Methods and compositions for increasing expression of UBE3a
By targeting the Ube3a-ATS transcript for degradation, the paternal Ube3a allele is activated, increasing UBE3A expression and addressing the symptoms of Angelman syndrome.
Patent Information
- Application Number
- PCT/US2025/023295
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-10
- Filing Date
- 2025-04-04
- Publication Date
- 2025-10-09
AI Technical Summary
Angelman syndrome, caused by deletion or mutation of the UBE3A gene, results in severe intellectual disability and seizures due to the silencing of the paternal UBE3A allele in the central nervous system, with no current cure available.
Targeting the Ube3a-ATS transcript for degradation in cells of the central nervous system using nucleic acid cassettes that encode RNAs complementary to UBE3A-ATS, thereby activating the paternal Ube3a allele and increasing UBE3A expression.
Enhances UBE3A expression in cells, potentially alleviating symptoms of Angelman syndrome by activating the paternal allele, which is usually silenced.
Smart Images

Figure US2025023295_09102025_PF_FP_ABST
Abstract
Description
METHODS AND COMPOSITIONS FOR INCREASING EXPRESSION OF UBE3ACROSS-REFERENCING
[0001] This application claims the benefit of U.S. provisional application serial nos. 63 / 575,564 filed on April 5, 2024, 63 / 639,403 filed on April 26, 2024, 63 / 672,664 filed on July 17, 2024, 63 / 715,502 filed on November 1, 2024, and 63 / 756,733 filed on February 10, 2025, which applications are incorporated by reference in their entireties.INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED AS A SEQUENCE LISTING XML FILE
[0002] A Sequence Listing is provided herewith as a Sequence Listing XML, “ENCO- 009WO_SEQLIST” created on April 1, 2025 and having a size of 226,199 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.BACKGROUND
[0003] Angclman syndrome is a genetic disorder that affects between 1 in 12,000 to 1 in 20,000 people. Symptoms are generally apparent by one year of age, and include severe intellectual disability, developmental delay and seizures. Generally, Angelman syndrome is caused by deletion or mutation of the UBE3A gene. UBE3A is subject to genomic imprinting, a naturally occurring phenomenon that may silence one allele of a gene while leaving the other allele on. In neurons of the central nervous system (CNS), the paternal UBE3A allele is generally off, whereas in other cell types of the body, both alleles of UBE3A are generally on. Angelman syndrome is generally associated with deletion or mutation of the maternal UBE3A gene. There is currently no cure available.SUMMARY
[0004] This disclosure provides, among other things, methods and compositions for increasing UBE3A expression in cells, particularly cells that express UBE3A-ATS, which is encoded by the bottom (antisense) DNA strand at the Ube3a locus. Without wishing to be bound to any specific theory, the Ube3a locus is believed to be imprinted and, in the central nervous system, only the maternal allele is expressed. The paternal Ube3a allele is thought to be silenced by the Ube3a-ATS transcript. By targeting the Ube3a-ATS transcript for degradation in cells of the central nervous system, the paternal Ube3a allele (which is usually silenced in those cells) becomes active in those cells which, in turn, increases the expression of IJBE3A in those cells.
[0005] In one exemplary aspect, the disclosure provides nucleic acid cassettes that encode RNAs that are complementary to one or more regions of UBE3A-ATS.
[0006] These and other aspects will be described in greater detail below.INCORPORATION BY REFERENCE
[0007] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS
[0008] Certain novel features of the invention may be set forth with particularity in the appended claims. A better understanding of some features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of some aspects of the invention are describes, and the accompanying drawings of which:
[0009] Figure 1 illustrates abundance of UBE3A-ATS (ATS) in iPSC derived glutamatergic neurons treated with AAVs encoding different oligonucleotides as indicated, plotted as mean with standard error of the mean (SEM) relative to the scrambled control.
[0010] Figure 2 illustrates abundance of UBE3A-ATS (ATS) in iPSC derived glutamatergic neurons treated with AAVs encoding different oligonucleotides as indicated, plotted as mean with SEM relative to the scrambled control.
[0011] Figure 3 illustrates abundance of UBE3A-ATS (ATS) in iPSC derived glutamatergic neurons treated with AAV s encoding different oligonucleotides as indicated, plotted as mean with SEM relative to the scrambled control.
[0012] Figure 4 illustrates abundance of UBE3A-ATS (ATS) in Si ISKOHeLa cells chemically transfected with plasmids encoding different oligonucleotides as indicated, plotted as mean with SEM relative to the scrambled control.
[0013] Figure 5 illustrates abundance of UBE3A-ATS (ATS) in S 115KOHeLa cells electroporated with plasmids encoding different oligonucleotides as indicated, plotted as mean with SEM relative to the scrambled control.
[0014] Figure 6 illustrates expression levels of paternal UBE3A in iPSC derived glutamatergic neurons treated with AAV s encoding different oligonucleotides as indicated, plotted as mean with SEM relative to the scrambled control.
[0015] Figure 7 illustrates expression levels of paternal UBE3A in iPSC derived glutamatergic neurons treated with AAV s encoding different oligonucleotides as indicated, plotted as mean with SEM relative to the scrambled control.
[0016] Figure 8 illustrates expression levels of paternal UBE3A in iPSC derived GABAergic cells treated with AAVs encoding SEQ ID NO: 12 in different miRNA scaffolds as indicated, plotted as mean with SEM.
[0017] Figure 9 illustrates the relative amount of artificial guide miRNA of SEQ ID NO: 12, as a percentage of total miRNAs, when produced from each of the indicated scaffolds.
[0018] Figure 10 illustrates the guide to passenger ratio of the products produced by each of the indicated scaffolds when expressing SEQ ID NO: 12.
[0019] Figure 11 illustrates the 5’ guide precision of the products produced by each of the indicated scaffolds when expressing SEQ ID NO: 12.
[0020] Figure 12A illustrates the percentage frequency of each different length of mature guide miRNA produced by an expression construct comprising the indicated scaffold sequence and an RNA sequence of SEQ ID :NO: 12.
[0021] Figure 12B illustrates the percentage frequency of each different length of mature guide miRNA produced by an expression construct comprising the indicated scaffold sequence and an RNA sequence of SEQ ID :NO: 36.
[0022] Figure 12C illustrates the percentage frequency of each different length of mature guide miRNA produced by an expression construct comprising the indicated scaffold sequence and an RNA sequence of SEQ ID :NO: 37.
[0023] Figure 13A illustrates expression levels of paternal UBE3A at 7 days post infection in iPSC derived GABAergic cells treated with AAV s encoding miRNA sequences and scaffolds as indicated, plotted as mean with SEM.
[0024] Figure 13B illustrates expression levels of paternal UBE3A at 21 days post infection in iPSC derived GAB Acrgic cells treated with AAV s encoding miRNA sequences and scaffolds as indicated, plotted as mean with SEM.
[0025] Figure 14 illustrates miRNA expression from five candidate AAVs, encoding SEQ ID NOS: 125-129, in different brain regions.
[0026] Figure 15 illustrates relative UBE3A-ATS expression after treatment with each of five candidate AAVs, encoding SEQ ID NOS: 125-129, in different brain regions.
[0027] Figure 16 illustrates paternal UBE3A expression after treatment with each of five candidate AAVs, encoding SEQ ID NOS: 125-129, in different brain regions.
[0028] Figure 17 illustrates relative UBE3A-ATS expression after treatment with each of five candidate AAVs, encoding SEQ ID NOS: 125-129, averaged across brain regions.
[0029] Figure 18 illustrates paternal UBE3A expression after treatment with each of five candidate AAVs, encoding SEQ ID NOS: 125-129, averaged across brain regions.
[0030] Figures 19A and 19B illustrate brain neuropathology findings for each of the animals treated with vehicle or a candidate AAV: 0 (empty cell) = no finding, 1 = minimal, 2 = mild, 3 = moderate, 4 = marked, and 5 = severe.
[0031] Figures 20A, 20B, 20C, and 20D illustrate DRG neuropathology findings for each of the animals treated with vehicle or a candidate AAV: 0 (empty cell) = no finding, 1 = minimal, 2 = mild, 3 = moderate, 4 = marked, and 5 = severe.
[0032] Figure 21 illustrates the percentage of nuclei in the cortex which are positive for the AAV expressed miRNA of each candidate.
[0033] Figure 22 illustrates the percentage of nuclei in the hippocampus which are positive for the AAV expressed miRNA of each candidate.
[0034] Figure 23 illustrates expression levels of paternal UBE3A in iPSC derived GABAergic cells treated with various concentrations of AAVs encoding SEQ ID 12 in different miRNA scaffolds as indicated, plotted as mean with SEM.
[0035] Figure 24 illustrates percent expression of the paternal SNP of UBE3A in three brain regions of NHPs after treatment with vehicle or an AAV containing a miR-190 scaffold expressing SEQ ID NO: 12. For each brain region the vehicle treated animals are shown on the left and the AAV treated on the right. Figure depicts mean + / - SEM. Statistical significance is indicated above bars with the following adjusted p-value: ** - p < 0.01 (Wald Z test).
[0036] Figure 25 illustrates relative UBE3A-ATS abundance in the brains of untreated WT mice and in Angclman model mice either untreated, or treated with an AAV-miR or control. Expression levels in WT untreated mice are normalized to 1 for comparison. Statistical significance is indicated in the figure or legend, with adjusted p-values as follows: * - p < 0.05;** - p , < 0.01; *** - p < 0.001; **** - p <0.0001.
[0037] Figure 26 illustrates relative UBE3A abundance in the brains of the mice as described in Figure 24. Expression levels in WT untreated mice are normalized to 1 for comparison. Statistical significance is indicated in the figure or legend, with adjusted p-values as follows: * - p < 0.05; ** - p < 0.01; *** - p < 0.001; **** - p <0.0001.
[0038] Figure 27 illustrates representative images of immunostaining of UBE3A in the brains of the mice as described in Figure 25.
[0039] Figure 28 illustrates body weights of the mice as described in Figure 25. Statistical significance is indicated in the figure or legend, with adjusted p-values as follows: * - p < 0.05.
[0040] Figure 29 illustrates distance traveled in an open field assay by the mice as described in Figure 25. Statistical significance is indicated in the figure or legend, with adjusted p-values as follows: * = p < 0.05; ** = p < 0.01; *** - p < 0.001; **** - p <0.0001.
[0041] Figure 30 illustrates time until continuous seizure in a PTZ assay of the mice as described in Figure 25. Statistical significance is indicated in the figure or legend, with adjusted p-values as follows: * - p < 0.05; ** - p , 0.01.
[0042] Figure 31 illustrates level of UBE3A protein in the mice described in Fig. 25. Protein levels are expressed as a percentage of the level in WT untreated animals, ** = p < 0.01.
[0043] Figure 32 illustrates expression of UBE3A-ATS in different brain regions of NHPs treated with vehicle (first bar of each pair) or an AAV expressing a miR-190 scaffold containing SEQ ID NO: 12 (second bar of each pair). UBE3A-ATS expression is shown relative to the vehicle treated group.
[0044] Figure 33 illustrates the percentage of the paternal allele in UBE3A mRNA in the indicated brain regions.
[0045] Figure 34 shows the time until fall (seconds) for WT unmanipulated mice, Angelman syndrome (AS) unmanipulated mice and AS AAV-miR dosed mice. Statistical significance is indicated in the figure or legend, with adjusted p-valucs as follows: * = p < 0.05; ** = p < 0.01; *** = p < 0.001; **** = p <0.0001.
[0046] Figure 35 A illustrates relative Ube3a mRNA abundance in the brains of WT control mice and in control or AAV-miR treated Angclman model mice. Expression levels in WT untreated mice are normalized to 1 for comparison. Statistical significance is indicated in the figure or legend, with adjusted p-values as follows: * - p < 0.05; ** - p , < 0.01; *** - p < 0.001; **** - p <0.0001.
[0047] Figure 35B illustrates relative Ube3a-Ats abundance in the brains of WT control mice and in control or AAV-miR treated Angelman model mice. Expression levels in WT untreated mice are normalized to 1 for comparison. Statistical significance is indicated in the figure or legend, with adjusted p-values as follows: * - p < 0.05; ** - p , < 0.01; *** - p < 0.001; **** - p <0.0001.
[0048] Figure 36 illustrates body weights of the mice described in Figures 35 A and B. The data has been divided to show the male (M) and female (F) mice separately. Statistical significance is indicated in the figure or legend, with adjusted p-values as follows: * = p < 0.05; ** = p < 0.01; *** - p < 0.001; **** - p <0.0001.
[0049] Figure 37 illustrates distance traveled in an open field assay by the mice as described in Figures 35 A and B. Statistical significance is indicated in the figure or legend, with adjusted p- values as follows: * = p < 0.05; ** = p < 0.01; *** - p < 0.001; **** - p <0.0001.
[0050] Figure 38 illustrates expression of UBE3A mRNA and UBE3A-ATS RNA in Angelman Syndrome patient derived iPSC-derived neurons treated with the indicated doses of an AAV expressing SEQ ID NO: 128.
[0051] Figure 39 illustrates expression of UBE3A protein in Angelman Syndrome patient derived iPSC-derived neurons treated with the indicated doses of an AAV expressing SEQ ID NO: 128.
[0052] Figure 40 illustrates differential expression analysis in human iPSC-derived neurons treated with an AAV expressing SEQ ID NO: 128 or a scrambled control miRNA. Only two genes demonstrated differential expression by 2-fold or more; UBE3A-ATS is indicated by the triangle and paternal UBE3A (pUBE3A) by the large circle.
[0053] Figure 41 illustrates a representative image of expression of the miRNA of SEQ ID NO: 12 in the brain of a non-human primate treated with an AAV expressing SEQ ID NO: 128.
[0054] Figure 42 illustrates levels of the miRNA of SEQ TD NO: 12 in the CSF of non-human primates treated with an AAV expressing SEQ ID NO: 128. For the vehicle control group n=3 and for each treatment group n=2.
[0055] Figure 43 illustrates levels of the miRNA of SEQ ID NO: 12 in the serum of non-human primates treated with an AAV expressing SEQ ID NO: 128. For the vehicle control group n=3 and for each treatment group n=2.
[0056] Figure 44 illustrates levels of UBE3A-ATS RNA in the cortex of non-human primates treated with vehicle or an AAV expressing SEQ ID NO: 128. For the vehicle control group n=3 and for each treatment group n=2.
[0057] Figure 45 illustrates levels of UBE3A mRNA in the cortex of non-human primates treated with vehicle or an AAV expressing SEQ ID NO: 128. For the vehicle control group n=3 and for each treatment group n=2.
[0058] Figure 46 illustrates the percentage of paternal UBE3A mRNA expressed in different brain regions of non-human primates treated with vehicle (n=3) or an AAV expressing SEQ ID NO: 128 at a dose of 5E13 vg / animal (Dose 1, n=2) or 1E14 vg / animal (Dose 2, n=2).
[0059] Figure 47 illustrates relative miRNA abundance in iPSC derived GABAergic cells treated with an scAAV9 expressing SEQ ID NO: 128.
[0060] Figure 48 illustrates abundance of the paternal UBE3A allele as a fraction of total UBE3A expression in iPSC derived GABAergic cells treated with an scAAV9 expressing SEQ ID NO: 128.
[0061] Figure 49 illustrates UBE3A-ATS expression in iPSC derived GABAergic cells treated with an scAAV9 expressing SEQ ID NO: 128.
[0062] Figure 50A illustrates expression of miRNA from an ssAAV9 comprising SEQ ID :NO: 140 and an scAAV9 comprising SEQ ID NO: 137.
[0063] Figure 50B illustrates guide:passenger ratios of miRNAs expressed from an ssAAV9 comprising SEQ ID NO: 140 and an scAAV9 comprising SEQ ID NO: 137.
