Highly specific primers and a probe for PCR-based assay for detection of candida auris

Abstract

This application relates to nucleic acids, reagents and methods for detecting C. auris in a sample from a subject.

Description

[0001] HIGHLY SPECIFIC PRIMERS AND A PROBE FOR PCR-BASED ASSAY FOR DETECTION OF CANDIDA AURIS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application is entitled to priority pursuant to 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 572,987, filed on April 2, 2024. The content of the application is incorporated herein by reference in its entirety.

[0004] GOVERNMENT INTERESTS

[0005] This invention was made with government support under Grant No. 1R01AI148437-01 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0006] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0007] The contents of the electronic sequence listing (096738.00797SeqList.xml; Size: 7,720 bytes; and Date of Creation: February 27, 2025) is herein incorporated by reference in its entirety.

[0008] FIELD OF THE INVENTION

[0009] This invention relates to methods, nucleic acids, and reagents for detecting C. auris in a sample.

[0010] BACKGROUND OF THE INVENTION

[0011] Candida auris (C. auris) is an emerging multi drug-resistant fungal pathogen and is considered a serious threat to global health. This often multi drug resistant (MDR) fungal pathogen although primarily a skin colonizer can cause bloodstream infections, leading to a crude mortality rate of 30-40% and is the first fungal pathogen that the CDC has classified as an “urgent threat.” The World Health Organization (WHO) also declared antibiotic resistant (AR) fungal pathogens as major public health threats. The COVID-19 pandemic has also been associated with a further surge in the number of C. auris cases in the US and worldwide, with clinical cases increasing from 478 (2019) to 2377 cases in 2022 in the United States alone.

[0012] There are five different clades of C. auris, which were originally classified based on their geographical distribution: the South Asian Clade (clade I), the East Asian Clade (clade II), the South African Clade (clade III), the South American Clade (clade IV) and Iranian Clade (lade V). However, C. auris clades are now reported on all continents except Antarctica. Clade I has the highest reported rate of MDR including isolates resistant to both azoles and amphotericin B, and isolates that are pan-resistant; Clade II isolates are often drug susceptible, whereas Clade III are most often resistant to azoles; Clade IV isolates carry the highest percentage of echinocandin resistance. Clades I, III, and IV include the MDR strains most often associated with hospital infections and outbreaks and are the clades responsible for most cases of candidemia and associated mortality. Strains belonging to Clades II and V commonly cause ear infections and rarely cause bloodborne infections and outbreaks.

[0013] Routine testing for C. auris could help guide treatment of febrile persons known to have been previously colonized. Given the high potential of C. auris for colonization and nosocomial spread, there remains a need to develop a rapid test to detect this pathogen on human environmental surfaces.

[0014] SUMMARY OF INVENTION

[0015] The invention described herein relates to molecular beacon probes, and methods of using the molecular beacon probes to detect C. auris in a biological sample or on a solid surface (e.g., those found in a hospital setting). In one aspect, provided is a method for detecting Candida auris in a sample. In some embodiments, the method comprises: amplifying a nucleic acid containing an ITS2-26s region in the sample with one or more primer pairs to obtain one or more amplicons, wherein each of the one or more primer pairs comprises a forward primer and a reverse primer, wherein the one or more primer pairs is each specific for a target region of the ITS2-26s region, and wherein the one or more amplicons respectively correspond to one or more target regions of the ITS2-26s region; contacting the one or more amplicons with one or more probes under a condition conducive to a hybridization reaction to form one or more probe-amplicon hybrids; determining the presence of a signal from the one or more probe-amplicon hybrids; and determining the presence of the signal from the one or more probe-amplicon hybrids as indicia of the presence of Candida auris in the sample. In one embodiment, the method is performed in time to positivity (TTP) of less than one hour.

[0016] In some embodiments, the one or more probes comprise a probe having a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence of SEQ ID NOs: 3 or 4, or having a nucleotide sequence of SEQ ID NO: 3 or 4.

[0017] In one embodiment, the one or more probes include one or more labels. In one embodiment, the one or more labels comprise at least one of a fluorophore and a quencher. In one embodiment, the one or more labels are located internally or at a terminus of the one or more probes. In some embodiments, the fluorophore is selected from Quasar 570, Hydroxycoumarin, Alexa fluor, Aminocoumarin, Methoxycoumarin, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer yellow, Alexa fluor 430, NBD, R-Phycoerythrin (PE), PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP, Cy2, TruRed, FluorX, Fluorescein, FAM, BODIPY-FL, TET, Alexa fluor 532, HEX, TRITC, Cy3, TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X-Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5 581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates, Cy5, Alexa fluor 660, Cy5.5, LC red 705, Alexa fluor 680, and Cy7. In some embodiments, the quencher is selected from BHQ-1, BHQ2, BHQ3, DDQ-I, Dabcyl, Eclipse, Iowa Black FQ, QSY-7, DDQ-II, Iowa Black RQ, and QSY-21.

[0018] In some embodiments, the one or more primer pairs comprise a primer having a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence of SEQ ID NOs: 1-2, or having a nucleotide sequence of SEQ ID NOs: 1-2.

[0019] In one embodiment, the nucleic acid is amplified by real-time PCR. In one embodiment, the step of amplifying is performed by a PCR comprising: initial denaturation at 95 °C for 1 minute, 45 cycles, denaturation at 95 °C for 10 seconds, annealing at 62 °C for 25 seconds, and extension at 72 °C for 15 seconds.

[0020] In one embodiment, the sample is a biological sample isolated from a patient. In one embodiment, the sample is collected from the solid surface of an object.

[0021] In one embodiment, the nucleic acid is a genomic DNA.

[0022] In one embodiment, the ITS2 region comprises nucleotides spanning from 238 to 330 of a ITS2 gene of the Candida auris. In one embodiment, the method is performed on a cartridge system that integrates sample processing and PCR amplification.

[0023] In one aspect, provided is a kit for detecting Candida auris in a sample, comprising one or more probes comprise a probe having a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence of SEQ ID NOs: 3 or 4, or having a nucleotide sequence of SEQ ID NO: 3 or 4.

