embodiment, the oligonucleotide strand of two or more of the handles hybridizes to two or more different oligonucleotides, each preferably attached to a different cell-targeting agent, imaging agent or diagnostic probe. Different amounts of DNA-cholesterol lead to different physicochemical characteristics, allowing to achieve advantageous targeting performance, e.g., in terms of target structure binding affinity and / or specificity / selectivity, thereby achieving improved passive targeting.

[0135] Table 2. Preferred composition of a Handle-Lipigami according to the present invention

[0136] Generally, at least one DNA base should be anchored to the lipid structure for the nanoparticle to be called Handle-Lipigami.

[0137] As illustrated in FIG. 1 or FIG. 2A, the Handle-Lipigami may encapsulate cargo.

[0138] Preferred embodiments

[0139] The volumetric ratio of the core to the lipid shell is, e.g., within the range of 1.5:1 to 6:1 , preferably 2:1 to 4:1 , more preferably 3:1. In case the encapsulated cargo is mRNA, the volumetric ratio of mRNA phase to Lipid phase is preferably kept at about 3:1 .

[0140] Preferably, the molar ratio of nitrogen atoms in the shell lipid to phosphate groups of cargo molecule(s) in the core is within the range of 1-10 : 1 , preferably 1-3 : 1 or 4-6 : 1 , more preferably 4-6 : 1.

[0141] In one preferred embodiment, the shell of the lipid nanoparticle comprises a lipid monolayer or a lipid bilayer, preferably a lipid bilayer.

[0142] In one preferred embodiment, the lipid nanoparticle comprises one or more lipids selected from an ionizable lipid, a structural lipid, a membrane modulating lipid, a surface lipid, and mixtures of two or more thereof; and / or one or more ionizable lipids, one or more structural lipids, one or more membrane modulating lipids, and one or more surface lipids or combinations thereof.

[0143] Preferably, the ionizable lipid is cationic, anionic, or a mixture thereof. More preferably, the ionizable lipid is or comprises one or more selected from: Dlin-MC3-DMA, ALC-0315, Lipid H (SM-102), BAME- 016B, A2-lso5-2DC18, and a mixture of two or more thereof. Most preferably, the ionizable lipid is or comprises at least Dlin-MC3-DMA.

[0144] Preferably, the structural lipid belongs to the class of phospholipids; preferably to the subgroups of neutral phospholipids, zwitterionic phospholipids, or mixtures thereof. More preferably, the structural lipid is or comprises one or more selected from: distearoylphosphatidylcholine (DSPC), 1 ,2-dioleoyl-sn- glycero-3-phosphoethanolamine (DOPE), and a mixture of two or more thereof. Most preferably, the structural lipid is or comprises at least DSPC.

[0145] Preferably, the membrane modulating lipid belongs to the class of steroids, more preferably the subgroup of sterols. Even more preferably, the membrane modulating lipid is or comprises one or more selected from: cholesterol, DC-cholesterol, p-sitosterol, BHEM-cholesterol, and mixtures of two or more thereof; preferably wherein the membrane modulating lipid is or comprises at least cholesterol.

[0146] Preferably, the surface lipid is or comprises a PEG-containing-lipid, more preferably selected from PEG2000-DMG, PEG2000-DSG, DME-PEG200-maleimide, and DMG-PEGnwherein n a number average number of EG units and is 12 to 45. Most preferably, the surface lipid is or comprises at least PEG2000-DMG.

[0147] In one preferred embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 5-20, preferably 7.5-15, more preferably 8-12, most preferably 10 mol-% of structural lipid(s).

[0148] In one preferred embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 5-20, preferably 7.5-15, more preferably 8-12, most preferably 10 mol-% of one or more selected from: distearoylphosphatidylcholine (DSPC), 1 ,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and a mixture thereof.

[0149] In one preferred embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 5-20, preferably 7.5-15, more preferably 8-12, most preferably 10 mol-% of distearoylphosphatidylcholine (DSPC).

[0150] In one preferred embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 0.5-5, preferably 1 .0-2.5, more preferably 1 .3- 1.8, most preferably 1.5 mol-% of surface lipid(s).

[0151] In one embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 0.5-5, preferably 1.0-2.5, more preferably 1.3-1 .8, most preferably 1.5 mol-% of a PEG-containing-lipid, preferably selected from PEG2000-DMG, PEG2000-DSG and DME-PEG200-maleimide DMG-PEGn, wherein n is 12 to 45.

[0152] In one preferred embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 0.5-5, preferably 1 .0-2.5, more preferably 1 .3- 1.8, most preferably 1.5 mol-% of PEG2000-DMG.

[0153] In one preferred embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 25-75, preferably 30-70, more preferably 40-60, most preferably 50 mol-% of ionizable lipid(s). Preferably, the ionizable lipid is cationic, anionic, or a mixture thereof.

[0154] In one embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 25-75, preferably 30-70, more preferably 40-60, most preferably 50 mol-% of Dlin-MC3-DMA, ALC-0315, Lipid H (SM-102), BAME-016B, A2-lso5-2DC18, and a mixture of two or more thereof.

[0155] In one preferred embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 25-75, preferably 30-70, more preferably 40-60, most preferably 50 mol-% of Dlin-MC3-DMA.

[0156] In one preferred embodiment, the total amount of membrane modulating lipids and the handles, is 20- 70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

[0157] In one preferred embodiment, the total amount of lipids selected from the class of steroids, preferably the subgroup of sterols, and the handles, based on the total amount of lipids in the hybrid nanoparticle, is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

[0158] In one preferred embodiment, the total amount of lipids selected from cholesterol, DC-cholesterol, p- sitosterol, BHEM-cholesterol, and mixtures of two or more thereof, and the handles is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

[0159] In one preferred embodiment, the total amount of cholesterol and the handles is 20-70, preferably 30- 60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

[0160] In one preferred embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle:

[0161] 5-20, preferably 7.5-15, more preferably 8-12, most preferably 10 mol-% of structural lipid(s);

[0162] 0.5-5, preferably 1.0-2.5, more preferably 1.3-1 .8, most preferably 1.5 mol-% of surface lipid(s);

[0163] 25-75, preferably 30-70, more preferably 40-60, most preferably 50 mol-% of ionizable lipid(s); and membrane modulating lipid(s), wherein the total amount of membrane modulating lipids and the handles is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

[0164] In one preferred embodiment, the hybrid nanoparticle comprises, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle: 5-20, preferably 7.5-15, more preferably 8-12, most preferably 10 mol-% of one or more selected from: distearoylphosphatidylcholine (DSPC), 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and a mixture thereof;

[0165] 0.5-5, preferably 1.0-2.5, more preferably 1.3-1 .8, most preferably 1.5 mol-% of a PEG-containing- lipid, preferably selected from PEG2000-DMG, PEG2000-DSG and DME-PEG200-maleimide DMG- PEGn, wherein n is 12 to 45;

[0166] 25-75, preferably 30-70, more preferably 40-60, most preferably 50 mol-% of Dlin-MC3-DMA, ALC- 0315, Lipid H (SM-102), BAME-016B, A2-lso5-2DC18, and a mixture of two or more thereof; and one or more selected from cholesterol, DC-cholesterol, p-sitosterol, BHEM-cholesterol, and mixtures of two or more thereof, wherein the total amount of cholesterol, DC-cholesterol, p-sitosterol, BHEM- cholesterol, and the handles is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

[0167] In one preferred embodiment, the molar ratio (A):(B) of (A) handles to (B) membrane modulating lipids not forming part of the hydrophobic moiety of the handles is:

[0168] (a) > 0:100 and < 100:0, preferably 10:90 to 100:0, more preferably 20:80 to 100:0, even more preferably 30:70 to 100: 0, yet more preferably 40:60 to 100:0, most preferably 50:50 to 100:0;

[0169] (b) > 0:100 and < 100:0, preferably 10:90 to 90:10, more preferably 20:80 to 80:20, even more preferably 30:70 to 70:30, yet more preferably 40:60 to 60:40, most preferably 50:50; or

[0170] (c) 5:95 to 15:85, 15:85 to 25:75, 25:75 to 35:65, 35:65 to 45:55, 45:55 to 55:45, 55:45 to 75:25 or 75:25 to 100:0; preferably 15:85 to 55:45.

[0171] In one preferred embodiment, the molar ratio (A):(B’) of (A) handles to (B’) lipids selected from the class of steroids, preferably the subgroup of sterols not forming part of the hydrophobic moiety of the handles is:

[0172] (a) > 0:100 and < 100:0, preferably 10:90 to 100:0, more preferably 20:80 to 100:0, even more preferably 30:70 to 100: 0, yet more preferably 40:60 to 100:0, most preferably 50:50 to 100:0;

[0173] (b) > 0:100 and < 100:0, preferably 10:90 to 90:10, more preferably 20:80 to 80:20, even more preferably 30:70 to 70:30, yet more preferably 40:60 to 60:40, most preferably 50:50; or

[0174] (c) 5:95 to 15:85, 15:85 to 25:75, 25:75 to 35:65, 35:65 to 45:55, 45:55 to 55:45, 55:45 to 75:25 or 75:25 to 100:0; preferably 15:85 to 55:45.

[0175] In one preferred embodiment, the molar ratio (A):(B”) of (A) handles to (B”) lipids selected from cholesterol, DC-cholesterol, p-sitosterol, BHEM-cholesterol, and mixtures of two or more thereof, not forming part of the hydrophobic moiety of the handles, is:

[0176] (a) > 0:100 and < 100:0, preferably 10:90 to 100:0, more preferably 20:80 to 100:0, even more preferably 30:70 to 100: 0, yet more preferably 40:60 to 100:0, most preferably 50:50 to 100:0;

[0177] (b) > 0:100 and < 100:0, preferably 10:90 to 90:10, more preferably 20:80 to 80:20, even more preferably 30:70 to 70:30, yet more preferably 40:60 to 60:40, most preferably 50:50; or

[0178] (c) 5:95 to 15:85, 15:85 to 25:75, 25:75 to 35:65, 35:65 to 45:55, 45:55 to 55:45, 55:45 to 75:25 or 75:25 to 100:0; preferably 15:85 to 55:45. Without wishing to be bound by theory, it is contemplated that a 100% substitution of all membrane modulating lipids, or lipids selected from the class of steroids, or lipids selected from cholesterol, DC- cholesterol, p-sitosterol, BHEM-cholesterol, and mixtures of two or more thereof, (i.e., a ratio of (A):(B), (A):(B’) or (A):(B”)) corresponding to 100:0 is less advantageous as it might be less stable. Accordingly, an optimal substitution ratio is between the two extremes, i.e., 0:100 (not according to the invention) and 100:0.