[0064] Figure 50C illustrates 5’ precision of miRNAs expressed from an ssAAV9 comprising SEQ ID NO: 140 and an scAAV9 comprising SEQ ID NO: 137.
[0065] Figure 51 illustrates length distributions of miRNAs expressed from an ssAAV9 comprising SEQ ID :NO: 140 and an scAAV9 comprising SEQ ID NO: 137.DEFINITIONS
[0066] As used herein, the singular forms "a", "an" and "the" arc intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms "including", "includes", "having", "has", "with", or variants thereof are used in either the detailed description and / or the claims, such terms are intended to be inclusive in a manner similar to the term "comprising".
[0067] The term "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or a derivative thereof. The term covers all serotypes, subtypes, and both naturally occurring and recombinant forms, except where required otherwise. The abbreviation "rAAV" refers to recombinant adeno-associated virus. The term "AAV" includes all serotypes of AAV, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hul4), AAV10, AAV11, AAV 12, AAV13, AAVrh8, AAVrhlO, AAV-DJ, and AAV-DJ8, and hybrids thereof (i.e., chimeric AAV vectors), as well as avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. The genomic sequences of various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank. A "rAAV vector" as used herein refers to an AAV vector comprising a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV), typically a sequence of interest for the genetic transformation of a cell. In general, the heterologous polynucleotide is flanked by at least one, and generally by two, AAV inverted terminal repeat sequences (ITRs). An rAAV vector may either be single-stranded (ssAAV) or self-complementary (scAAV). See, e.g., Raj et al., Expert Rev Hematol. 2011 Oct; 4(5): 539-549. An "AAV virus" or "AAV viral particle" refers to a viral particle composed of at least one AAV capsid protein and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell), it is typically referred to as an "rAAV viral particle" or simply an "rAAV particle". AAVs may comprise genome components and capsids from multiple serotypes (e.g., pseudotyped vectors). For example, an AAV may comprise the genome of serotype 2 (e.g., ITRs) packaged in the capsid from serotype 5 or serotype 9. Pseudotyped vectors may demonstrate improved transduction efficiency as well as altered tropism. In some cases, an AAV serotype that can cross the bloodbrain barrier or infect cells of the CNS is preferred.In certain embodiments, variant AAV capsids that have improved CNS tropism and / or that cross the blood-brain barrier arc employed, including, but not limited to: bCapl (SEQ ID NO:2 from W02023060264); AAV-B1 (SEQ ID NO: 5 from WO2016054557); AAV-S (AAV9 with insertion of SEQ ID NO:1 from WO2020198737); AAV-TT (SEQ ID NO:2 from W02015121501); and VCAP-101 or VCAP- 102 (SEQ ID NOS: 981 and 982, respectively, from WO2023081648). In some aspects, the recombinant AAV vector is AAV1, AAV8, AAV9, AAVDJ, or chimeric AAV comprising features of two or more of these serotypes. In various embodiments, the AAV vector is an AAV9 vector or an scAAV9 vector. In certain embodiments, the AAV vector is an AAV9 vector or an scAAV9 vector and comprises a heterologous nucleic acid flanked by ITRs from a AAV serotype other than AAV9. In certain embodiments, the AAV vector is an AAV9 vector or an scAAV9 vector and comprises a heterologous nucleic acid flanked by AAV serotype 2 ITRs (i.e., ITR2).
[0068] The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within one or more than one standard deviation, per the practice in the art. Alternatively, "about" can mean a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 1%) of a given value.
[0069] In any of the embodiments described herein, "comprising" may be replaced with "consisting essentially of" or "consisting of." For example, an embodiment in which a particular element is included using the open-ended term “comprising” encompasses embodiments in which the element is included using the more restrictive terms “consisting essentially of’ or “consisting of’.
[0070] The terms "determining", "measuring", "evaluating", "assessing", "assaying", "analyzing", and their grammatical equivalents can be used interchangeably herein to refer to any form of measurement and include determining if an element is present or not (for example, detection). These terms can include both quantitative and / or qualitative determinations. Assessing may be relative or absolute.
[0071] The term "expression" refers to the process by which a nucleic acid sequence or a polynucleotide is transcribed from a DNA template (such as into mRNA or other RNAtranscript) and / or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as "gene product." If the polynucleotide includes introns or splice sites, e.g., is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
[0072] An "expression cassette" refers to a nucleic molecule comprising one or more regulatory elements operably linked to a coding sequence (e.g., a gene or genes) for expression.
[0073] A “transgene” refers to a portion of a nucleic acid cassette that is designed to be expressed in a cell. In some embodiments, a transgene encodes functional RNA, e.g., an antisense RNA. In some embodiments, a transgene of the present disclosure encodes a therapeutic cargo, e.g., a therapeutic RNA.
[0074] The term "effective amount" or "therapeutically effective amount" refers to that amount of a composition described herein that is sufficient to affect the intended application, including but not limited to disease treatment, as defined below. The therapeutically effective amount may vary depending upon the intended treatment application (in a cell or in vivo), or the subject and disease condition being treated, e.g., the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will induce a particular response in a target cell. The specific dose will vary depending on the particular composition chosen, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, the tissue to which it is administered, and the physical delivery system in which it is carried.
[0075] A "fragment" of a nucleotide or peptide sequence is meant to refer to a sequence that is less than that believed to be the "full-length" sequence.
[0076] A "functional fragment" of a DNA, RNA, or protein sequence refers to a biologically active fragment of the sequence that is shorter than the full-length or reference DNA, RNA, or protein sequence, but which retains at least one biological activity (either functional or structural) that is substantially similar to a biological activity of the full-length or reference DNA, RNA, or protein sequence.
[0077] The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include theprimary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
[0078] The term "human derived" as used herein refers to sequences that are found in a human genome (or a human genome build), or sequences homologous thereto. A homologous sequence may be a sequence which has a region with at least 80% sequence identity (e.g., as measured by BLAST) as compared to a region of the human genome. For example, a sequence that has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to a human sequence is deemed human derived. In some cases, a regulatory element contains a human derived sequence and a non-human derived sequence such that overall the regulatory element has low sequence identity to the human genome, while a part of the regulatory element has 100% sequence identity (or local sequence identity) to a sequence in the human genome.
[0079] The term "in vitro" refers to an event that takes places outside of a subject's body. For example, an in vitro assay encompasses any assay run outside of a subject. In vitro assays encompass cell-based assays in which cells alive or dead are employed. In vitro assays also encompass a cell-free assay in which no intact cells are employed.
[0080] The term "in vivo" refers to an event that takes place in a subject's body.
[0081] An "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally, at a chromosomal location that is different from its natural chromosomal location, or contains only coding sequences.
[0082] As used herein, "operably linked", "operable linkage", "operatively linked", or grammatical equivalents thereof refer to juxtaposition of genetic elements, e.g., a promoter, an enhancer, a poly adenylation sequence, etc., wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a regulatory element, which can comprise promoter and / or enhancer sequences, is operatively linked to a coding region if the regulatory element helps initiate transcription of the coding sequence. There may be intervening residuesbetween the regulatory element and coding region so long as this functional relationship is maintained.
[0083] A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation or composition, other than an active ingredient, which is nontoxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
[0084] The terms "pharmaceutical formulation" or "pharmaceutical composition" refer to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
[0085] The term "regulatory element" refers to a nucleic acid sequence or genetic element which is capable of influencing (e.g., increasing, decreasing, or modulating) expression of an operably linked sequence, such as a gene, a coding sequence, or an RNA (e.g., an mRNA). Regulatory elements include, but are not limited to, promoter, enhancer, repressor, silencer, insulator sequences, an intron, UTR, an inverted terminal repeat (ITR) sequence, a long terminal repeat sequence (LTR), a stability element, a miRNA target site, a posttranslational response element, or a polyA sequence, or a combination thereof. Regulatory elements can function at the DNA and / or the RNA level, e.g., by modulating gene expression at the transcriptional phase, post- transcriptional phase, or at the translational phase of gene expression; by modulating the level of translation (e.g., stability elements that stabilize mRNA for translation), RNA cleavage, RNA splicing, and / or transcriptional termination; by recruiting transcriptional factors to a coding region that increase gene expression; by increasing the rate at which RNA transcripts are produced, increasing or decreasing the stability of RNA produced, and / or increasing the rate of protein synthesis from RNA transcripts; and / or by preventing RNA degradation and / or increasing its stability to facilitate protein synthesis. In an exemplary embodiment, a regulatory element refers to an enhancer, repressor, promoter, or a combination thereof, particularly an enhancer plus promoter combination or a repressor plus promoter combination. In exemplary embodiments, the regulatory element is derived from a human sequence.
[0086] In general, "sequence identity" or "sequence homology", which can be used interchangeably, refer to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Two or moresequences (polynucleotide or amino acid) can be compared by determining their "percent identity", also referred to as "percent homology". The percent identity to a reference sequence (e.g., nucleic acid or amino acid sequence) may be calculated as the number of exact matches between two optimally aligned sequences divided by the length of the reference sequence and multiplied by 100. Conservative substitutions are not considered as matches when determining the number of matches for sequence identity. It will be appreciated that where the length of a first sequence (A) is not equal to the length of a second sequence (B), the percent identity of A:B sequence will be different than the percent identity of B:A sequence. Sequence alignments, such as for the purpose of assessing percent identity, may be performed by any suitable alignment algorithm or program, including but not limited to the Needleman-Wunsch algorithm, the BLAST algorithm, the Smith-Waterman algorithm (see, e.g., the EMBOSS Water aligner), and Clustal Omega alignment program (F. Sievers et al., Mol Sys Biol. 7: 539 (2011)). Optimal alignment may be assessed using any suitable parameters of a chosen algorithm, including default parameters. The BLAST program is based on the alignment method of Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:2264-2268 (1990) and as discussed in Altschul, et al., J. Mol. Biol. 215:403-410 (1990); Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5877 (1993); and Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997).
[0087] The terms "subject" and "individual" are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. The methods described herein can be useful in human therapeutics, veterinary applications, and / or preclinical studies in animal models of a disease or condition.
[0088] As used herein, the terms "treat", "treatment", "therapy" and the like refer to obtaining a desired pharmacologic and / or physiologic effect, including, but not limited to, alleviating, delaying or slowing progression, reducing effects or symptoms, preventing onset, preventing reoccurrence, inhibiting, ameliorating onset of a diseases or disorder, obtaining a beneficial or desired result with respect to a disease, disorder, or medical condition, such as a therapeutic benefit and / or a prophylactic benefit. "Treatment," as used herein, covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease or at risk of acquiring the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease. A therapeuticbenefit includes eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder. In some cases, for prophylactic benefit, the compositions are administered to a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made. The methods of the present disclosure may be used with any mammal. In some cases, the treatment can result in a decrease or cessation of symptoms. A prophylactic effect includes delaying or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof.
[0089] A "variant" of a nucleotide sequence refers to a sequence having a genetic alteration or a mutation as compared to the most common wild-type DNA sequence (e.g., cDNA or a sequence referenced by its GenBank accession number) or a specified reference sequence (sometimes referred to herein as a “parent” sequence). A variant can be shorter or longer than the reference sequence and / or have one or more mutations relative to the reference sequence. In some cases, a variant may have a nucleotide sequence that is at least 80% identical, at least 90% identical or at least 95% identical to a reference sequence.
[0090] A "variant" of a polypeptide or protein sequence refers to a sequence having an amino acid difference as compared to a parent polypeptide or protein sequence, e.g., a wild-type polypeptide or protein sequence or a specified reference polypeptide or protein sequence. A variant can be shorter or longer than the parent sequence (i.e., include inserted or deleted amino acids) and / or have one or more substitutions relative to the parent sequence (i.e., a change of one or more amino acids in the parent sequence to a different amino acid). In some cases, a variant may have a polypeptide sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to its parent sequence.
[0091] A "vector" as used herein refers to a nucleic acid molecule that can be used to mediate delivery of another nucleic acid molecule to which it is linked into a cell where it can be replicated or expressed. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has beenintroduced. Certain vectors are capable of directing the expression of nucleic acids to which they arc operatively linked. Such vectors arc referred to herein as "expression vectors." Other examples of vectors include plasmids and viral vectors.
[0092] As used herein a “target cell” is generally a cell in which expression of RNA or protein product of the nucleic acid cassette is desired. A non-target cell is a cell in which expression of the RNA or protein product of the nucleic acid is not desired. As used herein “detargeting” generally refers to decreasing the expression in a non-target cell.
[0093] Unless otherwise indicated, all terms used herein have the same meaning as they would to one skilled in the art and the practice of the present invention will employ, conventional techniques of molecular biology, microbiology, and recombinant DNA technology, which are within the knowledge of those of skill of the ail.DETAILED DESCRIPTION
[0094] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, and as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0095] The upper and lower limits of ranges may independently be included in the ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0096] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.
[0097] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, forexample, reference to “a protein” includes a plurality of such proteins and reference to “the nucleic acid” includes reference to one or more nucleic acids and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
[0098] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.
[0099] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
[0100] As summarized above, this disclosure describes methods and compositions for increasing UBE3A expression in cells wherein UBE3A-ATS is expressed. In one aspect, the present application provides nucleic acid cassettes which encode RNAs that are complementary to one or more regions of UBE3A-ATS. In another aspect, the present application provides oligonucleotides that are complementary to one or more regions of UBE3A-ATS.
[0101] An oligonucleotide of this disclosure may be between 15 and 40 nucleotides in length. In some cases, an oligonucleotide may be between 10 and 30 nucleotides in length. In some cases, an oligonucleotide is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
[0102] The disclosed oligonucleotides can have a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 80% complementary, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% complementarity to a sequence of UBE3A-ATS.
[0103] In some embodiments, this disclosure describes oligonucleotides which bind, target, or are complementary to a nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15, according to Genome Reference Consortium Human Build 38, released 2013 / 12 / 17 (GRCh38.pl3), as deposited in GenBank as accession number NC_000015. In some embodiments, this disclosure describes oligonucleotides which bind, target, or are complementary to an RNA transcribed from a region between positions 25,170,426 and 25,252,333 on human chromosome 15. In some embodiments, this disclosure describes oligonucleotides which bind, target, or are complementary to an RNA comprising a region transcribed from a genomic sequence between positions 25,170,426 and 25,252,333 on human chromosome 15 according to GRCh38. The nucleotide sequence of an RNA transcribed from position 25,170,426 to position 25,252,333 on human chromosome 15 is also provided herein as SEQ ID NO: 1. In some embodiments, this disclosure describes oligonucleotides which bind, target, or are complementary to a nucleotide sequence within SEQ ID NO: 1.
[0104] An oligonucleotide may bind, or target, a sequence that is perfectly complementary to the oligonucleotide, or may bind to, or target, a sequence which includes mismatches in some positions relative to the genomic sequence. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to a 10-40 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15. An oligonucleotide of this invention may be complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to a 10-30 nucleotide sequence located within SEQ ID NO: 1. In some cases, an oligonucleotide described herein may be complementary to a 10-30 nucleotide sequence located within SEQ ID NO: 1. An oligonucleotide of this invention may bind to a 10-30 nucleotide sequence located within SEQID NO: 1 . In some cases, and oligonucleotide of this invention targets a 10-30 nucleotide sequence of SEQ ID NO: 1.
