Supercharging therapeutic adipocytes
By combining PPARγ and cAMP activators with Nrip1 gene disruption, adipocytes are transformed into highly thermogenic cells, addressing the limitations of current treatments for BMI-related conditions by improving metabolic health.
Patent Information
- Application Number
- PCT/US2025/023232
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-04
- Filing Date
- 2025-04-04
- Publication Date
- 2025-10-09
AI Technical Summary
Current treatments for conditions associated with elevated body mass index (BMI), such as type 2 diabetes and cardiovascular disease, are inadequate in effectively utilizing adipose cells for therapeutic purposes, particularly in enhancing thermogenic potential.
A combination treatment involving a peroxisome proliferator-activated receptor-gamma (PPARγ) activator, cyclic adenosine 3′,5′-monophosphate (cAMP) activator, and nuclear receptor interacting protein 1 (Nrip1) gene disruption is used to 'supercharge' adipocytes into a thermogenic phenotype, increasing thermogenic gene expression, including UCP1, Cidea, and AdipoQ.
The supercharged adipocytes exhibit enhanced thermogenic capacity, providing a therapeutic potential for treating or preventing conditions related to elevated BMI, including metabolic syndrome, type 2 diabetes, and cardiovascular disease.
Smart Images

Figure IMGF000011_0001 
Figure IMGF000011_0002 
Figure IMGF000016_0001
Abstract
Description
[0001]Attorney Docket 07917-0452WO1 / UMMS 24-36 SUPERCHARGING THERAPEUTIC ADIPOCYTES CLAIM OF PRIORITY This application claims the benefit of U.S. Provisional Application No.63 / 574,511 filed April 4, 2024. The entire contents of the foregoing are hereby incorporated by reference. FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under W81XWH-21-1-0565 awarded by the Department of Defense Health Agency, Medical Research and Development Branch. The Government has certain rights in the invention. TECHNICAL FIELD Methods and compositions provided herein involve engineered adipose cells for treating conditions associated with an elevated body mass index (BMI) such as diabetes. BACKGROUND Metabolic disease is a significant issue in human health globally; type 2 diabetes (T2D) affects nearly an astounding 10% of the population of the United States (see cdc.gov / diabetes / basics / type2.html). Overweight and obese men and women account for about two thirds of the USA population, and are greatly at risk of developing T2D. African Americans have an incidence of type 2 diabetes that is higher than the general population and Americans over the age of 65 have an incidence of T2D of over 25% (see cdc.gov / diabetes / data / statistics- report / diagnosed-undiagnosed-diabetes.html). Veterans are no exception and have an incidence of T2D that is higher than average (Liu et al., Prev. Chronic Dis., 2017, 14: 170230 (E135)) and with correspondingly high health care costs. The co-morbidities of type 2 diabetes, which include about a 2-fold increase in cardiovascular disease incidence as well as vascular disease and impaired wound healing, accounting for about 75,000 amputations per year in the United States. SUMMARY The present disclosure is based, at least in part, on the discovery that combination treatments involving a peroxisome proliferator-activated receptor-gamma (PPARγ) activator, a Attorney Docket 07917-0452WO1 / UMMS 24-36 cyclic adenosine 3′,5′-monophosphate (cAMP) activator, and a nuclear receptor interacting protein 1 (Nrip1) gene disruption can be extraordinarily synergistic in driving adipocytes to a thermogenic phenotype. The combination treatments described herein, such as activation of PPARγ and cAMP in combination with genetic disruption of Nrip1, can be referred to as “supercharging” adipocytes. Such supercharged adipocytes have improved thermogenesis compared to uncharged adipocytes, thus improving their therapeutic potential. Accordingly, aspects of the present disclosure provide a method of making a population of thermogenic adipose cells, the method comprising obtaining or providing a population of adipose progenitor cells; disrupting expression of nuclear receptor interacting protein 1 (Nrip1) in the cells, preferably by introducing into the population of adipose progenitor cells an engineered nuclease or an inhibitory nucleic acid targeting a nuclear receptor interacting protein 1 (Nrip1) gene, to produce a population of adipose progenitor cells comprising a disrupted Nrip1 gene; culturing the population of adipose progenitor cells comprising the disrupted Nrip1 gene under conditions sufficient to induce differentiation of the adipose progenitor cells into a population of mature adipose cells comprising the disrupted Nrip1 gene; and treating the population of mature adipose cells comprising the disrupted Nrip1 gene with a peroxisome proliferator-activated receptor (PPAR) activator and a cyclic adenosine 3′,5′-monophosphate (cAMP) activator to produce a population of thermogenic adipose cells. In some embodiments, the method comprises treating the population of mature adipose cells with the PPAR activator prior to treating the population of mature adipose cells with the cAMP activator. In some embodiments, the method comprises treating the population of mature adipose cells with the PPAR activator for about 12 to about 48 hours prior to treating the population of mature adipose cells with the cAMP activator for about 12 to about 36 hours. In some embodiments, the method further comprises treating the population of mature adipose cells with a fatty acid synthase (FASN) inhibitor. In some embodiments, treating the population of mature adipose cells comprises simultaneously treating the population of mature adipose cells with the PPAR activator and the FASN inhibitor. In some embodiments, the method comprises treating the population of mature adipose cells with the PPAR activator and the FASN inhibitor for about 12 to about 48 hours prior to treating the population of mature adipose cells with the cAMP activator for about 12 to about 36 hours. Attorney Docket 07917-0452WO1 / UMMS 24-36 In some embodiments, the method further comprises treating the population of mature adipose cells with a retinoid X receptor (RXR) agonist. In some embodiments, treating the population of mature adipose cells comprises simultaneously treating the population of mature adipose cells with the RXR agonist and the cAMP activator. In some embodiments, the method comprises treating the population of mature adipose cells with the PPAR activator for about 12 to about 48 hours prior to treating the population of mature adipose cells with the RXR agonist and the cAMP activator for about 12 to about 36 hours. In some embodiments, the engineered nuclease is a meganuclease; a zinc-finger nuclease; a transcription activator effector-like nuclease (TALEN); or a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Cas RNA-guided nuclease (RGN). In some embodiments, the engineered nuclease is a RGN and the method further comprises contacting the adipose progenitor cells with a guide RNA (gRNA) targeting the Nrip1 gene. In some embodiments, the RGN and gRNA are delivered to the progenitor cells as a ribonucleoprotein (RNP) complex. In some embodiments, the RNP complex comprises Streptococcus pyogenes Cas9 (SpCas9) and a gRNA comprising a sequence selected from the group consisting of: sgRNA-H4 ACAUCAGGAAGAUUCGUAUC (SEQ ID NO: 16), sgRNA-H5 GUCAUGUGCUGCAAGAUUAC (SEQ ID NO: 17), or sgRNA-H6 UUUGCAUGGUCCCUAAGAAA (SEQ ID NO: 18). In some embodiments, the RNP complex is delivered to the adipose progenitor cells by electroporation. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide or single- or double-stranded RNA interference (RNAi) compound. In some embodiments, the PPAR activator comprises a PPAR-gamma (PPARγ) activator, a PPAR-alpha (PPARα), or a pan PPAR activator. In some embodiments, the PPARγ activator comprises troglitazone, pioglitazone, rosiglitazone, AMG131, or a combination thereof. In some embodiments, the PPARα activator comprises clofibrate, fenofibrate, bezafibrate, pemafibrate, gemfibrozil, or a combination thereof. In some embodiments, the PPAR activator comprises a pan PPAR activator selected from lobeglitazone, chiclitazar, aleglitazar, elafibranor, saroglitazar, muraglitazar, tesaglitazar, or a combination thereof. In some embodiments, the cAMP activator comprises CL 316243, forskolin, a cAMP analog (e.g., 8-bromo-cAMP or NKH477), or a combination thereof. Attorney Docket 07917-0452WO1 / UMMS 24-36 In some embodiments, the FASN inhibitor comprises C75, FT113, TVB2640, TVB3664, or a combination thereof. In some embodiments, the RXR agonist comprises bexarotene, CD3254, docosahexaenoic acid, LG100268, retinoic acid, SR11237, or a combination thereof. In some embodiments, at least 50% of cells in the population of thermogenic adipose cells express uncoupling protein 1 (UCP1). In some embodiments, a level of expression of UCP1 in cells in the population of thermogenic adipose cells is at least 2-fold greater than a level of expression of UCP1 in cells in the population of mature adipose cells comprising the disrupted Nrip1 gene. In some embodiments, the adipose progenitor cells are Human Adipose Capillary Progenitor Cells (HACAPS) or primary adipose progenitor cells. In some embodiments, the thermogenic adipose cells are white, brite, or brown adipose cells. Aspects of the present disclosure provide a population of thermogenic adipose cells produced by any one of the methods described herein. Aspects of the present disclosure provide a method of treating, or reducing the risk of developing or worsening, of a condition associated with an elevated body mass index (BMI) in a subject, the method comprising administering to the subject an effective amount of a population of thermogenic adipose cells described herein. In some embodiments, the subject has a BMI > 25. In some embodiments, the condition associated with an elevated BMI is selected from the group consisting of metabolic syndrome, prediabetes, type 2 diabetes, lipodystrophy, cardiovascular disease, nephropathy, diabetic neuropathy, dyslipidemia, diabetic foot syndrome (DFS), leg or foot ulcers, impaired wound healing, fatty liver disease, or a combination thereof. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Attorney Docket 07917-0452WO1 / UMMS 24-36 Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. DETAILED DESCRIPTION OF THE DRAWINGS FIG.1 shows UCP1 levels in mouse adipocytes having a candidate gene knocked out by CRISP-based gene disruption. FIGs.2A-2C show similar morphology of differentiated adipocytes derived from 6-day- old and 4-week-old mice under different conditions. FIG.2A: Inguinal white adipose tissue (iWAT) isolated from 6-day (6d) and 4-week (4w) old mice. FIG.2B: Microscopic images of primary pre-adipocytes from 6-day old (top) and 4-week old mice (bottom) in cell culture at 10X magnification. FIG.2C: Microscopic images of differentiated mature adipocytes from different age groups in cell culture at 10X magnification. Cells of non-targeted control, NTC (top left), Nrip1-targeted, Nrip1-KO (top right), Zfp423-targeted, Zfp423-KO (bottom left), Nrip1 and Zfp423-double knock-out, dKO (bottom right). FIG.3 shows editing efficiency in primary pre-adipocytes 72 hours post-transfection based on indel percentage evaluated using the inference of CRISPR edits (ICE) analysis tool. FIGs.4A-4D show that double knockout adipocytes displayed little to no increase in UCP1 expression compared to single knockouts of NRIP1 and ZFP423. FIG.4A: UCP1 protein expression in primary adipocytes of the 6-day-old group at 6 days post differentiation. Lane 1 contains 1.5 µg protein lysate from mouse brown adipose tissue (BAT), and lanes 2 to 13 contain 15 µg protein lysate. FIG.4B: UCP1 protein expression in primary adipocytes of the 4-week old group at 6 days post differentiation. Lane 1 contains 1.5 µg protein lysate from mouse BAT, lane 2 to 13 contain 15 µg protein lysate. Tubulin was used as a loading control. FIG.4C: UCP1 protein fold change over NTC of primary adipocytes of 6-day and 4-week old groups on day 6 post-differentiation. FIG.4D: UCP1 thermogenic gene expression fold change over NTC of primary adipocytes on day 6 post-differentiation (n=3). FIGs.5A-5E show that the combination of NRIP1KO and treatment with PPARγ agonists greatly enhance adipocyte thermogenesis, causing synergistic upregulation of UCP1. FIG.5A: Timeline of treatments. Cas9 / sgRNA was directed against Nrip1, TVB3664 is a FASN inhibitor, rosiglitazone is PPARγ activator, CD3254 is an RXR agonist. FIG.5B: Western blot showing expression of UCP1 protein in a short and long exposure of the blot. FIG.5C: Relative UCP1 levels measured by RT-PCR. FIG.5D: Images showing cells that express UCP1 assessed Attorney Docket 07917-0452WO1 / UMMS 24-36 by immunofluorescence signal. Each spike represents the expression level of UCP1 in that adipocyte. FIG.5E: Images showing cells that express UCP1 assessed by immunofluorescence signal. Each dot represents the expression level of UCP1 in that adipocyte. FIGs.6A-6D show that treatment of NRIP1KO human adipocytes with PPARγ and cAMP activation causes strong browning effects that markedly increase expression of thermogenesis-selective genes including UCP1 (FIG.6A), Cidea (FIG.6B), AdipoQ (FIG.6C), and CDK15 (FIG.6D). FIGs.7A-7B show a timeline of differentiation and supercharging. FIG.7A: Overall timeline of differentiation and supercharging. FIG.7B: Supercharging phase on days 10-12. FIGs.8A-8B show the morphology of differentiated NHP adipocytes from control and supercharging treatment groups. Left: NTC control cells (NRIP1 intact). Right: NRIP1KO cells. FIGs.9A-9C show RNA and protein UCP1 response on day 11 after differentiation of NHP adipocytes from control and supercharging treatment groups. FIG.9A: UCP1 mRNA by RT-PCR, data on NTC and NRIP1KO panels normalized over NTC and treatment group 1. FIG. 9B: UCP1 detection by Western blotting (40 μg protein per lane). M = Marker. FIG.9C: Quantification of UCP1 protein by ImageJ normalized over NTC and treatment group 1. DETAILED DESCRIPTION The present disclosure is based, at least in part, on the discovery that adipocytes can be supercharged into a thermogenic state using a synergistic combination that can include a PPARγ activator, a cAMP activator, and a disrupted Nrip1 gene. Such supercharged thermogenic adipose cells showed significant upregulation of thermogenic selective genes including UCP1, Cidea, AdipoQ, and CDK15. It was also shown that adipocytes from a wide range of species could be supercharged into a highly thermogenic state including adipocytes from mice, nonhuman primates, and humans. Accordingly, provided herein are methods for making a population of supercharged thermogenic adipose cells that can include obtaining or providing adipose progenitor cells, editing the adipose progenitor cells to include a disrupted Nrip1 gene, differentiating the adipose progenitor cells into mature adipose cells, and treating the mature adipose cells with a PPARγ activator and a cAMP activator, and optionally with a FASN inhibitor and / or a RXR agonist. The present disclosure also provides compositions comprising such supercharged thermogenic Attorney Docket 07917-0452WO1 / UMMS 24-36 adipose cells, and methods of using such cells to treat or reduce the risk of developing or worsening of a condition associated with an elevated BMI. Adipose Progenitor Cells The present methods involve adipose progenitor cells (also referred to as preadipocytes) that can be genetically modified, expanded, differentiated, and supercharged into thermogenic adipose cells (also referred to as thermogenic adipocytes) for use in treating subjects. Adipose progenitor cells include primary adipose progenitor cells and Human Adipose Capillary Progenitor Cells (HACAPS), which are subcutaneous adipose tissue fragments cultured ex-vivo (e.g., embedded in MatriGel and incubated in the presence of angiogenic growth factor) to produce capillary networks that contain adipocyte progenitor cells. HACAPS are capable of giving rise to either white or “Brown-on-white” (Brite) adipose cells, and brite cells produced thereby, e.g., as described in US 10,927,348 and US 10,093,902, the relevant disclosures of which are incorporated by reference herein for the subject matter and purpose referenced herein. Primary adipose cells can be obtained from tissue, e.g., by standard methods such a biopsy or other surgical methods. For example, panniculectomy surgery, liposuction, bariatric surgery, or needle biopsy can be is used to obtain tissue that is can be a source of primary adipose progenitor cells. A mixture of primary cells is typically obtained from tissue. Accordingly, in some examples, the tissue is then dissociated into cells, using known methods, such as mechanical disruption, trituration, or enzymatic digestion or explanting. If enzymatic digestion is used, enzymes such as collagenase, hyaluronidase, dispase, pronase, trypsin, elastase and chymotrypsin can be used. Any method can be used to obtain adipose progenitor cells so long as the cells are viable. In some embodiments, adipose progenitor cells can be sorted or immunoadsorbed based on the expression of one or more cell surface markers to produce enriched populations of cells. Methods for sorting cells are known in the art, and include flow cytometry, e.g., fluorescence activated cell sorting (FACS), using fluorescently labeled antibodies that recognize the cell surface markers. When fluorescence detection is used, the primary antibodies can be labeled, or can be detected using labeled secondary antibodies. Suitable antibodies are known in the art and commercially available. Attorney Docket 07917-0452WO1 / UMMS 24-36 In some embodiments, adipose progenitor cells are enriched (e.g., by cell sorting), the cells are plated and then maintained in culture to proliferate. For example, after enrichment, the adipose progenitor cells can be plated and expanded in culture. In some embodiments, the adipose progenitor cells are resuspended in media (the cells can be genetically modified at this time) and further cultured and passaged and differentiated. In some embodiments, the adipose progenitor cells are used to seed biocompatible hydrogel scaffolds, which may be implanted directly, or after the seeded cells within the scaffold have been induced to differentiate in vitro into adipocytes, e.g., by incubation in the presence of methylisobutil-xanthine, dexamethasone and insulin (MDI) (e.g., synthetic glucocorticoid dexamethasone, the cAMP elevating agent 1-methyl-3-isobutyl xanthine (MIX), and pharmacological doses of insulin; see Hwang et al., Annu Rev Cell Dev Biol 13: 231-259). Genetic Editing of Adipose Cells Genetic modification of adipose cells can be performed at any time in methods described herein, e.g., before differentiation, after differentiation, before supercharging, after supercharging, before differentiation and supercharging, after differentiation and supercharging, after differentiation and before supercharging, or after supercharging and before differentiation. (a) Gene Edits The present disclosure provides methods of making thermogenic adipocytes comprising one or more disrupted genes including a disrupted Nrip1 gene. As used herein, the term “a disrupted gene” refers to a gene containing one or more mutations (e.g., insertion, deletion, substitution) relative to the wild-type counterparts so as to substantially reduce or completely eliminate the activity of the encoded gene product. The one or more mutations can be located in a non-coding region (e.g., a promoter region, a regulatory region, an intron). Alternatively, or in addition to, the one or more mutations can be located in a coding region (e.g., an exon), e.g., a premature stop codon. In some examples, the disrupted gene does not express or expresses a substantially reduced level of the encoded protein. In some examples, the disrupted gene expresses the encoded protein in a mutated form, which is either not functional or has substantially reduced activity. In some examples, a disrupted gene is a gene that does not encode a functional protein. In some examples, an engineered adipocyte comprising Attorney Docket 07917-0452WO1 / UMMS 24-36 a disrupted gene (e.g., a disrupted Nrip1 gene) does not express a detectable level of the protein encoded by the gene. In some embodiments, methods described herein comprise introducing a mutation into a target region of the Nrip1 gene. In some embodiments, the target region comprises nucleotides 596-3811, 596-3110, 665-3811, or 665-3110 of exon 4 of the Nrip1 gene as provided in SEQ ID NO: 21. In some embodiments, the target region comprises a region between nucleotides 250, 300, 350, 400, 450, or 500 on the 5’ end and nucleotides 2950, 3000, 3050, 3100, or 3110 on the 3’ end (and all ranges with any of the foregoing values as endpoints) of exon 4 of the Nrip1 gene as provided in SEQ ID NO: 21. In some embodiments, the target region comprises a region between nucleotides 250, 300, 350, 400, 450, 500, or 550 on the 5’ end and nucleotides 750, 800, 850, or 100 on the 3’ end (and all ranges with any of the foregoing values as endpoints) of exon 4 of the Nrip1 gene as provided in SEQ ID NO: 21. In some embodiments, the target region comprises a region between nucleotides 2500, 2550, 2600, 2650, 2750, or 2800 on the 5’ end and nucleotides 2950, 3000, 3050, 3100, or 3110 on the 3’ end (and all ranges with any of the foregoing values as endpoints) of exon 4 of the Nrip1 gene as provided in SEQ ID NO: 21. In some embodiments, the target region comprises a region comprising any of the target regions the human Nrip1 gene shown in Table 1 below, plus up to 50, 75, 100, 200, 300, 400, 500, 750, or 1000 nucleotides on either side. Table 1. Target regions of the human Nrip1 gene. The nucleic acid sequence of the human Nrip1 gene is provided in GenBank Accession No. NM_003489, which is provided as SEQ ID NO: 21. Region Location / Size Attorney Docket 07917-0452WO1 / UMMS 24-36 sgRNA-622 (H6) 2888-2908 STOP codon 3809-3811 3’UTR 3812- In some embodiments, the target region of the the nucleic acid sequence of SEQ ID NO: 21 or a nucleic acid sequence that is at least 80%, 85%, 90%, 85%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 21. To determine the percent identity of two sequences, the sequences are aligned for optimal comparison purposes (gaps are introduced in one or both of a first and a second amino acid or nucleic acid sequence as required for optimal alignment, and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% (in some embodiments, about 85%, 90%, 95%, or 100% of the length of the reference sequence) is aligned. The nucleotides or residues at corresponding positions are then compared. When a position in the first sequence is occupied by the same nucleotide or residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch ((1970) J. Mol. Biol.48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package, using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. In some embodiments, methods described herein comprise introducing a mutation into the Nrip1 gene and an additional gene. In some embodiments, the additional gene is involved in negative regulation of cAMP levels. Non-limiting examples of a gene involved in negative regulation of cAMP levels include a phosphodiesterase (PDE) gene, an inhibitory G protein (Gai) gene, an adenosine receptor gene, and a protein kinase A (PKA) gene. In some embodiments, the additional gene is a FASN gene. Attorney Docket 07917-0452WO1 / UMMS 24-36 Methods described herein encompass introducing a mutation into any isoform of a gene, e.g., a gene involved in negative regulation of cAMP levels or a FASN gene. For example, when methods comprise introducing a mutation into a PDE gene, methods can comprise introducing a mutation into a PDE1 gene, a PDE2 gene, a PDE3 gene, a PDE4 gene, a PDE5 gene, a PDE6 gene, a PDE7 gene, a PDE8 gene, a PDE9 gene, a PDE10 gene, a PDE11 gene, or a combination thereof. In another example, when methods comprise introducing a mutation into an adenosine receptor gene, the methods can comprise introducing a mutation into an A1 gene, an A2A gene, an A2Bgene, an A3gene, or a combination thereof. (b) Engineered Nucleases The present methods can include genetically modifying adipose cells using an engineered nuclease to disrupt a target gene such as Nrip1. The engineered nuclease can be transiently or stably expressed in the adipose cell, using methods known in the art; typically, to obtain expression, a sequence encoding a protein is subcloned into an expression vector that contains a promoter to direct transcription. Suitable eukaryotic expression systems are well known in the art and described, e.g., in Sambrook et al., Molecular Cloning, A Laboratory Manual (4th ed.2013); Kriegler, Gene Transfer and Expression: A Laboratory Manual (2006); and Current Protocols in Molecular Biology (Ausubel et al., eds., 2010). Transformation of adipose cells can be performed according to standard techniques (see, e.g., the reference above and Morrison, 1977, J. Bacteriol.132:349-351; Clark- Curtiss & Curtiss, Methods in Enzymology 101:347-362 (Wu et al., eds, 1983). Alternatively, the engineered nuclease can be expressed and purified and introduced into adipose cells as purified proteins or protein complexes. There are presently four main classes of engineered nucleases: (1) meganucleases, (2) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Cas RNA-guided nucleases (RGN) (3) zinc-finger nucleases, and (4) transcription activator effector-like nucleases (TALEN). Each are described below. Also see, e.g., Gaj et al., Trends Biotechnol.2013 Jul;31(7):397-405. Attorney Docket 07917-0452WO1 / UMMS 24-36 (1) Meganucleases Meganucleases are sequence-specific endonucleases originating from a variety of organisms such as bacteria, yeast, algae and plant organelles. Endogenous meganucleases have recognition sites of 12 to 30 base pairs; customized DNA binding sites with 18bp and 24bp-long meganuclease recognition sites have been described, and either can be used in the present methods and constructs. See, e.g., Silva, G., et al., Current Gene Therapy, 11:11-27, (2011); Arnould et al., Journal of Molecular Biology, 355:443-58 (2006); Arnould et al., Protein Engineering Design & Selection, 24:27-31 (2011); and Stoddard, Q. Rev. Biophys.38, 49 (2005); Grizot et al., Nucleic Acids Research, 38:2006-18 (2010). (2) RNA-guided nucleases (RGNs) and Guide RNAs The present methods include the use of RNA-guided nucleases (RGNs) targeted to a target region of the Nrip1 gene as described herein, to engineer adipocytes to disrupt the expression of Nrip1 and increase expression of UCP1. The methods can include the use of RGNs including Cas9, Cpf1, and orthologs thereof. The Cas9 nuclease from S. pyogenes can be guided via simple base pair complementarity between 17-20 nucleotides of an engineered guide RNA (gRNA), e.g., a single guide RNA or crRNA / tracrRNA pair, and the complementary strand of a target genomic DNA sequence of interest that lies next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG (Shen et al., Cell Res (2013); Dicarlo et al., Nucleic Acids Res (2013); Jiang et al., Nat Biotechnol 31, 233-239 (2013); Jinek et al., Elife 2, e00471 (2013); Hwang et al., Nat Biotechnol 31, 227-229 (2013); Cong et al., Science 339, 819-823 (2013); Mali et al., Science 339, 823-826 (2013c); Cho et al., Nat Biotechnol 31, 230-232 (2013); Jinek et al., Science 337, 816-821 (2012)). The engineered CRISPR from Prevotella and Francisella 1 (Cpf1, also known as Cas12a) nuclease can also be used, e.g., as described in Zetsche et al., Cell 163, 759-771 (2015); Schunder et al., Int J Med Microbiol 303, 51-60 (2013); Makarova et al., Nat Rev Microbiol 13, 722-736 (2015); Fagerlund et al., Genome Biol 16, 251 (2015). Unlike SpCas9, Cpf1 / Cas12a requires only a single 42-nt crRNA, which has 23 nt at its 3’ end that are complementary to the protospacer of the target DNA sequence (Zetsche et al., 2015). Furthermore, whereas SpCas9 recognizes an NGG PAM sequence that is 3’ of the protospacer, Attorney Docket 07917-0452WO1 / UMMS 24-36 AsCpf1 and LbCp1 recognize TTTN PAMs that are found 5’ of the protospacer (Zetsche et al., 2015). In some embodiments, the present system utilizes a wild type or variant Cas9 protein from S. pyogenes or Staphylococcus aureus, or a wild type or variant Cpf1 protein from Acidaminococcus sp. BV3L6 or Lachnospiraceae bacterium ND2006 either as encoded in bacteria or codon-optimized for expression in mammalian cells and / or modified in its PAM recognition specificity and / or its genome-wide specificity. A number of variants have been described; see, e.g., WO 2016 / 141224, PCT / US2016 / 049147, Kleinstiver et al., Nat Biotechnol. 2016 Aug;34(8):869-74; Tsai and Joung, Nat Rev Genet.2016 May;17(5):300-12; Kleinstiver et al., Nature.2016 Jan 28;529(7587):490-5; Shmakov et al., Mol Cell.2015 Nov 5;60(3):385-97; Kleinstiver et al., Nat Biotechnol.2015 Dec;33(12):1293-1298; Dahlman et al., Nat Biotechnol. 2015 Nov;33(11):1159-61; Kleinstiver et al., Nature.2015 Jul 23;523(7561):481-5; Wyvekens et al., Hum Gene Ther.2015 Jul;26(7):425-31; Hwang et al., Methods Mol Biol.2015;1311:317-34; Osborn et al., Hum Gene Ther.2015 Feb;26(2):114-26; Konermann et al., Nature.2015 Jan 29;517(7536):583-8; Fu et al., Methods Enzymol.2014;546:21-45; and Tsai et al., Nat Biotechnol.2014 Jun;32(6):569-76, inter alia. Cas9 and analogs are shown in Table 2, and engineered protospacer-adjacent motif (PAM) or high-fidelity variants are shown in Table 3. Table 2. List of Exemplary Cas9 or Cas12a Orthologs. Ortholog UniProt or GenBank A i N b Attorney Docket 07917-0452WO1 / UMMS 24-36 Table 3. List of Exemplary High Fidelity and / or PAM-relaxed RGN Orthologs. Published PMID / USSN Mutations* HF / PAM-RGN Attorney Docket 07917-0452WO1 / UMMS 24-36 E174R / S542R / K548R / N551R, E174R / S542R / K607H, S170R / S542R / K607R, or enLbCas12a(HF) USSN One or more of T152R, T152K, D156R, D156K, 15 / 960,271 Q529K, G532R, G532K, G532Q, K538R, K538V, D541R, Y542R, M592A, K595R, K595H, K595S or K595Q, e.g., D156R / G532R / K538R, D156R / G532R / K595R, D156R / G532R / K538V / Y542R, T152R / G532R / K538R, T152R / D156R, D156R / G532R, T152R / G532R, D156R / G532R / K538R / D541R, D156R / G532R / K595H, T152R / G532R / K595R, T152R / G532R / K538V / Y542R, optionally with the addition of one or more of: N260A, N256A, K514A, D505A, K881A, S286A, K272A, K897A enFnCas12a(HF) USSN One or more of T177A, K180R, K180K, E184R, 15 / 960,271 E184K, T604K, N607R, N607K, N607Q, K613R, K613V, D616R, N617R, M668A, K671R, K671H, K671S, or K671Q, e.g., E184R / N607R / K613R, E184R / N607R / K671R, E184R / N607R / K613V / N617R, K180R / N607R / K613R, K180R / E184R, E184R / N607R, K180R / N607R, E184R / N607R / K613R / D616R, E184R / N607R / K671H, K180R / N607R / K671R, K180R / N607R / K613V / N617R, optionally with the addition of one or more of: N305A, N301A, K589A, N580A, K962A, S334A, K320A, K978A * predicted based on UniRule annotation on the UniProt database. In some embodiments an RGN sequence is modified to include one or more nuclear localization sequences (NLSs), e.g., at the C- and / or N-terminus of the RGN protein, and a mini- polyadenylation signal (or Poly-A sequence). Exemplary NLSs include SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 1)); PKKKRKV (SEQ ID NO: 2); KRTADGSEFESPKKKRKV (SEQ ID NO: 3)); and nucleoplasmin NLS KRPAATKKAGQAKKKK (SEQ ID NO: 4)). Other NLSs are known in the art; see, e.g., Cokol et al., EMBO Rep.2000 Nov 15; 1(5):411–415; Freitas and Cunha, Curr Genomics.2009 Dec; 10(8): 550–557. An exemplary polyadenylation signal is Attorney Docket 07917-0452WO1 / UMMS 24-36 TAGCAATAAAGGATCGTTTATTTTCATTGGAAGCGTGTGTTGGTTTTTTGATCAGGCG CG (SEQ ID NO: 5). Guide RNAs appropriate for the RGN and the target gene should be used. In some embodiments, the gRNAs used in the present disclosure can be unimolecular (also referred to as single-molecule guide RNA (sgRNA)) or modular, as known in the art. Exemplary sgRNAs targeting a Nrip1 gene are provided below in Table 4. Table 4. Sequences of exemplary sgRNAs. Mouse Nrip1 sgRNA sequences (5’^ 3’) Human NRIP1 sgRNA sequences (5’^ 3’) sgRNA-M1 CUUGUAUUGAACAUGACUCA sgRNA-H1 CUUCUAUUGAACAUGACUCA C C C C A The gRNA targets a target sequence in a target gene. The target sequence is adjacent to a PAM sequence and is the sequence to be modified by Cas9. The target sequence is on the so- called PAM-strand in a target gene or a target nucleic acid, which is a double-stranded molecule containing the PAM-strand and a complementary non-PAM strand. One of skill in the art recognizes that the gRNA sequence hybridizes to the complementary sequence located in the non-PAM strand of the target nucleic acid. Thus, the gRNA sequence is the RNA equivalent of the target sequence. For example, if the Nrip1 target sequence is TTTGCATGGTCCCTAAGAAA (SEQ ID NO: 22), then the gRNA sequence is UUUGCAUGGUCCCUAAGAAA (SEQ ID NO: 18). It should be understood that when the gRNA sequence is described in terms of its target sequence, the target sequence can contain T and the gRNA sequence can contain U. Attorney Docket 07917-0452WO1 / UMMS 24-36 In some embodiments, the gRNA comprises a sequence of at least 10 contiguous nucleotides of a target sequence within exon 4 of the Nrip1 gene (e.g., SEQ ID NO: 21). In some embodiments, the guide RNA comprises a sequence of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 contiguous nucleotides of a target sequence within exon 4 of the Nrip1 gene (e.g., SEQ ID NO: 21). In some embodiments, the target sequence comprises nucleotides 596-3811, 596-3110, 665-3811, or 665-3110 within exon 4 of the Nrip1 gene (e.g., SEQ ID NO: 21). In some embodiments, the target sequence comprises nucleotides 250, 300, 350, 400, 450, or 500 on the 5’ end and nucleotides 2950, 3000, 3050, 3100, or 3110 on the 3’ end (and all ranges with any of the foregoing values as endpoints) within exon 4 of the Nrip1 gene (e.g., SEQ ID NO: 21). In some embodiments, the target sequence comprises nucleotides 250, 300, 350, 400, 450, 500, or 550 on the 5’ end and nucleotides 750, 800, 850, or 100 on the 3’ end (and all ranges with any of the foregoing values as endpoints) within exon 4 of the Nrip1 gene (e.g., SEQ ID NO: 21). In some embodiments, the target sequence comprises nucleotides 2500, 2550, 2600, 2650, 2750, or 2800 on the 5’ end and nucleotides 2950, 3000, 3050, 3100, or 3110 on the 3’ end (and all ranges with any of the foregoing values as endpoints) within exon 4 of the Nrip1 gene (e.g., SEQ ID NO: 21). In some embodiments, the target sequence comprises any of the target regions of the human Nrip1 gene shown in Table 1, plus up to 50, 75, 100, 200, 300, 400, 500, 750, or 1000 nucleotides on either side. In some embodiments, the degree of complementarity between the gRNA sequence and the target sequence in the target gene (e.g., the Nrip1 gene) can be about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100%. In some embodiments, the gRNA sequence and the target sequence in the target gene is 100%. In some embodiments, the gRNA sequence and the target sequence in the target gene can contain up to 10 mismatches, e.g., up to 9, up to 8, up to 7, up to 6, up to 5, up to 4, up to 3, up to 2, or up to 1 mismatch. Attorney Docket 07917-0452WO1 / UMMS 24-36 In some embodiments, the gRNA (e.g., sgRNA) is from 15-100 nucleotides long (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides long). Any of the gRNAs disclosed herein, including any of the sgRNAs, can be modified or unmodified. In some embodiments, the gRNA can include one or more modified nucleotides and / or modified backbones. In some embodiments, a modified gRNA such as an sgRNA can comprise one or more 2'-O-methyl phosphorothioate nucleotides, which can be located at either the 5’ end, the 3’ end, or both. Engineered nucleases can also include base editors, prime editors, and other CRISPR-Cas based proteins that introduce genomic edits in living cells. (3) Zinc Finger Nucleases (ZFNs) ZFNs are enzymes generated by fusing a zinc finger DNA-binding domain to a DNA- cleavage domain, thereby enabling ZFNs to recognize and target highly specific chromosomal sequences to facilitate disruption of a target gene (e.g., the Nrip1 gene). These nucleases exploit endogenous cellular mechanisms for homologous recombination and repair of double stranded breaks in genetic material. ZFNs can be used to target a wide variety of endogenous nucleic acid sequences in a cell or organism. The ZFN can include multiple (e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or more)) zinc fingers in order to improve its target specificity. The zinc finger domain can be derived from any class or type of zinc finger. For example, the zinc finger domain can include the Cys2His2 type of zinc finger that is very generally represented, for example, by the zinc finger transcription factors TFIIIA or Sp1. In a preferred embodiment, the zinc finger domain comprises three Cys2His2 type zinc fingers. The DNA-cleavage domain of the ZFN can be derived from a class of non-specific DNA cleavage domains, for example the DNA-cleavage domain of a Type II restriction enzyme such as FokI. Thus, a ZFN useful in the present methods can include three Cys2His2 type zinc fingers and a DNA-cleavage domain derived from the Type II restriction enzyme FokI. In this event, each zinc finger contacts three consecutive base pairs of DNA creating a 9 bp recognition sequence for the ZFN DNA binding domain. The DNA-cleavage domain of the embodiment requires dimerization of two ZFN DNA-cleavage domains for effective cleavage of double- stranded DNA. This imposes a requirement for two inverted recognition (target DNA) sites Attorney Docket 07917-0452WO1 / UMMS 24-36 within close proximity for effective targeted genetic recombination. If all positions in the target sites are contacted specifically, these requirements enforce recognition of a total of 18 base pairs of DNA. There may be a space between the two sites. The space between recognition sites for ZFNs may be equivalent to 6 to 