[0179] In one preferred embodiment, wherein the molar ratio (A):(B”’) of (A) handles to (B’”) cholesterol not forming part of the hydrophobic moiety of the handles is:

[0180] (a) > 0:100 and < 100:0, preferably 10:90 to 100:0, more preferably 20:80 to 100:0, even more preferably 30:70 to 100: 0, yet more preferably 40:60 to 100:0, most preferably 50:50 to 100:0;

[0181] (b) > 0:100 and < 100:0, preferably 10:90 to 90:10, more preferably 20:80 to 80:20, even more preferably 30:70 to 70:30, yet more preferably 40:60 to 60:40, most preferably 50:50; or

[0182] (c) 5:95 to 15:85, 15:85 to 25:75, 25:75 to 35:65, 35:65 to 45:55, 45:55 to 55:45, 55:45 to 75:25 or 75:25 to 100:0; preferably 15:85 to 55:45.

[0183] In one preferred embodiment, wherein the oligonucleotide strand of one or more, preferably each of the handles has a sequence comprising >20%, preferably >50%, more preferably 100% of the length of SEQ ID NO:1 and / or having >5%, preferably >20%, more preferably 100% sequence identity with SEQ ID NO:1.

[0184] In one preferred embodiment, one or more of the polynucleotide or oligonucleotide strand(s) of the scaffold strands, the staple oligonucleotide strands, the handles and the additional polynucleotide strands:

[0185] (a) comprises one or more of adenine, guanine, cytosine, thymine, uracil, a chimeric DNA base, 2-aminopurine, 5-Bromo deoxyuridine, deoxyuridine, 2,6-diaminopurine (2-Amino-dA), dideoxycytosine, 2'-O-methyl base(s), 2’-0-methoxy-ethyl base(s) and fluoro base(s); and / or

[0186] (b) has a DNA, right-handed DNA, left-handed DNA, Z-DNA, a RNA, a locked nucleic acid, or a PNA backbone.

[0187] In one preferred embodiment, the polynucleotide or oligonucleotide strand of each of the handles and the additional polynucleotide strands is DNA.

[0188] In one preferred embodiment, the one or more hydrophobic moieties of the handles and / or staples comprises a lipid; preferably wherein the lipid is selected from the group consisting of sterols, alkylated phenols, flavones, saturated and unsaturated fatty acids, and synthetic lipid molecules; more preferably wherein the hydrophobic moiety is a sterol; most preferably wherein the hydrophobic moiety is cholesterol. Manufacturing Process

[0189] The manufacturing process of the Handle-Lipigami is not particularly limited. Manufacturing of Handle- lipigamis according to the invention is further defined hereinbelow, illustrated in Example 1 and FIG. 1 , and reflected in the claims.

[0190] Generally, the synthesis of Handle-Lipigami is similar to the synthesis of LNPs. Hybrid nanoparticles are synthesized by rapid mixing technique, keeping the lipids in ethanol and the mRNA in acetate buffer. A small DNA part can be incorporated by adding it to the lipid phase. After mixing, particles self-assemble in 5 minutes. They are then purified using dialysis for 1 h / 100 pl purifying volume. The particles can then be upconcentrated, e.g., using 50k Amicon filters. The Lipigamis can be characterized afterwards (see below).

[0191] Full-lipigami version

[0192] A Full-Lipigami particle comprises a “Handle-Lipigami” structure as described above and a 2D- or 3D- polynucleotide structure in any shape. All embodiments and advantages otherwise disclosed or embodied herein for a “Handle-Lipigami” are readily combinable with and applicable to a 2D- or 3D- polynucleotide structure, to render a corresponding Full-Lipigami version of the hybrid nanoparticle.

[0193] As forthe handle-lipigamis, here too, the oligonucleotide strand of one or more of the handles preferably hybridizes to a further oligonucleotide, which, in turn, may be covalently attached to a cell-targeting agent, an imaging agent or a diagnostic probe, preferably a cell-targeting agent, more preferably selected from an oligonucleotide, an aptamer, a peptide, an antibody, a nanobody, and a protein, thereby enabling active targeting, as exemplified in FIG. 9.

[0194] In addition to the particularly good specificity of such targeting mechanism, the presence of a 2D- or 3D- polynucleotide structure can provide additional control of the nanoparticle topology and location / amount of handles, further nucleotides and cell targeting / imaging / diagnostic probe agents (“targeting moieties”), and even allow stoichiometric control of the amount of targeting moieties in the combination, and / or distance-controlled deployment of targeting moieties. This can contribute to further increasing the selectivity of the nanoparticle towards the target, while minimizing non-specific binding.

[0195] The staple sequences can be designed with the help of any suitable software known in the art, for example, "Talos". An exemplary design is described in the Examples and the corresponding sequences are included in the sequence listing including all staple sequences and the scaffold sequence. Preferably, the sequence of the staples used for future designs should align with the current design at least 30% in staple similarity.

[0196] Optionally, one or more of the staple oligonucleotide strands is covalently attached to a hydrophobic moiety, e.g., in the same manner as described above under “Handle-lipigami version” with respect to the covalent attachment of a hydrophobic moiety to a handle oligonucleotide strand. Polynucleotide structures

[0197] Two- or three-dimensional polynucleotide structures (i.e., polynucleotide nanostructures) as described above can be created using the "origami" technique. Therefore, in the context of the present invention, "origami" refers to the creation of arbitrary two- and three-dimensional shapes at the nanoscale. More specifically, the "origami" technique uses the folding of complementary polynucleotides and / or oligonucleotides as described above. The specificity of the interactions between complementary base pairs make polynucleotides and oligonucleotides as described above a useful construction material. In principle, any structure may be created through appropriate design of the base sequences. Yet more specifically, the "DNA origami" technique uses the folding of complementary DNA-based polynucleotides and / or oligonucleotides.

[0198] As used herein, the term "nanostructure" refers to a predesigned two or three dimensional molecular structure typically comprised from a biopolymer, suitably a naturally or non-naturally occurring nucleic acid, which structure has at least one dimension or an aspect of its geometry that is within the nanoscale (i.e. 10-9meters). Nanoscale structures suitably have dimensions or geometry of 40 nm to 1000 nm, preferably 80 nm to 500 nm, more preferably 100 to 250 nm.

[0199] Assembly of nucleic acid nanostructures may occur spontaneously in solution, or may require presence of additional co-factors including, but not limited to, nucleic acid scaffolds, nucleic acid aptamers, nucleic acid staples, co-enzymes, and molecular chaperones. Where desired nanostructures result from one or more predesigned spontaneously self-folding nucleic acid molecules, such as DNA, this is typically referred to as nucleic acid "origami".

[0200] The process involves the folding of a long single strand of viral DNA (typically, but not limited to, the 7,249 bp genomic DNA of M13 bacteriophage or a subsequence thereof, the "scaffold strand", or a strand according to SEQ ID NO. 2) as a “scaffold” strand, aided by multiple smaller "staple" strands (e.g., SEQ ID Nos. 3-122). These shorter strands bind the longer in various places, resulting in the formation of a pre-defined two- or three-dimensional shape.

[0201] A typical scaffold strand may be, but is not limited to, the 7,249 bp genomic DNA of M13 bacteriophage (Inovirus M13) or another bacteriophage, a subsequence thereof, a concatenation of two or more subsequences thereof, or a strand according to SEQ ID NO. 2, or has a sequence comprising >10%, preferably >30%, more preferably 100% of the length of SEQ ID NO:2 and / or having >10%, preferably >30%, more preferably 100% sequence identity with SEQ ID NO:2. For instance, a suitable subsequence of PDB Accession No. 4V5X_AA (Version 4V5X_AA, 7249 bp DNA linear, PHG 01 -MAR-2021) may comprise or consist of a sequence corresponding to nucleotides 1483 to 6018 thereof.

[0202] Typical staple strands may be, but are not limited to, strands selected from those having a sequence comprising >5%, preferably >20%, more preferably 100% of the length of one or more, preferably each of SEQ ID NO:3 to SEQ ID NO:122 to and / or having >5%, preferably >20%, more preferably 100% sequence identity with one or more, preferably each of SEQ ID NO:3 to SEQ ID NO:122.

[0203] To produce the desired shape, images are initially drawn with a raster fill of a single long DNA molecule. This design is then fed into a computer program that calculates the placement of individual staple strands. Each staple binds to a specific region of the DNA template, and thus due to Watson-Crick base pairing, the necessary sequences of all staple strands are known and displayed. The DNA is mixed, then heated and cooled. As the DNA cools, the various staples pull the long strand into the desired shape.

[0204] In an embodiment, the two- or three-dimensional polynucleotide structure comprises a plurality of staple oligonucleotide strands; and one or more, preferably one, scaffold polynucleotide strand(s), wherein each staple oligonucleotide strand hybridizes to the one or more scaffold polynucleotide strands.

[0205] In another embodiment, the two- or three-dimensional polynucleotide structure comprises plurality of staple oligonucleotide strands, wherein each staple oligonucleotide strand hybridizes to one or more of the other staple oligonucleotide strands. Preferably, ach one of at least three staple oligonucleotide strands at least partially hybridize to at least one portion of one or one of the remaining staple oligonucleotide strands to form a 2D- or 3D-Structure. In such embodiments, it is not strictly necessary to additionally provide a scaffold polynucleotide strand to form a 2D- or 3D-Structure.

[0206] Advantageously, the staple oligonucleotide strands may have, each independently, a length of 5 or more, preferably 5-500, more preferably 20-100, most preferably 22-62 nt; the scaffold oligonucleotide strands may have, each independently, a length of 500 or more, preferably 1000-60,000, more preferably 6,000-40,000, most preferably 10,000-20,000 nt.

[0207] Additionally, polynucleotide structure can be anchored to the lipid nanoparticle by means of one or more hydrophobic moieties.

[0208] One or more of the handles may hybridize to a portion ofthe one or more scaffold polynucleotide strands; and / or one or more of the staple oligonucleotide strands may be covalently attached to a hydrophobic moiety. Preferably, the hydrophobic moiety of the one or more handles hybridizing to a portion of the one or more scaffold polynucleotide strands and / or the one or more of the staple oligonucleotide strands covalently attached to a hydrophobic moiety protrude towards the inside of and anchor the polynucleotide structure to the lipid nanoparticle.