[0105] In some embodiments, this disclosure describes oligonucleotides which bind to, target, or are complementary to, a nucleotide sequence of a spliced or unspliced SNORD115 transcript. The oligonucleotide may bind within, or be complementary to a sequence within, a 3’ region, intron, exon or 5’ region of the SNORD115 transcript. In some cases, the oligonucleotide may target a 10-30 nucleotide sequence within, a 3’ region, intron, exon or 5’ region of the SNORD115 transcript. In some cases, the oligonucleotide may bind within, target, or be complementary, to a repeated sequence within a spliced or unspliced SNORD115 transcript. In some cases, the oligonucleotide may bind to, target, or be complementary to a repeated sequence within SEQ ID NO: 1. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, or at least 50, 10-30 nucleotide sequences located within SEQ ID NO: 1. The at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, or at least 50, 10-30 nucleotide sequences located within SEQ ID NO: 1 may be different sequences, or may be the same sequence but repeated multiple times within SEQ ID NO: 1. In some cases, an oligonucleotide described herein may be complementary to a 10-30 nucleotide sequence located within SEQ ID NO:1, wherein the 10-30 nucleotide sequence is repeated at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, or at least 50 times within SEQ ID NO: 1. In some cases, an oligonucleotide of this invention may bind, target, or be at least 80%, 85%, 90%, 95%, or 98% complementary to a 10-30 nucleotide sequence located within SEQ ID NOs: 2, 3, 77, or 78. In some cases, an oligonucleotide described herein may bind, target, or be complementary to a 10-30 nucleotide sequence located within SEQ ID NOS: 2, 3, 77 or 78.
[0106] In some cases, an oligonucleotide described herein binds to, or targets, a spliced or unspliced SNORD115-E3 transcript. In some cases, an oligonucleotide described herein binds to, targets, or is complementary to a sequence of, any one of exons 139-143 of SNORD115-E3. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to a contiguous nucleotide sequence within any one of exons 139-143 of SNORD115-E3. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to a sequence located within any one of SEQ ID NOs: 4-8. In some cases, an oligonucleotidedescribed herein may be complementary to a sequence located within any one of SEQ TD NOs: 4-8.
[0107] An oligonucleotide described herein may comprise a sequence at least 80%, 85%, 90%, 95%, or 98% identical to a sequence of any one of SEQ ID NOS: 9-38. An oligonucleotide described herein may comprise a sequence of any one of SEQ ID NOS: 9-38. In some cases, an oligonucleotide described herein may have a sequence of any one of SEQ ID NOS: 9-38. In some cases, an oligonucleotide described herein may comprise a sequence of any one of SEQ ID NOS: 9-38, and may also comprise an additional 1, 2, 3, 4, or 5 nucleotides which are complementary to the 1, 2, 3, 4, or 5 nucleotides surrounding the oligonucleotide binding site on SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, or 77. In some cases, an oligonucleotide of this disclosure may comprise a sequence complementary to a sequence located within SEQ ID NO: 1, wherein the sequence complementary to a sequence located within SEQ ID NO:1 comprises a fragment of any one of SEQ ID NOS: 9-38. In some cases, the oligonucleotide may be a walkthrough of an RNA binding site on SEQ ID NO: 1, wherein the binding site is complementary to any one of SEQ ID NOS: 9-38.
[0108] In some cases, the oligonucleotide is a non-naturally occurring oligonucleotide. Oligonucleotide design refers to the pattern of nucleoside sugar modifications in the oligonucleotide sequence. The disclosed antisense oligonucleotide may comprise sugar-modified nucleosides and may also comprise DNA, RNA, or arabino nucleic acid (ANA) nucleosides. In some embodiments, the oligonucleotide comprises sugar-modified nucleosides and DNA nucleosides. In some embodiments, the oligonucleotide comprises sugar-modified nucleosides and RNA nucleosides. In some embodiments, the oligonucleotide comprises sugar-modified nucleosides and ANA nucleosides.
[0109] In some embodiments, the oligonucleotide comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides. In an embodiment the oligonucleotide comprises from 1 to 10 modified nucleosides, such as from 2 to 9 modified nucleosides, such as from 3 to 8 modified nucleosides, such as from 4 to 7 modified nucleosides, such as 6 or 7 modified nucleosides.
[0110] In some embodiments, the oligonucleotide comprises at least one modified intemucleoside linkage. In some embodiments, the internucleoside linkages within thecontiguous nucleotide sequence are phosphorothioate or boranophosphate intemucleoside linkages.
[0111] In some embodiments, the oligonucleotide is an RNA and does not comprise a modified nucleoside. In some cases, an RNA may be chemically synthesized, or may be expressed in a cell from a DNA template. In some embodiments, an RNA as described herein may be an miRNA, a siRNA a shRNA, or an RNA oligonucleotide.
[0112] Reference to an “RNA” in this disclosure, particularly reference an RNA that binds to a target sequence in another molecule such as an RNA transcript or a sequence on human chromosome 15, refers to an RNA molecule that can have an inhibitory effect on expression of the other molecule. Such inhibitory RNAs include, but are not limited to antisense RNAs and inhibitory RNA (e.g., siRNAs and miRNAs). Such molecules are reviewed in a number of publications, including Hastings et al (RNA 2023 29: 393-395). Such RNA molecules can be made synthetically. Alternatively, RNA can be encoded by a transgene. If a transgene “encodes” such an RNA, then the transgene may contain all of the necessary sequence elements to effect expression of the RNA, or a precursor of the same that will be processed by the cell’s endogenous machinery to produce the RNA.
[0113] Antisense oligonucleotides (ASOs) are small (-18-30 nucleotides) single- stranded nucleic acids of diverse chemistries, which can be employed to modulate gene expression via various mechanisms. ASOs can be subdivided into two major categories: RNase H competent and steric block. RnaseH competent ASOs comprise DNA. For RnaseH competent ASOs, the endogenous RNase H enzyme recognizes RNA-DNA heteroduplex substrates that are formed when DNA-based oligonucleotides bind to their cognate transcripts and catalyzes the degradation of the RNA. Cleavage at the site of ASO binding results in destruction of the target RNA, thereby silencing target gene expression.
[0114] Steric block oligonucleotides are typically RNA. These ASOs are designed to bind to target transcripts with high affinity but do not induce target transcript degradation as they lack RNase H competence. Steric block oligonucleotides can mask specific sequences within a target transcript and thereby interfere with transcript RNA-RNA and / or RNA-protein interactions. The most widely used application of steric block ASOs is in the modulation of alternative splicing in order to selectively exclude or retain a specific exon. In these cases, the oligonucleotide ‘masks’a splicing signal such that it becomes invisible to the spliceosome, leading to alterations in splicing.
[0115] ASOs are typically made synthetically, in which case they may contain any number of chemical modifications, including nucleobase modifications, terminal modifications and ribose sugar modifications (e.g., 2'-O-methoxyethyl or 2'-O-methyl bases) and can be directly administered, e.g., using a lipid-based carrier such as lipid nanoparticles.
[0116] Silencing RNAs, on the other hand, target the RNA transcript to which they bind for translational repression, destabilization or degradation, typically via the RISC complex. miRNAs (microRNAs) and siRNAs (small interfering RNAs) are types of silencing RNAs. Silencing RNAs are typically produced by transcribing a longer hairpin molecule (referred to as a ‘pri- miRNA’ or ‘pre-miRNA’ in the case of miRNAs or a ‘shRNA’ (short hairpin RNA) in the case of siRNAs) from an expression cassette in a cell, which is then processed by the cell’s endogenous machinery. Pre- and pri-miRNAs are encoded by the human genome. miRNAs are initially transcribed as longer primary transcripts (or termed pri-miRNAs), containing a 60- 120 nt RNA hairpin in which one of the two strands includes the miRNA. siRNAs can be designed using the sequence of a transcript. shRNAs have a 19-29 base pair stem, a small loop and 3 '-terminal overhang, typically a UU overhang. In both cases, the hairpin is subsequently processed by Dicer to produce a duplex of 21 to 23 nucleotides and a 3’ overhang. miRNAs have the same general structure as siRNAs, except that there may be mismatches in the duplex. Although either strand of the duplex may potentially act as a functional silencing RNA, only one strand is usually incorporated into the RNA-induced silencing complex (RISC) where the miRNA / siRNA and its target interact. Such molecules can also be produced by a ‘mature’ miRNA vector system that makes use of convergent promoters (e.g., the U6 and Hl promoters). A description of several strategies for expressing miRNAs and shRNAs can be found Fan et al (Cancer Gene Therapy 27: 424-437) and Herrera-Carrillo et al (Hum Gene Ther Methods 2017 28: 177-190).
[0117] Because strategies that rely on silencing RNA (particularly miRNAs) should be non- immunogenic and expression of the silencing RNA can be restricted to a particular tissue or celltype by the use a tissue-specific or cell type-specific promoter, therapies that are based on administering silencing RNAs have the potential to have less side effects in certain cases. Further, multiple silencing RNAs can, in theory, be encoded on a single vector, allowing a singletranscript to be targeted by multiple different silencing RNAs. Finally, silencing RNA-based strategics should result in long term effects, because, in theory, the vector should persist in the cells and should not diffuse away or degraded, which would be the case for certain other types of therapies.Repeated sequences
[0118] In some embodiments, an RNA may be described as binding to a sequence that is repeated in a longer sequence, i.e., a repeated sequence. In these embodiments, the term “repeated sequence element” refers to a sequence that is present at multiple places in a longer contiguous sequence, a “repeat containing sequence”. The repeated sequence element may be repeated with 100% sequence identity, or may be repeated with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97 at least, at least 98%, or at least 99% sequence identity in each instance of the repeated sequence element in the repeat containing sequence. A “repeated sequence element” may be a sequence that is at least 30 nt, at least 50 nt, at least 100 nt, at least 200nt, at least 300 nt, or at least 400 nt in length. A “repeated sequence element” may be present in at least 2, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, or at least 100 places in a repeat containing sequence, where the sequences of the copies of the repeated sequence element may be, independently, at least 80%, at least 90%, or at least 95% identical to the sequence of a single instance of the repeated sequence element.
[0119] One example of a repeated sequence element that is repeated in the sequence between nucleotides 25,170,426 and 25,252,333 of human chromosome 15 (i.e., SEQ ID NO: 1) is: CAGGCCCUUCCUCACACCCUGGUCUCCUGCACUAGCUGUGGUGAGCACAUCCGGG UCCCGCUGGAUGCAUGCAAGAGGUGGUUGGUCUCGUGGGUUGGGUCGAUGAUGA GAACCUUAUAUUUUCCUGAAGAGAGGUGAUGACUUAAAAAUCAUGCUCAAUAGG AUUACGCUGAGGCCCAGCCUAGGUGAGAACUUUGGAAGSEQ ID NO: 2
[0120] This repeated sequence element corresponds to nucleotides 73093 - 73293 of SEQ ID NO: 1 and is 201 nucleotides in length. Allowing for up 34 mismatches (i.e., an approximately 17% variation in the sequence, at approximately 83% sequence identity), at least 37 copies of this repeated sequence element, in addition to nucleotides 73093 - 73293, can be found in SEQ ID NO: 1, specifically at the following intervals: 2116 - 2314, 4411 - 4606, 6312 - 6511, 8216 -8417, 9975 - 10176, 13784 - 13985, 15109 - 15310, 17014 - 17214, 18889 - 19093, 20885 - 21095, 22801 - 23000, 24418 - 24599, 27048 - 27254, 28943 - 29126, 30802 - 31002, 32706 -32906, 33836 - 34036, 35740 - 35941, 37562 - 37761, 39400 - 39597, 41273 - 41473, 43125 -43327, 45023 - 45220, 48098 - 48295, 52728 - 52922, 54681 - 54880, 56584 - 56788, 60341 -60514, 61866 - 62066, 63728 - 63926, 65564 - 65764, 69316 - 69517, 71246 - 71425, 74970 -75157, 76825 - 77024, 78682 - 78877, and 80353 - 80538. Binding sites for SEQ ID NOS: 37, 12, 14, 35, 13, 36, 79, 80, 81, 17 and 18 can be found in this repeated sequence. In other words, binding sites for SEQ ID NOS: 37, 12, 14, 35, 13, 36, 79, 80, 81, 17 and 18 can be found multiple times in SEQ ID NO: 1 because those binding sites can be found in SEQ ID NO: 2 and its copies in SEQ ID NO: 1, where the sequences of the copies are independently at least 83% identical to SEQ ID NO: 2.
[0121] Another example of a repeated sequence element that is repeated in SEQ ID NO: 1 is: UCUGAAGAGAGGUGAUGACUUAAAAAUCAUGCUCAAUAGGAUUACGCUGA GGCCCAGCCUAGGUGAGAAUUUSEQ ID NO: 3
[0122] This repeated sequence element corresponds to nucleotides 6434 - 6505 of SEQ ID NO: 1 and is 72 nucleotides in length. This sequence is repeated 6 times in SEQ ID 1 at 100% sequence identity. At an identity threshold of at least 85% sequence identity at least 42 copies of this repeated sequence element, in addition to nucleotides 6434 - 6505, can be found in SEQ ID NO: 1, specifically at the following intervals: 326 - 396, 2239 - 2308, 4530 - 4598, 8341 - 8411, 10099 - 10170, 11985 - 12054, 13908 - 13979, 15234 - 15304, 17137 - 17208, 19017 - 19086,21019 - 21089, 22924 - 22994, 24522 - 24593, 27177 - 27248, 29051 - 29121, 30926 - 30996,32830 - 32900, 33960 - 34030, 35865 - 35934, 37684 - 37755, 39521 - 39591, 41400 - 41469,43250 - 43321, 45144 - 45214, 48220 - 48290, 50100 - 50169, 51949 - 52018, 52849 - 52919,54805 - 54876, 56712 - 56782, 58570 - 58640, 60441 - 60511, 61989 - 62060, 63851 - 63920,65688 - 65758, 67589 - 67659, 69441 - 69511, 71349 - 71419, 73217 - 73287, 75081 - 75149,76947 - 77018, 78801 - 78871, and 80462 - 80532.
[0123] Binding sites for SEQ ID NOS: 35, 14, 13, 16, 12 and 17 can be found in this sequence.
[0124] In another example, the following sequence can be found 14 times in SEQ ID NO: 1 at 100% sequence identity:UUGUCCUGAAGAGAGGUGAUGACUUAAAAAUCAUG (SEQ ID NO: 77)
[0125] This repeated sequence element corresponds to nucleotides 4525 - 4559 of SEQ ID NO: 1 and is 35 nucleotides in length. At a sequence identity threshold of at least 80% at least 42 copies of this repeated sequence element, in addition to nucleotides 4525 - 4559, can be found in SEQ ID NO: 1, specifically at the following intervals: 321 - 355, 2233 - 2267, 6430 - 6464, 8336 - 8370, 10095 - 10129, 11980 - 12014, 13904 - 13938, 15229 - 15263, 17134 - 17167, 19012 - 19046, 21014 - 21048, 22919 - 22953, 24519 - 24552, 27174 - 27207, 29046 - 29080, 30921 - 30954, 32825 - 32858, 33955 - 33988, 35860 - 35894, 37685 - 37714, 39516 - 39550, 43246 - 43280, 45139 - 45173, 48215 - 48249, 50095 - 50129, 51950 - 51979, 52844 - 52878, 54801 - 54835, 56707 - 56741, 58565 - 58599, 60436 - 60470, 61986 - 62019, 63845 - 63879, 65683 - 65717, 67584 - 67618, 69436 - 69470, 71344 - 71378, 73212 - 73246, 75076 - 75110, 76943 - 76977, 78796 - 78830, and 80457 - 80491. At a sequence identity of at least 96% at least 26 copies of this repeated sequence element are found. Binding sites for SEQ ID NOS: 35, 16, 14, 13, and 12 can be found in this sequence.