[0024] BRIEF DESCRIPTION OF THE DRAWINGS

[0025] FIG. 1 depicts C. auris surveillance assay (CASA) primers and probe location on the reference sequence NR_154998 (SEQ ID NO: 5) and the location of published assays. Annotation on the NR 154998 reference sequence indicates bases <1..83=ITS1; 84..237=5.8s rRNA; 238..320 =ITS2; 321. >359 = 28S rRNA. CASA assay primers are indicated in highlighted sequences. ASA- ITS2-R (311-330) =reverse primer. Published CDC / Leach et al. (Leach L. et al. 2018. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples. J Clin Microbiol 56) primer sequences CAURF (159-178) and CAURR (274-293) are underlined in grey and Kordalewska et al. (Kordalewska et al. 2017. Rapid and Accurate Molecular Identification of the Emerging Multi drug-Resistant Pathogen Candida auris. Journal of Clinical Microbiology 55:2445-2452) primer sequences CauF (186-205) and CauR (322-347) are underlined in black.

[0026] FIGS. 2A and 2B are graphs of the cycle threshold (CT) values for the C. auris surveillance assay using EvaGreen® in LC480. FIG. 2A shows the optimization of Mg++. FIG. 2B shows the primer concentrations at the indicated annealing temperatures (z.e., 60 °C, 65 °C, and 68 °C).

[0027] FIGS. 3A and 3B are graphs of the C. auris surveillance assay limit of detection (LoD) in Roche LC480 (LightCycler® 480) with genomic DNA from a non-aggregative strain and an aggregative strain of C. auris. FIG. 3A depicts the results from a representative non-aggregative strain, AR0388. FIG. 3B depicts the results from a representative aggregative strain, AR0382. DETAILED DESCRIPTION OE THE INVENTION

[0028] The disclosure described herein relates to molecular beacon probes, and methods of using the molecular beacon probes to detect C. miris in a biological sample or on a solid surface (e.g., those found in a hospital setting). The molecular beacon probes disclosed herein provide advantages over existing methods of detecting C. auris as they are suitable for rapid point-of-care testing, routine surveillance, and preventing further colonization and outbreaks in acute and chronic healthcare settings. Notably, the molecular beacon probes are highly specific, sensitive, and enable an assay time to positive (TTP) in less than one hour. The molecular beacon probes described herein are used in a PCR assay such as real-time PCR (RT-PCR).

[0029] Methods for Detecting C. auris

[0030] In one aspect, this disclosure provides a method of detecting Candida auris in a sample. In some embodiments, the method comprises: (a) amplifying a nucleic acid containing an ITS2-26s region in the sample with one or more primer pairs to obtain one or more amplicons, wherein each of the one or more primer pairs comprises a forward primer and a reverse primer, wherein the one or more primer pairs is each specific for a target region of the ITS2-26s region, and wherein the one or more amplicons respectively correspond to one or more target regions of the ITS2-26s region; (b) contacting the one or more amplicons with one or more probes under a condition conducive to a hybridization reaction to form one or more probe-amplicon hybrids; (c) determining the presence of a signal from the one or more probe-amplicon hybrids; and (d) determining the presence of the signal from the one or more probe-amplicon hybrids as indicia of the presence of Candida auris in the sample.

[0031] In one embodiment, the molecular beacon probes and primers described herein are used in a method of early detection of C. auris.

[0032] In one embodiment, the molecular beacon probes and primers described herein are used to quantify the pathogen load of C. auris to monitor the effectiveness of treatment and infection control interventions. In one embodiment, the molecular beacon probes and primers described herein are used for routine surveillance and screening of patients, particularly those at high risk, such as those in intensive care units or with a history of prolonged antibiotic use.

[0033] In one embodiment, the molecular beacon probes and primers described herein are used during an outbreak of C. auris in a healthcare facility. In particular, RT-PCR can be used to quickly assess the extent of the spread and to monitor the effectiveness of control measures.

[0034] In one embodiment, the molecular beacon probes and primers described herein are used for RT-PCR according to the PCR cycling conditions in Table 2.

[0035] As used herein, the term “subject” refers to any organism having a genome, such as a living animal, e.g., a mammal, which has been the object of diagnosis, treatment, observation or experiment. Examples of a subject can be a human, a livestock animal (beef and dairy cattle, sheep, poultry, swine, etc.), or a companion animal (dogs, cats, horses, etc.).

[0036] As used herein, a “sample” refers to any biological fluid or tissue obtained from an organism (e.g., patient), or a microorganism (e.g., bacteria, virus or fungi) or from components (e.g., blood) of an organism. The sample may be of any biological tissue, cell(s) or fluid. The sample may be a “clinical sample,” which is a sample derived from a subject, such as a human patient or veterinary subject, which may or may not contain an infectious microorganism (bacteria, virus or fungi) . Useful biological samples include, without limitation, whole blood, saliva, urine, synovial fluid, bone marrow, cerebrospinal fluid, vaginal mucus, cervical mucus, nasal secretions, sputum, semen, amniotic fluid, bronchoalveolar lavage fluid, and other cellular exudates from a patient or subject. Such samples may further be diluted with saline, buffer or a physiologically acceptable diluent. Alternatively, such samples are concentrated by conventional means. Biological samples may also include sections of tissues, such as frozen sections taken for histological purposes. A biological sample may also be referred to as a “patient sample.” A biological sample may also include a substantially purified or isolated protein, membrane preparation, or cell culture.

[0037] As used herein, a “target region,” “target nucleic acid sequence,” or “target sequence” refers to a specific sequence that may include all or part of the sequence of a single- stranded nucleic acid. A target sequence may be within a nucleic acid template or within the genome of a cell, which may be any form of single-stranded or double-stranded nucleic acid. A template may be a purified or isolated nucleic acid, or may be non-purified or non-isolated.

[0038] As used herein, the terms "polynucleotide", "nucleotide sequence" or "nucleic acid" refer to a polymer composed of a multiplicity of nucleotide units (ribonucleotide or deoxyribonucleotide or related structural variants) linked via phosphodiester bonds, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA. Examples of a nucleic acid include and are not limited to mRNA, miRNA, tRNA, rRNA, snRNA, siRNA, dsRNA, cDNA and DNA / RNA hybrids. Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods. As will be appreciated by those in the art, the depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. As will also be appreciated by those in the art, many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. As will also be appreciated by those in the art, a single strand provides a probe for a probe that may hybridize to the target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.