35 bp of DNA. The region of DNA between the two recognitions sites may be referred to as the “spacer.” A linker, if present, between the cleavage and recognition domains of the ZFN can be a sequence of amino acid residues that result in a flexible linker, although linkerless constructs tend to improve target site specificity. A linkerless construct has a strong preference for binding to and then cleaving between recognition sites that are 6 bp apart. However, with linker lengths of between 0 and about 18 amino acids in length, ZFN-mediated cleavage occurs between recognition sites that are between 5 and 35 bp apart. For a given linker length, there will be a limit to the distance between recognition sites that is consistent with both binding and dimerization. As noted, there may be no linker between the cleavage and recognition domains, and the target locus can include two nine nucleotide recognition sites in inverted orientation with respect to one another, separated by a six nucleotide spacer. To target genetic recombination or mutation, two 9 bp zinc finger DNA recognition sequences are identified in the host DNA. These recognition sites will be in an inverted orientation with respect to one another and separated by about 6 bp of DNA. ZFNs are then generated by designing and producing zinc finger combinations that bind DNA specifically at the target locus, and then linking the zinc fingers to a DNA-cleavage domain. (4) Transcription Activator-Like Effector Nulceases (TALENs) TALENs function in a manner somewhat similar to ZFNs, in that they can be used to induce sequence-specific cleavage; see, e.g., Hockemeyer et al., Nat Biotechnol.29(8):731-4 (2011); Moscou et al., 2009, Science 326:1501; Boch et al., 2009, Science 326:1509-1512. Methods are known in the art for designing TALENs, see, e.g., Rayon et al., Nature Biotechnology 30:460–465 (2012). Methods for generating engineered TALE arrays are known in the art, see, e.g., the fast ligation-based automatable solid-phase high-throughput (FLASH) system described in USSN 61 / 610,212, and Reyon et al., Nature Biotechnology 30,460–465 (2012); as well as the methods described in Bogdanove & Voytas, Science 333, 1843-1846 (2011); Bogdanove et al., Curr Opin Plant Biol 13, 394-401 (2010); Scholze & Boch, J. Curr Opin Microbiol (2011); Boch et al., Attorney Docket 07917-0452WO1 / UMMS 24-36 Science 326, 1509-1512 (2009); Moscou & Bogdanove, Science 326, 1501 (2009); Miller et al., Nat Biotechnol 29, 143-148 (2011); Morbitzer et al., T. Proc Natl Acad Sci U S A 107, 21617- 21622 (2010); Morbitzer et al., Nucleic Acids Res 39, 5790-5799 (2011); Zhang et al., Nat Biotechnol 29, 149-153 (2011); Geissler et al., PLoS ONE 6, e19509 (2011); Weber et al., PLoS ONE 6, e19722 (2011); Christian et al., Genetics 186, 757-761 (2010); Li et al., Nucleic Acids Res 39, 359-372 (2011); Mahfouz et al., Proc Natl Acad Sci USA 108, 2623-2628 (2011); Mussolino et al., Nucleic Acids Res (2011); Li et al., Nucleic Acids Res 39, 6315-6325 (2011); Cermak et al., Nucleic Acids Res 39, e82 (2011); Wood et al., Science 333, 307 (2011); Hockemeye et al. Nat Biotechnol 29, 731-734 (2011); Tesson et al., Nat Biotechnol 29, 695-696 (2011); Sander et al., Nat Biotechnol 29, 697-698 (2011); Huang et al., Nat Biotechnol 29, 699- 700 (2011); and Zhang et al., Nat Biotechnol 29, 149-153 (2011); all of which are incorporated herein by reference in their entirety. Also suitable for use in the present methods are MegaTALs, which are a fusion of a meganuclease with a TAL effector; see, e.g., Boissel et al., Nucl. Acids Res.42(4):2591-2601 (2014); Boissel and Scharenberg, Methods Mol Biol.2015;1239:171-96. (c) Inhibitory Nucleic Acids Alternatively, the present methods can include the use of inhibitory nucleic acids that are directed to the target region of Nrip1. Inhibitory nucleic acids useful in the present methods and compositions include antisense oligonucleotides, ribozymes, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, modified bases / locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and other oligomeric compounds or oligonucleotide mimetics that hybridize to at least a portion of the target nucleic acid and modulate its function. In some embodiments, the inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof. See, e.g., WO 2010040112. Attorney Docket 07917-0452WO1 / UMMS 24-36 (d) Delivery to Adipose Cells Nucleic acids and proteins involved in gene editing can be delivered to adipose cells using any method suitable for delivery of such into the adipose cells. For example, sequences encoding an inhibitory nucleic acid or an engineered nuclease (e.g., meganuclease, ZFN, TALEN, or RGN and guide RNA) can be delivered to the cells using electroporation. Also described herein are targeted expression vectors for in vivo transfection and expression of a polynucleotide that encodes a engineered nuclease, e.g., RGN and guide RNA, as described herein in adipocytes. Expression constructs of such components can be administered in any effective carrier, e.g., any formulation or composition capable of effectively delivering the component gene to the cells. Approaches include insertion of the gene in viral vectors, including recombinant retroviruses, adenovirus, adeno-associated virus, lentivirus, and herpes simplex virus-1, alphavirus, vaccinia virus, or recombinant bacterial or eukaryotic plasmids. Viral vectors transfect cells directly; plasmid or naked DNA can be delivered naked or with the help of, for example, cationic liposomes (lipofectamine) or derivatized (e.g., antibody conjugated), cationic dendrimers, inorganic vectors (e.g., iron oxide magnetofection), lipidoids, cell-penetrating peptides, cyclodextrin polymer (CDP), polylysine conjugates, gramacidin S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaPO4 precipitation carried out in vivo. An exemplary approach for in vivo introduction of nucleic acid into a cell is by use of a viral vector containing nucleic acid, e.g., a cDNA. Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells that have taken up viral vector nucleic acid. Viral vectors can be used as a recombinant gene delivery system for the transfer of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells, and in some cases the transferred nucleic acids are stably integrated into the chromosomal DNA of the host. Protocols for producing recombinant viruses and for infecting cells in vitro or in vivo with such viruses can be found in Ausubel, et al., eds., Gene Therapy Protocols Volume 1: Production and In Vivo Applications of Gene Transfer Vectors, Humana Press, (2008), pp.1-32 and other standard laboratory manuals. Attorney Docket 07917-0452WO1 / UMMS 24-36 A preferred viral vector system useful for delivery of nucleic acids is the adeno- associated virus (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al., Curr. Topics in Micro and Immunol.158:97-129 (1992); see also Domenger and Grimm, Human Molecular Genetics, 28(R1):R3–R14 (October 2019)). AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo. Although AAV vector genomes can persist within cells as episomes, vector integration has been observed (see for example Deyle and Russell, Curr Opin Mol Ther.2009 Aug; 11(4): 442–447; Asokan et al., Mol Ther.2012 April; 20(4): 699–708; Flotte et al., Am. J. Respir. Cell. Mol. Biol.7:349-356 (1992); Samulski et al., J. Virol.63:3822-3828 (1989); and McLaughlin et al., J. Virol.62:1963-1973 (1989)). AAV vectors, particularly AAV2, have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther.2009 Aug; 11(4): 442–447; Asokan et al., Mol Ther.2012 April; 20(4): 699– 708. AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression. Space for exogenous DNA is limited to about 4.5 kb. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example the references cited above and those cited in Asokan et al., Molecular Therapy (2012); 204, 699–708; and Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al., Mol. Cell. Biol.4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol.51:611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993). In some embodiments, a self-complementary AAV is used, which contains an inverted repeat genome that folds to make double-stranded DNA. In some embodiments, preferred viral vectors are adeno-associated virus type 5 (AAV5), see, e.g., Sharma et al., Hum Gene Ther Methods.2016 Dec;27(6):219-227, or AAV8, see Jimenez et al., EMBO Mol Med.2018 Aug; 10(8): e8791 Retroviruses can also be used. The development of specialized cell lines (termed “packaging cells”) which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are characterized for use in gene Attorney Docket 07917-0452WO1 / UMMS 24-36 transfer for gene therapy purposes (for a review see Katz et al., Human Gene Therapy 24:914 (2013)). A replication defective retrovirus can be packaged into virions, which can be used to infect a target cell through the use of a helper virus by standard techniques. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include ^Crip, ^Cre, ^2 and ^Am. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro and / or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641- 647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol.150:4104-4115; U.S. Patent No.4,868,116; U.S. Patent No.4,980,286; PCT Application WO 89 / 07136; PCT Application WO 89 / 02468; PCT Application WO 89 / 05345; and PCT Application WO 92 / 07573). Another viral gene delivery system useful in the present methods utilizes adenovirus- derived vectors. The genome of an adenovirus can be manipulated, such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See, for example, Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al., Science 252:431-434 (1991); and Rosenfeld et al., Cell 68:143-155 (1992). Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus (e.g., Ad2, Ad3, Ad7, etc.) are known to those skilled in the art. Recombinant adenoviruses can be advantageous in certain circumstances, in that they are not capable of infecting non-dividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al., (1992) supra). Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity. Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situ, where introduced Attorney Docket 07917-0452WO1 / UMMS 24-36 DNA becomes integrated into the host genome (e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al., supra; Haj-Ahmand and Graham, J. Virol.57:267 (1986). In some embodiments, sequences encoding an engineered nuclease, e.g., TALE, ZFN, or RGN and guide RNAs, are entrapped in liposomes bearing positive charges on their surface (e.g., lipofectins), which can be tagged with antibodies against cell surface antigens of the target tissue (Mizuno et al., No Shinkei Geka 20:547-551 (1992); PCT publication WO91 / 06309; Japanese patent application 1047381; and European patent publication EP-A-43075). The vectors can also include promoters, enhancers (e.g., CMV enhancer), other cis- regulatory elements, and / or capsid serotype variants. With regard to promoters, vectors can include promoters that drive expression in many cell types (e.g., CAG or CASI) or specifically in adipocytes (e.g., adiponectin or adipocyte P2 (aP2) promoter). Other cis-regulatory elements can include woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), adipocyte P2 enhancer, or minute virus of mice (MVM) intron (see Domenger and Grimm, Human Molecular Genetics, 28(R1):R3–R14 (October 2019)). Alternatively, the methods can include delivering an RGN and guide RNA together, e.g., as a complex. For example, the RGN and gRNA can be overexpressed in a host cell and purified, then complexed with the guide RNA (e.g., in a test tube) to form a ribonucleoprotein (RNP), and delivered to cells. In some embodiments, the RGN can be expressed in and purified from bacteria through the use of bacterial expression plasmids. For example, His-tagged deaminase fusion protein can be expressed in bacterial cells and then purified using nickel affinity chromatography. The use of RNPs circumvents the necessity of delivering plasmid DNAs encoding the nuclease or the guide, or encoding the nuclease as an mRNA. RNP delivery may also improve specificity, presumably because the half-life of the RNP is shorter and there’s no persistent expression of the nuclease and guide (as you’d get from a plasmid). The RNPs can be delivered to the cells in vivo or in vitro, e.g., using lipid-mediated transfection or electroporation. See, e.g., Liang et al. “Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection.” Journal of biotechnology 208 (2015): 44-53; Zuris, John A., et al. “Cationic lipid- mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo.” Nature biotechnology 33.1 (2015): 73-80; Kim et al. “Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins.” Genome