[0126] In another example, the following sequence can be found 10 times in SEQ ID NO: 1 at least 80% sequence identity:GCACCCUGGUCUCCUGCACUGAGCUGUGGUGAGCACAUCCAG GUUCUGCUGGAUGCAUGCAUGGGGAGGGCCUUGAUUGGGUCA AUGAUGAGAACCUUAUAU (SEQ ID NO: 78)
[0127] This repeated sequence element corresponds to nucleotides 78695 - 78796 of SEQ ID NO: 1 and is 102 nucleotides in length. At a mismatch or gap for every 6 nucleotides (a sequence identity threshold of at least 83%) at least 9 copies of this repeated sequence element, in addition to nucleotides 78695 - 78796, can be found in SEQ ID NO: 1, specifically at the following intervals: 2126 - 2233, 22812 - 22919, 39411 - 39516, 54694 - 54801, 61879 - 61985, 69329 - 69436, 73106 - 73212, 74969 - 75076, and 76836 - 76943. Binding sites for SEQ ID NOS: 36 and 37 can be found in this sequence.
[0128] In some cases, an oligonucleotide described herein binds to, or targets, a sequence which is repeated within SEQ ID NO:1. In some cases, an oligonucleotide described herein binds to, targets, or is complementary to a sequence which is repeated within SEQ ID NO:1. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to a contiguous nucleotide sequence which is repeated within SEQ ID NO:1. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to a sequencewhich is repeated within SEQ ID NO:1 . In some cases, an oligonucleotide described herein may be complementary to a sequence which is repeated within SEQ ID NO:1. The sequence repeated within SEQ ID NO: 1 may be repeated at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, or at least 50 times within SEQ ID NO: 1. The sequence repeated within SEQ ID NO: 1 may be repeated with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity.
[0129] In some cases, an oligonucleotide described herein binds to, or targets, a sequence within one of more of SEQ ID NOS: 2, 3, 77, and 78. In some cases, an oligonucleotide described herein binds to, targets, or is complementary to a sequence of, any one of SEQ ID NOS: 2, 3, 77, and 78. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to a contiguous nucleotide sequence within any one of SEQ ID NOS: 2, 3, 77, and 78. An oligonucleotide of this invention may be at least 80%, 85%, 90%, 95%, or 98% complementary to a sequence located within any one of SEQ ID NOS: 2, 3, 77, and 78. In some cases, an oligonucleotide described herein may be complementary to a sequence located within any one of SEQ ID NOS: 2, 3, 77, and 78.Sliding Windows
[0130] Reference to an RNA “which binds a nucleotide sequence” in a longer sequence, e.g., in the sequence defined by nucleotides 25,170,426 and 25,252,333 of human chromosome 15 (i.e., SEQ ID NO: 1), or a transcript encoded by the same, refers to an RNA that binds to any subsequence within that longer sequence. The sub-sequence may be of any length, e.g., in the range of 10 nts to 1,000 nts, 10 nts to 100 nts, 10 nts to 50 nts or 10 nts to 30 nts in length (e.g., 15 to 25 nts in length), and may start at any position in the longer sequence. That is, the 5’ end of the sub-sequence may be at any position in the longer sequence, e.g., at position 1, 2, 3, 4, 5, etc.Mismatches
[0131] miRNAs are known to regulate gene expression by binding to a target sequence. miRNAs contain a seed sequence, which is a conserved heptametrical sequence which is situated at positions 2-7 from the 5 '-end of the miRNAs. The seed sequence should be perfectly complementary to the target sequence. The remainder of the miRNA sequence (i.e., the sequence that is 3’ to the seed sequence) can be less than perfectly complementary to the target sequence.As such, in many cases, an RNA that ‘binds’, ‘recognizes’ or ‘targets’ a longer sequence may, in some embodiments, comprise 6, 7, 8, 9 or 10 contiguous nucleotides that perfectly base pair with the target sequence at the 5’ end and a 3’ and that contains mismatches. In any embodiment, an RNA of the invention may contain 0, 1 , 2, 3 or 4 mismatches relative to the sequence to which it binds, particularly towards the 3’ end.Transgenes
[0132] In some embodiments, this disclosure provides a transgene which encodes an RNA. The transgene may comprise a sequence encoding the RNA as described herein and sequences that enable expression and processing of the RNA. In some cases, the transgene comprises a miRNA scaffold sequence. In some cases, the transgene comprises a sequence encoding a pri-miRNA. In some cases, the transgene comprises a sequence encoding a pre-miRNA. In some cases, the transgene comprises a sequence encoding an shRNA.Scaffolds
[0133] In some embodiments, a pri-miRNA may comprise an RNA of the present disclosure (e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions), the complement of the RNA (with the optional exception of 1, 2, 3, 4 or 5 nucleotide substitutions, which produce bulges) and the scaffold (which may comprises a 5’ flanking sequence, a 5’ stem, a loop, a 3’ stem, and a 3’ flanking sequence). The RNA can be on either side of the loop. As such, in some embodiments, a pri-miRNA may comprise an optional 5’ flanking sequence, a 5’ stem, the antisense of an RNA (passenger; with the optional exception of 1, 2, 3, 4 or 5 nucleotide substitutions, which produce bulges), a loop, the RNA (guide), a 3’ stem, and an optional 3’ flanking sequence. Alternatively, a pri-miRNA may comprise an optional 5’ flanking sequence, a 5’ stem, the RNA (guide), a loop, the antisense of the RNA (passenger; with the optional exception of 1, 2, 3, 4 or 5 nucleotide substitutions, which produce bulges), a 3’ stem, and an optional 3’ flanking sequence. mRNA scaffolds are described in a variety of publications, including Xie et al (Mol. Ther. 2020 28: 422-430), Bofill-De Ros et al (Methods 2016 103: 157-166), Curtin et al (Adv. Healthc. Mater. 2018 7) and Rao at al (Adv. Drug Deliv. Rev. 2009 61: 746-59), Galka-Marciniak et al (Biochimica et Biophysica Acta 2016 1859: 639-649).
[0134] In some embodiments, a pri-miRNA may comprise an RNA of the present disclosure (e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotidesubstitutions), the complement of the RNA (with the optional exception of 1 , 2, 3, 4 or 5 nucleotide substitutions, which produce bulges) and the scaffold (which may comprises a 5’ flanking sequence, a 5’ stem, a loop, a 3’ stem, and a 3’ flanking sequence). The RNA can be on either side of the loop. As such, in some embodiments, a pri-miRNA may comprise an optional 5’ flanking sequence, a 5’ stem, the antisense of an RNA (with the optional exception of 1, 2, 3, 4 or 5 nucleotide substitutions, which produce bulges), a loop, the RNA, a 3’ stem, and an optional 3’ flanking sequence. Alternatively, a pri-miRNA may comprise an optional 5’ flanking sequence, a 5’ stem, the antisense of an RNA, a loop, the RNA, a 3’ stem, and an optional 3’ flanking sequence. mRNA scaffolds are described in a variety of publications, including Xie et al (Mol. Ther. 202028: 422-430), Bofill-De Ros et al (Methods 2016 103: 157-166), Curtin et al (Adv. Healthc. Mater. 2018 7) and Rao at al (Adv. Drug Deliv. Rev. 2009 61: 746-59), Galka- Marciniak et al (Biochimica et Biophysica Acta 2016 1859: 639-649).
[0135] In some embodiments, a pri-miRNA may comprise an RNA of the present disclosure, an antisense of the RNA (optionally with 1, 2, 3, 4, or 5 nucleotide substitutions) and a scaffold as described herein. In some cases, the antisense of the RNA comprises 1, 2, 3, 4 or 5 nucleotide substitutions, which produce bulges. These nucleotide substitutions may be performed such that the resulting bulges mimic the bulges in a naturally occurring pri-miRNA. For example, an antisense RNA in a mir-33 derived scaffold may comprise nucleotide substitutions which result in bulges that mimic the bulges in a naturally occurring pri-miR-33. The nucleotide substitutions may be performed according to the rules set out in the following table.
[0136] For the above, ‘antisense’ sequence refers to a sequence complementary to the nucleotides of the RNA sequence. Mismatch refers to the following substitution rule: G -> C, C - > G, A -> T, T -> A. Bulge mismatch transition refers to the rule: T -> C, C - > A, A -> C, G-> A. Bulge mismatch transversion refers to the rule: G -> T, C -> A, A-> C, T -> G. Add GU wobble refers to the rule: If base is C, then convert to T.
[0137] The following table provides the annotated parts of several exemplary pri-miRNA sequences, including the scaffold sequences.Tabic 1
[0138] In some embodiments, the transgene may encode a pri-miRNA comprising:(i) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem of SEQ ID NO: 83, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of1, 2, 3 or 4 nucleotide substitutions, a loop of SEQ ID NO: 85, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of1 , 2, 3 or 4 nucleotide substitutions, a loop of SEQ ID NO: 91, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem of SEQ ID NO: 96, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 98, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of SEQ ID NO: 102, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of1, 2, 3 or 4 nucleotide substitutions,a loop of SEQ ID NO: 103, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem of SEQ ID NO: 108, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 110, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112; or(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem of SEQ ID NO: 114, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of1, 2, 3 or 4 nucleotide substitutions, a loop of SEQ ID NO: 116, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), and a 3’ stem of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118;(vii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions, a loop of SEQ ID NO: 119, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges, a 3’ stem of SEQ ID NO: 105, andan optional 3’ flanking sequence SEQ ID NO: 106;(viii) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem of SEQ ID NO: 83, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 85, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(ix) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 91, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(x) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem of SEQ ID NO: 96, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 98, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem of SEQ ID NO: 99, and an optional 3’ Hanking sequence of SEQ ID NO: 100;(xi) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of SEQ ID NO: 102,the complement of an RNA of the present disclosure (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 103, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(xii) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem of SEQ ID NO: 108, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 110, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112;(xiii) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem of SEQ ID NO: 114, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 116, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118.
[0139] In some embodiments, the transgene may encode a pri-miRNA comprising:(i) an optional 5’ flanking sequence of SEQ ID NO: 82; a 5’ stem of SEQ ID NO: 83, an antisense strand of SEQ ID NO: 84, a loop of SEQ ID NO: 85, an RNA of 12,a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of SEQ ID NO: 90, a loop of SEQ ID NO: 91, an antisense strand of SEQ ID NO: 92, a 3’ stem of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem of SEQ ID NO: 96, an antisense strand of SEQ ID NO: 97, a loop of SEQ ID NO: 98, an RNA of SEQ ID NO: 90, a 3’ stem of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 103, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem of SEQ ID NO: 108, an antisense strand of SEQ ID NO: 109, a loop of SEQ ID NO: 110, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112; or(vi) an optional 5’ flanking sequence of SEQ ID NO: 113,a 5’ stem of SEQ ID NO: 114, an antisense strand of SEQ ID NO: 115, a loop of SEQ ID NO: 116, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118.(vii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 119, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106. 401 In some embodiments, the transgene may encode a pri-miRNA comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to any one of SEQ ID NOS: 125-129, shown below:SEQ ID NO: 125:GCAGGGCCGGCAUGCCUCUGCUGCUGGCCACGUGAAGAGAUGUGAUGAUUUCC UGUCUGCACCUGUCACUAGUAAGUCAUCACCUCUCUUCAGGUGGCCGUGUAGU GCUACCCAGCGCUGGCUGCCUCCUCAGCAUUGSEQ ID NO: 126:GAGCUCAGUCAAACCUGGAUGCCUUUUCUGCAGGCCUCUGUGUAUAAGGUUCU CAUCAUUGACCUGUUAUUUAAUCCAGGUAUGAUGAGAACCUUACCCUACAGUG UCUUGCCCUGUCUCCGGGGGUUCCUAAUAAAGSEQ ID NO: 127:AGGGCUCUGCGUUUGCUCCAGGUAGUCCGCUGCUCCCUUGGGCCUGGGCCCACU GACAGCCCUGGUGCCUCUGGCCGGCUGCACACCUCCUGGCGGGCAGCUGUGUAA GUCAUCACCUCUCUUCAGUGUUCUGGCAAUACCUGCUGAAGAGUCGCGAUGAC UUACACGGAGGCCUGCCCUGACUGCCCACGGUGCCGUGGCCAAAGAGGAUCUAA GGGCACCGCUGAGGGCCUACCUAACCAUCGUGGGGAAUAAGGACAGUGUCACC CSEQ ID NO: 128:GAGCUCAGUCAAACCUGGAUGCCUUUUCUGCAGGCCUCUGUGUAAGUCAUCAC CUCUCUUCAGGUGUUAUUUAAUCCACCUAGAGAGGUGAUGACUCCCUACAGUG UCUUGCCCUGUCUCCGGGGGUUCCUAAUAAAGSEQ ID NO: 129: CAUGCAGACUGCCUGCUUGGGCGUGAAGAGAGGUGAUGAGAUUAUAUGGACCU GCUAAGCUAUAAGUCAUCACCUCUCUUCAGGCUCAGGCCGGGACCUCUCUCGCC GCACUGAGGGGCACUCCACACCACGGGGGCCGNucleic acid cassettes
[0141] In some cases, a transgene may be contained within a nucleic acid cassette. A nucleic acid cassette may contain one or more additional regulatory elements (e.g., a promoter, a repressor, an insulator, a terminator, miRNA binding site, and / or an enhancer, etc.) that induces or represses expression of a transgene in a particular cell type, or a particular class of cell types. For instance, a cell type selective regulatory element can induce gene expression in a particular cell type relative to one or more other cell types. Alternatively, or in addition, a cell type selective regulatory element can induce gene expression in a particular class of cells relative to one or more other classes of cells. In one embodiment, a cell type selective regulatory element of the invention enhances gene expression in a particular cell type, or a particular class of cells. In another embodiment, a cell type selective regulatory element suppresses gene expression in a particular cell type, or a particular class of cells. Cell type selective modulation of gene expression (e.g., enhancing or suppressing gene expression) does not require that gene expression is affected only in the target cell type or class of cells. Rather, cell type selective modulation of gene expression (e.g., enhancing or suppressing gene expression) requires only that gene expression increase, or decrease, in the target cell type relative to one or more other cell types, or classes of cells.
[0142] In certain embodiments, a promoter may be human derived or comprises a sequence that is human derived. In some cases, the promoter may be mouse derived or comprises a sequence that is mouse derived. In some cases, the promoter is non-naturally occurring or comprises a non-naturally occurring sequence. In some instances, the sequence of a promoter may be 100% human derived. In other instances, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% of the promoter sequence is human derived. For example, a promoter can have 50% of its sequence derived from human, and the remaining 50% be non-human derived (e.g., mouse derived or fully synthetic). In some embodiments, the promoter may be a sequence at least 80%, 85%, 90%, 95% or 100% identical to SEQ ID NO: 130 (U6 promoter).
[0143] In some embodiments, the nucleic acid cassette may comprise a sequence at least 80%, 85%, 90%, 95% or 100% identical to any one of SEQ ID NOS: 131-135.
[0144] In certain embodiments, the nucleic acid constructs described herein comprise another regulatory element in an addition to a promoter, such as, for example, sequences associated with transcription initiation or termination, enhancer sequences, and efficient RNA processing signals. Exemplary regulatory elements include, for example, an intron, an enhancer, UTR, stability element, WPRE sequence, a Kozak consensus sequence, or a combination thereof. Regulatory elements can function to modulate gene expression at the transcriptional phase or post- transcriptional phase of gene expression. At the RNA level, regulation can occur at the level of miRNA processing from pri-miRNA and pre-miRNA. In various embodiments, regulatory elements can recruit transcription factors that increase gene expression selectivity in a cell type of interest, increase the rate at which RNA transcripts are produced, and / or increase the rate of miRNA synthesis from RNA transcripts.
[0145] The cassette may be linear, circular and, in some embodiments, the nucleic acid cassette may be a vector such as a plasmid or viral vector, e.g., an adeno-associated virus (AAV) vector or lentiviral vector. The nucleic acid cassette may comprise sequences allowing for replication or packaging of the nucleic acid cassette. For example, a nucleic acid cassette may comprise viral vector sequences that allow for replication and / or packaging with capsid proteins. In certain embodiments, the viral vector may be an AAV vector selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hul4), AAV10, AAV11, AAV 12, AAV13, AAVrh8, AAVrhlO, AAV-DJ, and AAV-DJ8, and hybrids thereof. In some embodiments, the nucleic acid cassette may comprise an AAV ITR sequence. The AAV ITR sequence may be selected from an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hul4), AAV10, AAV11, AAV 12, AAV13, AAVrh8, AAVrhlO, AAV-DJ, or AAV-DJ8 ITR sequence, or may comprise a hybrid thereof. In some cases, the AAV ITR is an AAV2 ITR.