[0039] “Stringent hybridization conditions” as used herein refers to conditions under which a first nucleic acid sequence (e.g., probe) will hybridize to a second nucleic acid sequence (e.g., target), such as in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. One with ordinary skill can determine the appropriate conditions according to standard assays known in the art.

[0040] Probes

[0041] In one embodiment, the molecular beacon probes described herein target the complete internal transcribed spacer 2 (ITS2) gene and partial 26s RNA gene (238-330 bp) of C. auris (termed the “ITS2-26s region”). In one embodiment, the molecular beacon probes can detect all five known clades of C. auris (i.e., the South Asian Clade (clade I), the East Asian Clade (clade II), the South African Clade (clade III), the South American Clade (clade IV) and Iranian Clade (clade V)). In one embodiment, the molecular beacon probes described herein are used in an assay that can differentiate C. auris from other closely related species.

[0042] In some embodiments, one or more probes may include a first probe or a second probe capable of hybridizing to the first amplicon. In some embodiments, one or more probes may include a third probe or a fourth probe capable of hybridizing to the second amplicon. In some embodiments, one or more probes may include a fifth probe or a sixth probe capable of hybridizing to the third amplicon.

[0043] A probe can be made in various detection formats, such as dual labeled probes, including linear probes, Taqman probes, molecular beacon probes, and sloppy molecular beacon (SMB) probes. A “sloppy” probe refers to a probe that is mismatch-tolerant. Mismatch-tolerant probes hybridize with and generate a detectable signal for more than one target sequence at a detection temperature in an assay, and various hybrids so formed will have different melting temperatures. Linear, or random coil, single-stranded probes are generally mismatch tolerant. Examples of such probes are hairpin or linear probes with an internal fluorescent moiety whose level of fluorescence increases upon hybridization to one or another target strand. See, e.g., U.S. Pat. Nos. 7,662,550 and 5,925,517. US 20130095479.

[0044] In some embodiments, the sloppy probes are dual-labeled hairpin probes or molecular beacon probes, described in U.S. Pat. Nos. 7,662,550 and 5,925,517. These hairpin probes contain a target binding sequence flanked by a pair of arms complementary to one another. They can be DNA, RNA, or PNA, or a combination of all three nucleic acids. Furthermore, they can contain modified nucleotides and modified intemucleotide linkages. They can have a first fluorophore on one arm and a second fluorophore on the other arm, wherein the absorption spectrum of the second fluorophore substantially overlaps the emission spectrum of the first fluorophore. Such hairpin probes may be “molecular beacon probes” that have a fluorophore on one arm and a quencher on the other arm such that the probes are dark when free in solution. They can also be wavelengthshifting molecular beacon probes with, for example, multiple fluorophores on one arm that interact by fluorescence resonance energy transfer (FRET), and a quencher on the other arm. They can also have first fluorophore on one arm and second fluorophore on the other arm with an internal quencher molecule in the target binding sequence region. The target binding sequences can be, for example, 12 to 50, or 25 to 50 nucleotides in length, and the hybridizing arms can be 4 to 10 or 4 to 7 (e.g., 5 or 7) nucleotides in length. A portion of the arm sequence of the probe can have complementarity to the target sequence and a portion of the target region of the hairpin probe can participate in forming the hairpin along with the arm sequence. Molecular beacon probes can be tethered to primers, as described in U.S. Pat. Nos. 7,662,550 and 5,925,517 and WO 01 / 31062.

[0045] “Molecular beacon probe” as used herein refers to a hybridization probe that forms a stem and loop structure. The molecular beacon probe may range in length from 5 nucleotides to a 1000 nucleotides, such as from 10 to 50 nucleotides in length. The molecular beacon probe has a 5' arm, a loop portion that is a probe sequence, and a 3 'arm. The 5' and 3' arms are complementary to each other but not to the loop portion or the target, and bind to each other to form the stem of the molecular beacon probe.

[0046] Sloppy molecular beacon (SMB) probes thus refer to such a class of fluorescently labeled hairpin oligonucleotide hybridization probes. Such probes produce a detectable signal in a homogeneous assay, that is, without having to separate probes hybridized to target from unbound probes. By virtue of their ability to bind to more than one variants of a given target sequence, the probes can be used in assays to detect the presence of one variant of a nucleic acid sequence segment of interest from among a number of possible variants or even to detect the presence of two or more variants. The probes can therefore be used in combinations of two or more in the same assay. Because they differ in target binding sequence, their relative avidities for different variants are different. For example, a first probe may bind strongly to a wild-type sequence, moderately to a first allele, weakly to a second allele and not at all to a third allele; while a second probe may bind weakly to the wild-type sequence and the first variant, and moderately to the second variant and the third variant. Additional sloppy probes will exhibit yet different binding patterns due to their different target binding sequences. Thus, the patterns of the fluorescence emission spectra from combinations of sloppy probes can define different microbial strains or species, as well as allelic variants / mutation of genes.

[0047] As the sloppy probes reproducibly fluoresce with variable intensities after binding to different DNA sequences, combinations can be used in, for example, rapid, and sensitive nucleic acid amplification reaction assays (e.g., PCR-based assays) that identify multiple pathogens or variants in a single reaction container. It is understood, however, that the assays can also be performed on samples suspected of containing directly detectable amounts of unamplified target nucleic acids. This identification assay is based on analyzing the spectra of a set of partially hybridizing sloppy signaling probes, such as sloppy molecular beacon probes, each labeled with a fluorophore that emits light with a different wavelength optimum, to generate “signature spectra” of species-specific or variant-specific DNA sequences.

[0048] Using the probes, multiplexing can be achieved, for example, by designing a different allele-discriminating molecular beacon probe for each target and labeling each probe differentially. (See, e.g, U.S. Pat. Nos. 7,662,550 and 5,925,517, WO 01 / 31062, and Tyagi et al. (2000) Nature Biotechnology 18: 1 191 -1 196). Mixtures of allele-discriminating probes, each comprising aliquots of multiple colors, extend the number of probe signatures. To that end, every molecular beacontarget hybrid with a unique melting temperature will have corresponding unique signal intensity at a defined temperature and concentration of probe and amplicon. Thus, a limited number of sloppy probes could be used as probes to identify many different possible target sequences in a real-time PCR assay. The probes can be added to the amplification reaction mixture before, during, or after the amplification. See U.S. Pat. No. 7,662,550.