[0209] Exemplary 3D-nanostructures may comprise a Platonic solid, Archimedean solid, Johnson solid, Catalan solid, or another polyhedron. More specifically, the 3D-geometry of the nanostructure can be a tetrahedron, cube, octahedron, dodecahedron, icosahedron, cubeoctahedron, icosidodecahedron, rhombicuboctahedron, snub cube, truncated cube, truncated cuboctahedron, truncated dodecahedron, truncated icosahedron, truncated octahedron, truncated tetrahedron, gyroelongated pentahedron pyramid, triangular bipyramid, pentagonal bipyramid, gyroelongated square bipyramid, square gyrobicupola, pentagonal orthocupolarotunda, pentagonal orthobirotunda, elongated pentagonal gyrobicupola, elongated pentagonal gyrobirotunda, gyroelongated square bicupola, rhombic dodecahedron, rhombic triacontahedron, deltoidal icositetrahedron, penta icositetrahedron, triakis octahedron, disdyakis dodecahedron, triakis icosahedron, pentakis dodecahehedron, tetrakis hexahedron, triakis tetrahedron, twisted trigonal prism, heptagonal bipyramid, enneagonal trapezohedron, small stell dodecahedron, or rhombic hexecontahedron.

[0210] A 3D icosahedral shape of the polynucleotide structure is preferred. The two components can be connected via complementary staple strands protruding from the Handle-Lipigami, reaching into the interior of the outer polynucleotide structure. For additional connectivity, the inner staple strands of the 3D-polynucleotide structure (e.g., icosahedron) preferably have a cholesterol modification additionally anchoring it to the LNP.

[0211] Preferred embodiments

[0212] In one embodiment, the polynucleotide or oligonucleotide strand of each of the scaffold strands, the staple oligonucleotide strands, the handles and the additional polynucleotide strands is DNA.

[0213] In one embodiment, at least one, preferably each scaffold polynucleotide strand: has a sequence comprising >10%, preferably >30%, more preferably 100% of the length of SEQ ID NO:2 and / or having >10%, preferably >30%, more preferably 100% sequence identity with SEQ ID NO:2; and / or is linear or circular sequence(s) corresponding to the full genome, or a fragment thereof, of a bacteriophage, preferably M13 bacteriophage.

[0214] In one embodiment, the staple polynucleotide strands are selected from those having a sequence comprising >5%, preferably >20%, more preferably 100% of the length of one or more, preferably each of SEQ ID NO:3 to SEQ ID NO:122 to and / or having >5%, preferably >20%, more preferably 100% sequence identity with one or more, preferably each of SEQ ID NO:3 to SEQ ID NO:122.

[0215] Manufacturing

[0216] The manufacturing process of the Full-Lipigami is not particularly limited. Manufacturing of Handle- Lipigamis according to the invention is further defined hereinbelow, illustrated in Example 1 and FIG. 2A, and reflected in the claims. However, generally, the Handle-Lipigamis are manufactured according to the method described above. In an exemplary preparation protocol, the scaffold and staples are mixed with a staple surplus of at least 10x. The scaffold-staple mix is heated to 60-70, preferably >65°C, e.g., for 15 minutes to separate any secondary structures that might have already formed. The scaffold-staple mix is then mixed with the Handle Lipigami in a ratio of scaffold :Lipigami 1 :1 . A temperature ramp from 40°C-20°C is run, decreasing 1 °C / h. The Lipigamis can then be purified using Amicon 50K filters.

[0217] Physical Properties

[0218] Certain physical properties of the present hybrid nanoparticles can contribute to a particularly advantageous targeting performance. Hydrodynamic diameter

[0219] Handle-Lipigamis or Full-Lipigamis can have a well-defined hydrodynamic diameter, e.g., ranging from about 40 nm to about 1000 nm, preferably 80 nm to 500 nm, more preferably 100 to 250 nm, as measured by Dynamic Light Scattering (DLS) in PBS at pH = 7.4 and 25 °C..

[0220] The hydrodynamic diameter, as used herein, can be measured by Dynamic Light Scattering (DLS) in DPBS in polystyrene cuvettes at pH = 7.4 and 25 °C. A preferred measurement method is performed as follows. 1 mL of nanoparticles dispersed in DPBS (pH = 7.4) is placed in polystyrene cuvettes and then analyzed using Dynamic Light Scattering Device (DLS) at a constant temperature of 25 C. Prior to each measurement, an equilibration time of 120 s was set to ensure the thermal fluctuations do not affect the results.

[0221] Polydispersity index (PDI)

[0222] The polydispersity index (PDI), as used herein, can be measured in DPBS (pH = 7.4) in polystyrene cuvettes and analyzed using a Dynamic Light Scattering Device (DLS) at 25 °C. A preferred measurement method is performed as follows. 1 mL of LNPs dispersed in DPBS at pH = 7.4 is placed in polystyrene cuvettes and then analyzed using Dynamic Light Scattering Device (DLS) at a constant temperature of 25 C. Prior to each measurement, an equilibration time of 120 s was set to ensure the thermal fluctuations do not affect the results.

[0223] Advantageously, the polydispersity index (PDI) of the hybrid nanoparticle is less than 0.3.

[0224] Zeta potential

[0225] According to some embodiments of the aspects and embodiments herein, the Handle-Lipigamis or Full- Lipigamis advantageously have a zeta potential at pH 7.4 ranging from about + 10 preferably 0 to -20 mV, more preferably -4 to -18 mV, even more preferably -8 to -16 mV,

[0226] The zeta potential, as used herein, can be measured in PBS (pH = 7.4) in folded capillary cuvettes using a Dynamic Light Scattering device at 25 °C and quantified using the Smoluchowski approximation of the Henry equation. A preferred measurement method is performed as follows. Nanoparticles dispersed in PBS at pH = 7.4 are diluted 1 :100 using water (e.g., milli Q), and 1 mL of the diluted dispersion is placed in folded capillary cuvettes and their zeta potential is measured using Dynamic Light Scattering device at a constant temperature of 25 °C. Prior to each measurement, an equilibration time of 120 s was set to ensure the thermal fluctuations do not affect the results. Then, the zeta potential of the particles is quantified using the Smoluchowski approximation of the Henry equation. Targeting

[0227] Passive targeting

[0228] With the Handle-Lipigami or Full-Lipigami design passive targeting by modulating the charge and hydrodynamic diameter of our particles can be achieved. Since the surface charge is altered, different proteins attach in circulation and target to a different area.

[0229] Active targeting

[0230] The design of both Handle-Lipigamis and Full-Lipigamis allows for easy hybridization of any targeting moiety (e.g., antibody, peptide, aptamer, etc.) when this targeting moiety has a complementary handle sequence attached (see FIG. 8 and FIG. 9).

[0231] When antibodies are used as targeting moieties, avidity can be influenced by the exact distance between antibodies. If the antibodies are too far apart, they may not be able to form a stable interaction with the target, resulting in a weaker immune response. On the other hand, if the antibodies are too close together, they can interfere with each other's binding to the target, which can also reduce the effectiveness of the immune response. Therefore, the proper positioning of antibodies is crucial for optimal immune function. By controlling the stoichiometry and / or distance between the hybrid handles in the nanoparticles of the present invention, better control of antibody avidity can be achieved.

[0232] Tageting moiety attachment is possible through the hybridization of hydrophobically (e.g., cholesterol modified) oligonucleotide handles’ with the complementary sequences, which are covalently coupled with the targeting moieties. Conjugation of the targeting moieties to the complementary further oligonucleotide strands can be achieved by different conjugation chemistries to attach targeting molecules to the complementary sequences, e.g.,: maleimide coupling, carbodiimide coupling, CuAAC, SPAAC. Exemplary coupling strategies are shown in FIG. 10 and in Taiariol, Ludivine, et al. Chemical Reviews 2022, 122 (1), 340-384.

[0233] Further advantages in targeting applications

[0234] The unique design of the hybrid nanoparticles of the invention can provide additional advantages in the context of targeting applications, as outlined below

[0235] Targeting of multiple receptors

[0236] Some diseases or pathogens may express multiple receptors on the surface of their cells. In such cases, a stoichiometric combination of targeting moieties that can recognize and bind to different receptors can improve the specificity and efficacy of the nanoparticle.

[0237] Minimizing non-specific binding

[0238] Targeting moieties on nanoparticles can also bind to non-target cells or tissues, leading to off-target effects. A stoichiometric combination of targeting moieties can increase the selectivity of the nanoparticle towards the target, while minimizing non-specific binding. Increasing uptake

[0239] The uptake of nanoparticles by target cells can be influenced by a variety of factors, including the quantity and presentation of targeting moieties. A stoichiometric combination of targeting moieties can optimize the presentation of the moieties and increase the uptake of the nanoparticle by the target cells. Stochiometric combination of multiple targeting moieties

[0240] As described above, the specific design of hybrid nanoparticles according to the present invention allow accommodating stoichiometric combination of multiple targeting moieties (cell-targeting agents, imaging agents and / or diagnostic probe). For instance, this can be achieved by anchoring a precisely controlled amount of hydrophobically-modified oligonucleotide strands (“handles”) to the LNP, to which the desired targeting moieties conjugated to at least partially complementary further oligonucleotide (that hybridizes to the handles) are hybridized in a well-defined manner. Further improved control (stoichiometric and distance-controlled deployment) of targeting moieties can be achieved by employing a “Full-Lipigami”, as described herein.

[0241] Further advantages Further advantages provided by nanoparticles of the present invention are summarized in the below table.

[0242] Cargo

[0243] Lipid nanoparticles are conventionally used to encapsulate cargo.

[0244] Combining lipid nanoparticles with oligonucleotides and / or polynucleotides allows to pack various types of cargo, which enables, for example, delivery of multiple therapeutic agents simultaneously to the same target within one particle.

[0245] For example, in an embodiment comprising stable strands as described above, the origami staples themselves can be used themselves as therapeutic agents, using antisense oligonucleotides to prevent a specific RNA translation. Furthermore, CRISPR / Cas gene editing components can be selected as cargo molecules to be delivered by any of the described hybrid nanoparticles (Lipigamis).

[0246] Furthermore, small molecules can easily be attached to DNA moieties and therefore be encapsulated in Lipigamis as a cargo. Several small molecule drugs, such as doxorubicin, even intercalate automatically into DNA strands, making delivery of these drugs even easier with Lipigami.