[0146] In any embodiment, the nucleic acid cassette may be non-naturally occurring, meaning that, for example, the miRNA sequence may be heterologous to the miRNA scaffold sequence. In any embodiment, the nucleic acid cassette may comprise a promoter and / or enhancer. In some embodiments, this nucleic acid cassette may be composed of a promoter, a coding sequence and a terminator, where the promoter, coding sequence and terminator are in operable linkage. In these embodiments, the promoter may be heterologous to the miRNA sequence, meaning that thepromoter does not drive the expression of that miRNA sequence in a wild type cell. In any embodiment, the nucleic acid cassette may additionally comprise an enhancer.
[0147] In some embodiments, the nucleic acid cassette may comprise a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 137. In some embodiments, the nucleic acid cassette may comprise a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 138. In some embodiments, the nucleic acid cassette may comprise a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 139. In some embodiments, the nucleic acid cassette may comprise a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 140. In some embodiments, the nucleic acid cassette may comprise a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 141. In some embodiments, the nucleic acid cassette may comprise a nucleotide sequence of any one of SEQ ID NOS: 137-141.Vectors
[0148] Expression vectors may be used to deliver the nucleic acid molecule to a target cell via transfection or transduction. A vector may be an integrating or non-integrating vector, referring to the ability of the vector to integrate the expression cassette or transgene into the genome of the host cell. Examples of expression vectors include, but are not limited to, (a) non-viral vectors such as nucleic acid vectors including linear oligonucleotides and circular plasmids; artificial chromosomes such as human artificial chromosomes (HACs), yeast artificial chromosomes (YACs), and bacterial artificial chromosomes (BACs or PACs)); episomal vectors; transposons (e.g., PiggyBac); and (b) viral vectors such as retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors.
[0149] Expression vectors may be linear oligonucleotides or circular plasmids and can be delivered to a cell via various transfection methods, including physical and chemical methods. Physical methods generally refer to methods of delivery employing a physical force to counteract the cell membrane barrier in facilitating intracellular’ delivery of genetic material. Examples of physical methods include the use of a needle, ballistic DNA, electroporation, sonoporation, photoporation, magnetofection, and hy droporation. Chemical methods generally refer to methods in which chemical carriers deliver a nucleic acid molecule to a cell and may include inorganic particles, lipid-based vectors, polymer-based vectors and peptide-based vectors.
[0150] In some embodiments, an expression vector is administered to a target cell using an inorganic particle. Inorganic particles may refer to nanoparticlcs, such as nanoparticlcs that arc engineered for various sizes, shapes, and / or porosity to escape from the reticuloendothelial system or to protect an entrapped molecule from degradation. Inorganic nanoparticles can be prepared from metals (e.g., iron, gold, and silver), inorganic salts, or ceramics (e.g., phosphate or carbonate salts of calcium, magnesium, or silicon). The surface of these nanoparticles can be coated to facilitate DNA binding or targeted gene delivery. Magnetic nanoparticles (e.g., supermagnetic iron oxide), fullerenes (e.g., soluble carbon molecules), carbon nanotubes (e.g., cylindrical fullerenes), quantum dots and supramolecular systems may also be used.
[0151] In some embodiments, an expression vector is administered to a target cell using a cationic lipid (e.g., cationic liposome). Various types of lipids have been investigated for gene delivery, such as, for example, a lipid nano emulsion (e.g., which is a dispersion of one immiscible liquid in another stabilized by emulsifying agent) or a solid lipid nanoparticle.
[0152] In some embodiments, an expression vector is administered to a target cell using a peptide-based delivery vehicle. Peptide based delivery vehicles can have advantages of protecting the genetic material to be delivered, targeting specific cell receptors, disrupting endosomal membranes and delivering genetic material into a nucleus. In some embodiments, an expression vector is administered to a target cell using a polymer-based delivery vehicle. Polymer based delivery vehicles may comprise natural proteins, peptides and / or polysaccharides or synthetic polymers. In one embodiment, a polymer-based delivery vehicle comprises polyethylenimine (PEI). PEI can condense DNA into positively charged particles which bind to anionic cell surface residues and are brought into the cell via endocytosis. In other embodiments, a polymer based delivery vehicle may comprise poly-L-lysine (PLL), poly (DL-lactic acid) (PLA), poly ( DL-lactide-co-glycoside) (PLGA), polyomithine, polyarginine, histones, protamines, dendrimers, chitosans, synthetic amino derivatives of dextran, and / or cationic acrylic polymers. In certain embodiments, polymer-based delivery vehicles may comprise a mixture of polymers, such as, for example PEG and PLL.
[0153] In certain embodiments, an expression vector may be a viral vector suitable for gene therapy. Preferred characteristics of viral gene therapy vectors or gene delivery vectors may include the ability to be reproducibly and stably propagated and purified to high titres; to mediate targeted delivery (e.g., to deliver the transgene specifically to the tissue or organ of interestwithout widespread vector dissemination elsewhere); and to mediate gene delivery and transgene expression without inducing harmful side effects.
[0154] Several types of viruses, for example the non-patho genic parvovirus referred to as adeno- associated virus, have been engineered for the purposes of gene therapy by harnessing the viral infection pathway but avoiding the subsequent expression of viral genes that can lead to replication and toxicity. Such viral vectors can be obtained by deleting all, or some, of the coding regions from the viral genome, but leaving intact those sequences (e.g., terminal repeat sequences) that may be necessary for functions such as packaging the vector genome into the virus capsid or the integration of vector nucleic acid (e.g., DNA) into the host chromatin.
[0155] In various embodiments, suitable viral vectors include retroviruses (e.g., A-type, B-type, C-type, and D-type viruses), adenovirus, parvovirus (e.g. adeno-associated viruses or AAV), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e. g. measles and Sendai), positive strand RNA viruses such as picomavirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, fowlpox and canarypox). Examples of retroviruses include avian leukosis-sarcoma virus, human T-lympho trophic virus type 1 (HTLV-1), bovine leukemia virus (BLV), lentivirus, and spumavirus. Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example. Viral vectors may be classified into two groups according to their ability to integrate into the host genome - integrating and non- integrating. Oncoretroviruses and lentiviruses can integrate into host cellular chromatin while adenoviruses, adeno-associated viruses, and herpes viruses predominantly persist in the cell nucleus as extrachromosomal episomes.
[0156] In certain embodiments, a suitable viral vector is a retroviral vector. Retroviruses refer to viruses of the family Retroviridae. Examples of retroviruses include oncoretroviruses, such as murine leukemia virus (MLV), and lentiviruses, such as human immunodeficiency virus 1 (HIV- 1). Retroviral genomes are single-stranded (ss) RNAs and comprise various genes that may be provided in cis or trans. For example, retroviral genome may contain cis-acting sequences such as two long terminal repeats (LTR), with elements for gene expression, reverse transcription and integration into the host chromosomes. Other components include the packaging signal (psi ory), for the specific RNA packaging into newly formed virions and the polypurine tract (PPT), the site of the initiation of the positive strand DNA synthesis during reverse transcription. In addition, the retroviral genome may comprise gag, pol and env genes. The gag gene encodes the structural proteins, the pol gene encodes the enzymes that accompany the ssRNA and carry out reverse transcription of the viral RNA to DNA, and the env gene encodes the viral envelope. Generally, the gag, pol and env are provided in trans for viral replication and packaging.
[0157] In certain embodiments, a retroviral vector provided herein may be a lentiviral vector. At least five serogroups or serotypes of lentiviruses are recognized. Viruses of the different serotypes may differentially infect certain cell types and / or hosts. Lentiviruses, for example, include primate retroviruses and non-primate retroviruses. Primate retroviruses include HIV and simian immunodeficiency virus (SIV). Non-primate retroviruses include feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), caprine arthritisencephalitis virus (CAEV), equine infectious anemia virus (EIAV) and visnavirus. Lentiviruses or lentivectors may be capable of transducing quiescent cells. As with oncoretrovirus vectors, the design of lentivectors may be based on the separation of cis- and trans-acting sequences.
[0158] In exemplary embodiments, a viral vector provided herein is an adeno-associated virus (AAV). AAV is a small, replication-defective, non-enveloped animal virus that infects humans and some other primate species. AAV is not known to cause human disease and induces a mild immune response. AAV vectors can also infect both dividing and quiescent cells without integrating into the host cell genome.
[0159] The AAV genome consists of a linear single stranded DNA which is ~4.7kb in length. The genome consists of two open reading frames (ORF) flanked by an inverted terminal repeat (ITR) sequence that is about 145bp in length. The ITR consists of a nucleotide sequence at the 5’ end (5’ ITR) and a nucleotide sequence located at the 3’ end (3’ ITR) that contain palindromic sequences. The ITRs function in cis by folding over to form T-shaped hairpin structures by complementary base pairing that function as primers during initiation of DNA replication for second strand synthesis. The two open reading frames encode for rep and cap genes that are involved in replication and packaging of the virion. In an exemplary embodiment, an AAV vector provided herein does not contain the rep or cap genes. Such genes may be provided in trans for producing virions as described further below.
[0160] In certain embodiments, an AAV vector may include a filler or st ffer nucleic acid. In some embodiments, the filler or staffer nucleic acid may encode a green fluorescent protein or antibiotic resistance gene such as kanamycin or ampicillin. In certain embodiments, the filler or staffer nucleic acid may be located outside of the ITR sequences (e.g., as compared to the polynucleotide encoding a therapeutic protein or RNA, and regulatory sequences, which are located between the 5’ and 3’ ITR sequences). In certain embodiments, the filler or staffer nucleic acid may be located inside of the ITR sequences (e.g. in proximity to the polynucleotide encoding a therapeutic protein or RNA, and regulatory sequences, which are located between the 5’ and 3’ ITR sequences). In certain embodiments, an AAV vector may include two or more filler or stuffer nucleic acids, at least one outside of the ITR sequences, and at least one inside of the ITR sequences. In a further embodiment, a filler or stuffer polynucleotide sequence may be positioned within a heterologous polynucleotide sequence, e.g., analogous to an intron within a genomic nucleic acid.
[0161] In various embodiments, a filler or stuffer polynucleotide sequence is a sequence between 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-75, 75-100, 100-150, 150-200, 200-250, 250-300, 300-400, 400-500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-2,500, 2,500-3,000, 3,000-3,500, 3,500-4,000, 4,000-4,500, 4,500-5,000, 5,500-6,000, 6,000-7,000, 7,000-8,000, or 8,000-9,000 nucleotides in length.
[0162] In various embodiments, a filler or stuffer polynucleotide sequence has a length that when combined with a heterologous polynucleotide sequence the total combined length of the heterologous polynucleotide sequence and filler or stuffer polynucleotide sequence is between about 3.0-5.5 Kb, between about 4.0-5.0 Kb, between about 4.3-4.8 Kb, or between about 4.6-4.8 Kb when positioned within two wildtype adeno-associated virus (AAV) ITR sequences. In other embodiments, a filler or stuffer polynucleotide sequence has a length that when combined with a heterologous polynucleotide sequence the total combined length of the heterologous polynucleotide sequence and filler or stuffer polynucleotide sequence is between about 1.8-2.8 Kb, between about 2.0-2.5 Kb, or between about 2.1-2.3 Kb when positioned between a wildtype adeno-associated virus (AAV) ITR sequence and a self complementary AAV ITR sequence.
[0163] In certain embodiments, a filler or stuffer polynucleotide sequence may be inert or innocuous and have no function or activity. In various particular aspects, a filler or stuffer polynucleotide sequence may not be a bacterial polynucleotide sequence, a filler or stufferpolynucleotide sequence may not be a sequence that encodes a protein or peptide, a filler or stuffcr polynucleotide sequence may be a sequence distinct from any of: the heterologous polynucleotide sequence, an AAV inverted terminal repeat (ITR) sequence, an expression control element, an origin of replication, a selectable marker or a poly-Adenine (poly-A) sequence. In certain embodiments, a filler or a stuffer may be derived from genomic DNA, for example from human genomic DNA. In certain embodiments, a filler or a stuffer may be derived from human genomic DNA and modified to remove ATG and Alu elements.
[0164] In certain embodiments, a filler or stuffer located within the AAV ITR sequences may be selected from SEQ ID NOS: 130-132.
[0165] Various serotypes of AAV exist, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hul4), AAV10, AAV11, AAV 12, AAV13, AAVrh8, AAVrhlO, AAV-DI, and AAV-DJ8. These serotypes differ in their tropism, or the types of cells they infect. AAVs may comprise the genome and capsids from multiple serotypes (e.g., pseudotypes). For example, an AAV may comprise the genome of serotype 2 (e.g., ITRs) packaged in the capsid from serotype 5 or serotype 9. Pseudotypes may improve transduction efficiency as well as alter tropism.
[0166] In some embodiments, an AAV vector or an AAV viral particle, or virion, may be used to deliver a construct comprising a cell selective regulatory element operably linked to a polynucleotide encoding functional therapeutic protein into a cell, cell type, or tissue, and may done either in vivo, ex vivo, or in vitro. In exemplary embodiments, such an AAV vector is replication-deficient. In some embodiments, an AAV virus is engineered or genetically modified so that it can replicate and generate virions only in the presence of helper factors.
[0167] In certain embodiments, a viral vector can be selected to produce a virion having high infectivity without selectivity for a particular cell type. In some cases, an AAV serotype that can cross the blood brain barrier or infect cells of the CNS is preferred. In certain embodiments, an rAAV particle of the present disclosure comprises an AAV capsid that has an enhanced tropism for a tissue or a cell, e.g., a CNS tissue or cell, where in some embodiments the AAV capsid is modified from a parent capsid, e.g., an AAV capsid with a variant polypeptide sequence and / or having a chemical modification (e.g., a covalently-modified AAV capsid). Examples of AAV capsids that have improved CNS tropism or that can cross the blood brain barrier include, but arc not limited to, those disclosed in the following PCT publications, each of which is incorporatedby reference herein in its entirety: W02023060264 entitled “Capsid variants and methods of using the same” (Dyno Therapeutics, Inc.; sec, c.g., SEQ ID NO: 2 disclosed therein, referred to herein as “bCapl”); WO2016054557 entitled “Novel high efficiency library-identified AAV vectors” (University of Massachusetts; see, e.g., SEQ ID NOs: 5 disclosed therein, referred to herein as “AAV -Bl”); WO2020198737 entitled “Engineered adeno-associated (AAV) vectors for transgene expression” (Harvard College General Hospital Corp.; see, e.g., AAV9 parent with insertion of SEQ ID NO: 1 disclosed therein, referred to herein as “AAV-S”); W02015121501 entitled “Adeno-associated virus vector” (Kings College London; see, e.g., SEQ ID NO:2 disclosed therein, referred to herein as “AAV-TT”); WO2023081648 entitled “AAV capsid variants and uses thereof’ (Voyager Therapeutics, Inc.; see, e.g., SEQ ID NOs: 981 and 982 disclosed therein, referred to herein as “VCAP-101” and “VCAP-102”, respectively);WO2021041498 entitled “Adeno- Associated Viral Vectors for Crossing the Human Blood Brain Barrier”; WO2023168333 entitled “Compositions and Methods for Crossing Blood Brain Barrier”; WO2022235702 entitled “Recombinant AAVs for Delivery to Central Nervous System and Brain Vasculature”; WO2024017387 entitled “Novel AAV Capsids for Targeting Nervous System and Uses Thereof’; WO2024191877 entitled “Human Central Nervous System (CNS) Targeting AAV Variants”; WO2022221193 entitled “Recombinant AAV for treatment of neural disease”; W02024030976 entitled “Compositions and methods for crossing the blood brain barrier”; WO2024218192 entitled “Novel Neurotropic Adeno- Associated Virus Capsids with Detargeting of Peripheral Organs”; W02020072683 entitled “Redirection of Tropism of AAV Capsids”; WO19222441 entitled “AAV Serotypes for Brain Specific Payload Delivery”;W02016081811 entitled “AAV vectors targeted to the central nervous system”; WO2021089856 entitled “Modified adeno-associated virus vectors and delivery thereof into the central nervous system”; and WO2022096681 entitled “Lactam-modified adeno-associated virus vectors”.