[0049] In some embodiments, the probes may include one or more labels. As used herein, a “label” or “reporter molecule” is a chemical or biochemical moiety useful for labeling a nucleic acid (including a single nucleotide), polynucleotide, oligonucleotide, or protein ligand, e.g., amino acid or antibody. Examples include fluorescent agents, chemiluminescent agents, chromogenic agents, quenching agents, radionucleotides, enzymes, substrates, cofactors, inhibitors, magnetic particles, and other moieties known in the art. Labels or reporter molecules are capable of generating a measurable signal and may be covalently or noncovalently joined to an oligonucleotide or nucleotide (e.g., a non-natural nucleotide) or ligand.

[0050] In some embodiments, the probe comprises one or more labels. In some embodiments, the one or more labels comprise at least one of a fluorophore and a quencher. In some embodiments, the one or more labels are located internally or at a terminus of the probe.

[0051] In some embodiments, the labels may include a fluorophore and / or a quencher.

[0052] As used herein, a “fluorophore” includes a molecule that is capable of absorbing energy at a wavelength range and releasing energy at a wavelength range other than the absorbance range. In some embodiments, the fluorophore is a molecule that is capable of absorbing energy at about 250 nm to about 900 nm, and can release energy at a wavelength range of about 260 nm to about 910 nm. The term “excitation wavelength” refers to the range of wavelengths at which a fluorophore absorbs energy. The term “emission wavelength” refers to the range of wavelengths that the fluorophore releases energy or fluoresces.

[0053] Examples of fluorophores include but are not limited to fluorescein, Texas Red, DAPI, Pl, acridine orange, Alexa fluors, e.g., Alexa 350, Alexa 405 or Alexa 488, cyanine dyes such as Cy3, Cy5, and Cy7, coumarin, ethidium bromide, fluorescein, BODIPY, rhodol, Rox, 5- carboxyfluorescein, 6-carboxyfluorescein, an anthracene, 2-amino-4-methoxynapthalene, a phenalenone, an acridone, fluorinated xanthene derivatives, a-naphtol, P-napthol, 1 - hydroxypyrene, coumarins, e. ., 7-amino-4-methyl coumarin (AMC) or 7-amino-4- trifluoromethyl coumarin (AFC), rhodamines, e.g., tetramethyl rhodamine, rhodamine- 110, carboxyrhodamine, cresyl violet, or resorufin, as well as fluorophores disclosed in U S Patent No 6,420,130 (Makings, et al.), the disclosure of which is incorporated by reference herein Fluorophores include cyanine dyes, such as compounds of the formula Ar-[CH=CH]n-[CH=]mAr, wherein Ar is an aryl or heteroaryl group, n is 1, 2, 3, or 4, m is 0 or 1 , and wherein each Ar includes a quaternary nitrogen or a nitrogen capable of being quaternized through resonance Examples of such aryl or heteroaryl groups include dimethyl-aminophenyl, imidazole, pyridine, pyrrole, quinoline, thiazole, and indole, each optionally substituted The fluorophore can be a compound that is inherently fluorescent or demonstrates a change in fluorescence upon binding to a biological compound, i.e., it can be fluorogenic, or its intensity can be diminished by quenching Fluorophores may contain substituents that alter the solubility, spectral properties or physical properties of the fluorophore Various fluorophores are known to those skilled in the art and also include, but are not limited to benzofurans, quinolines, quinazolinones, indoles, benzenols, borapolyazaindacene, and xanthenes including fluorescein, rhodamine, and rhodol, as well as other fluorophores described in Richard P Haugland’s The Handbook. A Guide to Fluorescent Probes and Labeling Technologies (10thedition, 2005), which describes numerous fluorophores available from Invitrogen Molecular Probes

[0054] Examples of quenchers may include, but are not limited to, Quasar®570 , CAL Fluor® Red 590, CAL Fluor® Red 610, CAL Fluor® Red 635, Pulsar 650, Quasar® 670, Quasar® 705, DDQ-I, Dabcyl, Eclipse, Iowa Black® FQ, BHQ®-1, QSY-7, BHQ®-2, DDQ-II, Iowa Black® RQ, QSY-21, BHQ®-3, IRDye® QC-1, IBFQ, IBRQ, ZEN, and Licor IRDye® QC-1.

[0055] In some embodiments, the molecular beacon probes described herein comprise a nucleic acid sequence that is at least about 80% (e.g, 80%, 82%, 84%, 86%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) identical to SEQ ID NO: 3. In one embodiment, the molecular beacon probes comprise the nucleic acid sequence of SEQ ID NO: 3.

[0056] In some embodiments, the molecular beacon probes described herein comprise a nucleic acid sequence that is at least about 80% (e.g., 80%, 82%, 84%, 86%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) identical to SEQ ID NO: 4. In one embodiment, the molecular beacon probes comprise the nucleic acid sequence of SEQ ID NO: 4.

[0057] In one embodiment, the molecular beacon probes described herein further comprise a fluorophore attached to one end and a non-fluorescent quencher moiety attached to the other end. The fluorophore can be any suitable fluorophore known in the art including, but not limited to Quasar®570, CAL Fluor® Red 590, CAL Fluor® Red 610, CAL Fluor® Red 635, Pulsar 650, Quasar®670, or Quasar®705. The non-fluorescent quencher moiety can be any suitable non- fluorescent quencher moiety known in the art including, not limited to BHQ (Black Hole Quencher)®-1, BHQ®-2, or BHQ®-3. In one embodiment, the molecular beacon probes described herein comprise Quasar® 570 and BHQ®-2.

[0058] Primers

[0059] The present disclosure also provides C. auris surveillance assay primers. One of skill in the art can determine suitable primers useful for amplification. In one embodiment, the primers amplify the ITS2-26s region of C. auris.