Attorney Docket 07917-0452WO1 / UMMS 24-36 research 24.6 (2014): 1012-1019. Other engineered nuclease proteins, e.g., Meganucleases, TALEs, or ZFNs, can also be produced and delivered in this manner. Differentiating Adipose Progenitor Cells Adipose progenitor cells can be differentiated using any method known in the art. For example, to differentiate into brite fat cells, the HACAPS can be cultured, e.g., in proprietary media EGM2-MV (Lonza) or a formulation consisting of Media 199 supplemented with glucose (e.g., 10 mM), ascorbic acid (e.g., 500 mM), hydrocortisone (e.g., 1 µM) and human recombinant FGF-2 (e.g., 0.1 nM), until confluence is reached, and then exposed to adipogenic cocktail, e.g., comprising DMEM containing 10% (v / v) FBS, 3-isobutyl-1-methylxanthine (e.g., 500 µM), dexamethasone (e.g., 100 nM) and insulin (e.g., 1 µM) for 3 days. The cells are then cultured for an additional time, e.g., 5-10 days, e.g., 7 days in media, e.g., in DMEM containing 10% (v / v) FBS, and then in the same medium supplemented with adenylate cyclase activators such as forskolin (e.g., 1 µM) or adrenergic agonists such as isoproterenol (e.g., 10 µM), epinephrine (e.g., 10 µM), norepinephrine (e.g., 10 µM), terbutaline (e.g., 10 µM) or dobutamine (e.g., 10 µM) or to thyroid hormone (T3, e.g., 10 µM) for 1 week to induce differentiation of the HACAPS into brite cells. These methods are exemplary, and other methods can also be used. The adipose progenitor cells (e.g., HACAPS) can be differentiated into adipocytes and cultured, e.g., in the presence of forskolin or adrenergic agonists such as isoproterenol, epinephrine, norepinephrine, terbutaline or dobutamine, or the thyroid hormone tri-iodo- thyronine (T3), to induce a brite adipocyte phenotype. In some embodiments, the adipose progenitor cells are differentiated to mature adipocytes prior to transplantation into a subject. In some embodiments, the adipose progenitor cells are genetically engineered prior to differentiation, and then used for treating a subject. In some embodiments, the adipose progenitor cells are maintained in culture, differentiated into adipocytes (e.g., by incubation in the presence of MDI), and then used for treating a subject. In some embodiments, the adipose progenitor cells are differentiated to mature adipocytes prior to supercharging. Alternatively, or in addition to, the adipose progenitor cells can be simultaneously differentiated and supercharged. Attorney Docket 07917-0452WO1 / UMMS 24-36 Supercharging Adipose Cells Supercharging adipose cells into a thermogenic state can be performed at any time in methods described herein, e.g., before differentiation, after differentiation, simultaneously with differentiation, before genetic editing, or after genetic editing. Methods for supercharging adipose cells can comprise treating adipose cells (e.g., progenitor adipose cells, mature adipose cells, progenitor adipose cells comprising a disrupted Nrip1 gene, mature adipose cells comprising a disrupted Nrip1 gene, or a combination of any of these) with any of the combination treatments described herein to produce thermogenic adipose cells. Non-limiting examples of supercharging treatments include: (i) treatment with an engineered nuclease or an inhibitory nucleic acid targeting a Nrip1 gene, a PPAR activator (e.g., a PPARγ activator, a PPARα activator, a PPARα / γ), and a cAMP activator; (ii) treatment with an engineered nuclease or an inhibitory nucleic acid targeting a Nrip1 gene, a cAMP activator, and a FASN inhibitor; (iii) treatment with an engineered nuclease or an inhibitory nucleic acid targeting a Nrip1 gene, a PPAR activator (e.g., a PPARγ activator, a PPARα activator, a PPARα / γ), a cAMP activator, a FASN inhibitor, and a RXR agonist; (iv) treatment with an engineered nuclease or an inhibitory nucleic acid targeting a Nrip1 gene, a PPAR activator (e.g., a PPARγ activator, a PPARα activator, a PPARα / γ), a FASN inhibitor, and a RXR agonist; and (v) treatment with an engineered nuclease or an inhibitory nucleic acid targeting a Nrip1 gene, a PPAR activator (e.g., a PPARγ activator, a PPARα activator, a PPARα / γ), a cAMP activator, and a RXR agonist. Methods for supercharging adipose cells described herein encompass treating adipose cells with any of the combination treatments described herein in a sequential manner (each treatment is performed at a different time), a substantially simultaneous manner (each treatment is performed at substantially the same time), or both (a single treatment is before prior to a substantially simultaneous treatment or vice versa). Methods for supercharging adipose cells described herein encompass treating adipose cells (e.g., progenitor adipose cells, mature adipose cells, progenitor adipose cells comprising a disrupted Nrip1 gene, mature adipose cells comprising a disrupted Nrip1 gene, or a combination of any of these) with any of the combination treatments described herein in any order and for any length of time suitable for producing thermogenic adipose cells. Attorney Docket 07917-0452WO1 / UMMS 24-36 In some embodiments, adipose cells (e.g., progenitor adipose cells, mature adipose cells, progenitor adipose cells comprising a disrupted Nrip1 gene, mature adipose cells comprising a disrupted Nrip1 gene, or a combination of any of these) are treated with an engineered nuclease or an inhibitory nucleic acid targeting a Nrip1 gene for any length of time suitable for disrupting the Nrip1 gene, e.g., for about 12 to about 48 hours (e.g., about 24 to about 48 hours, about 36 to about 48 hours, about 12 to about 36 hours, or about 12 to about 24 hours). In some embodiments, methods described herein comprise treating adipose cells (e.g., progenitor adipose cells, mature adipose cells, progenitor adipose cells comprising a disrupted Nrip1 gene, mature adipose cells comprising a disrupted Nrip1 gene, or a combination of any of these) with a PPAR activator (e.g., a PPARγ activator (e.g., rosiglitazone), a PPARα activator (e.g., fenofibrate), a PPARα / γ (e.g., tesaglitazar)) prior to treating the adipose cells with a cAMP activator (e.g., forskolin). In such instances, methods can comprise treating adipose cells with a PPAR activator for about 12 to about 48 hours (e.g., about 24 to about 48 hours, about 36 to about 48 hours, about 12 to about 36 hours, or about 12 to about 24 hours) and with a cAMP activator for about 12 to about 36 hours (e.g., about 24 to about 36 hours or about 12 to about 24 hours). In some embodiments, methods described herein comprise treating adipose cells (e.g., progenitor adipose cells, mature adipose cells, progenitor adipose cells comprising a disrupted Nrip1 gene, mature adipose cells comprising a disrupted Nrip1 gene, or a combination of any of these) with a PPAR activator (e.g., a PPARγ activator (e.g., rosiglitazone), a PPARα activator (e.g., fenofibrate), a PPARα / γ (e.g., tesaglitazar)) prior to treating the adipose cells with a cAMP activator (e.g., forskolin) and a FASN inhibitor (e.g., TVB2640). In such instances, methods can comprise treating adipose cells with a PPAR activator for about 12 to about 48 hours (e.g., about 24 to about 48 hours, about 36 to about 48 hours, about 12 to about 36 hours, or about 12 to about 24 hours) and with a cAMP activator and a FASN inhibitor for about 12 to about 36 hours (e.g., about 24 to about 36 hours or about 12 to about 24 hours). In some embodiments, methods described herein comprise treating adipose cells (e.g., progenitor adipose cells, mature adipose cells, progenitor adipose cells comprising a disrupted Nrip1 gene, mature adipose cells comprising a disrupted Nrip1 gene, or a combination of any of these) with a PPAR activator (e.g., a PPARγ activator (e.g., rosiglitazone), a PPARα activator (e.g., fenofibrate), a PPARα / γ (e.g., tesaglitazar)) prior to treating the adipose cells with a cAMP Attorney Docket 07917-0452WO1 / UMMS 24-36 activator (e.g., forskolin), a FASN inhibitor (e.g., TVB2640), and a RXR agonist (e.g., CD3525). In such instances, methods can comprise treating adipose cells with a PPAR activator for about 12 to about 48 hours (e.g., about 24 to about 48 hours, about 36 to about 48 hours, about 12 to about 36 hours, or about 12 to about 24 hours) and with a cAMP activator, a FASN inhibitor, and a RXR agonist for about 12 to about 36 hours (e.g., about 24 to about 36 hours or about 12 to about 24 hours). In some embodiments, methods described herein comprise treating adipose cells (e.g., progenitor adipose cells, mature adipose cells, progenitor adipose cells comprising a disrupted Nrip1 gene, mature adipose cells comprising a disrupted Nrip1 gene, or a combination of any of these) with a PPAR activator (e.g., a PPARγ activator (e.g., rosiglitazone), a PPARα activator (e.g., fenofibrate), a PPARα / γ (e.g., tesaglitazar)) prior to treating the adipose cells with a FASN inhibitor (e.g., TVB2640) and a RXR agonist (e.g., CD3525). In such instances, methods can comprise treating adipose cells with a PPAR activator for about 12 to about 48 hours (e.g., about 24 to about 48 hours, about 36 to about 48 hours, about 12 to about 36 hours, or about 12 to about 24 hours) and with a FASN inhibitor and a RXR agonist for about 12 to about 36 hours (e.g., about 24 to about 36 hours or about 12 to about 24 hours). In some embodiments, methods described herein comprise treating adipose cells (e.g., progenitor adipose cells, mature adipose cells, progenitor adipose cells comprising a disrupted Nrip1 gene, mature adipose cells comprising a disrupted Nrip1 gene, or a combination of any of these) with a PPAR activator (e.g., a PPARγ activator (e.g., rosiglitazone), a PPARα activator (e.g., fenofibrate), a PPARα / γ (e.g., tesaglitazar)) prior to treating the adipose cells with a cAMP activator (e.g., forskolin) and a RXR agonist (e.g., CD3525). In such instances, methods can comprise treating adipose cells with a PPAR activator for about 12 to about 48 hours (e.g., about 24 to about 48 hours, about 36 to about 48 hours, about 12 to about 36 hours, or about 12 to about 24 hours) and with a cAMP activator and a RXR agonist for about 12 to about 36 hours (e.g., about 24 to about 36 hours or about 12 to about 24 hours). Methods for supercharging adipose cells described herein encompass use of any method known in the art or described herein for genetic editing of adipose cells (e.g., genetic editing of Nrip1, genetic editing of Nrip1 and an additional gene). Non-limiting examples of methods for genetic editing of adipose cells are provided in the section entitled “Genetic Editing of Adipose Cells”. Attorney Docket 07917-0452WO1 / UMMS 24-36 Any PPAR activator suitable for activating one or more of PPAR (e.g., PPARγ, PPARα, PPARβ / δ, or a combination of any of these) can be used in methods for supercharging adipose cells described herein. Non-limiting examples of a PPARγ activator for use in methods described herein include troglitazone, pioglitazone, rosiglitazone, AMG131, or a combination thereof. Non-limiting examples of a PPARα activator for use in methods described herein include clofibrate, fenofibrate, bezafibrate, pemafibrate, gemfibrozil, or a combination thereof. Non- limiting examples of a pan PPAR activator (e.g., a PPARα / γ activator) for use in methods described herein include lobeglitazone, chiclitazar, aleglitazar, elafibranor, saroglitazar, muraglitazar, tesaglitazar, or a combination thereof. Any cAMP activator suitable for activating cAMP can be used in methods for supercharging adipose cells described herein. Non-limiting examples of a cAMP activator for use in methods described herein include CL 316243, forskolin, a cAMP analog (e.g., 8-bromo- cAMP or NKH477), or a combination of any of these. Any FASN inhibitor suitable for inhibiting FASN can be used in methods for supercharging adipose cells described herein. Non-limiting examples of a FASN inhibitor for use in methods described herein include C75, FT113, TVB2640, TVB3664, or a combination of any of these. Any RXR agonist suitable for activating RXR can be used in methods for supercharging adipose cells described herein. Non-limiting examples of a RXR agonist for use in methods described herein include bexarotene, CD3254, docosahexaenoic acid, LG100268, retinoic acid, SR11237, or a combination of any of these. Populations of Thermogenic Adipose Cells The present disclosure also provides populations of thermogenic adipose cells, i.e., populations of cells supercharged by a method described herein. The population of thermogenic adipose cells can include white adipose cells, brite adipose cells, brown adipose cells, or a combination thereof. In some embodiments, the present disclosure provides populations of thermogenic adipose cells (e.g., progenitor cells or mature cells) comprising a disrupted Nrip1 gene. In some embodiments, at least 50% (e.g., 60%, 70%, 80%, 90%, or 95%) of the population of Attorney Docket 07917-0452WO1 / UMMS 24-36 thermogenic adipose cells produced by methods described herein do not express a detectable level of NRIP1. In some embodiments, the population of thermogenic adipose cells comprises a disrupted Nrip1 gene and at least one additional gene edit such as a disrupted gene involved in negative regulation of cAMP levels (e.g., a disrupted PDE gene, a disrupted Gai gene, a disrupted adenosine receptor gene, a disrupted PKA gene, or a combination thereof) or a disrupted FASN gene. In some embodiments, at least 50% (e.g., 60%, 70%, 80%, 90%, or 95%) of the population of engineered adipose cells produced by methods described herein do not express a detectable level of a disrupted gene (e.g., a detectable level of NRIP1, a detectable level of FASN, or a detectable level of NRIP1 and FASN). Also within the scope of the present disclosure are populations of thermogenic adipose cells that are supercharged toward a thermogenic phenotype, e.g., supercharged to express UCP1. In some embodiments, at least 50% (e.g., 60%, 70%, 80%, 90%, or 95%) of the population of thermogenic adipose cells produced by methods described herein express UCP1. In some embodiments, a level of expression of UCP1 in cells in a population of supercharged, thermogenic adipose cells is at least 2-fold (e.g., 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9- fold, 10-fold, or more) greater than a level of expression of UCP1 in cells in a population of thermogenic adipose cells that have not been supercharged as described herein. II. Methods of Treatment Provided herein are methods of treating subjects (e.g., mammalian subjects, e.g., human or non-human veterinary subjects) who are overweight (BMI 25-29.9) or who have obesity (BMI > 30) that involve administering any of the thermogenic adipose cells described herein. Methods described herein also encompass treating subjects having a condition associated with an elevated BMI (e.g., BMI > 25) including, but are not limited to, metabolic syndrome, prediabetes, type 2 diabetes, lipodystrophy, cardiovascular disease (e.g., coronary artery disease (CAD), atherosclerosis, stroke), nephropathy, diabetic neuropathy, dyslipidemia, diabetic foot syndrome (DFS), leg or foot ulcers, impaired wound healing, fatty liver disease (e.g., nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH)), or a combination thereof. Lipodystrophy includes lipodystrophies associated with genetic mutations Attorney Docket 07917-0452WO1 / UMMS 24-36 (e.g., congenital generalized lipodystrophy (CGL), familial partial lipodystrophy (FPLD)) and / or viral infections (e.g., HIV infection). In some instances, a subject who is not overweight or obese (e.g., a subject having a BMI ˂ 25) can have a condition associated with an elevated BMI. Accordingly, methods described herein encompass treating a subject who is not overweight or obese and who has a condition associated with an elevated BMI. For example, methods described herein include treating a subject who is not overweight or obese (e.g., BMI ˂ 24.9) and who has lipodystrophy. Suitable subjects can be identified by one of skill in the art. For example, a subject who is overweight or obese and / or who has a condition associated with an elevated BMI can be identified by routine medical examination, e.g., laboratory tests, organ functional tests, physical examination, genetic testing, metabolic profiling, and combinations thereof. Methods described herein can be used to treat, or to reduce the risk of developing or worsening, of any of the conditions described herein including conditions associated with being overweight or obese such as metabolic syndrome and type 2 diabetes. The methods can result in improvement in one or more symptoms or clinical parameters of the condition, e.g., reduction in weight, reduction in insulin resistance, improved glucose tolerance (routinely measured by the fasting glucose test), reduction in need for insulin, and / or a reduction in symptoms, severity, or risk of developing cardiovascular disease, diabetic retinopathy, diabetic kidney failure, diabetic neuropathy, periodontal disease, and non-alcoholic fatty liver disease. In some embodiments, the subject has prediabetes, i.e., a precursor stage prior to the onset of diabetes mellitus in which not all of the symptoms required to diagnose diabetes are present, but blood sugar is abnormally high. Impaired fasting glycemia and impaired glucose tolerance are two forms of prediabetes that are similar in clinical definition (glucose levels that too high for their context) but are physiologically distinct (Disse, E; et al. (2013), Diabetes Metab., 39 (2): 132-138). Insulin resistance, the insulin resistance syndrome (metabolic syndrome or syndrome X), and prediabetes are closely related to one another and have overlapping aspects. Methods described herein include administering an effective amount of thermogenic adipose cells, i.e., adipocytes that have been supercharged according to methods described herein. Methods known in the art can be used to administer the thermogenic adipose cells, e.g., as described in Tran and Kahn, Nature Reviews Endocrinology 6, 195-213 (2010); Yoshimura et al., Breast J.16(2):169-75 (2010); Yoshimura et al., Dermatol Surg.34(9):1178-85 (2008); and Attorney Docket 07917-0452WO1 / UMMS 24-36 Yoshimura et al., Regen Med.4(2):265-73 (2009). For example, the thermogenic adipose cells can be administered by subcutaneous injection, site-specific transplantation, injection into a specific tissue, or intravenous injection, e.g., wherein the ASCs home to the injured tissue (see, e.g., Lee et al., J. Orthop. Res.27, 295-302 (2009); Kim et al., Int. J. Cardiol.146(3):371-8 (2011)). In some examples, the thermogenic adipose cells can be administered an adenylate cyclase activator (e.g., forskolin, catecholamine). Any of the thermogenic adipose cells described herein can be administered alone or in combination with another therapy. For example, when a subject has type 2 diabetes, the subject can be treated with thermogenic adipose cells or with thermogenic adipose cells and insulin therapy. Methods described herein encompass administering a single dose or multiple doses of thermogenic adipose cells to a subject. For example, a subject can be administered a single dose of thermogenic adipose cells. Alternatively, or in addition to, a subject can be administered multiple doses of thermogenic adipose cells (e.g., 2, 3, 4, 5, 6, 7, 8 or more doses). For clinical use, thermogenic adipose cells are preferably autologous, i.e., obtained from the same individual to whom the thermogenic adipose cells are to be administered. Alternatively, or in addition to, thermogenic adipose cells for clinical use are allogeneic, i.e., obtained from a different individual than the individual to whom the thermogenic adipose cells are to be administered. In some examples, when administering thermogenic adipose cells, methods described herein can further comprise administering an immunosuppressive agent to the subject. EXAMPLES In order that the invention described may be more fully understood, the following examples are set forth. The examples described in this application are offered to illustrate the methods and compositions provided herein and are not to be construed in any way as limiting their scope. Example 1: Screening Candidate Genes for Suppression of Adipocyte Browning The thermogenesis of NRIP1-deficient mouse adipocytes is about tenfold less than that of brown adipose tissue from mice. The goal of the experiments described herein was to identify a gene knockout that could be combined with NRIP1KO to increase the level of thermogenesis of Attorney Docket 07917-0452WO1 / UMMS 24-36 NRIP1-deficient adipocytes to that of brown adipose tissue. Genes that have been reported to increase UCP1 expression and thermogenesis were selected as candidate genes to combine with NRIP1KO to enhance the “browning” of white adipocytes. To screen candidate genes, individual gene knockouts were created in mouse adipocytes using CRISPR-based gene editing, and then UCP1 levels of the genetically modified adipocytes were measured. As shown in FIG.1, upregulation of UCP1 by 2-fold or more was observed for only 3 of the candidate genes: Isg15, zfp423, and Alk7. Thus, most of the candidate genes provided little to no increase in UCP1 expression. Example 2: Characterization of Candidate Genes The results described in Example 1 were surprising given that the candidate genes were reported to function as thermogenesis suppressor genes. At least one reason for the discrepancy between the literature and the results described in Example 1 may be that the candidate genes act more robustly on mechanisms that predominate early in the lineage towards beige adipocytes and that the primary mouse progenitors used in the experiments may have progressed beyond this early point. Thus, unlike NRIP1, which can function to increase “browning” at any stage of progenitor or mature adipocyte progression, the candidate genes may only function at early stages of browning. The candidate gene ZFP423 was used as an example to test whether candidate genes function at early stages of browning. The effect of the candidate gene ZFP423 on browning was examined in adipocyte progenitors obtained from 6-day-old and 4-week-old mice. As shown in FIG.2A, pieces of adipose tissue are much smaller when excised from 6-day-old mice that from 4-week-old mice, and less progenitors are obtained from them (as indicated by the amount of pelleted cells shown in 50 mL conical tubes). However, progenitors from both ages of mice were quite robust in their growth and fibroblastic appearance in culture (FIG.2B). In addition, upon differentiation to mature adipocytes, both sets of cells displayed plentiful lipid droplets and a full adipocyte appearance (FIG.2C). Importantly, there are no apparent differences in morphology of the control cells (FIG.2C, top left), ZPF423KO cells (FIG.2C, bottom left), NRIP1KO cells (FIG.2C, top right), or dual KO cells (FIG.2C, bottom right) at either at the 6-day or 4-week time points. Similar results were obtained using adipose tissue and progenitors from 7-week-old Attorney Docket 07917-0452WO1 / UMMS 24-36 and 16-week-old mice (data not shown). As shown in FIG.3, at least 50% editing efficiency was achieved in adipocytes derived from 6-day-old or 4-week-old mice. The candidate gene ZFP423 was also used as an example to test whether knockout of candidate genes in combination with NRIP1 can enhance thermogenesis compared to knockout of NRIP1 alone. FIGs.4A-4D show results of UCP1 upregulation in response to single and double knockouts of ZFP423 and NRIP1 in mature adipocytes derived from progenitors from either 6-day-old or 4-week-old mice. NRIP1KO strongly upregulated UCP1 protein expression several fold in cells derived from 6-day-old mice, while ZFP423KO had no significant effect (FIG.3A). The double KO exerted little or no further increase in UCP1 protein expression compared to NRIP1KO alone in cells from the 6-day-old mouse group (FIG.4A). In progenitors from 4-week old mice, a slight upregulation of UCP1 by ZFP423KO alone was observed, and double KO also slightly upregulated UCP1 more than NRIP1KO alone (FIG.4B). Quantification of UCP1 protein and mRNA data are shown in FIG.4C and FIG.4D, respectively. Taken together, these results demonstrate that the candidate genes tested (e.g., ZFP423) are unlikely to operate more robustly at an earlier stage of progenitor cell lineage, and that the combination of a candidate gene (e.g., ZFP423KO) with NRIP1KO does not significantly increase UCP1 expression compared to NRIP1KO alone. Example 3: NRIP1KO and PPARγ Activation Synergize to Enhance Thermogenic Activity of Mouse Adipocytes This Example demonstrates that the thermogenic effects of NRIP1KO can be enhanced or “supercharged” using synergistic combination treatments. This discovery is based on the idea that both “brakes” and “accelerators” of the UCP1 promoter are required to optimize adipocyte conversion to the enhanced thermogenic state. Examples of “brakes” include Nrip1depletion and “accelerators” include transcription factors such as PPARγ and PPARα, which are known to promote adipocyte browning, although with relatively small effects under normal in vitro conditions. FIG.5A provides a timeline for supercharging mouse adipocytes using a synergistic treatment combination. As shown in FIGs.5B-5C, PPARγ activation by rosiglitazone (Rosi) plus an RXR agonist (CD3254) had a minimal effect on UCP1 protein expression. However, the combination