[0168] In exemplary embodiments, the application provides expression vectors that have been designed for delivery by an AAV. The AAV can be any serotype, for examples, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hul4), AAV10, AAV11, AAV 12, AAV13, AAVrh8, AAVrhlO, AAV-DJ, and AAV-DJ8, or a chimeric, hybrid, or variant AAV. The AAV can also be a self-complementary AAV (scAAV), where a “self- complementary” AAV is one in which the coding region has been designed to form an intramolecular double-stranded DNA template. Upon infection of such vectors, rather than waitingfor cell mediated synthesis of the second strand, the two complementary halves of the scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. The design of scAAV vectors is described in a variety of publications, including McCarty et al Gene Therapy 2001 8: 1248-54.
[0169] In certain embodiments, an expression vector designed for delivery by an AAV comprises a 5’ ITR and a 3’ ITR. In certain embodiments, an expression vector designed for delivery by an AAV comprises a 5’ ITR, a promoter, a construct as described above and a 3’ ITR. In certain embodiments, an expression vector designed for delivery by an AAV comprises a 5’ ITR, an enhancer, a promoter, a construct as described above and a 3’ ITR.Method for reducing expression of UBE3A-ATS
[0170] In some embodiments, the present disclosure provides methods of reducing expression of UBE3A-ATS in a cell wherein UBE3A-ATS is expressed. The methods may comprise contacting the cell with an oligonucleotide of this disclosure, an RNA of this disclosure, or a nucleic acid cassette or vector of this disclosure. The method of reducing expression of UBE3A- ATS may result in reduced expression compared to a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of UBE3A- ATS may be reduced by about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, or about 98% as compared to expression of UBE3A-ATS in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of UBE3A-ATS may be reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 98% as compared to expression of UBE3A-ATS in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of UBE3A-ATS may be reduced by about 5% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 50%, about 15% to about 50%, or about 15% to about 50%, as compared to expression of UBE3A-ATS in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. The reduction in expression of UBE3A-ATS may be assessed by standard molecular techniques, including quantitative polymerase chain reaction.
[0171] In some embodiments, the present disclosure provides methods of increasing expression of UBE3A mRNA or protein in a cell wherein UBE3A-ATS is expressed. The methods may comprise contacting the cell wherein UBE3A-ATS is expressed with an oligonucleotide of this disclosure, an RNA of this disclosure, or a nucleic acid cassette or vector of this disclosure. The method of increasing expression of UBE3A may result in increased expression compared to a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of UBE3A may be increased by about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, or about 98% as compared to expression of UBE3A in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of UBE3A may be increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 98% as compared to expression of UBE3A in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of UBE3A may be increased by about 5% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 50%, about 15% to about 50%, or about 15% to about 50%, as compared to expression of UBE3A in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. The increase in expression of UBE3A may be assessed by standard molecular techniques, including quantitative polymerase chain reaction and western blot analysis.
[0172] In some embodiments, the present disclosure provides methods of increasing expression of paternal UBE3A mRNA, or protein, in a cell wherein UBE3A-ATS is expressed. The methods may comprise contacting the cell wherein UBE3A-ATS is expressed with an oligonucleotide of this disclosure, an RNA of this disclosure, or a nucleic acid cassette or vector of this disclosure. The method of increasing expression of paternal UBE3A may result in increased expression of paternal UBE3A compared to a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of paternal UBE3A may be increased by about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, or about 98% as compared to expression ofpaternal UBE3A in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of paternal UBE3A may be increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 98% as compared to expression of paternal UBE3A in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of paternal UBE3A may be increased by about 5% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 50%, about 15% to about 50%, or about 15% to about 50%, as compared to expression of paternal UBE3A in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. In some cases, the expression of paternal UBE3A may be increased by at least 1.5 fold, 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 12 fold, 14 fold, 15 fold, or more than 15 fold as compared to expression of paternal UBE3A in a comparable cell not treated with the oligonucleotide, RNA, nucleic acid cassette or vector. The increase in expression of paternal UBE3A may be assessed by standard molecular techniques in cells where there are polymorphisms between the maternal and paternal UBE3A alleles. Such techniques include next generation sequencing.
[0173] In some embodiments, a cell in which: expression of UBE3A-ATS is decreased, expression of UBE3A is increased, or expression of paternal UBE3A is increased may be a cultured cell or an in vitro cell. In some cases, the cell is a primary neuron, an IPSC derived neural cell, a neuronal cell line, and engineered cell line, or a neural stem cell. Contacting a cultured cell or an in vitro cell may comprise introducing the oligonucleotide, RNA, nucleic acid cassette or vector to the culture medium. In some cases, the cell is an in vivo cell. For example, a neuron such as a central nervous system neuron. In some cases, contacting the in vivo cell may comprise introducing the oligonucleotide, RNA, nucleic acid cassette or vector into the blood stream or the cerebral spinal fluid. The oligonucleotide, RNA, nucleic acid cassette or vector may be introduced into the cerebral spinal fluid by intraparenchymal injection, intrathecal injection, intra-cisterna magna injection, or intracerebroventricular injection.Pharmaceutical compositions
[0174] Also disclosed are pharmaceutical compositions comprising any of the aforementioned viruses, vectors, expression cassettes, oligonucleotides and / or oligonucleotide conjugates and apharmaceutically acceptable diluent, carrier, salt and / or adjuvant. A pharmaceutically acceptable diluent includes phosphatc-buffcrcd saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the diluent is artificial cerebrospinal fluid (aCSF).
[0175] The disclosed viruses, vectors, expression cassettes, or oligonucleotides may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
[0176] Those skilled in the art are aware of a variety of formulation strategies useful for storage and / or administration of viruses, vectors, expression cassettes, and nucleic acid therapeutics such as oligonucleotide therapeutics.Methods of treatment
[0177] Also disclosed are methods for treating or preventing a neurological condition, disorder, or disease, comprising administering a therapeutically or prophylactically effective amount of a pharmaceutical composition comprising an oligonucleotide, RNA, nucleic acid cassette, or vector, disclosed herein to a subject suffering from or susceptible to the disease.
[0178] Also disclosed is use of the disclosed oligonucleotides for the manufacture of a medicament for the treatment of a disorder as referred to herein, or for a method of the treatment of as a disorder as referred to herein.
[0179] The disclosed pharmaceutical compositions may be administered by topical (such as, to the skin, inhalation, ophthalmic or otic) or enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal) administration. In some embodiments, the disclosed pharmaceutical compositions are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, e.g., intracerebral or intraventricular, administration. In some embodiments, the oligonucleotide is administered by intracerebral or intracerebroventricular injection. In another embodiment the active oligonucleotide or oligonucleotide conjugate is administered intrathecally. In some embodiments, the pharmaceutical composition is administered by intracistemae magna injection.
[0180] In some embodiments, therapy with pharmaceutical compositions described herein is administered to subjcct(s) suffering from or susceptible to Angclman syndrome (AS). In some embodiments, a subject has been determined to have genetic characteristic associated with a defect in a maternal UBE3A gene. In some embodiments, an AS-associated genetic characteristic is, or comprises, a maternal deletion. In some embodiments, an AS-associated genetic characteristic is, or comprises, uniparental disomy. In some embodiments, an AS-associated genetic characteristic is, or comprises, a UBE3A mutation. In some embodiments, an AS- associated genetic characteristic is, or comprises, an imprinting defect.
[0181] In some cases, immunosuppressive co-therapy may be used for subjects in need. Immunosuppressants for such co-therapy include, but are not limited to, glucocorticoids, steroids, metabolic antagonists, T cell inhibitors, macrolides (e.g., rapamycin or rapalog), and cell growth inhibitors. In certain embodiments, immunosuppressive therapy may be initiated 0, 1, 2, 3, 4, 5, 6, 7 days or more days before or after gene therapy administration. Such immunosuppressive therapy may involve administration of one, two or more drugs (eg, glucocorticoids, prednisolone, my cophenolate mofetil (MMF) and I or sirolimus (ie, rapamycin)). Such immunosuppressive agents may be administered to the subject in need once, twice or more often at the same or adjusted dose. Such therapy may involve co-administering two or more drugs (eg, prednisolone, mycophenolate mofetil (MMF) and / or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued at the same or adjusted dose after gene therapy administration. Such therapy can be given for about 1 week (7 days), about 60 days, or longer, as needed. In certain embodiments, a tacrolimus-free dosing regimen is selected.
[0182] Optionally, the method or use comprises prophylactic co-administration of a steroid, i.e. a suitable dose of a steroid is administered to the patient. The co-administration may be concomitant, i.e. the patient receives the dose of steroid at the same time as receiving a dose of the pharmaceutical composition as described herein. Alternatively, the steroid may be administered before or after the pharmaceutical composition is administered to the patient. Optionally, the steroid is administered at 6 to 12 weeks after administration of the pharmaceutical composition to a patient. Optionally, the steroid is selected from the group consisting of prednisone, bethamethasone, prednisolone, triamcinolone, methylprednisolone and dexamethasone. Optionally the steroid is prednisolone.
[0183] Tabic 2 provides sequences of genes, genomic regions, and oligonucleotides referenced in this disclosure. SEQ ID NO; 1 can be found in the sequence listing.
[0184] Table 2EMBODIMENTS
[0185] Exemplary embodiments are listed below:
[0186] Embodiment 1. A nucleic acid cassette comprising a transgene encoding an RNA that binds a nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0187] Embodiment 2. The nucleic acid cassette of embodiment 1, wherein the RNA binds a repeated sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0188] Embodiment 3. The nucleic acid cassette of embodiment 1 or 2, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0189] Embodiment 4. The nucleic acid cassette of any prior embodiment, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0190] Embodiment 5. The nucleic acid cassette of any prior embodiment, wherein the RNA is complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15, with the optional exception of 1, 2, 3 or 4 mismatches.
[0191] Embodiment 6. A nucleic acid cassette comprising a transgene encoding an RNA that binds a region of UBE3A-ATS that contains a SNORD115 transcript.
[0192] Embodiment 7. The nucleic acid cassette of embodiment 6, wherein the RNA binds a repeated sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
[0193] Embodiment 8. The nucleic acid cassette of embodiment 6 or 7, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
[0194] Embodiment 9. The nucleic acid cassette of any of embodiments 6-8, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
[0195] Embodiment 10. The nucleic acid cassette of any of embodiments 6-9, wherein the RNA is complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD1 15 transcript, with the optional exception of 1, 2, 3 or 4 mismatches.
[0196] Embodiment 11. A nucleic acid cassette comprising a transgene encoding an RNA that binds a spliced or unspliced SNORD115 transcript.
[0197] Embodiment 12. The nucleic acid cassette of embodiment 11, wherein the RNA binds within a 3’ region, intron, exon or 5’ region of the SNORD115 transcript.
[0198] Embodiment 13. The nucleic acid cassette of embodiment 11 or 12, wherein the RNA binds a repeated sequence of the spliced or unspliced SNORD115 transcript.
[0199] Embodiment 14. The nucleic acid cassette of any one of embodiments 11-13, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript.
[0200] Embodiment 15. The nucleic acid cassette of any of embodiments 11-14, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript.
[0201] Embodiment 16. The nucleic acid cassette of any of embodiments 11-15, wherein the RNA is complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript with the optional exception of 1, 2, 3 or 4 mismatches.
[0202] Embodiment 17. A nucleic acid cassette comprising a transgene encoding an RNA that binds to a 10-30 nucleotide sequence of SEQ ID NO: 1.
[0203] Embodiment 18. The nucleic acid cassette of embodiment 17, wherein a 10 to 30 nucleotide sequence of the RNA is at least 90% complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1.
[0204] Embodiment 19. The nucleic acid cassette of embodiment 17 or 18, wherein a 10 to 30 nucleotide sequence of the RNA is at least 95% complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1.
[0205] Embodiment 20. The nucleic acid cassette of any of embodiments 17-19, wherein a 10 to 30 nucleotide sequence of the RNA is complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1, with the optional exception of 1, 2, 3 or 4 mismatches.
[0206] Embodiment 21. The nucleic acid cassette of any of embodiments 17-20, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1.
[0207] Embodiment 22. The nucleic acid cassette of any of embodiments 17-21, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1.
[0208] Embodiment 23. The nucleic acid cassette of any of embodiments 17-22, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1, with the optional exception of 1, 2, 3 or 4 mismatches.
[0209] Embodiment 24. A nucleic acid cassette comprising a transgene encoding an RNA that targets SEQ ID NO: 2, 3, 77 or 78.
[0210] Embodiment 25. The nucleic acid cassette of embodiment 25, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 2, 3, 77, or 78.
[0211] Embodiment 26. The nucleic acid cassette of embodiment 25 or 26, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 2, 3, 77, or 78.
[0212] Embodiment 27. The nucleic acid cassette of any of embodiments 24-26, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 2, 3, 77, or 78, with the optional exception of 1, 2, 3 or 4 mismatches.
[0213] Embodiment 28. A nucleic acid cassette comprising a transgene encoding an RNA wherein the RNA comprises at least 90% sequence identity to SEQ ID NO: 9-38.
[0214] Embodiment 29. The nucleic acid cassette of embodiment 29, wherein the RNA comprises at least 95% sequence identity to SEQ ID NO: 9-38.
[0215] Embodiment 30. The nucleic acid cassette of embodiment 29, wherein the RNA comprises a sequence of SEQ ID NO: 9-38, with the optional exception of 1, 2, 3 or 4 mismatches.
[0216] Embodiment 31. A nucleic acid cassette comprising a transgene comprising a sequence having at least 90% sequence identity to SEQ ID NO: 40-70.
[0217] Embodiment 32. The nucleic acid cassette of embodiment 32, wherein the transgene comprises a sequence having at least 95% sequence identity to SEQ ID NO: 40-70.
[0218] Embodiment 33. The nucleic acid cassette of embodiment 31 or 32, wherein the transgcnc comprises a sequence of SEQ ID NO: 40-70, with the optional exception of 1, 2, 3 or 4 mismatches.
[0219] Embodiment 34. A nucleic acid cassette comprising a transgene encoding an RNA that binds a nucleotide sequence between positions 2526643 land 25271534 on human chromosome 15.
[0220] Embodiment 35. The nucleic acid cassette of embodiment 34, wherein the miRNA is at least 90% complementary to a 10-30 nucleotide sequence between positions 2526643 land 25271534 on human chromosome 15.
[0221] Embodiment 36. The nucleic acid cassette of embodiment 34 or 35, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence between positions 25266431and 25271534 on human chromosome 15.
[0222] Embodiment 37. The nucleic acid cassette of any of embodiments 34-36, wherein the RNA is complementary to a 10-30 nucleotide sequence between positions 25266431 and 25271534 on human chromosome 15, with the optional exception of 1, 2, 3 or 4 mismatches.