[0060] In some embodiments, the one or more primer pairs comprise a nucleotide sequence having at least 80% (e.g, 80%, 82%, 84%, 86%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity with a nucleotide sequence of SEQ ID NOs: 1-2, or having a nucleotide sequence of SEQ ID NOs: 1-2. The term “primer” refers to any nucleic acid that is capable of specifically hybridizing to a complementary nucleic acid molecule and that provides a free 3’ hydroxyl terminus, which can be extended by a nucleic acid polymerase. As used herein, amplification primers are a pair of nucleic acid molecules that can anneal to 5’ or 3’ regions of a gene (plus and minus strands, respectively, or vice-versa) and contain a short region in between. Under appropriate conditions and with appropriate reagents, such primers permit the amplification of a nucleic acid molecule having the nucleotide sequence flanked by the primers. For in situ methods, a cell or tissue sample can be prepared and immobilized on a support, such as a glass slide, and then contacted with a probe that can hybridize to DNA or RNA. Alternative methods for amplifying nucleic acids corresponding to expressed RNA samples include those described in, e.g., U.S. Patent No. 7,897,750.

[0061] As used herein, the term “oligonucleotide” refers to a short polynucleotide, typically less than or equal to 300 nucleotides long (e.g., in the range of 5 and 150, such as in the range of 10 to 100, or in the range of 15 to 50 nucleotides in length). However, as used herein, the term is also intended to encompass longer or shorter polynucleotide chains. An “oligonucleotide” may hybridize to other polynucleotides, therefore serving as a probe for polynucleotide detection, or a primer for polynucleotide chain extension.

[0062] As used herein, the term “amplification” and its variants include any process for producing multiple copies or complements of at least some portion of a polynucleotide, the polynucleotide typically being referred to as a “template.” The template polynucleotide can be single stranded or double stranded. A template may be a purified or isolated nucleic acid, or may be non-purified or non-isolated. Amplification of a given template can result in the generation of a population of polynucleotide amplification products, collectively referred to as an “amplicon.” The polynucleotides of the amplicon can be single stranded or double stranded, or a mixture of both. Typically, the template will include a target sequence, and the resulting amplicon will include polynucleotides having a sequence that is either substantially identical or substantially complementary to the target sequence. In some embodiments, the polynucleotides of a particular amplicon are substantially identical, or substantially complementary, to each other; alternatively, in some embodiments, the polynucleotides within a given amplicon can have nucleotide sequences that vary from each other. Amplification can proceed in a linear or exponential fashion, and can involve repeated and consecutive replications of a given template to form two or more amplification products. Some typical amplification reactions involve successive and repeated cycles of template-based nucleic acid synthesis, resulting in the formation of a plurality of daughter polynucleotides containing at least some portion of the nucleotide sequence of the template and sharing at least some degree of nucleotide sequence identity (or complementarity) with the template. In some embodiments, each instance of nucleic acid synthesis, which can be referred to as a “cycle” of amplification, includes creating free 3’ end (e.g., by nicking one strand of a dsDNA), thereby generating a primer and primer extension steps; optionally, an additional denaturation step can also be included wherein the template is partially or completely denatured. In some embodiments, one round of amplification includes a given number of repetitions of a single cycle of amplification. For example, a round of amplification can include 5, 10, 15, 20, 25, 30, 35, 40, 50, or more repetitions of a particular cycle. In one exemplary embodiment, amplification includes any reaction wherein a particular polynucleotide template is subjected to two consecutive cycles of nucleic acid synthesis. The synthesis can include template-dependent nucleic acid synthesis.

[0063] Kits

[0064] The present disclosure provides a kit for detection of C. auris comprising a molecular beacon probe described herein and optionally a pair of primers for amplification of the ITS2-26s region. In some embodiments, the kit includes a probe that is at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 3 or 4. The probe may optionally have a fluorophore attached to one end and a non-fluorescent quencher moiety attached to the other end.

[0065] The kit may be comprised of one or more containers and may also include collection equipment, for example, bottles, bags (such as intravenous fluids bags), vials, syringes, and test tubes. Other components may include needles, diluents and buffers. The kit may comprise reagents for PCR and may further comprise instructions for performing the method of detection of C. auris disclosed herein.

[0066] In addition, one or more materials and / or reagents required for preparing a biological sample for the isolation of the ITS2-26s region are optionally included in the kit. Furthermore, optionally included in the kits are one or more enzymes suitable for amplifying nucleic acids, including various polymerases (RT, Taq, etc ), one or more deoxynucleotides, and buffers to provide the necessary reaction mixture for amplification.

[0067] Optionally, the kits described herein further include software to expedite the generation, analysis and / or storage of data, and to facilitate access to databases. The software includes logical instructions, instructions sets, or suitable computer programs that can be used in the collection, storage and / or analysis of the data. Comparative and relational analysis of the data is possible using the software provided.

[0068] Additional Definitions

[0069] To aid in understanding the detailed description of the compositions and methods according to the disclosure, a few express definitions are provided to facilitate an unambiguous disclosure of the various aspects of the disclosure. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0070] Nucleic acids may be single-stranded or double-stranded, or may contain portions of both double stranded and single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods. Nucleic acids may contain modified deoxyribo- and ribo-nucleotide bases with side chain alkyl modifications like propynyl modification.

[0071] A “nucleic acid duplex,” “duplex,” “stem,” “nucleic acid hybrid,” or “hybrid” refers to a stable nucleic acid structure comprising a double-stranded, hydrogen-bonded region, e.g., RNA:RNA, RNA:DNA, and DNA:DNA duplex molecules and analogs thereof. Such structure may be detected by any known means, e.g., by using a labeled probe, an optically active probe- coated substrate sensitive to changes in mass at its surface (U.S. Pat. No. 6,060,237), or binding agents (U.S. Pat. No. 5,994,056).

[0072] The term “substantial identity” or “substantially identical,” when referring to a nucleic acid or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 90%, such as at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST or GAP, as discussed below. A nucleic acid molecule having substantial identity to a reference nucleic acid molecule may, in certain instances, encode a polypeptide having the same or substantially similar amino acid sequence as the polypeptide encoded by the reference nucleic acid molecule.