of PPARγ activation plus Nrip1KO induced a truly remarkable synergistic effect on Attorney Docket 07917-0452WO1 / UMMS 24-36 UCP1 protein upregulation (FIGs.5B-5C). Immunofluorescence studies using adipocytes adhered on cover slips and an anti-UCP1 antibody showed similar results (FIGs.5D-5E). Interestingly, not only is total UCP1 protein upregulation markedly elevated by the combined treatment, but the number of cells expressing UCP1 is dramatically increased to over half the cells (FIGs.5D-5E). Thus, the majority of originally white adipocytes expressed UCP1 protein when a “brake” (e.g., Nrip1) was removed and an “accelerator” (e.g., PPARγ) was activated. This Example also demonstrates that the thermogenic effects of NRIP1KO can be enhanced by depletion of fatty acid synthase (FASN), which directs de novo lipogenesis in adipocytes and other cells. As shown in FIGs.5B-5D, inhibition of FASN with the small molecule TVB3664 significantly increased upregulation of UCP1 in NRIP1KO mouse adipocytes in the presence of the PPARγ agonist rosiglitazone and the RXR agonist CD3254. The effect of FASN inhibition is not easily seen in the Western blot due to the high level of UCP1, however, FASN inhibition increases UCP1 mRNA about 20% compared to treatment with Rosi / CD3254 (FIG.5C). Thus, FASN blockade, like NRIP1KO, greatly increases UCP1 expression in the presence of PPARγ / RXR agonists, but not in their absence. Example 4: NRIP1KO and PPARγ Activation Synergize to Enhance Thermogenic Activity of Human Adipocytes This Example demonstrates that the synergistic effects of NRIP1KO and PPARγ activation on thermogenic activity were also observed in human adipocytes. Experiments with human adipocytes were performed as described above for mouse adipocytes. As shown in FIG. 6A, activation of PPARγ and cAMP with tesaglitazar and forskolin, respectively, significantly increased upregulation of UCP1 in NRIP1KO human adipocytes. Significant upregulation of other thermogenic selective genes including Cidea (FIG.6B), AdipoQ (FIG.6C), and CDK15 (FIG.6D) was also observed in NRIP1KO treated with PPARγ and cAMP activators. No further increase in UCP1 expression was observed when FASN inhibition was combined with activation of PPARγ and cAMP in NRIP1 KO human adipocytes (data not shown). Thus, NRIP1KO in combination with PPARγ and cAMP activation significantly enhances thermogenic activity of human adipocytes. Attorney Docket 07917-0452WO1 / UMMS 24-36 Example 5: NRIP1KO and PPARγ Activation Synergize to Enhance Thermogenic Activity of Nonhuman Primate (NHP) Adipocytes This Example demonstrates that the supercharging protocol developed using mouse and human adipocytes could be translated to nonhuman primate (NHP) adipocytes such as adipocytes from Cynomolgus monkey (Cyno monkey). The binding site of sgRNA-H5 was the same in the coding region of the human and the Cyno monkey NRIP1 gene, and therefore sgRNA-H5 was used to edit NRIP1 in NHP adipocytes. As shown in Table 5 below, NRIP1KO NHP adipocytes were treated with combinations of the FASN inhibitor TVB 2640 (200 nM), the RXR agonist CD3525 (200 nM), the cAMP activator forskolin (FSK) (10 μΜ), the PPARγ activator rosiglitazone (1 nM), the PPARα activator fenofibrate 20 μΜ, and the PPARγ / PPARα activator tesaglitazar (10 μM). Table 5. Treatment conditions for NRIP1KO NHP adipocytes. PPAR Activation Treatment FASN RXR Rosiglitazone Fenofibrate Tesaglitazar & NHP adipocytes were cultured in adipogenesis induction media (MDI) comprising T3 (1 nM) and tesaglitazar (10 μM) until lipid droplets could be visualized microscopically on day 5, and then added or replaced with fenofibrate or rosiglitazone in the supercharging phase (days 10- 12) depending on treatment (Tx) (FIG.7A). The supercharging phase on days 10-12 included a pre-treatment with the FASN inhibitor and the PPARα and / or PPARγ agonist for 12 hours followed by treatment with the RXR agonist and forskolin for 24 hours prior to RNA and protein isolation (FIG.7B). Control and NRIP1KO NHP adipocytes appeared normal (FIG.8A). Supercharging created smaller NHP adipocytes with smaller lipid droplets due to treatment with forskolin, which increases lipolysis and loss of lipid from the droplets. Nonetheless, NHP adipocytes in Attorney Docket 07917-0452WO1 / UMMS 24-36 each treatment group were healthy and there was no toxicity evident in the microscopic images (FIGs.8A-8B). UCP1 expression was detected in NHP adipocytes in each treatment group. The highest upregulation of UCP1 mRNA in the NTC adipocytes (NRIP1 not disrupted) was about 80-fold, although UCP1 levels were well below that number for most of the tested conditions (FIG.9A). By contrast, the supercharged NHP adipocytes with NRIP1KO exhibited an upregulation of UCP1 mRNA of about 1200-fold (FIG.9A). Further examination of the UCP1 protein expression by quantifying the relative density of UCP1 protein normalized to vinculin protein in the western blot showed the highest level of UCP1 protein in the fully supercharged condition (treatment group 2) (FIGs.9B-9C). Thus, these results demonstrate that the full supercharge condition is likely the most effective condition in maximally inducing NHP adipocyte thermogenesis because it induced the greatest increase in UCP1 protein, and UCP1 protein (not mRNA) is the functional readout of adipocyte browning that leads to increased thermogenesis and reflects the expression of a myriad of other brown adipocyte gene expression levels. EXEMPLARY SEQUENCES In some embodiments, the sequence of a protein or nucleic acid used in a composition or method described herein is at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to a sequence set forth herein. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by Attorney Docket 07917-0452WO1 / UMMS 24-36 the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch ((1970) J. Mol. Biol.48:444-453 ) algorithm which has been incorporated into the GAP program in the GCG software package (available on the world wide web at gcg.com), using the default parameters, e.g., a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. In some embodiments, the sequence of a protein or nucleic acid used in a composition or method described herein has up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions or deletions as compared to a sequence set forth herein. In some embodiments, the substitutions are conservative substitutions. Mouse NRIP1 exon 4 (SEQ ID NO: 20): TACTGACGTGCGTTTGGTGAGCAACGAAAGATGATGAAGAAAGAAAACCAGCATATTCCCTGAGACCTGG GTGCCAGCGCTGCCGCTGTGCTAAGGAAGTTGCGAGGCTGGCCCTTGCCTAGCCACTCATCAGTGCTGTA GTCTGCACCCGAGTTTGCCCCAGCCTCTGAGCCCCTCGTCACTGCCTGAAGATCCCCTGGTCAGAATGTT AACAGTGCATCTCTGCCCGACTGCTATGGGAGGTGATCAGGTGACGCTCACTTCCTGACGTCACGTGGGA TCTTACTGACGAGAGGAGCTCTTTCACGTGAACGGAAGCCGAGCCCCTGTGAGCGCTTGTATTGAACATG ACTCATGGAGAAGAGCTTGGCTCTGATGTGCATCAGGATTCTATTGTCTTAACTTACCTCGAAGGGTTAC TAATGCATCAGGCAGCAGGGGGATCAGGCACTGCCATTAACAAAAAGTCTGCTGGCCACAAAGAGGAAGA CCAGAACTTTAACCTCTCGGGCAGTGCGTTTCCCTCCTGTCAAAGCAATGGTCCCACTGTCAGTACCCAG ACGTACCAGGGATCTGGCATGCTGCACCTCAAAAAAGCCAGACTGCTGCAGTCTTCCGAGGACTGGAACG CGGCAAAGCGGAAGAGGCTGTCTGATTCCATCGTGAATTTAAACGTAAAGAAGGAAGCGTTGCTGGCTGG CATGGTTGACAGTGTGCCTAAAGGCAAACAGGATAGCACATTGCTGGCCTCTTTGCTTCAGTCATTCAGC TCTAGGCTGCAGACTGTTGCTCTGTCACAGCAGATTAGACAGAGCCTCAAGGAGCAGGGATATGCCCTCA GTCACGAGTCTTTAAAAGTGGAGAAGGATTTAAGGTGCTATGGCGTGGCCTCAAGTCACTTAAAAACTCT GTTGAAGAAAAGTAAAACCAAGGATCAAAAGTCAGGTCCCACCCTCCCTGACGTGACTCCAAACCTTATC AGAGATAGCTTTGTTGAGTCATCCCATCCCGCAGTGGGACAAAGTGGGACAAAGGTCATGAGTGAGCCCT TGTCATGTGCTGCAAGATTACAGGCTGTTGCCAGCATGGTGGAGAAAAGGGCGAGTCCCGCTGCCTCCCC AAAGCCTAGTGTTGCCTGCAGCCAGTTGGCGCTGCTCCTGTCCAGCGAGGCCCACCTGCAGCAGTACTCT CGGGAACATGCTCTAAAAACGCAGAACGCACATCAGGTGGCAAGCGAAAGACTTGCAGCCATGGCCAGAT TGCAAGAGAATGGGCAGAAGGACGTGGGCAGTTCGCAGCTCTCCAAAGGGGTGTCTGGCCATCTCAACGG GCAGGCCAGAGCACTGCCGGCAAGCAAACTGGTGGCCAACAAGAATAACGCTGCCACCTTTCAGAGTCCA ATGGGTGTTGTCCCTTCCTCCCCCAAAAACACGAGCTATAAGAACTCACTGGAAAGAAACAACCTAAAGC AGGCTGCTAATAACAGTCTGCTTTTGCATCTCCTCAAAAGCCAGACCATACCCACGCCGATGAACGGGCA CAGCCAGAACGAGAGAGCGAGCAGTTTTGAGAGTAGCACGCCCACCACGATTGATGAGTACTCCGATAAC AACCCGAGCTTTACAGATGACAGCAGTGGAGACGAAAGCTCGTACTCCAATTGCGTTCCCATAGACCTGT CTTGCAAACACCGGATCGAAAAGCCGGAAGCTGAGCGGCCCGTTTCGCTGGAGAACCTAACCCAGTCCTT GTTAAACACGTGGGATCCCAAGATCCCCGGCGTTGACATCAAAGAAGATCAAGATACCTCAACAAATTCC Attorney Docket 07917-0452WO1 / UMMS 24-36 AAGCTGAATTCACACCAGAAAGTCACTCTTCTTCAGTTGCTGCTCGGCCATAAAAGTGAAGAAACTGTTG AAAGGAACGCCAGCCCTCAGGACATCCATAGTGATGGGACTAAGTTCAGTCCTCAGAATTACACAAGGAC TTCTGTCATCGAAAGCCCCAGTACCAACAGGACTACCCCAGTGAGCACTCCACCACTGTATACAGCCAGC CAAGCAGAGTCTCCCATCAATCTTTCCCAGCACTCTCTGGTCATCAAGTGGAATTCCCCGCCGTATGCCT GCAGTACTCCCGCTTCCAAGCTCACGAACACCGCGCCTAGCCACCTGATGGACCTCACGAAAGGCAAAGA GTCCCAAGCCGAGAAACCAGCCCCGAGTGAAGGTGCACAAAATTCCGCCACGTTCAGTGCCAGTAAACTG TTACAAAATTTGGCTCAGTGCGGATTGCAGTCTTCCGGGCCAGGGGAAGAGCAGAGACCCTGCAAACAGC TGTTAAGTGGAAACCCAGACAAACCTCTCGGTCTGATTGATAGATTAAACAGCCCTCTGCTCTCAAATAA AACCAATGCGGCTGAAGAGAGCAAAGCCTTCAGCAGTCAGCCTGCCGGGCCTGAGCCGGGACTTCCTGGT TGTGAGATAGAAAATCTCTTGGAAAGACGGACTGTCCTTCAGTTGCTCCTGGGAAATTCCAGCAAAGGGA AGAATGAGAAGAAAGAGAAAACCCCCGCACGAGACGAGGCTCCTCAGGAGCATTCGGAGAGGGCTGCAAA TGAACAGATACTCATGGTGAAGATTAAATCCGAGCCTTGTGACGACTTCCAGACCCACAACACAAACCTG CCCTTAAACCACGATGCCAAGAGCGCCCCCTTCTTAGGTGTGACTCCCGCCATCCACAGGAGCACAGCGG CCTTACCAGTGTCGGAGGACTTTAAATCCGAGCCTGCTTCACCTCAGGATTTCTCTTTCTCAAAGAACGG GCTGTTGAGTCGCTTGCTGAGACAGAATCAAGAGAGTTACCCGGCAGATGAGCAGGACAAGAGTCACAGA AACAGTGAGCTGCCAACCCTGGAGTCGAAGAACATCTGCATGGTCCCGAAGAAAAGGAAGCTGTATACGG AACCACTGGAGAATCCATTTAAAAAGATGAAAAATACTGCCGTAGATACTGCCAATCATCACAGCGGCCC GGAAGTACTCTACGGGTCGTTGCTTCATCAGGAAGAGCTGAAGTTTAGCAGGAATGAGCTCGATTATAAA TACCCTGCTGGGCATAGTTCAGCCAGCGATGGTGACCACAGGAGTTGGGCCAGAGAGAGCAAAAGCTTCA ATGTTCTCAAGCAGCTGCTGCTCTCCGAGAACTGTGTGCGAGATCTGTCCCCACACAGGAGTGACTCTGT CCCCGACACGAAAAAGAAAGGACACAAAAACAACGCGCCCGGCAGCAAACCTGAATTCGGCATTTCTTCT TTAAATGGACTGATGTATAGTTCCCCGCAGCCTGGCAGTTGTGTGACGGATCATAGGACATTTTCATACC CGGGAATGGTAAAGACCCCTCTGAGCCCTCCTTTCCCAGAGCACTTGGGCTGTGTGGGGTCCAGACCAGA ACCTGGGCTTTTGAATGGATGTTCCGTGCCCGGTGAGAAGGGACCCATTAAGTGGGTCATCGCAGATATG GATAAGAATGAATACGAAAAAGACTCTCCAAGACTGACCAAAACTAATCCGATCCTCTATTACATGCTCC AGAAGGGAGGGGGCAATTCTGTTACCACACAAGAAACCCAGGACAAAGACATCTGGAGGGAGCCTGCGTC AGCCGAGAGTCTCTCACAGGTTACAGTCAAAGAAGAGCTACTTCCCGCTGCAGAAACTAAAGCTTCTTTC TTTAATCTAAGAAGCCCGTACAATAGCCATATGGGAAATAATGCTTCTCGCCCACACAGTACAAATGGAG AAGTGTATGGACTTCTGGGAAACGCGCTCACCATAAAAAAAGAGTCAGAATAAATGTGTACCTGCCATAC CACTTTGGGTCTTTTTAAAATTTAGTCAGTATGAACTTGAGATCTGTATAAATAAGAGCATGATTTGAGA AAAGCATGGTATAACTGAAACTCCTTCCTTTTGAAAGTATTGGTCACTGGTGATGTTTAAATATGCATAC TAATTTTTGCTTAACATTAGATGTCATGAGGAAACAATTGAACTCGAGGTTGGTTGTTTACTATTTCTGT ATGCATCAGATAACAACTGTGACTAGCCTACGAATGAACCTGTTTTTATAATCGTAAATAAGAGGCATAC ATTAAAATGCACAACTTCACCAG Human NRIP1 exon 4 (SEQ ID NO: 21): ACACTGATATTTGCATTTAATGGGGAACAAAAGATGAAGAAGGAAAAGGAATATATTCACTAAGGATTCT ATCTGCTTACTGCTACAGACCTATGTGTTAAGGAATTCTTCTCCTCCTCCTTGCGTAGAAGTTGATCAGC ACTGTGGTCAGACTGCATTTATCTTGTCATTGCCAGAAGAAATCTTGGACAGAATGTAACAGTACGTCTC TCTCTGATTGCGATGGAAGGTGATAAACTGATACTCCTTTATTAAAGTTACATCGCACTCACCACAGAAA ACCATTCTTTAAAGTGAATAGAAACCAAGCCCTTGTGAACACTTCTATTGAACATGACTCATGGAGAAGA GCTTGGCTCTGATGTGCACCAGGATTCTATTGTTTTAACTTACCTAGAAGGATTACTAATGCATCAGGCA GCAGGGGGATCAGGTACTGCCGTTGACAAAAAGTCTGCTGGGCATAATGAAGAGGATCAGAACTTTAACA TTTCTGGCAGTGCATTTCCCACCTGTCAAAGTAATGGTCCAGTTCTCAATACACATACATATCAGGGGTC TGGCATGCTGCACCTCAAAAAAGCCAGACTGTTGCAGTCTTCTGAGGACTGGAATGCAGCAAAGCGGAAG AGGCTGTCTGATTCTATCATGAATTTAAACGTAAAGAAGGAAGCTTTGCTAGCTGGCATGGTTGACAGTG TGCCTAAAGGCAAACAGGATAGCACATTACTGGCCTCTTTGCTTCAGTCATTCAGCTCTAGGCTGCAGAC TGTTGCTCTGTCACAACAAATCAGGCAGAGCCTCAAGGAGCAAGGATATGCCCTCAGTCATGATTCTTTA AAAGTGGAGAAGGATTTAAGGTGCTATGGTGTTGCATCAAGTCACTTAAAAACTTTGTTGAAGAAAAGTA AAGTTAAAGATCAAAAGCCTGATACGAATCTTCCTGATGTGACTAAAAACCTCATCAGAGATAGGTTTGC Attorney Docket 07917-0452WO1 / UMMS 24-36 AGAGTCTCCTCATCATGTTGGACAAAGTGGAACAAAGGTCATGAGTGAACCGTTGTCATGTGCTGCAAGA TTACAGGCTGTTGCAAGCATGGTGGAAAAAAGGGCTAGTCCTGCCACCTCACCTAAACCTAGTGTTGCTT GTAGCCAGTTAGCATTACTTCTGTCAAGCGAAGCCCATTTGCAGCAGTATTCTCGAGAACACGCTTTAAA AACGCAAAATGCAAATCAAGCAGCAAGTGAAAGACTTGCTGCTATGGCCAGATTGCAAGAAAATGGCCAG AAGGATGTTGGCAGTTACCAGCTCCCAAAAGGAATGTCAAGCCATCTTAATGGTCAGGCAAGAACATCAT CAAGCAAACTGATGGCTAGCAAAAGTAGTGCTACAGTGTTTCAAAATCCAATGGGTATCATTCCTTCTTC CCCTAAAAATGCAGGTTATAAGAACTCACTGGAAAGAAACAATATAAAACAAGCTGCTAACAATAGTTTG CTTTTACATCTTCTTAAAAGCCAGACTATACCTAAGCCAATGAATGGACACAGTCACAGTGAGAGAGGAA GCATTTTTGAGGAAAGTAGTACACCTACAACTATTGATGAATATTCAGATAACAATCCTAGTTTTACAGA TGACAGCAGTGGTGATGAAAGTTCTTATTCCAACTGTGTTCCCATAGACTTGTCTTGCAAACACCGAACT GAAAAATCAGAATCTGACCAACCTGTTTCCCTGGATAACTTCACTCAATCCTTGCTAAACACTTGGGATC CAAAAGTCCCAGATGTAGATATCAAAGAAGATCAAGATACCTCAAAGAATTCTAAGCTAAACTCACACCA GAAAGTAACACTTCTTCAATTGCTACTTGGCCATAAGAATGAAGAAAATGTAGAAAAAAACACCAGCCCT CAGGGAGTACACAATGATGTGAGCAAGTTCAATACACAAAATTATGCAAGGACTTCTGTGATAGAAAGCC