[0223] Embodiment 38. A nucleic acid cassette comprising a transgene encoding a RNA that binds to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0224] Embodiment 39. The nucleic acid cassette of embodiment 38, wherein a 10 to 30 nucleotide sequence of the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0225] Embodiment 40. The nucleic acid cassette of embodiment 38 or 39, wherein a 10 to 30 nucleotide sequence of the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0226] Embodiment 41. The nucleic acid cassette of any of embodiments 38-40, wherein a 10 to 30 nucleotide sequence of the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8, with the optional exception of 1, 2, 3 or 4 mismatches.
[0227] Embodiment 42. The nucleic acid cassette of any of embodiments 38-41, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0228] Embodiment 43. The nucleic acid cassette of any of embodiments 38-42, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0229] Embodiment 44. The nucleic acid cassette of any of embodiments 38-43, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8, with the optional exception of 1, 2, 3 or 4 mismatches.
[0230] Embodiment 45. The nucleic acid cassette of any one of embodiments 1-44, wherein the RNA is a miRNA, an shRNA or an RNA antisense oligonucleotide.
[0231] Embodiment 46. The nucleic acid cassette of any one of embodiments 1-45, wherein the nucleic acid cassette is non-naturally occurring.
[0232] Embodiment 47. The nucleic acid cassette of any one of embodiments 1-46, wherein the nucleic acid cassette is DNA.
[0233] Embodiment 48. The nucleic acid cassette of any one of embodiments 1-47, wherein the nucleic acid cassette comprises a promoter.
[0234] Embodiment 49. The nucleic acid cassette of any one of embodiments 1-48, wherein the nucleic acid cassette comprises an enhancer.
[0235] Embodiment 50. The nucleic acid cassette of any one of embodiments 1-49, wherein the transgene encodes a pri-miRNA that comprises the RNA and a miRNA scaffold.
[0236] Embodiment 51. The nucleic acid cassette of embodiment 50, wherein the miRNA scaffold is derived from the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR- 132.
[0237] Embodiment 52. The nucleic acid cassette of embodiment 50 or 51, wherein the nucleotide sequence of the miRNA scaffold is at least 80% identical to, at least 90% identical, or at least 95% identical the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR- 132, or is identical to the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132, with up to 15, up to 10, up to 8, or up to 5, nucleotide substitutions.
[0238] Embodiment 53. The nucleic acid cassette of any of embodiments 50-52, wherein the pri- miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem of SEQ ID NO: 83,an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 85, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87,(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 91, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 98, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 103,the complement of the RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem / flanking sequence of SEQ ID NO: 108, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 110, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112;(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem / flanking sequence of SEQ ID NO: 114, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 116, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), and a 3’ stem / flanking sequence of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118;(vii) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem / flanking sequence of SEQ ID NO: 83, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 85, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(viii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem / flanking sequence of SEQ ID NO: 89, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 91, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(ix) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 98, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(x) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 103, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(xi) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem / flanking sequence of SEQ ID NO: 108, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges),a loop of SEQ ID NO: 110, the RNA of the present disclosure, c.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112;(xii) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem / flanking sequence of SEQ ID NO: 114, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 116, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118; or(xiii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions, a loop of SEQ ID NO: 119, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
[0239] Embodiment 54. The nucleic acid cassette of any of embodiments 50-53, wherein the pri- miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82; a 5’ stem of SEQ ID NO: 83, an antisense strand of SEQ ID NO: 84, a loop of SEQ ID NO: 85, an RNA of 12, a 3’ stem of SEQ ID NO: 86, andan optional 3’ flanking sequence of SEQ ID NO: 87;(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of SEQ ID NO: 90, a loop of SEQ ID NO: 91, an antisense strand of SEQ ID NO: 92, a 3’ stem of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem of SEQ ID NO: 96, an antisense strand of SEQ ID NO: 97, a loop of SEQ ID NO: 98, an RNA of SEQ ID NO: 90, a 3’ stem of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 103, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem of SEQ ID NO: 108, an antisense strand of SEQ ID NO: 109, a loop of SEQ ID NO: 110, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112; or(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem of SEQ ID NO: 114,an antisense strand of SEQ ID NO: 1 15, a loop of SEQ ID NO: 116, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118; or(vii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 119, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
[0240] Embodiment 55. The nucleic acid cassette of any one of embodiments 1-54, wherein the nucleic acid cassette is a linear construct.
[0241] Embodiment 56. A vector comprising the nucleic acid cassette of any one of embodiments 1-55.
[0242] Embodiment 57. The vector of embodiment 56, wherein the vector is a plasmid.
[0243] Embodiment 58. The vector of embodiment 56, wherein the vector is a viral vector, optionally a lentiviral vector or an adeno-associated virus (AAV) vector.
[0244] Embodiment 59. The vector of embodiment 58, wherein the viral vector is an adeno- associated virus (AAV) vector.
[0245] Embodiment 60. The vector of embodiment 59, wherein the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV-DJ.
[0246] Embodiment 61. The vector of embodiment 59 or 60, wherein the AAV is an sc AAV.
[0247] Embodiment 62. The vector of embodiment 59, wherein the AAV vector comprises an AAV capsid variant that has enhanced tropism for a central nervous system (CNS) tissue or cell, optionally wherein the AAV capsid variant is selected from the group consisting of: bCapl, AAV-B1, AAV-S, AAV-TT, VCAP-101, VCAP-102, and variants or hybrids thereof.
[0248] Embodiment 63. A method of reducing expression of UBE3A-ATS in a cell, comprising contacting the cell with an effective amount of a nucleic acid cassette of any one of embodiments 1-55 or the vector of any one of embodiments 56-62.
[0249] Embodiment 64. The method of embodiment 63, wherein expression of UBE3A-ATS in the cell is reduced compared to a comparable cell not treated with the nucleic acid cassette of any one of embodiments 1-55 or the vector of any one of embodiments 56-62.
[0250] Embodiment 65. The method of embodiment 63 or 64, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of embodiments 1-55, or the vector of any one of embodiments 56-62, results in at least a 5% reduction in UBE3A-ATS in the cell compared to a comparable untreated cell.
[0251] Embodiment 66. The method of any of embodiments 63-65, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of embodiments 1-55, or the vector of any one of embodiments 56-62, results in at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% reduction in UBE3A- ATS in the cell compared to a comparable untreated cell.
[0252] Embodiment 67. The method of any of embodiments 63-66, wherein reduction in UB ESATS is measured by quantitative polymerase chain reaction.
[0253] Embodiment 68. An in vivo or in vitro method for inducing ubiquitin-protein ligase E3A (UBE3A) expression in a cell where UBE3A-ATS is expressed, the method comprising administering an effective amount of a nucleic acid cassette of any one of embodiments 1-55, or the vector of any one of embodiments 56-62, to the cell.
[0254] Embodiment 69. The method of embodiment 68, wherein expression of UBE3A in the cell is increased compared to a comparable cell not treated with the nucleic acid cassette of any one of embodiments 1-55, or the vector of any one of embodiments 56-62.
[0255] Embodiment 70. The method of embodiment 68 or 69, wherein expression of UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, or more than 3 fold compared to a comparable untreated cell.
[0256] Embodiment 71. The method of any of embodiments 68-70, wherein expression of paternal UBE3A in the cell is increased compared to a comparable cell not treated with the nucleic acid cassette of any one of embodiments 1-55, or the vector of any one of embodiments 56-62.
[0257] Embodiment 72. The method of embodiment 71, wherein expression of paternal UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, 4 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, or more than 10 fold compared to a comparable untreated cell.
[0258] Embodiment 73. The method of any one of embodiments 63-72, wherein the cell is a cultured cell.
[0259] Embodiment 74. The method of embodiment 73, wherein the cell is a primary neuron, an IPSC derived neural cell, a neuronal cell line, an engineered cell line or a neural stem cell.
[0260] Embodiment 75. The method of any one of embodiments 63-72, wherein the cell is in vivo.
[0261] Embodiment 76. The method of embodiment 75, wherein the cell is a neuron.
[0262] Embodiment 77. The method of embodiment 75, wherein the cell is a neuron in the central nervous system (CNS), or a cell in contact with cerebral spinal fluid.
[0263] Embodiment 78. The method of any one of embodiments 63-77, wherein contacting the cell comprises delivering the nucleic acid cassette to the CNS or cerebral spinal fluid (CSF).
[0264] Embodiment 79. The method of any one of embodiments 63-78, wherein contacting the cell comprises delivering the nucleic acid cassette by intraparenchymal injection, intrathecal injection, intra-cisterna magna injection, or intracerebroventricular injection.
[0265] Embodiment 80. A method for treating or preventing a neurological condition or disorder in a subject comprising administering a therapeutically or prophylactically effective amount of a pharmaceutical composition comprising a nucleic acid cassette of any one of embodiments 1-55, or the vector of any one of embodiments 56-62.
[0266] Embodiment 81. The method of embodiment 80, wherein the neurological condition or disorder is Angelman syndrome.
[0267] Embodiment 82. The method of embodiment 80 or 81, wherein the method comprises administering the pharmaceutical composition to the subject via intraparenchymal injection, intrathecal injection, intra-cistema magna injection, intravenous injection, or intracerebroventricular injection.
[0268] Embodiment 83. A use of the nucleic acid cassette of any one of embodiments 1-55, or the vector of any one of embodiments 56-62, in the manufacture of a medicament for the treatment of a neurological condition or disorder.
[0269] Embodiment 84. A method of inducing expression of paternal UBE3A in a cell where expression of paternal UBE3A is suppressed, comprising administering to the cell an oligonucleotide that is at least 90% complementary to a 10-30 nucleotide sequence of an mRNAexpressed from a region between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0270] Embodiment 85. The method of embodiment 84, wherein the oligonucleotide comprises an RNA backbone, a DNA backbone, a modified backbone, or a combination of one of more backbones.
[0271] Embodiment 86. A method of inducing expression of paternal UBE3A in a cell where expression of paternal UBE3A is suppressed, comprising administering to the cell an oligonucleotide of at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15, a shRNA comprising a sequence at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15, or a nucleic acid capable of expressing an RNA comprising a sequence at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0272] Embodiment 87. A method of inducing expression of paternal UBE3A in a cell where expression of paternal UBE3A is suppressed, comprising administering to the cell an oligonucleotide of SEQ ID NOS: 9-38, a shRNA comprising a sequence of SEQ ID NOS: 9-38, or a nucleic acid capable of expressing an RNA comprising a sequence of SEQ ID :NO: 9-38.
[0273] Embodiment 88: The nucleic acid cassette of any of embodiments, 1-55, wherein the transgene encodes pri-miRNA comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to any one of SEQ ID NOS: 125-129.
[0274] Embodiment 89: A nucleic acid cassette encodes a pri-miRNA that comprises an RNA as set forth in any of embodiments 1-44 and a miRNA scaffold.
[0275] Embodiment 90. The nucleic acid cassette of embodiment 89, wherein the miRNA scaffold is derived from the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR- 132.
[0276] Embodiment 91. The nucleic acid cassette of embodiment 89 or 90, wherein the nucleotide sequence of the miRNA scaffold is at least 80% identical to, at least 90% identical, or at least 95% identical the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR- 132, or is identical to the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132, with up to 15, up to 10, up to 8, or up to 5, nucleotide substitutions.
[0277] Embodiment 92. The nucleic acid cassette of any of embodiments 89-91 , wherein the pri- miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem of SEQ ID NO: 83, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 85, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87,(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 91, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 98, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102,an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 103, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem / flanking sequence of SEQ ID NO: 108, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 110, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112;(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem / flanking sequence of SEQ ID NO: 114, an RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 116, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), and a 3’ stem / flanking sequence of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118;(vii) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem / flanking sequence of SEQ ID NO: 83, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 85,the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(viii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem / flanking sequence of SEQ ID NO: 89, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 91, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(ix) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 98, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(x) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 103, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(xi) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem / flanking sequence of SEQ ID NO: 108, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 110, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112;(xii) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem / flanking sequence of SEQ ID NO: 114, the complement of an RNA of the present disclosure (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 116, the RNA of the present disclosure, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118; or(xiii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions, a loop of SEQ ID NO: 119, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
[0278] Embodiment 93. The nucleic acid cassette of any of embodiments 89-92, wherein the pri- miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82; a 5’ stem of SEQ ID NO: 83, inan antisense strand of SEQ ID NO: 84, a loop of SEQ ID NO: 85, an RNA of 12, a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of SEQ ID NO: 90, a loop of SEQ ID NO: 91, an antisense strand of SEQ ID NO: 92, a 3’ stem of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem of SEQ ID NO: 96, an antisense strand of SEQ ID NO: 97, a loop of SEQ ID NO: 98, an RNA of SEQ ID NO: 90, a 3’ stem of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 103, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem of SEQ ID NO: 108, an antisense strand of SEQ ID NO: 109, a loop of SEQ ID NO: 110, an RNA of SEQ ID NO: 12,a 3’ stem of SEQ ID NO: 111 , and an optional 3’ flanking sequence of SEQ ID NO: 112; or(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem of SEQ ID NO: 114, an antisense strand of SEQ ID NO: 115, a loop of SEQ ID NO: 116, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118; or(vii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 119, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
[0279] Embodiment 94. The nucleic acid cassette of any one of embodiments 89-93, wherein the nucleic acid cassette is a linear construct.
[0280] Embodiment 95: The nucleic acid cassette of any of embodiments 89-94, wherein the pri- miRNA comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to any one of SEQ ID NOS: 125-129.
[0281] Embodiment 96. A vector comprising the nucleic acid cassette of any one of embodiments 89-95.
[0282] Embodiment 97. The vector of embodiment 96, wherein the vector is a plasmid.
[0283] Embodiment 98. The vector of embodiment 96, wherein the vector is a viral vector, optionally a lentiviral vector or an adeno-associated virus (AAV) vector.
[0284] Embodiment 99. The vector of embodiment 98, wherein the viral vector is an adeno- associated virus (AAV) vector.
[0285] Embodiment 100. The vector of embodiment 99, wherein the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV-DJ.
[0286] Embodiment 101. The vector of embodiment 99 or 100, wherein the AAV is an scAAV.
[0287] Embodiment 102. The vector of embodiment 99, wherein the AAV vector comprises an AAV capsid variant that has enhanced tropism for a central nervous system (CNS) tissue or cell, optionally wherein the AAV capsid variant is selected from the group consisting of: bCapl, AAV-B1, AAV-S, AAV-TT, VCAP-101, VCAP-102, and variants or hybrids thereof.
[0288] Embodiment 103. A method of reducing expression of UBE3A-ATS in a cell, comprising contacting the cell with an effective amount of a nucleic acid cassette of any one of embodiments 89-95 or the vector of any one of embodiments 96-102.
[0289] Embodiment 104. The method of embodiment 103, wherein expression of UBE3A-ATS in the cell is reduced compared to a comparable cell not treated with the nucleic acid cassette of any one of embodiments 1-55 or the vector of any one of embodiments 56-62.
[0290] Embodiment 105. The method of embodiment 103 or 104, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of embodiments 89-95 or the vector of any one of embodiments 96-102, results in at least a 5% reduction in UBE3A-ATS in the cell compared to a comparable untreated cell.
[0291] Embodiment 106. The method of any of embodiments 103 or 105, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of embodiments 89-95 or the vector of any one of embodiments 96-102, results in at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% reduction in UBE3A-ATS in the cell compared to a comparable untreated cell.
[0292] Embodiment 107. The method of any of embodiments 103-106, wherein reduction in UBE3-ATS is measured by quantitative polymerase chain reaction.
[0293] Embodiment 108. An in vivo or in vitro method for inducing ubiquitin-protein ligase E3A (UBE3A) expression in a cell where UBE3A-ATS is expressed, the method comprising administering an effective amount of a 103 or 104 to the cell.
[0294] Embodiment 109. The method of embodiment 68, wherein expression of UBE3A in the cell is increased compared to a comparable cell not treated with the 103 or 104.