[0073] Sequence similarity for polypeptides is typically measured using sequence analysis software. Protein analysis software matches similar sequences using measures of similarity assigned to various substitutions, deletions, and other modifications, including conservative amino acid substitutions. For instance, GCG software contains programs such as GAP and BESTFIT, which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild-type protein and a mutein thereof. See, e.g., GCG Version 6.1. Polypeptide sequences also can be compared using FASTA with default or recommended parameters; a program in GCG Version 6.1. FASTA e.g., FASTA2 and FASTA3) provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson (2000) supra). Another preferred algorithm when comparing a sequence of the invention to a database containing a large number of sequences from different organisms is the computer program BLAST, especially BLASTP or TBLASTN, using default parameters. See, e.g., Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and (1997) Nucleic Acids Res. 25:3389- 3402, each of which is herein incorporated by reference.

[0074] The terms “determining,” “measuring,” “assessing,” and “assaying” are used interchangeably and include both quantitative and qualitative measurement, and include determining if a characteristic, trait, or feature is present or not. Assessing may be relative or absolute. “Assessing the presence of’ a target includes determining the amount of the target present, as well as determining whether it is present or absent.

[0075] As used herein, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. As used herein, the terms “including,” “comprising,” “containing,” or “having” and variations thereof are meant to encompass the items listed thereafter and equivalents thereof as well as additional subject matter unless otherwise noted.

[0076] As used herein, the phrases “in one embodiment,” “in various embodiments,” “in some embodiments,” and the like are used repeatedly. Such phrases do not necessarily refer to the same embodiment, but they may unless the context dictates otherwise.

[0077] As used herein, the terms “and / or” means any one of the items, any combination of the items, or all of the items with which this term is associated.

[0078] As used herein, the word “substantially” does not exclude “completely,” e.g., a composition which is “substantially free” from Y may be completely free from Y. Where necessary, the word “substantially” may be omitted from the definition of this disclosure.

[0079] As used herein, the term “each,” when used in reference to a collection of items, is intended to identify an individual item in the collection but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.

[0080] As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In some embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). Unless indicated otherwise herein, the term “about” is intended to include values, e.g., weight percents, proximate to the recited range that are equivalent in terms of the functionality of the individual ingredient, the composition, or the embodiment.

[0081] As disclosed herein, a number of ranges of values are provided. It is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0082] The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0083] All methods described herein are performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. In regard to any of the methods provided, the steps of the method may occur simultaneously or sequentially. When the steps of the method occur sequentially, the steps may occur in any order, unless noted otherwise. In cases in which a method comprises a combination of steps, each and every combination or sub-combination of the steps is encompassed within the scope of the disclosure, unless otherwise noted herein.

[0084] Each publication, patent application, patent, and other reference cited herein is incorporated by reference in its entirety to the extent that it is not inconsistent with the present disclosure. Publications disclosed herein are provided solely for their disclosure prior to the filing date of the present invention. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.

[0085] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. EXAMPLES

[0086] Example 1. Materials and Methods

[0087] This Examples details the materials and methods used in Example 2.

[0088] 1A. Sample matrix, media and pathogens All bacterial and fungal strains used in this study are listed in Table 1 and were obtained from the CDC Antimicrobial Resistance (AR) bank, Atlanta, GA. Assay optimization and limit of detection (LoD) studies performed with genomic DNA from Clade I C. auris strains AR0388 (non- aggregative), and AR0382 (aggregative). The dynamic range of the assay in this study was evaluated in Amies transport media. Table 1. Microbial strains and C. auris assay performance

[0089] AR bank: CDC-FDA Antimicrobial resistance strain bank

[0090] IB, Assay design and optimization

[0091] A 359 bp Internal transcribed spacer (ITS) rDNA region in the C. auris genome (NR_154998) was selected for the surveillance assay design, which includes genes encoding ITS1, 5.8s rRNA, ITS2 and partially 26s rRNA (Satoh K. et al. 2009. Candida auris sp. nov., a novel ascomycetous yeast isolated from the external ear canal of an inpatient in a Japanese hospital. Microbiol Immunol 53:41 -4). Representative GeneBank deposited sequences from C. auris isolates from various countries around the world belonging to different clades (N=20) were selected and analyzed by using clustalW alignment (MegAlignl5, Lasergene DNAStar). A 150 bp consensus sequence from this alignment was further used to design gene-specific primers and probes using the PrimerSelect (DNAStar Lasegene 15.1) and / or Primer3 programs (Rozen S. et al. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132:365-86) to amplify a 93 bp region on the ITS2-26s region on the C. auris genome (Table 2). Assay specific molecular probes were designed as molecular beacons using the unafold Web server unafold.org / mfold / applications / dna-folding-form.php (Zuker M. 2003. Mfold eb server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31 :3406-15 and SantaLucia J. 1998. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. PNAS 95:1460-1465).

[0092] Primers were obtained from Millipore Sigma (St. Louis, MO) and the molecular beacon was synthesized by LGC Biosearch technologies (Petaluma, CA). The PCR assay reagents Mg++ (1.5, 2 and 2.5 mM), primer concentrations (0.25, 0.5 and 1 pM) and annealing temperature (60 °C, 65 °C and 68 °C) were evaluated using EvaGreen® in Roche LightCycler® 480 (LC480, FIG. 1). The final optimized PCR mix contained IX Phoenix PCR buffer, 2.5mM MgCE, 20mM KC1, 400pM of each nucleotide (deoxynucleotide triphosphates), 0.5pM concentration of each C. auris primer (CASA-ITS2-F and CASA- ITS2-R), and 12U of Phoenix Taq DNA polymerase (Qiagen Beverly, MA). Molecular beacon specific for C. auris ITS2 gene (CASA-ITS2 (SEQ ID NO: 3) RT probe Quasar® 570-BHQ®-2) was added to the PCR mix at 250 nM concentration for realtime PCR detection.

[0093] Table 2. Primer and beacon sequences

[0094] Quasar®570: fluorescent dye by Biosearch LGC technologies replacement for Cy™ 3; BHQ®-2: Black Hole Quencher®-2; Note: The lowercase letters represent the stem portion and the uppercase letters represent the probe portion of the molecular beacon.