CCAGTACAAATCGGACTACTCCAGTGAGCACTCCACCTTTACTTACATCAAGCAAAGCAGGGTCTCCCAT CAATCTCTCTCAACACTCTCTGGTCATCAAATGGAATTCCCCACCATATGTCTGCAGTACTCAGTCTGAA AAGCTAACAAATACTGCATCTAACCACTCAATGGACCTTACAAAAAGCAAAGACCCACCAGGAGAGAAAC CAGCCCAAAATGAAGGTGCACAGAACTCTGCAACGTTTAGTGCCAGTAAGCTGTTACAAAATTTAGCACA ATGTGGAATGCAGTCATCCATGTCAGTGGAAGAGCAGAGACCCAGCAAACAGCTGTTAACTGGAAACACA GATAAACCGATAGGTATGATTGATAGATTAAATAGCCCTTTGCTCTCAAATAAAACAAATGCAGTTGAAG AAAATAAAGCATTTAGTAGTCAACCAACAGGTCCTGAACCAGGGCTTTCTGGTTCTGAAATAGAAAATCT GCTTGAAAGACGTACTGTCCTCCAGTTGCTCCTGGGGAACCCCAACAAAGGGAAGAGTGAAAAAAAAGAG AAAACTCCCTTAAGAGATGAAAGTACTCAGGAACACTCAGAGAGAGCTTTAAGTGAACAAATACTGATGG TGAAAATAAAATCTGAGCCTTGTGATGACTTACAAATTCCTAACACAAATGTGCACTTGAGCCATGATGC TAAGAGTGCCCCATTCTTGGGTATGGCTCCTGCTGTGCAGAGAAGCGCACCTGCCTTACCAGTGTCCGAA GACTTTAAATCGGAGCCTGTTTCACCTCAGGATTTTTCTTTCTCCAAGAATGGTCTGCTAAGTCGATTGC TAAGACAAAATCAAGATAGTTACCTGGCAGATGATTCAGACAGGAGTCACAGAAATAATGAAATGGCACT TCTAGAATCAAAGAATCTTTGCATGGTCCCTAAGAAAAGGAAGCTTTATACTGAGCCATTAGAAAATCCA TTTAAAAAGATGAAAAACAACATTGTTGATGCTGCAAACAATCACAGTGCCCCAGAAGTACTGTATGGGT CCTTGCTTAACCAGGAAGAGCTGAAATTTAGCAGAAATGATCTTGAATTTAAATATCCTGCTGGTCATGG CTCAGCCAGCGAAAGTGAACACAGGAGTTGGGCCAGAGAGAGCAAAAGCTTTAATGTTCTGAAACAGCTG CTTCTCTCAGAAAACTGTGTGCGAGATTTGTCCCCGCACAGAAGTAACTCTGTGGCTGACAGTAAAAAGA AAGGACACAAAAATAATGTGACCAACAGCAAACCTGAATTTAGCATTTCTTCTTTAAATGGACTGATGTA CAGTTCCACTCAGCCCAGCAGTTGCATGGATAACAGGACATTTTCATACCCAGGTGTAGTAAAAACTCCT GTGAGTCCTACTTTCCCTGAGCACTTGGGCTGTGCAGGGTCTAGACCAGAATCTGGGCTTTTGAATGGGT GTTCCATGCCCAGTGAGAAAGGACCCATTAAGTGGGTTATCACTGATGCGGAGAAGAATGAGTATGAAAA AGACTCTCCAAGATTGACCAAAACCAACCCAATACTATATTACATGCTTCAAAAAGGAGGCAATTCTGTT ACCAGTCGAGAAACACAAGACAAGGACATTTGGAGGGAGGCTTCATCTGCTGAAAGTGTCTCACAGGTCA CAGCCAAAGAAGAGTTACTTCCTACTGCAGAAACGAAAGCTTCTTTCTTTAATTTAAGAAGCCCTTACAA TAGCCATATGGGAAATAATGCTTCTCGCCCACACAGCGCAAATGGAGAAGTTTATGGACTTCTGGGAAGC GTGCTAACGATAAAGAAAGAATCAGAATAAAATGTACCTGCCATCCAGTTTTGGATCTTTTTAAAACTAA TGAGTATGAACTTGAGATCTGTATAAATAAGAGCATGATTTGAAAAAAAGCATGGTATAATTGAAACTTT TTTCATTTTGAAAAGTATTGGTTACTGGTGATGTTGAAATATGCATACTAATTTTTGCTTAACATTAGAT GTCATGAGGAAACTACTGAACTAGCAATTGGTTGTTTAACACTTCTGTATGCATCAGATAACAACTGTGA GTAGCCTATGAATGAAATTCTTTTATAAATATTAGGCATAAATTAAAATGTAAAACTCCATTCATAGTGG ATTAATGCATTTTGCTGCCTTTATTAGGGTACTTTATTTTGCTTTTCAGAAGTCAGCCTACATAACACAT TTTTAAAGTCTAAACTGTTAAACAACTCTTTAAAGGATAATTATCCAATAAAAAAAAACCTAGTGCTGAT TCACAGCTTATTATCCAATTCAAAAATAAATTAGAAAAATATATGCTTACATTTTTCACTTTTGCTAAAA AGAAAAAAAAAAGGTGTTTATTTTTAACTCTTGGAAGAGGTTTTGTGGTTCCCAATGTGTCTGTCCCACC CTGATCCTTTTCAATATATATTTCTTTAAACCTTGTGCTACTTAGTAAAAATTGATTACAATTGAGGGAA GTTTGATAGATCCTTTAAAAAAAAGGCAGATTTCCATTTTTTGTATTTTAACTACTTTACTAAATTAATA CTCCTCCTTTTACAGAATTAGAAAAGTTAACATTTATCTTTAGGTGGTTTCCTGAAAAGTTGAATATTTA Attorney Docket 07917-0452WO1 / UMMS 24-36 AGAAATTGTTTTTAACAGAAGCAAAATGGCTTTTCTTTGGACAGTTTTCACCATCTCTTGTAAAAGTTAA TTCTCACCATTCCTGTGGTACCTGCGAGTGTTATGACCAGGATTCCTTAAACCTGAACTCAGACCACTTG CATTAGAACCATCTGGAGCACTTGTTTTAAAATGCAGATTCATAGGCAGCATCTCAGATCTACAGAACAA GAATCTCTGCTAAGTGGACCTGGAATCTTCCATCTGCATCTTAACATGCTCTCTAGGTGTTTCTTGTGTT TGAGAACCATGACTTATGACTTTCCTCAGAACATGAGACTGTAAAACAAAAACAAAAAACTATGTGATGC CTCTATTTTCCCCAATACAGTCACACATCAGCTCAAAATTTGCAATATTGTAGTTCATATATTACCGTTA TGTCTTTGGAAATCGGGTTCAGAACACTTTTTATGACAAAAATTGGGTGGAGGGGATAACTTTCATATCT GGCTCAACATCTCAGGAAAATCTGTGATTATTTGTGTGTTCTAATGAGTAACATCTACTTAGTTAGCCTT AGGGATGGAAAAACAGGGCCACTTACCAAACTCAGGTGATTCCAGGATGGTTTGGAAACTTCTCCTGAAT GCATCCTTAACCTTTATTAAAACCATTGTCCTAAGAACAATGCCAACAAAGCTTACAACATTTAGTTTAA ACCCAAGAAGGGCACTAAACTCAGATTGACTAAATAAAAAGTACAAAGGGCACATATACGTGACAGAATT GTACACAATCACTCCATTGGATCTTTTACTTTAAAGTAGTGATGAAAAGTACATGTTGATACTGTCTTAG AAGAAATTAATATATTAGTGAAGCCACATGGGGTTTCAGTTGCGAAACAGGTCTGTTTTTATGTTCAGTT TGTACAATCCACAATTCATTCACCAGATATTTTGTTCTTAATTGTGAACCAGGTTAGCAAATGACCTATC AAAAATTATTCTATAATCACTACTAGTTAGGATATTGATTTAAAATTGTTCTACTTGAAGTGGTTTCTAA GATTTTTATATTAAAAATAGGTGTGATTTCCTAATATGATCTAAAACCCTAAATGGTTATTTTTCCTCAG AATGATTTGTAAATAGCTACTGGAAATATTATACAGTAATAGGAGTGGGTATTATGCAACATCATGGAGA AGTGAAGGCATAGGCTTATTCTGACATAAAATTCCACTGGCCAGTTGAATATATTCTATTCCATGTCCAT ACTATGACAATCTTATTGTCAACACTATATAAATAAGCTTTTAAACAAGTCATTTTTCTTGATCGTTGTG GAAGGTTTGGAGCCTTAGAGGTATGTCAGAAAAAATATGTTGGTATTCTCCCTTGGGTAGGGGGAAATGA CCTTTTTACAAGAGAGTGAAATTTAGGTCAGGGAAAAGACCAAGGGCCAGCATTGCTACTTTTGTGTGTG TGTGTGTGGGTTTTGTTTTGTTTTTTTGGTTGGCTGGTTGTTTTCGTTGTTGTTAACAAAGGAATGAGAA TATGTAATACTTAAATAAACATGACCACGAAGAATGCTGTTCTGATTTACTAGAGAATGTTCCCAATTTG AATTTAGGGTGATTTTAAAGAACAGTGAGAAAGGGCATACATCCACAGATTCACTTTGTTTATGCATATG TAGATACAAGGATGCACATATACACATTTTCAAGGACTATTTTAGATATCTAGACAATTTCTTCTAATAA AGTCATTTGTGAAAGGGTACTACAGCTTATTGACATCAGTAAGGTAGCATTCATTACCTGTTTATTCTCT GCTGCATCTTACAGAAGAGTAAACTGGTGAGAGTATATATTTTATATATATATATATATATATATATATA ATATGTATATATATATATATTGACTTGTTACATGAAGATGTTAAAATCGGTTTTTAAAGGTGATGTAAAT AGTGATTTCCTTAATGAAAAATACATATTTTGTATTGTTCTAATGCAACAGAAAAGCCTTTTAATCTCTT TGGTTCCTGTATATTCCATGTATAAGTGTAAATATAATCAGACAGGTTTAAAAGTTGTGCATGTATGTAT ACAGTTGCAAGTCTGGACAAATGTATAGAATAAACCTTTTATTTAAGTTGTGATTACCTGCTGCATGAAA AGTGCATGGGGGACCCTGTGCATCTGTGCATTTGGCAAAATGTCTTAACAAATCAGATCAGATGTTCATC CTAACATGACAGTATTCCATTTCTGGACATGACGTCTGTGGTTTAAGCTTTGTGAAAGAATGTGCTTTGA TTCGAAGGGTCTTAAAGAATTTTTTTAATCGTCAACCACTTTTAAACATAAAGAATTCACACAACTACTT TCATGAATTTTTTAATCCCATTGCAAACATTATTCCAAGAGTATCCCAGTATTAGCAATACTGGAATATA GGCACATTACCATTCATAGTAAGAATTCTGGTGTTTACACAACCAAATTTGATGCGATCTGCTCAGTAAT ATAATTTGCCATTTTTATTAGAAATTTAATTTCTTCATGTGATGTCATGAAACTGTACATACTGCAGTGT GAATTTTTTTGTTTTGTTTTTTAATCTTTTAGTGTTTACTTCCTGCAGTGAATTTGAATAAATGAGAAAA AATGCATTGTC OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
Attorney Docket 07917-0452WO1 / UMMS 24-36 What Is Claimed Is:
1. A method of making a population of thermogenic adipose cells, the method comprising: providing a population of adipose progenitor cells; disrupting expression of nuclear receptor interacting protein 1 (Nrip1) in the cells, preferably by introducing into the population of adipose progenitor cells an engineered nuclease or an inhibitory nucleic acid targeting a nuclear receptor interacting protein 1 (Nrip1) gene, to produce a population of adipose progenitor cells comprising a disrupted Nrip1 gene; culturing the population of adipose progenitor cells comprising the disrupted Nrip1 gene under conditions sufficient to induce differentiation of the adipose progenitor cells into a population of mature adipose cells comprising the disrupted Nrip1 gene; and treating the population of mature adipose cells comprising the disrupted Nrip1 gene with a peroxisome proliferator-activated receptor (PPAR) activator and a cyclic adenosine 3′,5′- monophosphate (cAMP) activator to produce a population of thermogenic adipose cells.
2. The method of claim 1, wherein the method comprises treating the population of mature adipose cells with the PPAR activator prior to treating the population of mature adipose cells with the cAMP activator.
3. The method of claim 1 or claim 2, wherein the method comprises treating the population of mature adipose cells with the PPAR activator for about 12 to about 48 hours prior to treating the population of mature adipose cells with the cAMP activator for about 12 to about 36 hours.
4. The method of any one of claims 1-3, further comprising treating the population of mature adipose cells with a fatty acid synthase (FASN) inhibitor.
5. The method of claim 4, wherein treating the population of mature adipose cells comprises simultaneously treating the population of mature adipose cells with the PPAR activator and the FASN inhibitor.
6. The method of claim 4 or claim 5, wherein the method comprises treating the population of mature adipose cells with the PPAR activator and the FASN inhibitor for about 12 to about 48Attorney Docket 07917-0452WO1 / UMMS 24-36 hours prior to treating the population of mature adipose cells with the cAMP activator for about 12 to about 36 hours.
7. The method of any one of claims 1-6, further comprising treating the population of mature adipose cells with a retinoid X receptor (RXR) agonist.
8. The method of claim 7, wherein treating the population of mature adipose cells comprises simultaneously treating the population of mature adipose cells with the RXR agonist and the cAMP activator.
9. The method of claim 7 or claim 8, wherein the method comprises treating the population of mature adipose cells with the PPAR activator for about 12 to about 48 hours prior to treating the population of mature adipose cells with the RXR agonist and the cAMP activator for about 12 to about 36 hours.
10. The method of any one of claims 1-9, wherein the engineered nuclease is a meganuclease; a zinc-finger nuclease; a transcription activator effector-like nuclease (TALEN); or a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Cas RNA-guided nuclease (RGN).
11. The method of claim 10, wherein the engineered nuclease is a RGN and the method further comprises contacting the adipose progenitor cells with a guide RNA (gRNA) targeting the Nrip1 gene.
12. The method of claim 11, wherein the RGN and gRNA are delivered to the progenitor cells as a ribonucleoprotein (RNP) complex.
13. The method of claim 12, wherein the RNP complex comprises Streptococcus pyogenes Cas9 (SpCas9) and a gRNA comprising a sequence selected from the group consisting of: sgRNA-H4 ACAUCAGGAAGAUUCGUAUC (SEQ ID NO: 16),Attorney Docket 07917-0452WO1 / UMMS 24-36 sgRNA-H5 GUCAUGUGCUGCAAGAUUAC (SEQ ID NO: 17), or sgRNA-H6 UUUGCAUGGUCCCUAAGAAA (SEQ ID NO: 18).
14. The method of claims 12 or claim 13, wherein the RNP complex is delivered to the adipose progenitor cells by electroporation.
15. The method of any one of claims 1-14, wherein the inhibitory nucleic acid is an antisense oligonucleotide or single- or double-stranded RNA interference (RNAi) compound.
16. The method of any one of claims 1-15, wherein the PPAR activator comprises a PPAR- gamma (PPARγ) activator, a PPAR-alpha (PPARα), or a pan PPAR activator.
17. The method of claim 16, wherein the PPARγ activator comprises troglitazone, pioglitazone, rosiglitazone, AMG131, or a combination thereof.
18. The method of claim 16, wherein the PPARα activator comprises clofibrate, fenofibrate, bezafibrate, pemafibrate, gemfibrozil, or a combination thereof.
19. The method of claim 16, wherein the PPAR activator comprises a pan PPAR activator selected from lobeglitazone, chiclitazar, aleglitazar, elafibranor, saroglitazar, muraglitazar, tesaglitazar, or a combination thereof.
20. The method of any one of claims 1-19, wherein the cAMP activator comprises CL 316243, forskolin, a cAMP analog (e.g., 8-bromo-cAMP or NKH477), or a combination thereof.
21. The method of any one of claims 1-20, wherein the FASN inhibitor comprises C75, FT113, TVB2640, TVB3664, or a combination thereof.
22. The method of any one of claims 1-21, wherein the RXR agonist comprises bexarotene, CD3254, docosahexaenoic acid, LG100268, retinoic acid, SR11237, or a combination thereof.Attorney Docket 07917-0452WO1 / UMMS 24-36 23. The method of any one of claims 1-22, wherein at least 50% of cells in the population of thermogenic adipose cells express uncoupling protein 1 (UCP1).
24. The method of any one of claims 1-23, wherein a level of expression of UCP1 in cells in the population of thermogenic adipose cells is at least 2-fold greater than a level of expression of UCP1 in cells in the population of mature adipose cells comprising the disrupted Nrip1 gene.
25. The method of any one of claims 1-24, wherein the adipose progenitor cells are Human Adipose Capillary Progenitor Cells (HACAPS) or primary adipose progenitor cells.
26. The method of any one of claims 1-25, wherein the thermogenic adipose cells are white, brite, or brown adipose cells.
27. A population of thermogenic adipose cells produced by the method of any one of claims 1-26.
28. A method of treating, or reducing the risk of developing or worsening, of a condition associated with an elevated body mass index (BMI) in a subject, the method comprising administering to the subject an effective amount of the population of thermogenic adipose cells of claim 27.
29. The method of claim 28, wherein the subject has a BMI > 25.
30. The method of claim 28 or claim 29, wherein the condition associated with an elevated BMI is selected from the group consisting of metabolic syndrome, prediabetes, type 2 diabetes, lipodystrophy, cardiovascular disease, nephropathy, diabetic neuropathy, dyslipidemia, diabetic foot syndrome (DFS), leg or foot ulcers, impaired wound healing, fatty liver disease, or a combination thereof.
Citation Information
Patent Citations
Compositions and Methods for Modulating Metabolic Pathways
US20140148488A1
Brown Adipocyte Progenitors in Human Skeletal Muscle
US20150240206A1
Complexes for gene deletion and editing
US20190316156A1
Targeting Nrip1 to Alleviate Metabolic Disease
US20220220461A1
Methods and compositions for the differentiation of human preadipocytes into adipocytes
US7001746B1