[0247] Preferably, a therapeutic agent encapsulated in the lipigami nanoparticle of the present invention is one or more selected from:

[0248] (a) oligonucleotide(s), more preferably selected from mRNA, siRNA, pDNA and miRNA, most preferably mRNA;

[0249] (b) small molecule drug(s), more preferably enzyme-, protein- or receptor-interacting agents;

[0250] (c) amino acid-based components; more preferably proteins or peptides, most preferentially therapeutic peptides;

[0251] (d) stimulatory or suppressive immunomodulatory agents; more preferably known vaccine adjuvants, most preferentially compounds targeting immune pathways such as thalidomide and / or lenalidomide; and

[0252] (e) gene editing tools, more preferably CRISPR-Cas9 components, most preferably a Cas9 mRNA and a sgRNA.

[0253] Pharmaceutical compositions

[0254] The present invention further provides a pharmaceutical composition comprising hybrid nanoparticles as described herein and a pharmaceutically acceptable carrier or excipient. Compositions and formulations for administration to a subject may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients. Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome -containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and selfemulsifying semisolids.

[0255] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0256] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Suspensions (e.g., aqueous suspensions) may further contain substance(s) which increase or control the viscosity of the suspension, and / or stabilizer(s).

[0257] Applications

[0258] Lipigami particles or compositions comprising these particles can be used for a wide range of targeting applications, taking advantage of the ability to attach various targeting moieties onto the Lipigami surface. These moieties can include aptamers, antibodies, peptides, and proteins, which facilitate targeted drug delivery and increase the specificity and efficacy of the therapy.

[0259] In general, the Lipigami formulation can be employed to deliver a variety of therapeutic agents, including nucleic acids, small molecules, and proteins, to treat, prevent, or ameliorate the symptoms associated with numerous disorders related to gene expression, cellular dysfunction, or aberrant signaling pathways.

[0260] The transport of cargo and targeted deliver of hybrid nanoparticles of the invention is described in detail above.

[0261] The versatility of the Lipigami system allows for the attachment of specific targeting moieties to the nanoparticle surface, enabling precise delivery of therapeutic agents to the desired tissue or cell type. This targeted approach has the potential to minimize off-target effects and reduce the required therapeutic dosage, leading to improved safety and efficacy.

[0262] Preferably, the hybrid nanoparticle is capable of or used for providing controlled or sustained release of an encapsulated therapeutic agent; or is adapted to provide a stimulus-responsive release of the encapsulated therapeutic agent in response to a specific trigger, such as a change in pH, temperature, or presence of a specific biomolecule.

[0263] In addition to the broad range of therapeutic applications, Lipigami nanoparticles can also be employed in diagnostic and imaging applications. By conjugating imaging agents or probes to the Lipigami surface, these nanoparticles can serve as versatile platforms for molecular imaging, enabling early detection and monitoring of diseases, as well as the assessment of therapeutic responses.

[0264] Medical uses

[0265] Any of the hybrid nanoparticles described herein, or compositions comprising these particles, may be used in methods of treatment. Alternatively, the invention relates to methods of treatment comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof.

[0266] Illustrative disease states include, but are not limited to:

[0267] Genetic disorders: cystic fibrosis, hemophilia A, hemophilia B, thalassemia, muscular dystrophies (e.g., Duchenne, Becker), Hurler's disease, adenosine deaminase deficiency, and other rare genetic diseases.

[0268] Viral infections: Human immunodeficiency virus (HIV), hepatitis B and C, and emerging viral diseases.

[0269] Neurodegenerative diseases: Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, epilepsy, and other neurological disorders.

[0270] Cancer: Solid tumors, hematological malignancies, and cancer-related complications.

[0271] Metabolic disorders: Diabetes mellitus, obesity, lipid disorders, and inborn errors of metabolism, such as ornithine transcarbamylase deficiency.

[0272] Cardiovascular diseases: Atherosclerosis, coronary artery disease, heart failure, and cardiomyopathies.

[0273] Ocular disorders: Age-related macular degeneration, retinitis pigmentosa, and other retinal degenerative diseases.

[0274] Inflammatory and autoimmune disorders: Rheumatoid arthritis, inflammatory bowel disease, multiple sclerosis, and systemic lupus erythematosus.

[0275] Respiratory diseases: Asthma, chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis, and other lung disorders.

[0276] Therefore, in an embodiment of the invention, the hybrid nanoparticle described herein is for use in a method of treatment. Alternatively, in an embodiment, the invention relates to methods of treatment comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof. In a further embodiment, the invention relates to the hybrid nanoparticle of the invention for use in a method of treating, preventing or ameliorating a disorder related to gene expression, cellular dysfunction or aberrant signaling pathways. Alternatively, in an embodiment, the invention relates to methods of treating, preventing or ameliorating a disorder related to gene expression, cellular dysfunction or aberrant signaling pathways comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof.

[0277] In a further embodiment, the invention relates to the hybrid nanoparticle of the invention in a method of treating cancer. Alternatively, in an embodiment, the invention relates to methods of treating cancer comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof.

[0278] In a further embodiment, the invention relates to the hybrid nanoparticle of the invention for use in a method of gene therapy. Alternatively, in an embodiment, the invention relates to methods of gene therapy comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof.

[0279] In a further embodiment, the invention relates to the hybrid nanoparticle of the invention for use as a vaccine.

[0280] In a further embodiment, the invention relates to the hybrid nanoparticle of the invention for use in a method of treating, preventing or ameliorating a disorder selected from:

[0281] (a) genetic disorders, preferably selected from cystic fibrosis, hemophilia A, hemophilia B, thalassemia, muscular dystrophies (e.g., Duchenne, Becker), Hurler's disease, adenosine deaminase deficiency, and other rare genetic diseases;

[0282] (b) viral infections, preferably selected from Human immunodeficiency virus (HIV), hepatitis B and C, and emerging viral diseases;

[0283] (c) neurodegenerative diseases, preferably selected from Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, epilepsy, and other neurological disorders.

[0284] (d) Cancer: Solid tumors, hematological malignancies, and cancer-related complications;

[0285] (e) metabolic disorders, preferably selected from Diabetes mellitus, obesity, lipid disorders, and inborn errors of metabolism, such as ornithine transcarbamylase deficiency;

[0286] (f) cardiovascular diseases, preferably selected from Atherosclerosis, coronary artery disease, heart failure, and cardiomyopathies;

[0287] (g) ocular disorders, preferably selected from Age-related macular degeneration, retinitis pigmentosa, and retinal degenerative diseases;

[0288] (h) inflammatory and autoimmune disorders: Rheumatoid arthritis, inflammatory bowel disease, multiple sclerosis, and systemic lupus erythematosus;

[0289] (i) respiratory diseases, preferably selected from Asthma, chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis, and other lung disorders.

[0290] Alternatively, in an embodiment, the invention relates to methods of treating, preventing or ameliorating a disorder selected from: (a) genetic disorders, preferably selected from cystic fibrosis, hemophilia A, hemophilia B, thalassemia, muscular dystrophies (e.g., Duchenne, Becker), Hurler's disease, adenosine deaminase deficiency, and other rare genetic diseases;

[0291] (b) viral infections, preferably selected from Human immunodeficiency virus (HIV), hepatitis B and C, and emerging viral diseases;

[0292] (c) neurodegenerative diseases, preferably selected from Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, epilepsy, and other neurological disorders.

[0293] (d) Cancer: Solid tumors, hematological malignancies, and cancer-related complications;

[0294] (e) metabolic disorders, preferably selected from Diabetes mellitus, obesity, lipid disorders, and inborn errors of metabolism, such as ornithine transcarbamylase deficiency;

[0295] (f) cardiovascular diseases, preferably selected from Atherosclerosis, coronary artery disease, heart failure, and cardiomyopathies;

[0296] (g) ocular disorders, preferably selected from Age-related macular degeneration, retinitis pigmentosa, and retinal degenerative diseases;

[0297] (h) inflammatory and autoimmune disorders: Rheumatoid arthritis, inflammatory bowel disease, multiple sclerosis, and systemic lupus erythematosus;

[0298] (i) respiratory diseases, preferably selected from Asthma, chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis, and other lung disorders, comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof.

[0299] In another embodiment, the invention relates to the hybrid nanoparticle of the invention for use in improving the therapeutic agent's distribution, release, and / or efficacy.

[0300] In another embodiment, the invention relates to the hybrid nanoparticle of the invention for use in combination therapy method(s), involving delivering multiple therapeutic agents with different mechanisms of action to synergistically treat a disorder. Alternatively, the invention relates to combination therapy method(s), involving delivering multiple therapeutic agents with different mechanisms of action to synergistically treat a disorder comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof.

[0301] In another embodiment, the invention relates to the hybrid nanoparticles of the invention for use in tissue engineering and regenerative medicine, wherein the encapsulated therapeutic agent promotes tissue repair, regeneration, or the differentiation of stem cells. Alternatively, the invention relates to methods of tissue engineering and regenerative medicine, wherein the encapsulated therapeutic agent promotes tissue repair, regeneration, orthe differentiation of stem cells comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof.

[0302] In another embodiment, the invention relates to the hybrid nanoparticles of the invention for use in targeted delivery of therapeutic agents to the central nervous system (CNS) by crossing the blood-brain barrier. Alternatively, the invention relates to methods of targeted delivery of therapeutic agents to the central nervous system (CNS) by crossing the blood-brain barrier comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof. In another embodiment, the invention relates to the hybrid nanoparticles of the invention for use in personalized medicine by tailoring the nanoparticle composition and cell-targeting agents based on the patient's genetic, clinical, or environmental information. Alternatively, the invention relates to methods of personalized medicine by tailoring the nanoparticle composition and cell-targeting agents based on the patient's genetic, clinical, or environmental information comprising administering any of the hybrid nanoparticles of the invention to a subject in need thereof.

[0303] EXAMPLES

[0304] The present invention will be further illustrated by the following examples. The following are given by way of illustration and do not limit the scope of the invention in any way.

[0305] Example 1 : Lipigami production

[0306] (a) Handle-Lipigami

[0307] Lipigamis were generated using lipid components commercially available from Avanti Polar Lipids. The lipids were first mixed in ethanol while the model cargo molecule mRNA and / or the full DNA origami was dissolved in acetate buffer (10 mM, pH 4.5). The molar ratio of the lipid components was adjusted for DSPC:PEG2k-DMG:Dlin-MC3-DMA:Cholesterol as 10:1 .5:50:38.5. For Handle-Lipigami generation, the cholesterol component was substituted by Cholesterol-DNA at varying percentages of 10, 20, 50, and 100%. To achieve this, a custom-designed oligonucleotide (obtained from Eurofins) with a cholesterol modification at the 3’ end was used:

[0308] Lipigami handle DNA sequence (5’-3’): TCTCCTCATCCCTCCTTCCTTCTATC (SEQ ID NO. 1)

[0309] Subsequently, the ethanol and acetate phases were mixed, leading to the self-assembly of the components and the formation of Handle-Lipigami within 30 minutes. The resulting Handle-Lipigami were then dialyzed against sterile PBS (pH = 7.4) using PurALyzerMidi dialysis tubes (Sigma Aldrich). The dialysis time was adjusted to 1 hour for each 100 microliters of Lipigami. Subsequently, the resulting Lipigamis were upconcentrated using Amicon filters (MWCO: 30k or 50k), following the instructions provided by the producers. The structure of Handle-Lipigami and method as used above is illustrated in FIG. 1 and FIG. 2(1).