[0095] 1C. Limit of detection (LOD)

[0096] The analytical LOD of the C. auris specific surveillance assay was assessed using quantitated C. auris (AR 0388 and AR0382) genomic DNA. Serial dilutions of respective C. auris genomic DNA was tested at 0, 0.1, 0.5, 1, 5, 10 and 50 GE / reaction (N=20 each). For this study, the LOD was defined as the lowest concentration at which 95% of the samples tested were positive.

[0097] ID. Assay inclusivity and exclusivity

[0098] Assay inclusivity was tested with 17 different strains of C. auris belonging to all five clades at 50 genomic equivalents in replicates of 4 (Table 1 inclusivity). All these isolates are obtained from the CDC and Food and Drug Administration (FDA) Antimicrobial Resistance (AR) Isolate bank, Atlanta, GA. The specificity of the assay was determined by testing 104-105 genomic equivalents of different yeast species (N=l l) as recommended and supplied as part of the CDC AR panel (Table 1 exclusivity). Test isolates included non-auris Candida species (N=8), Saccharomyces cerevisiae (N=2) and Kodameae ohmeri (N=l).

[0099] Example 2. Results of the assay

[0100] 2A, Distinctive and specific assay design

[0101] Based on the annotation of the reference sequence Genebank accession number NR_154998 (Satoh K. et al. 2009. Candida auris sp. nov., a novel ascomycetous yeast isolated from the external ear canal of an inpatient in a Japanese hospital. Microbiol Immunol 53:41-4), the final assay amplicon covers the complete ITS2 gene and partial 26s rRNA gene (238-330 bp, FIG. 1), which is unique and different from other published assays (Leach L. et al. 2018. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples. J Clin Microbiol 56 and Kordalewska M. et al. 2022. Detection and Identification of Candida auris from Clinical Skin Swabs. Methods Mol Biol 2542:245-256). C. auris assay published by CDC (cdc.gov / fungal / candida-auris / pdf / Real-time-PCR-based-Id-C- auris-508.pdf) and Leach etal., (Leach L. etal. 2018. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples. J Clin Microbiol 56) covers bases from 159-293 encoding partial 5.8s through C. haemulonilC. duobushaemulonisIC. lusitaniae, or Homo sapiens, indicating high specificity of the primer sequences to the assay target.

[0102] 2B, PCR reagent optimization

[0103] The key PCR reagents Mg++, primers and annealing temperature were evaluated to determine the optimal concentration / temperature for the most efficient surveillance assay. Based on the data shown in FIGS. 2A-2B, Mg++ at 2.5 mM was finalized (FIG. 2A), both forward and reverse primer concentration for a symmetric assay at 1 : 1 ratio was determined to give optimal performance at 0.5 uM concentration at three different annealing temperatures (FIG. 2B). 2C. Analytical LOD determination

[0104] C. auris surveillance assay (CASA) primers and the CASA probe LOD were evaluated by testing C. auris AR 0388 and AR 0382 at 0.1, 0.5, 1, 5 10 and 50 genomic equivalents (GE) per 20 ul reaction mix (N=20). In this study, the LOD was defined at 95% or 19 / 20 replicates were positive. Using linear regression curve fit (GraphPad Prism ver 8.4.3), the assay LOD was determined to be 0.2 GE / reaction for non-aggregative strain (FIG. 3A) and 0.4 GE / reaction for the aggregative strain (FIG. 3B) of C. auris.

[0105] 2D, Inclusivity and exclusivity

[0106] The assay inclusivity was tested on 17 different strains of C. auris belonging to all five clades so far reported (Table 1). The assay detected C. auris in all samples tested regardless of their clades yielding an assay inclusivity of 100%. The assay exclusivity (specificity) was evaluated by testing 104 to 105 GE / reaction of CDC AR exclusivity panel (Table 1). The assay did not detect any of the non-target pathogens tested, indicating a specificity of 100%.

[0107] The C. auris surveillance assay primers and probe developed in this study proved to be highly specific and sensitive. The test demonstrated an analytical LoD as low as 0.2 GE / reaction non-aggregative and 0.4 GE / reaction for aggregative strain. The assay was able to detect all five clades of C. auris and did not cross-react with other closely related species of C. auris or yeasts demonstrating high specificity for C. auris. Additionally, the assay time to positive (TTP) was less than one hour. Thus, this assay will offer a better solution to healthcare providers at hospitals and long-term care facilities in their ongoing efforts for effective and timely control of C. auris infection and hence quicker response for any potential future outbreaks.

[0108] The foregoing examples and description of the preferred embodiments should be taken as illustrating, rather than as limiting the present invention as defined by the claims. As will be readily appreciated, numerous variations and combinations of the features set forth above can be utilized without departing from the present invention as set forth in the claims. Such variations are not regarded as a departure from the scope of the invention, and all such variations are intended to be included within the scope of the following claims. All references cited herein are incorporated by reference in their entireties. Sequence Listing:

[0109] SEQ ID NO: 1 (CASA-ITS2-F)

[0110] CTTCTCACCAATCTTCGCGG

[0111] SEQ ID NO: 2 (CASA-ITS2-R)

[0112] TGAGGCGACAACAAAACGAA

[0113] SEQ ID NO: 3 (CASA-ITS2-RT probe)

[0114] Quasar®570-cggcgACAGCTTGCACGAAAAAAATCTACGCcg-3 ’ BHQ®-2

[0115] SEQ ID NO: 4 (Probe portion of CASA-ITS2-RT probe)

[0116] ACAGCTTGCACGAAAAAAATCTACGC

[0117] SEQ ID NO: 5 (NR_154998) aaggatcattattgatattttgcatacacactgatttggattttaaaactaacccaacgttaagttcaactaaactataaagaaaactttcaacaac ggatctcttggttctcgcatcgatgaagaacgcagcgaaatgcgatacgtagtatgacttgcagacgtgaatcatcgaatctttgaacgcaca ttgcgccttggggtattccccaaggcatgcctgtttgagcgtgatgtcttctcaccaatcttcgcggtggcgttgcattcacaaaattacagcttg cacgaaaaaaatctacgcttttttttcgttttgttgtcgcctcaaatcaggtaggactacccgctgaacttaa

[0118] SEQ ID NO: 6 (ITS2-26s region) cttctcaccaatcttcgcggtggcgttgcattcacaaaattacagcttgcacgaaaaaaatctacgcttttttttcgttttgttgtcgcctca