[0310] (b) Full-Lipigami

[0311] The staple sequences were designed with the help of “Talos”, the sequences are contained in the sequence listing and outlined in Table 3 below. The Handle-Lipigami structures are manufactured according to the previous example first. The scaffold (SEQ NO. 2) and staples (SEQ NO. 3 to 122) are mixed with a staple molar surplus of 10x.The scaffold-staple mix is heated to 65°C for 15 minutes to separate any secondary structures that might have already formed. The scaffold-staple mix is then mixed with the Handle Lipigami in a ratio of scaffold :Lipigami 1 :1. A temperature ramp from 40°C-20°C is run, decreasing 1 °C / h on a Thermocycler. The Full Lipigamis are then purified using Amicon 30K or 50K filters. The method and resulting structures are illustrated in FIG. 2(2).

[0312] Example 2: Hydrodynamic size and zeta potential measurements

[0313] The following protocol applies to both Handle Lipigamis and Full-Lipigami. The hydrodynamic size and zeta potential values of the Lipigamis were measured using a Dynamic Light Scattering device (Malvern NanoZS).

[0314] To measure the hydrodynamic size, u peon cent rated Lipigamis were diluted in a ratio of 1 :20 in PBS (pH = 7.4) and transferred to 4-clear sided polystyrene cuvettes. The intensity-based size distribution was recorded at a fixed temperature of 25 °C.

[0315] Similarly, the zeta potential of the 1 :20 diluted Lipigamis (pH = 7.4) was measured by placing them in folded capillary zeta cells. For zeta potential measurements, 1 :20 PBS diluted Lipigamis were further diluted 1 :100 using milli Q water. Measurements were performed as triplicates. FIG. 4 shows the result for Handle-Lipigami with different levels of cholesterol-modified oligonucleotides (see Example 1). The data shows how the surface charge of the Handle-Lipigamis can be fine-tuned by design. The more cholesterols are substituted with DNA-cholesterol, the higher the negativity gets.

[0316] In contrast to other potential ways of controlling the zeta potential, by using hydrophobically-modified oligonucleotide strands (“handles”), it is possible to tune the zeta potential particularly reliably and precisely, since the oligonucleotides allow for easy and well-defined control of both their amount as well as length, and thus even more finely and reliably adjust the hybrid nanoparticle’s charge.

[0317] Example 3: In vivo biodistribution assessment

[0318] For biodistribution experiments, female BALB / c or BL6 mice were used, aged 4-6 weeks. The Handle- Lipigamis were injected intravenously into the tail vein at a dose of 1 pg mRNA / animal and then were allowed to circulate in the mouse body for 1 h. Afterwards, the animals were subjected to anesthesia by intraperitoneal injection of a Ketamine-Xylazine solution and subsequently perfused intracardially with heparinized PBS. This was followed by paraformaldehyde fixation and EDTA decalcification to prepare the tissue for imaging. 41 able 3. Details of the sequences for a "Full-Lipigami" structure (stating scaffold and staple sequences to create an icosahedral shell)

[0319]

[0320]

[0321] Tissue clearing was performed using the well-established 3DISCO protocol, which has been previously published (Ertiirk et al., Nat. Prot., 2012, 7:1983-1995). In brief, the bodies of mice were placed in a 300 ml glass chamber. Within the chamber, they were incubated in 200 ml of a THF (Tetrahydrofuran, Roth, CP82.1) gradient solution prepared in distilled water. The gradient consisted of the following concentrations: 50% xi , 70% xi , 80% xi , and 100% *2. Each step in the gradient was incubated for a duration of 12 hours. Subsequently, the bodies were immersed in dichloromethane (DCM, Sigma, 270997) for 3 hours. Finally, the bodies were transferred to a BABB solution (a mixture of benzyl alcohol and benzyl benzoate in a 1 :2 v / v ratio, Sigma, 24122 and W213802) until optical transparency was achieved. All steps were performed with gentle shaking in a fume hood.

[0322] For imaging, a customized Ultramicroscope Blaze light-sheet microscope was utilized. The entire mouse body was imaged using a 4x objective lens, and image stacks were recorded for each channel of interest. Subsequently, the 2D image stacks were stitched together using a Fiji stitching plugin to create a composite image.

[0323] To generate 3D volumetric images, the stitched images were processed using Imaris converter software. The resulting volumetric images were used for visualizing the whole body as well as specific organ scans. Visualization and analysis of the images were performed using Imaris software. The resulting images for Handle-Lipigami in the presence or absence of cholesterol-modified oligonucleotides is shown in FIG. 3.

[0324] We observed liver de-targeting, a major aim of nanoparticle design (FIG. 3). Without wishing to be bound by theory, it is contemplated that this is achieved at least partially through the particular zeta potential of the hybrid nanoparticle.

[0325] To validate our hypothesis that more positively charged proteins will bind to the surface of the more negatively charged Handle-Lipigamis, the protein corona of different LNP and Handle-Lipigami species was analyzed by measuring them with a mass spectrometer. As discussed above, FIG. 4 shows the difference in charge of Handle-Lipigamis to the standard LNP. The plot clearly shows how the surface charge of the Handle-Lipigamis can be fine-tuned by design. The more cholesterols are substituted with DNA-cholesterol, the higher the negativity gets. The reason for the 100% DNA-chol outlier is probably the instability of the particle due to the DNA content that is too high to ensure LNP integrity.

[0326] Further, the protein's isoelectric points were plotted for a better comparison (FIG. 5). More negatively charged nanoparticles (20%, 50%) have a higher number of proteins with a lower isoelectric point

[0327] To further analyze differences ofthe protein corona of different Handle-Lipigamis, the 10 most abundant proteins found in each of the samples were plotted, revealing clear differences to the standard LNP formulation, but also differences between each other (FIG. 6).

[0328] Therefore, with the Lipigami formulation technique, it is possible to tune the surface charge and therefore protein corona in a very specific manner. Example 4: Protein corona assessment

[0329] Handle-Lipigamis were mixed with human serum (Sigma Aldrich) in a 1 :1 volume ratio and incubated for 15 minutes at 37 °C. The Handle-Lipigami / serum mixture was then loaded onto a 0.7 M sucrose cushion with the same volume as the mixture. Subsequently, the mixture was centrifuged at 15,300 g and 4 °C for 1 hour. After centrifugation, the supernatant was carefully removed, and the resulting pellet was washed with 1 x PBS. Following the wash, the pellet was centrifuged at 15,300 g and 4 °C for 5 minutes, and the supernatant was once again removed. After the removal of supernatant, the remaining proteins were dissolved in ice cold acetone for precipitation at -80 °C overnight, followed by centrifugation for 15 min at 4°C. Protein composition was measured with a Bruker timsTOF Pro Mass Spectrometer and afterwards analyzed using the MaxQuant software searching the human Uniprot databases (UP000005640_9606.fa, UP000005640_9606).

[0330] In FIG. 7, we show the amount of proteins common in all samples (222 proteins) next to the amount of proteins only binding to certain groups. The grey dots indicate proteins that only occur in this specific sample. In Tables 4A-E those unique proteins for the different formulations are listed.

[0331] Table 4A. Unique proteins for standard LNP

[0332]

[0333] Table 4B. Unique proteins for 10 % DNA-chol Handle-Lipigami

[0334]

[0335] Table 4C. Unique proteins for 20 % DNA-chol Handle-Lipigami

[0336] Table 4D. Unique proteins for 50 % DNA-chol Handle-Lipigami

[0337] Table 4E. Unique proteins for 100 % DNA-chol Handle-Lipigami Example 5: Hybridization of active targeting moieties

[0338] As showcases for the attachment method, a DNA aptamer (AS1411) was chosen.

[0339] The aptamer DNA sequence was ordered from Eurofins, with the hybridization sequence on the 5' end (sequence below). The hybridization of the 2 complementary DNA handles was carried out in a thermocycler in PBS or PBS+Magnesium with a temperature ramp from 37°C- 20°C, decreasing l°C / minute. A successful hybridization can be measured (l)by the increase in double stranded DNA, measured photometrically with a NanodropOne in ng / ml. And (2) by the increase in surface negativity, measured with a DLS Zetasizer, see Figure 8.

[0340] [comp_AS14115'-3']GATAGAAGGAAGGAGGGATGAGGAGA GGT GGT GGT GGT TGT GGT GGT GGT GG

[0341] REFERENCES

[0342] US8168775B2

[0343] Liang et a!., Nat. Med., 2015, 21 (3): 288-294

[0344] Wang et al., Nat. Prot., 2023, 18: 265-291

[0345] Julin et al., Angew. Chem. Int. Ed., 2021 , 60: 827

[0346] Bian et a!., Nat. Chem. Biol, 2019, 15(8): 830-837

[0347] Stewart et al. (WO / 2019 / 067999)

[0348] Prieve et al. (US20180221402)

[0349] Li et al., Nat. Commun., 2022, 13: 5561

[0350] Rothemund, Nature, 440: 297-302

[0351] Erturk et al., Nat. Prot., 2012, 7:1983-1995

[0352] Akinc et al., Nat. Nanotechnol., 2019, 14: 1084-1087

[0353] Zaleski et al., Adv. Matter, 2025, 37(5): e2409945, doi: 10.1002 / adma.202409945

Claims

CLAIMS1. A hybrid nanoparticle, comprising: one or more hydrophobically-modified oligonucleotide strands (“handles”), each comprising a oligonucleotide strand covalently attached to a hydrophobic moiety; and a lipid nanoparticle comprising one or more lipids, wherein the hydrophobic moiety anchors the handle to the lipid nanoparticle.

2. The hybrid nanoparticle of claim 1 , wherein the oligonucleotide strand of each handle has a length of 5 or more, preferably 5-50, more preferably 10-40, even more preferably 20-30, yet more preferably 24- 28, most preferably 26 nucleotides (nt).