[0119] SEQ ID NO: 7 (ITS2) cttctcaccaatcttcgcggtggcgttgcattcacaaaattacagcttgcacgaaaaaaatctacgcttttttttcgttttgt

Claims

CLAIMSWhat is claimed is:

1. A method of detecting Candida auris in a sample, comprising: amplifying a nucleic acid containing an ITS2-26s region in the sample with one or more primer pairs to obtain one or more amplicons, wherein each of the one or more primer pairs comprises a forward primer and a reverse primer, wherein the one or more primer pairs is each specific for a target region of the ITS2-26s region, and wherein the one or more amplicons respectively correspond to one or more target regions of the ITS2-26s region; contacting the one or more amplicons with one or more probes under a condition conducive to a hybridization reaction to form one or more probe-amplicon hybrids; determining the presence of a signal from the one or more probe-amplicon hybrids; and determining the presence of the signal from the one or more probe-amplicon hybrids as indicia of the presence of Candida auris in the sample.

2. The method of claim 1, wherein the method is performed in time to positivity (TTP) of less than one hour.

3. The method of any one of the preceding claims, wherein the one or more probes comprise a probe having a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence of SEQ ID NOs: 3 or 4, or having a nucleotide sequence of SEQ ID NO: 3 or 4.

4. The method of any one of the preceding claims, wherein the one or more probes include one or more labels.

5. The method of claim 4, wherein the one or more labels comprise at least one of a fluorophore and a quencher.

6. The method of any one of claim 4, wherein the one or more labels are located internally or at a terminus of the one or more probes.

7. The method of claim 5, wherein the fluorophore is selected from Quasar 570, Hydroxycoumarin, Alexa fluor, Aminocoumarin, Methoxycoumarin, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer yellow, Alexa fluor 430, NBD, R-Phycoerythrin (PE), PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP, Cy2, TruRed, FluorX, Fluorescein, FAM, BODIPY-FL, TET, Alexa fluor 532, HEX, TRITC, Cy3, TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X- Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5 581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates, Cy5, Alexa fluor 660, Cy5.5, LC red 705, Alexa fluor 680, and Cy7.

8. The method of claim 5, wherein the quencher is selected from BHQ-1, BHQ2, BHQ3, DDQ-I, Dabcyl, Eclipse, Iowa Black FQ, QSY-7, DDQ-II, Iowa Black RQ, and QSY-21.

9. The method of any one of the preceding claims, wherein the one or more primer pairs comprise a primer having a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence of SEQ ID NOs: 1-2, or having a nucleotide sequence of SEQ ID NOs: 1-2.

10. The method of any one of the preceding claims, wherein the nucleic acid is amplified by real-time PCR.

11. The method of any one of the preceding claims, wherein the step of amplifying is performed by a PCR comprising: initial denaturation at 95 °C for 1 minute, 45 cycles, denaturation at 95 °C for 10 seconds, annealing at 62 °C for 25 seconds, and extension at 72 °C for 15 seconds.

12. The method of any one of the preceding claims, wherein the sample is a biological sample isolated from a patient.

13. The method of any one of the preceding claims, wherein the sample is collected from the solid surface of an object.

14. The method of any one of the preceding claims, wherein the nucleic acid is a genomic DNA.

15. The method of any one of the preceding claims, wherein the ITS2 region comprises nucleotides spanning from 238 to 330 of a ITS2 gene of the Candida auris.

16. The method of any one of the preceding claims, wherein the method is performed on a cartridge system that integrates sample processing and PCR amplification.

17. A kit for detecting Candida auris in a sample, comprising one or more probes comprise a probe having a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence of SEQ ID NOs: 3 or 4, or having a nucleotide sequence of SEQ ID NO: 3 or 4.

18. The kit of claim 17, wherein the one or more probes include one or more labels.

19. The kit of claim 18, wherein the one or more labels comprise at least one of a fluorophore and a quencher.

20. The kit of claim 18, wherein the one or more labels are located internally or at a terminus of the one or more probes.

21. The kit of claim 19, wherein the fluorophore is selected from Quasar 570, Hydroxycoumarin, Alexa fluor, Aminocoumarin, Methoxycoumarin, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer yellow, Alexa fluor 430, NBD, R-Phycoerythrin (PE), PE-Cy5 conjugates, PE-Cy7 conjugates, Red 613, PerCP, Cy2, TruRed, FluorX, Fluorescein, FAM, BODIPY-FL, TET, Alexa fluor 532, HEX, TRITC, Cy3, TMR, Alexa fluor 546, Alexa fluor 555, Tamara, X- Rhodamine, Lissamine Rhodamine B, ROX, Alexa fluor 568, Cy3.5 581, Texas Red, Alexa fluor 594, Alexa fluor 633, LC red 640, Allophycocyanin (APC), Alexa fluor 633, APC-Cy7 conjugates, Cy5, Alexa fluor 660, Cy5.5, LC red 705, Alexa fluor 680, and Cy7.

22. The kit of claim 19, wherein the quencher is selected from BHQ-1, BHQ-2, BHQ-3, DDQ- I, Dabcyl, Eclipse, Iowa Black FQ, QSY-7, DDQ-II, Iowa Black RQ, and QSY-21.

23. The kit of any one of claims 17-22, further comprising one or more primer pairs comprise a primer having a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence of SEQ ID NOs: 1-2, or having a nucleotide sequence of SEQ ID NOs: 1-2.

24. The kit of any one of claims 17-23, further comprising an instructional material having a PCR protocol comprising: initial denaturation at 95 °C for 1 minute, 45 cycles, denaturation at 95 °C for 10 seconds, annealing at 62 °C for 25 seconds, and extension at 72 °C for 15 seconds.

25. The kit of any one of claims 17-24, wherein the one or more probes or the one or more primer pairs are specific to a ITS2 region of Candida auris.

26. The kit of claim 25, wherein the ITS region comprises nucleotides spanning from 238 to 330 of a ITS2 gene of the Candida auris.

27. The kit of any one of claims 17-26, wherein the sample is a biological sample isolated from a patient.

28. The kit of any one of claims 17-26, wherein the sample is collected from the solid surface of an object.

Images