3. The hybrid nanoparticle of any one of the preceding claims, wherein the oligonucleotide strand of each handle has a GC content of 10%-100%, preferably 20%-80%, more preferably 30%-70%, even more preferably 40%-60%, most preferably 50%; or > 10%, preferably > 20%, more preferably > 30%, even more preferably > 40%, most preferably > 50%, expressed as molar percentage based on the total number of nt in the respective oligonucleotide strand.

4. The hybrid nanoparticle of any one of the preceding claims, wherein the oligonucleotide strand of one or more of the handles hybridizes to a further oligonucleotide. As used herein and unless specified otherwise, „hybridizes“ preferably means that at least a portion of one or more of the handles staple polynucleotide strands is capable of hybridizing to the one or more portion(s) of the further polynucleotide; a portion means a discontinuous or continuous (i.e., linear) sub-sequence of a polynucleotide strand, and is preferably a linear sequence of consecutive nucleotides, more preferably > 4, > 5, > 10, or > 15 nucleotides.

5. The hybrid nanoparticle of claim 4, wherein the further oligonucleotide is covalently attached to a cell-targeting agent, an imaging agent or a diagnostic probe, preferably a cell-targeting agent.

6. The hybrid nanoparticle of claim 5, wherein the cell-targeting agent is selected from an oligonucleotide, an aptamer, a peptide, an antibody, a nanobody, and a protein.

7. The hybrid nanoparticle of any one of claims 4 to 6, wherein each further oligonucleotide strand has a length of 5 or more, preferably 5-50, more preferably 10-40, even more preferably 20-30, yet more preferably 24-28, most preferably 26 nt.

8. The hybrid nanoparticle of any one of claims 5 to 7, wherein the oligonucleotide strand of two or more of the handles hybridizes to two or more different oligonucleotides, each preferably attached to a different cell-targeting agent, imaging agent or diagnostic probe.

9. The hybrid nanoparticle of any one of the preceding claims, further comprising a two- or three- dimensional polynucleotide structure comprising: a plurality of staple oligonucleotide strands; and zero, one or more, scaffold polynucleotide strands wherein each staple oligonucleotide strand hybridizes to the one or more scaffold polynucleotide strands, if present, and / or to one or more of the other staple oligonucleotide strands, to form the polynucleotide structure. As used herein and unless specified otherwise, „hybridizes“ preferably means that at least a portion of each of the plurality of staple polynucleotide strands is capable of hybridizing to the one or more portion(s) of a scaffold polynucleotide strand to form the two- or three-dimensional structure; a portion means a discontinuous or continuous (i.e., linear) sub-sequence of a polynucleotide strand, and is preferably a linear sequence of consecutive nucleotides, more preferably > 4, > 5, > 10, or> 15 nucleotides.

10. The hybrid nanoparticle of claim 9, wherein the two- or three-dimensional polynucleotide structure comprises: a plurality of staple oligonucleotide strands; and one or more, preferably one, scaffold polynucleotide strand(s), wherein each staple oligonucleotide strand hybridizes to the one or more scaffold polynucleotide strands.11 . The hybrid nanoparticle of claim 9, wherein the two- or three-dimensional polynucleotide structure comprises: a plurality of staple oligonucleotide strands; wherein each staple oligonucleotide strand hybridizes to one or more of the other staple oligonucleotide strands.

12. The hybrid nanoparticle of any one of claims 9-11 , wherein the staple oligonucleotide strands have each independently a length of 5 or more, preferably 5-500, more preferably 20-100, most preferably 22- 62 nt.

13. The hybrid nanoparticle of any one of claims 9-12, preferably of claim 12, wherein the scaffold oligonucleotide strands have each independently a length of 500 or more, preferably 1000-60,000, more preferably 1 ,500-20,000, most preferably 4,000-8,000 nt.

14. The hybrid nanoparticle of any one of claims 9 to 13, wherein the polynucleotide structure is anchored to the lipid nanoparticle by means of one or more hydrophobic moieties.

15. The hybrid nanoparticle of any one of claims 9 to 14, wherein: one or more of the handles hybridize to a portion of the one or more scaffold polynucleotide strands; and / or one or more of the staple oligonucleotide strands is covalently attached to a hydrophobic moiety.

16. The hybrid nanoparticle of claim 15, wherein the hydrophobic moiety of the one or more handles hybridizing to a portion of the one or more scaffold polynucleotide strands and / or the one or more of the staple oligonucleotide strands covalently attached to a hydrophobic moiety protrude towards the inside of and anchor the polynucleotide structure to the lipid nanoparticle.

17. The hybrid nanoparticle of any one of claims 9 to 16, which is a polynucleotide-encapsulated nanoparticle wherein the polynucleotide structure is at least partially arranged outside the lipid nanoparticle.

18. The hybrid nanoparticle of any one of claims 9 to 17, which is a polynucleotide-encapsulated nanoparticle wherein the polynucleotide structure is at least partially arranged inside the lipid nanoparticle.

19. The hybrid nanoparticle of any one of claims 9 to 17, which is a polynucleotide-encapsulated nanoparticle wherein the oligonucleotide structure is completely arranged outside the lipid nanoparticle.

20. The hybrid nanoparticle of any one of claims 9 to 19, wherein the polynucleotide structure has a 3D-geometry of a Platonic solid, Archimedean solid, Johnson solid, Catalan solid, or another polyhedron.21 . The hybrid nanoparticle of any one of claims 9 to 20, wherein the polynucleotide structure has a 3D-geometry of a tetrahedron, cube, octahedron, dodecahedron, icosahedron, cubeoctahedron, icosidodecahedron, rhombicuboctahedron, snub cube, truncated cube, truncated cuboctahedron, truncated dodecahedron, truncated icosahedron, truncated octahedron, truncated tetrahedron, gyroelongated pentahedron pyramid, triangular bipyramid, pentagonal bipyramid, gyroelongated square bipyramid, square gyrobicupola, pentagonal orthocupolarotunda, pentagonal orthobirotunda, elongated pentagonal gyrobicupola, elongated pentagonal gyrobirotunda, gyroelongated square bicupola, rhombic dodecahedron, rhombic triacontahedron, deltoidal icositetrahedron, penta icositetrahedron, triakis octahedron, disdyakis dodecahedron, triakis icosahedron, pentakis dodecahehedron, tetrakis hexahedron, triakis tetrahedron, twisted trigonal prism, heptagonal bipyramid, enneagonal trapezohedron, small stell dodecahedron, or rhombic hexecontahedron.

22. The hybrid nanoparticle of any one of claims 9 to 21 , wherein the polynucleotide structure has a 3D-geometry of a icosahedron.

23. The hybrid nanoparticle of any one of the preceding claims, wherein the lipid nanoparticle is a lipid vesicle.

24. The hybrid nanoparticle of any one of the preceding claims, wherein the lipid nanoparticle comprises lipid shell and a hydrophobic or a hydrophilic core.

25. The hybrid nanoparticle of claim 24, wherein volumetric ratio of the core to the lipid shell is within the range of 1 .5:1 to 6:1 ; preferably 2:1 to 4:1 ; more preferably 3:1 .

26. The hybrid nanoparticle of claim 24 or 25, comprising cargo molecule(s) in the core, preferably wherein the molar ratio of nitrogen atoms in the shell lipid to phosphate groups of cargo molecule(s) in the core is within the range of 1-10 : 1 , preferably 1-3 : 1 or 4-6 : 1 , more preferably 4-6 : 1 .

27. The hybrid nanoparticle of any one of the preceding claims, wherein the shell of the lipid nanoparticle comprises a lipid monolayer or a lipid bilayer, preferably a lipid bilayer.

28. The hybrid nanoparticle of any one of the preceding claims, wherein the lipid nanoparticle comprises one or more lipids selected from an ionizable lipid, a structural lipid, a membrane modulating lipid, a surface lipid, and mixtures of two or more thereof.

29. The hybrid nanoparticle of any of the preceding claims, wherein the lipid nanoparticle comprises one or more ionizable lipids, one or more structural lipids, one or more membrane modulating lipids, and one or more surface lipids or combinations thereof.

30. The hybrid nanoparticle of claim 28 or 29, wherein the ionizable lipid is cationic, anionic, or a mixture thereof.31 . The hybrid nanoparticle of any one of claims 28-30, wherein the ionizable lipid is or comprises one or more selected from: Dlin-MC3-DMA, ALC-0315, Lipid H (SM-102), BAME-016B, A2-lso5-2DC18, and a mixture of two or more thereof; preferably wherein the ionizable lipid is or comprises at least Dlin-MC3- DMA.

32. The hybrid nanoparticle of any one of claims 28-31 , wherein the structural lipid belongs to the class of phospholipids; preferably to the subgroups of neutral phospholipids, zwitterionic phospholipids, or mixtures thereof.

33. The hybrid nanoparticle of any one of claims 28-32, wherein the structural lipid is or comprises one or more selected from: distearoylphosphatidylcholine (DSPC), 1 ,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), and a mixture of two or more thereof; preferably wherein the structural lipid is or comprises at least DSPC.

34. The hybrid nanoparticle of any one of claims 28-33, wherein the membrane modulating lipid belongs to the class of steroids, preferably the subgroup of sterols.

35. The hybrid nanoparticle of any one of claims 28-34, wherein the membrane modulating lipid is or comprises one or more selected from: cholesterol, DC-cholesterol, p-sitosterol, BHEM-cholesterol, and mixtures of two or more thereof; preferably wherein the membrane modulating lipid is or comprises at least cholesterol.

36. The hybrid nanoparticle of any one of claims 28-35, wherein the surface lipid is or comprises a PEG-containing-lipid, preferably selected from PEG2000-DMG, PEG2000-DSG, DME-PEG200-maleimide, and DMG-PEGn wherein n a number average number of EG units and is 12 to 45, more preferably wherein the surface lipid is or comprises at least PEG2000-DMG.

37. The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 5-20, preferably 7.5-15, more preferably 8- 12, most preferably 10 mol-% of structural lipid(s).

38. The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 5-20, preferably 7.5-15, more preferably 8- 12, most preferably 10 mol-% of one or more selected from: distearoylphosphatidylcholine (DSPC), 1 ,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and a mixture thereof.

39. The hybrid nanoparticle of any one of the preceding comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 5-20, preferably 7.5-15, more preferably 8-12, most preferably 10 mol-% of distearoylphosphatidylcholine (DSPC).

40. The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 0.5-5, preferably 1 .0-2.5, more preferably1.3-1 .8, most preferably 1.5 mol-% of surface lipid(s).41 . The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 0.5-5, preferably 1 .0-2.5, more preferably1.3-1 .8, most preferably 1.5 mol-% of a PEG-containing-lipid, preferably selected from PEG2000-DMG, PEG2000-DSG and DME-PEG200-maleimide DMG-PEGn, wherein n is 12 to 45.

42. The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 0.5-5, preferably 1 .0-2.5, more preferably1 .3-1 .8, most preferably 1 .5 mol-% of PEG2000-DMG.

43. The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 25-75, preferably 30-70, more preferably 40- 60, most preferably 50 mol-% of ionizable lipid(s).

44. The hybrid nanoparticle of claim 43, wherein the ionizable lipid is cationic, anionic, or a mixture thereof.

45. The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 25-75, preferably 30-70, more preferably 40-60, most preferably 50 mol-% of Dlin-MC3-DMA, ALC-0315, Lipid H (SM-102), BAME-016B, A2-lso5- 2DC18, and a mixture of two or more thereof.

46. The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle, 25-75, preferably 30-70, more preferably 40-60, most preferably 50 mol-% of Dlin-MC3-DMA.

47. The hybrid nanoparticle of any one of the preceding claims, wherein the total amount of membrane modulating lipids and the handles, is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

48. The hybrid nanoparticle of any one of the preceding claims, wherein the total amount of lipids selected from the class of steroids, preferably the subgroup of sterols, and the handles, based on the total amount of lipids in the hybrid nanoparticle, is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

49. The hybrid nanoparticle of any one of the preceding claims, wherein the total amount of lipids selected from cholesterol, DC-cholesterol, p-sitosterol, BHEM-cholesterol, and mixtures of two or more thereof, and the handles is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

50. The hybrid nanoparticle of any one of the preceding claims, wherein the total amount of cholesterol and the handles is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.51 . The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle:5-20, preferably 7.5-15, more preferably 8-12, most preferably 10 mol-% of structural lipid(s); 0.5-5, preferably 1.0-2.5, more preferably 1.3-1 .8, most preferably 1.5 mol-% of surface lipid(s); 25-75, preferably 30-70, more preferably 40-60, most preferably 50 mol-% of ionizable lipid(s); and membrane modulating lipid(s), wherein the total amount of membrane modulating lipids and the handles is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

52. The hybrid nanoparticle of any one of the preceding claims, comprising, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle:5-20, preferably 7.5-15, more preferably 8-12, most preferably 10 mol-% of one or more selected from: distearoylphosphatidylcholine (DSPC), 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and a mixture thereof;0.5-5, preferably 1.0-2.5, more preferably 1.3-1 .8, most preferably 1.5 mol-% of a PEG- containing-lipid, preferably selected from PEG2000-DMG, PEG2000-DSG and DME-PEG200-maleimide DMG-PEGn, wherein n is 12 to 45;25-75, preferably 30-70, more preferably 40-60, most preferably 50 mol-% of Dlin-MC3-DMA, ALC-0315, Lipid H (SM-102), BAME-016B, A2-lso5-2DC18, and a mixture of two or more thereof; and one or more selected from cholesterol, DC-cholesterol, p-sitosterol, BHEM-cholesterol, and mixtures of two or more thereof, wherein the total amount of cholesterol, DC-cholesterol, p-sitosterol, BHEM-cholesterol, and the handles is 20-70, preferably 30-60, more preferably 34-42, most preferably 38.5 mol-%, based on the total amount of lipids and hydrophobic moieties in the hybrid nanoparticle.

53. The hybrid nanoparticle of any one of the preceding claims, wherein the molar ratio (A):(B) of (A) handles to (B) membrane modulating lipids not forming part of the hydrophobic moiety of the handles is:(a) > 0:100 and < 100:0, preferably 10:90 to 100:0, more preferably 20:80 to 100:0, even more preferably 30:70 to 100: 0, yet more preferably 40:60 to 100:0, most preferably 50:50 to 100:0;(b) > 0:100 and < 100:0, preferably 10:90 to 90:10, more preferably 20:80 to 80:20, even more preferably 30:70 to 70:30, yet more preferably 40:60 to 60:40, most preferably 50:50; or(c) 5:95 to 15:85, 15:85 to 25:75, 25:75 to 35:65, 35:65 to 45:55, 45:55 to 55:45, 55:45 to 75:25 or 75:25 to 100:0; preferably 15:85 to 55:45.

54. The hybrid nanoparticle of any one of the preceding claims, wherein the molar ratio (A):(B’) of (A) handles to (B’) lipids selected from the class of steroids, preferably the subgroup of sterols not forming part of the hydrophobic moiety of the handles is:(a) > 0:100 and < 100:0, preferably 10:90 to 100:0, more preferably 20:80 to 100:0, even more preferably 30:70 to 100: 0, yet more preferably 40:60 to 100:0, most preferably 50:50 to 100:0;(b) > 0:100 and < 100:0, preferably 10:90 to 90:10, more preferably 20:80 to 80:20, even more preferably 30:70 to 70:30, yet more preferably 40:60 to 60:40, most preferably 50:50; or(c)5:95 to 15:85, 15:85 to 25:75, 25:75 to 35:65, 35:65 to 45:55, 45:55 to 55:45, 55:45 to 75:25 or 75:25 to 100:0; preferably 15:85 to 55:45.

55. The hybrid nanoparticle of any one of the preceding claims, wherein the molar ratio (A):(B”) of (A) handles to (B”) lipids selected from cholesterol, DC-cholesterol, p-sitosterol, BHEM-cholesterol, and mixtures of two or more thereof, not forming part of the hydrophobic moiety of the handles, is:(a) > 0:100 and < 100:0, preferably 10:90 to 100:0, more preferably 20:80 to 100:0, even more preferably 30:70 to 100: 0, yet more preferably 40:60 to 100:0, most preferably 50:50 to 100:0;(b) > 0:100 and < 100:0, preferably 10:90 to 90:10, more preferably 20:80 to 80:20, even more preferably 30:70 to 70:30, yet more preferably 40:60 to 60:40, most preferably 50:50; or(c) 5:95 to 15:85, 15:85 to 25:75, 25:75 to 35:65, 35:65 to 45:55, 45:55 to 55:45, 55:45 to 75:25 or 75:25 to 100:0; preferably 15:85 to 55:45.

56. The hybrid nanoparticle of any one of the preceding claims, wherein the molar ratio (A):(B”’) of (A) handles to (B’”) cholesterol not forming part of the hydrophobic moiety of the handles is:(a) > 0:100 and < 100:0, preferably 10:90 to 100:0, more preferably 20:80 to 100:0, even more preferably 30:70 to 100: 0, yet more preferably 40:60 to 100:0, most preferably 50:50 to 100:0;(b) > 0:100 and < 100:0, preferably 10:90 to 90:10, more preferably 20:80 to 80:20, even more preferably 30:70 to 70:30, yet more preferably 40:60 to 60:40, most preferably 50:50; or(c) 5:95 to 15:85, 15:85 to 25:75, 25:75 to 35:65, 35:65 to 45:55, 45:55 to 55:45, 55:45 to 75:25 or 75:25 to 100:0; preferably 15:85 to 55:45.

57. The hybrid nanoparticle of any one of claims 10-56, wherein the polynucleotide structure additionally comprises one or more additional polynucleotide strands, each comprising: a first polynucleotide section hybridizing to a portion of the one or more scaffold polynucleotide strands, and a second polynucleotide section not hybridizing to a portion of the one or more scaffold polynucleotide strands.

58. The hybrid nanoparticle of claim 57, wherein the first polynucleotide section of one or more the additional polynucleotide strands has a length of 5-50, 10-40, 15-30, 20-30 or 24-28 nt, preferably 26 nt.

59. The hybrid nanoparticle of claim 57 or 58, wherein the second polynucleotide section of one or more the additional polynucleotide strands has a length of 5-50, 10-40, 15-30, 20-30 or 24-28 nt, preferably 26 nt.

60. The hybrid nanoparticle of any one of claims 57-59, wherein the second polynucleotide section of the one or more additional polynucleotide strands has a GC content of 10%-90%, 20%-80%, 30%-70% or 40%-60%, preferably 50%; or > 10%, preferably > 20%, more preferably > 30%, even more preferably > 40%, most preferably > 50%, expressed as molar percentage based on the total number of nt in the respective oligonucleotide strand.61 . The hybrid nanoparticle of any one of claims 57-60, wherein the second polynucleotide section of one or more of the additional polynucleotide strands is an aptamer.

62. The hybrid nanoparticle of any one of claims 57-61 , wherein the second polynucleotide section of the one or more additional polynucleotide strand is hybridized to a further oligonucleotide as defined in any of claims 4 to 7.

63. The hybrid nanoparticle of any one of claims 57-62, wherein the second polynucleotide section of two or more of the additional polynucleotide strands hybridizes to two or more different further oligonucleotides, each preferably attached to a different cell-targeting agent, imaging agent or diagnostic probe.

64. The hybrid nanoparticle of claim of any one of claims 2-63, wherein the oligonucleotide strand of one or more, preferably each of the handles has a sequence comprising >20%, preferably >50%, more preferably 100% of the length of SEQ ID NO:1 and / or having >5%, preferably >20%, more preferably 100% sequence identity with SEQ ID NO:1 .

65. The hybrid nanoparticle of claim of any one of claims 9-64, wherein at least one, preferably each scaffold polynucleotide strand: has a sequence comprising >10%, preferably >30%, more preferably 100% of the length of SEQ ID NO:2 and / or having >10%, preferably >30%, more preferably 100% sequence identity with SEQ ID NO:2; and / or is linear or circular sequence(s) corresponding to the full genome, or a fragment thereof, of a bacteriophage, preferably M13 bacteriophage.

66. The hybrid nanoparticle of claim of any one of claims 9-65, wherein the staple polynucleotide strands are selected from those having a sequence comprising >5%, preferably >20%, more preferably 100% of the length of one or more, preferably each of SEQ ID NO:3 to SEQ ID NO:122 to and / or having >5%, preferably >20%, more preferably 100% sequence identity with one or more, preferably each of SEQ ID NO:3 to SEQ ID NO:122.

67. The hybrid nanoparticle of claim of any one of the preceding claims, wherein one or more of the polynucleotide or oligonucleotide strand(s) of the scaffold strands, the staple oligonucleotide strands, the handles and the additional polynucleotide strands:(a) comprises one or more of adenine, guanine, cytosine, thymine, uracil, a chimeric DNA base, 2- aminopurine, 5-Bromo deoxyuridine, deoxyuridine, 2,6-diaminopurine (2-Amino-dA), dideoxy-cytosine, 2'- O-methyl base(s), 2’-0-methoxy-ethyl base(s) and fluoro base(s); and / or(b) has a DNA, right-handed DNA, left-handed DNA, Z-DNA, a RNA, a locked nucleic acid, or a PNA backbone.

68. The hybrid nanoparticle of any one of the preceding claims, wherein the polynucleotide or oligonucleotide strand of each of the scaffold strands, the staple oligonucleotide strands, the handles and the additional polynucleotide strands is DNA.

69. The hybrid nanoparticle of any one of the preceding claims, wherein the one or more hydrophobic moieties of the handles and / or staples comprises a lipid; preferably wherein the lipid is selected from the group consisting of sterols, alkylated phenols, flavones, saturated and unsaturated fatty acids, and synthetic lipid molecules; more preferably wherein the hydrophobic moiety is a sterol; most preferably wherein the hydrophobic moiety is cholesterol.

70. The hybrid nanoparticle of any one of the preceding claims, wherein the hydrodynamic diameter of the hybrid nanoparticle is 40 nm to 1000 nm, preferably 80 nm to 500 nm, more preferably 100 to 250 nm, as measured by Dynamic Light Scattering (DLS) in PBS at pH = 7.4 and 25 °C.

71. The hybrid nanoparticle of claim of any one of the preceding claims, wherein the polydispersity index (PDI) of the hybrid nanoparticle is less than 0.3, e.g., as measured in DPBS (pH = 7.4) in polystyrene cuvettes and analyzed using a Dynamic Light Scattering Device (DLS) at 25 °C.

72. The hybrid nanoparticle of any one of the preceding claims, wherein the zeta potential of the hybrid nanoparticle is within the range of +10 to -30 mV, preferably 0 to -20 mV, more preferably -4 to -18 mV, even more preferably -8 to -16 mV, as measured in a folded capillary zeta cell at pH = 7.4, e.g., as measured in PBS (pH = 7.4) / water in folded capillary cuvettes using a Dynamic Light Scattering device at 25 °C and quantified using the Smoluchowski approximation of the Henry equation.

73. The hybrid nanoparticle of any one of the preceding claims, wherein the nanoparticle encapsulates a therapeutic agent, preferably wherein the therapeutic agent is one or more selected from:(a) oligonucleotide(s), more preferably selected from mRNA, siRNA, pDNA and miRNA, most preferably mRNA;(b) small molecule drug(s), more preferably enzyme-, protein- or receptor-interacting agents;(c) amino acid-based components; more preferably proteins or peptides, most preferentially therapeutic peptides;(d) stimulatory or suppressive immunomodulatory agents; more preferably known vaccine adjuvants, most preferentially compounds targeting immune pathways such as thalidomide and / or lenalidomide; and(e) gene editing tools, more preferably CRISPR-Cas9 components, most preferably a Cas9 mRNA and a sgRNA.

74. The hybrid nanoparticle of any one of the preceding claims, capable of providing controlled or sustained release of an encapsulated therapeutic agent.

75. The hybrid nanoparticle of any one of the preceding claims, adapted to provide a stimulus- responsive release of the encapsulated therapeutic agent in response to a specific trigger, such as a change in pH, temperature, or presence of a specific biomolecule.

76. The hybrid nanoparticle of any one of the preceding claims, adapted to accommodate stoichiometric combination of multiple targeting moieties, preferably cell-targeting agents.

77. The hybrid nanoparticle of any one of the preceding claims having enhanced targeting specificity and / or efficacy.

78. The hybrid nanoparticle of any one of the preceding claims having improved antibody avidity improvement.

79. The hybrid nanoparticle of any one of the preceding claims, wherein the surface charge is adjusted to create a particle with a partially positive and partially negative charge distribution, improving penetration through complex biological barriers, thereby enhancing targeted delivery and therapeutic efficacy.

80. The hybrid nanoparticle of any one of the preceding claims, adapted to encapsulate and deliver a therapeutic agent with poor solubility or bioavailability, thereby improving the pharmacokinetic properties of the agent.

81. The hybrid nanoparticle of any one of the preceding claims, arranged to encapsulate and deliver a therapeutic agent one to degradation or elimination, thereby protecting the agent from premature degradation or elimination in vivo.

82. The hybrid nanoparticle of any one of the preceding claims functioning as a biosensor.

83. The hybrid nanoparticle of any one of the preceding claims comprising an imaging agent and / or a diagnostic probe, for use in diagnostic and imaging applications.

84. The hybrid nanoparticle of any one of the preceding claims for use in passive targeting in vivo.

85. Use of the hybrid nanoparticle of any one of the preceding claims for passive targeting ex vivo or post mortem.

86. The hybrid nanoparticle for use any one of claims 84-85, wherein passive targeting is achieved by modulating the charge and / or hydrodynamic diameter of the particles, thereby inducing specific adsorption of different serum proteins.

87. The hybrid nanoparticle for use of any one of the preceding claims for use in a method involving active targeting in vivo; or use of the hybrid nanoparticle in a method involving active targeting or ex vivo or post mortem.

88. The hybrid nanoparticle for use of claim 87, wherein active targeting is achieved by one or more targeting agents attached to further oligonucleotide strands hybridized to handles protruding from the nanoparticle, preferably wherein each targeting agent is selected an oligonucleotide, an aptamer, a peptide, an antibody, a nanobody, and a protein.

89. The hybrid nanoparticle of any one of claims 1-88 for use in a method of treatment.

90. The hybrid nanoparticle of any one of claims 1-89 for use in a method of treating, preventing or ameliorating a disorder related to gene expression, cellular dysfunction or aberrant signaling pathways.

91. The hybrid nanoparticle of any one of claims 1-90 for use in a method of treating cancer.

92. The hybrid nanoparticle of any one of claims 1-91 , for use in a method of gene therapy.

93. The hybrid nanoparticle of any one of claims 1-92, for use as a vaccine or vaccine component.

94. The hybrid nanoparticle of any one of claims 1-93 for use in a method of treating, preventing or ameliorating a disorder selected from:(a) genetic disorders, preferably selected from cystic fibrosis, hemophilia A, hemophilia B, thalassemia, muscular dystrophies (e.g., Duchenne, Becker), Hurler's disease, adenosine deaminase deficiency, and other rare genetic diseases;(b) viral infections, preferably selected from Human immunodeficiency virus (HIV), hepatitis B and C, and emerging viral diseases;(c) neurodegenerative diseases, preferably selected from Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, epilepsy, and other neurological disorders;(d) cancer, preferably selected from solid tumors, hematological malignancies, and cancer-related complications;(e) metabolic disorders, preferably selected from Diabetes mellitus, obesity, lipid disorders, and inborn errors of metabolism, such as ornithine transcarbamylase deficiency;(f) cardiovascular diseases, preferably selected from Atherosclerosis, coronary artery disease, heart failure, and cardiomyopathies;(g) ocular disorders, preferably selected from Age-related macular degeneration, retinitis pigmentosa, and retinal degenerative diseases;(h) inflammatory and autoimmune disorders: Rheumatoid arthritis, inflammatory bowel disease, multiple sclerosis, and systemic lupus erythematosus; and(i) respiratory diseases, preferably selected from Asthma, chronic obstructive pulmonary disease (COPD), idiopathic pulmonary fibrosis, and other lung disorders.

95. The hybrid nanoparticle of any one of clams 1-94 for use in improving a therapeutic agent's distribution, release, and / or efficacy upon administration to a subject.

96. The hybrid nanoparticle of any one of claims 1-95, for use in combination therapy, delivering multiple therapeutic agents with different mechanisms of action to synergistically treat a disorder.

97. The hybrid nanoparticle of any one of claims 1-96, for use in tissue engineering and regenerative medicine, wherein the encapsulated therapeutic agent promotes tissue repair, regeneration, or the differentiation of stem cells.

98. The hybrid nanoparticle of any one of claims 1-97, for use in targeted delivery of one or more therapeutic agents to the central nervous system (CNS) by crossing the blood-brain barrier.

99. The hybrid nanoparticle of any one of claims 1-98, for use in personalized medicine by tailoring the nanoparticle composition and cell-targeting agents based on the patient's genetic, clinical, or environmental information.

100. A method for screening the efficacy of hybrid nanoparticles of any of claims 1-99, comprising the steps of: synthesizing a library of hybrid nanoparticles with varying polynucleotide structures, lipid compositions, and cell-targeting agents; testing the hybrid nanoparticles for their cellular uptake, specificity, and therapeutic efficacy in vitro and / or in vivo; and selecting the optimal hybrid nanoparticle for a specific application based on the screening results.

101. A method for preparing a hybrid nanoparticle, comprising the steps of steps (A) and (B):(A) preparing one or more hydrophobically-modified polynucleotide strands comprising a polynucleotide strand covalently attached to a hydrophobic moiety;(B) assembling a lipid nanoparticle comprising one or more lipids and the one or more hydrophobically-modified polynucleotide strands.

102. The method of synthesizing a hybrid nanoparticle of claim 99, additionally comprising step (C):(C) assembling a two- or three-dimensional polynucleotide structure, comprising the sub-steps of:1) synthesizing and purifying the one or more scaffold polynucleotide strand; a plurality of staple polynucleotide strands; and2) hybridizing each of the plurality of staple polynucleotide strands and the one or more hydrophobically-modified polynucleotide strand to the one or more scaffold polynucleotide strand to form a three-dimensional structure.

103. The method of claim 102, wherein steps (A) and (B) are executed before step (C), or wherein steps (A), (B) and (C) are executed at least partially concomitantly.

104. The method of claim 102 or 103, wherein sub-step 1) additionally comprises a step preparing one or more additional polynucleotide strands, and sub-step 2) additionally comprises a step of hybridizing one or more additional polynucleotide strands to the scaffold polynucleotide strand.

105. The method of claim 104, wherein the one or more additional polynucleotide strands comprise a first polynucleotide section that hybridizes to a portion of the one or more scaffold polynucleotide strands and a second polynucleotide section that does not hybridize to a portion of the one or more scaffold polynucleotide strand.

106. The method of any one of claims 101-105, wherein step B) comprises assembly of a lipid vesicle.

107. The method of any one of claims 101-106, wherein the method additionally comprises a step of hybridizing the one or more further polynucleotide to the one or more second polynucleotide section of the one or more additional polynucleotide strand, optionally wherein any of the least one further polynucleotide strands is covalently attached to a cell-targeting agent, optionally wherein the cell-targeting agent is selected from an oligonucleotide, a peptide, an antibody a nanobody or a protein.

108. The method of any one of claims 101-107, wherein the method produces a hybrid nanoparticle of any one of claims 1-99.

Images