[0295] Embodiment 110. The method of embodiment 108 or 109, wherein expression of UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, or more than 3 fold compared to a comparable untreated cell.
[0296] Embodiment 111. The method of any of embodiments 108-110, wherein expression of paternal UBE3A in the cell is increased compared to a comparable cell not treated with thenucleic acid cassette of any one of embodiments 89-95 or the vector of any one of embodiments 96-102.
[0297] Embodiment 112. The method of embodiment 111, wherein expression of paternal UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, 4 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, or more than 10 fold compared to a comparable untreated cell.
[0298] Embodiment 113. The method of any one of embodiments 103-112, wherein the cell is a cultured cell.
[0299] Embodiment 114. The method of embodiment 113, wherein the cell is a primary neuron, an IPSC derived neural cell, a neuronal cell line, an engineered cell line or a neural stem cell.
[0300] Embodiment 115. The method of any one of embodiments 103-112, wherein the cell is in vivo.
[0301] Embodiment 116. The method of embodiment 115, wherein the cell is a neuron.
[0302] Embodiment 117. The method of embodiment 115, wherein the cell is a neuron in the central nervous system (CNS), or a cell in contact with cerebral spinal fluid.
[0303] Embodiment 118. The method of any one of embodiments 103-117, wherein contacting the cell comprises delivering the nucleic acid cassette to the CNS or cerebral spinal fluid (CSF).
[0304] Embodiment 119. The method of any one of embodiments 103-118, wherein contacting the cell comprises delivering the nucleic acid cassette by intraparenchymal injection, intrathecal injection, intra-cisterna magna injection, or intracerebroventricular injection.
[0305] Embodiment 120. A method for treating or preventing a neurological condition or disorder in a subject comprising administering a therapeutically or prophylactically effective amount of a pharmaceutical composition comprising a nucleic acid cassette of any one of embodiments 89-95 or the vector of any one of embodiments 96-102.
[0306] Embodiment 121. The method of embodiment 120, wherein the neurological condition or disorder is Angelman syndrome.
[0307] Embodiment 122. The method of embodiment 120 or 121, wherein the method comprises administering the pharmaceutical composition to the subject via intraparenchymal injection, intrathecal injection, intra-cistema magna injection, intravenous injection, or intracerebroventricular injection.
[0308] Embodiment 123. A use of the nucleic acid cassette of any one of embodiments 89-95 or the vector of any one of embodiments 96-102 in the manufacture of a medicament for the treatment of a neurological condition or disorder.
[0309] Embodiment 124. A nucleic acid cassette comprising a transgene encoding a pri- miRNA which comprises an RNA and a miRNA scaffold, wherein the RNA binds a sequence in a UBE3A-ATS transcript, and the nucleotide sequence of the miRNA scaffold is at least 80% identical to, at least 90% identical, or at least 95% identical the scaffold of miR-E, miR-33, miR- 130a, miR-190a, miR-1-1 or miR-132, or is identical to the scaffold of miR-E, miR-33, miR- 130a, miR-190a, miR-1-1 or miR-132.
[0310] Embodiment 125. The nucleic acid cassette of embodiment 124, wherein the RNA binds a sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0311] Embodiment 126. The nucleic acid cassette of embodiment 124, wherein the RNA binds a repeated sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0312] Embodiment 127. The nucleic acid cassette of any of embodiments 124-126, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0313] Embodiment 128. The nucleic acid cassette of any of embodiments 124- 127 embodiment, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
[0314] Embodiment 129. The nucleic acid cassette of any of embodiments 124- 128embodiment, wherein the RNA is complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15, with the optional exception of 1, 2, 3 or 4 mismatches.
[0315] Embodiment 130. The nucleic acid cassette of embodiment 124, wherein the RNA binds a region of UBE3A-ATS that contains a SNORD115 transcript.
[0316] Embodiment 131. The nucleic acid cassette of embodiment 130, wherein the RNA binds a repeated sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
[0317] Embodiment 132. The nucleic acid cassette of embodiment 130 or 131, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence in the region of UBE3A- ATS that contains the SNORD115 transcript.
[0318] Embodiment 133. The nucleic acid cassette of any of embodiments 130-132, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence in the region of UBE3A- ATS that contains the SNORD115 transcript.
[0319] Embodiment 134. The nucleic acid cassette of any of embodiments 130-133, wherein the RNA is complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD115 transcript, with the optional exception of 1, 2, 3 or 4 mismatches.
[0320] Embodiment 135. The nucleic acid cassette of embodiment 124, wherein the RNA binds a spliced or unspliced SNORD115 transcript.
[0321] Embodiment 136. The nucleic acid cassette of embodiment 135, wherein the RNA binds within a 3’ region, intron, exon or 5’ region of the SNORD115 transcript.
[0322] Embodiment 137. The nucleic acid cassette of embodimentl35 or 136, wherein the RNA binds a repeated sequence of the spliced or unspliced SNORD115 transcript.
[0323] Embodiment 138. The nucleic acid cassette of any one of embodiments 135-137, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript.
[0324] Embodiment 139. The nucleic acid cassette of any of embodiments 135-138, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript.
[0325] Embodiment 140. The nucleic acid cassette of any of embodiments 135-139, wherein the RNA is complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript with the optional exception of 1, 2, 3 or 4 mismatches.
[0326] Embodiment 141. The nucleic acid cassette of embodiment 124, wherein the RNA binds to a 10-30 nucleotide sequence of SEQ ID NO: 1.
[0327] Embodiment 142. The nucleic acid cassette of embodiment 141, wherein a 10 to 30 nucleotide sequence of the RNA is at least 90% complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1.
[0328] Embodiment 143. The nucleic acid cassette of embodimentl41 or 142, wherein a 10 to 30 nucleotide sequence of the RNA is at least 95% complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1.
[0329] Embodiment 144. The nucleic acid cassette of any of embodiments 141-143, wherein a 10 to 30 nucleotide sequence of the RNA is complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1, with the optional exception of 1, 2, 3 or 4 mismatches.
[0330] Embodiment 145. The nucleic acid cassette of any of embodiments 141-144, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1.
[0331] Embodiment 146. The nucleic acid cassette of any of embodiments 141-145, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1.
[0332] Embodiment 147. The nucleic acid cassette of any of embodiments 141-146, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1, with the optional exception of 1, 2, 3 or 4 mismatches.
[0333] Embodiment 148. The nucleic acid cassette of embodiment 124, wherein the RNA targets SEQ ID NO: 2, 3, 77 or 78.
[0334] Embodiment 149. The nucleic acid cassette of embodiment 148, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID :NO: 2, 3, 77, or 78.
[0335] Embodiment 150. The nucleic acid cassette of embodiment 148 or 149, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID :NO: 2, 3, 77, or 78.
[0336] Embodiment 151. The nucleic acid cassette of any of embodiments 148-150, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID :NO: 2, 3, 77, or 78, with the optional exception of 1, 2, 3 or 4 mismatches.
[0337] Embodiment 152. The nucleic acid cassette of embodiment 124, wherein the RNA comprises at least 90% sequence identity to SEQ ID :NO: 9-38.
[0338] Embodiment 153. The nucleic acid cassette of embodiment 152, wherein the RNA comprises at least 95% sequence identity to SEQ ID :NO: 9-38.
[0339] Embodiment 154. The nucleic acid cassette of embodiment 152, wherein the RNA comprises a sequence of SEQ ID NO: 9-38, with the optional exception of 1, 2, 3 or 4 mismatches.
[0340] Embodiment 155. The nucleic acid cassette of embodiment 124, wherein the transgene comprises a sequence having at least 90% sequence identity to SEQ ID :NO: 40-70.
[0341] Embodiment 156. The nucleic acid cassette of of embodiments 124-155, wherein the transgene comprises a sequence having at least 95% sequence identity to SEQ ID :NO: 40-70.
[0342] Embodiment 157. The nucleic acid cassette of embodiment 155 or 156, wherein the transgcnc comprises a sequence of SEQ ID :NO: 40-70, with the optional exception of 1, 2, 3 or 4 mismatches.
[0343] Embodiment 158. The nucleic acid cassette of embodiment 124, wherein the RNA binds a nucleotide sequence between positions 2526643 land 25271534 on human chromosome 15.
[0344] Embodiment 159. The nucleic acid cassette of embodiment 158, wherein the miRNA is at least 90% complementary to a 10-30 nucleotide sequence between positions 2526643 land 25271534 on human chromosome 15.
[0345] Embodiment 160. The nucleic acid cassette of embodiment 158 or 159, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence between positions 25266431and 25271534 on human chromosome 15.
[0346] Embodiment 161. The nucleic acid cassette of any of embodiments 158-160, wherein the RNA is complementary to a 10-30 nucleotide sequence between positions 25266431 and 25271534 on human chromosome 15, with the optional exception of 1, 2, 3 or 4 mismatches.
[0347] Embodiment 162. The nucleic acid cassette of embodiment 124, wherein the RNA binds to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0348] Embodiment 163. The nucleic acid cassette of embodiment 162, wherein a 10 to 30 nucleotide sequence of the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0349] Embodiment 164. The nucleic acid cassette of embodiment 162 or 163, wherein a 10 to 30 nucleotide sequence of the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0350] Embodiment 165. The nucleic acid cassette of any of embodiments 162-164, wherein a 10 to 30 nucleotide sequence of the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8, with the optional exception of 1, 2, 3 or 4 mismatches.
[0351] Embodiment 166. The nucleic acid cassette of any of embodiments 162-165, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0352] Embodiment 167. The nucleic acid cassette of any of embodiments 162-166, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
[0353] Embodiment 168. The nucleic acid cassette of any of embodiments 162-167, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8, with the optional exception of 1, 2, 3 or 4 mismatches.
[0354] Embodiment 169. The nucleic acid cassette of any one of embodiments 124-168, wherein the RNA is a miRNA or an shRNA.
[0355] Embodiment 170. The nucleic acid cassette of any one of embodiments 124-169, wherein the nucleic acid cassette is non-naturally occurring.
[0356] Embodiment 171. The nucleic acid cassette of any of embodiments 124-170, wherein the pri-miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem of SEQ ID NO: 83, the RNA; a loop of SEQ ID NO: 85, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87,(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, the RNA; a loop of SEQ ID NO: 91, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, the RNA;a loop of SEQ ID NO: 98, the complement of the RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102, the RNA; a loop of SEQ ID NO: 103, the complement of the RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem / flanking sequence of SEQ ID NO: 108, the RNA; a loop of SEQ ID NO: 110, the complement of the RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112;(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem / flanking sequence of SEQ ID NO: 114, the RNA; a loop of SEQ ID NO: 116, the complement of the RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), and a 3’ stem / flanking sequence of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118;(vii) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem / flanking sequence of SEQ ID NO: 83,the complement of an RNA any of embodiments 1-47 (with the optional exception of 1 ,2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 85, the RNA; a 3’ stem / flanking sequence of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(viii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem / flanking sequence of SEQ ID NO: 89, the complement of an RNA of any of embodiments 1-47 (with the optional exception of1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 91, the RNA; a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(ix) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, the complement of an RNA of any of embodiments 1-47 (with the optional exception of1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 98, the RNA; a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(x) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102, the complement of an RNA of any of embodiments 1-47 (with the optional exception of1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 103, the RNA; a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(xi) an optional 5’ flanking sequence of SEQ ID NO: 107,a 5’ stem / flanking sequence of SEQ ID NO: 108, the complement of an RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 110, the RNA; a 3’ stem / flanking sequence of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112; or(xii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, the RNA, a loop of SEQ ID NO: 119, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
[0357] Embodiment 172. The nucleic acid cassette of any of embodiments 124-170, wherein the pri-miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82; a 5’ stem of SEQ ID NO: 83, an antisense strand of SEQ ID NO: 84, a loop of SEQ ID NO: 85, an RNA of 12, a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of SEQ ID NO: 90, a loop of SEQ ID NO: 91, an antisense strand of SEQ ID NO: 92, a 3’ stem of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem of SEQ ID NO: 96, an antisense strand of SEQ ID NO: 97, a loop of SEQ ID NO: 98, an RNA of SEQ ID NO: 90, a 3’ stem of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 103, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem of SEQ ID NO: 108, an antisense strand of SEQ ID NO: 109, a loop of SEQ ID NO: 110, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112; or(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem of SEQ ID NO: 114, an antisense strand of SEQ ID NO: 115, a loop of SEQ ID NO: 116, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118; or(vii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of SEQ ID NO: 12,a loop of SEQ ID NO: 119, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
[0358] Embodiment 173. The nucleic acid cassette of any one of embodiments 124-172, wherein the pri-miRNA comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to any one of SEQ ID NOS: 125-129.
[0359] Embodiment 174. The nucleic acid cassette of any one of embodiments 124-172, wherein the nucleic acid cassette is DNA.
[0360] Embodiment 175. The nucleic acid cassette of any one of embodiments 124-174, wherein the nucleic acid cassette comprises a promoter.
[0361] Embodiment 176. The nucleic acid cassette of embodiment 175, wherein the promoter is a U6 promoter.
[0362] Embodiment 177. The nucleic acid cassette of any of the embodiments above, further comprising a stuffer sequence.
[0363] Embodiment 178. The nucleic acid cassette of embodiment 177, wherein the stuffer comprises one of SEQ ID NO: 130-132.
[0364] Embodiment 179. The nucleic acid cassette of any one of embodiments 124-178, wherein the nucleic acid cassette comprises an enhancer.
[0365] Embodiment 180. The nucleic acid cassette of any one of embodiments 124-179, further comprising an AAV ITR.
[0366] Embodiment 181. The nucleic acid cassette of embodiment 180, wherein the AAV ITR sequence is selected from SEQ ID NOS. 133-135.
[0367] Embodiment 182. The nucleic acid cassette of embodiment 180, further comprising a second AAV ITR.
[0368] Embodiment 183. The nucleic acid cassette of any one of embodiments 124-182, wherein the nucleic acid cassette is a linear’ construct.
[0369] Embodiment 184. A vector comprising the nucleic acid cassette of any one of embodiments 124-183.
[0370] Embodiment 185. The vector of embodiment 184, wherein the vector is a plasmid.
[0371] Embodiment 186. The vector of embodiment 185, wherein the vector is a viral vector, optionally a lentiviral vector or an adcno-associatcd virus (AAV) vector.
[0372] Embodiment 187. The vector of embodiment 186, wherein the viral vector is an adeno- associated virus (AAV) vector.
[0373] Embodiment 188. The vector of embodiment 187, wherein the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV-DJ.
[0374] Embodiment 189. The vector of embodiment 187 or 188, wherein the AAV is an scAAV.
[0375] Embodiment 190. The vector of embodiment 187, wherein the AAV vector comprises an AAV capsid variant that has enhanced tropism for a central nervous system (CNS) tissue or cell, optionally wherein the AAV capsid variant is selected from the group consisting of: bCapl, AAV-B1, AAV-S, AAV-TT, VCAP-101, VCAP-102, and variants or hybrids thereof.
[0376] Embodiment 191. A method of reducing expression of UBE3A-ATS in a cell, comprising contacting the cell with an effective amount of a nucleic acid cassette of any one of embodiments 124-183 or the vector of any one of embodiments 184-190.
[0377] Embodiment 192. The method of embodiment 191, wherein expression of UBE3A-ATS in the cell is reduced compared to a comparable cell not treated with the nucleic acid cassette of any one of embodiments 124-183 or the vector of any one of embodiments 184-190.
[0378] Embodiment 193. The method of embodiment 191 or 192, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of embodiments 124-183 or the vector of any one of embodiments 184-190, results in at least a 5% reduction in UBE3A-ATS in the cell compared to a comparable untreated cell.
[0379] Embodiment 194. The method of any of embodiments 191-193, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of embodiments 124-183 or the vector of any one of embodiments 184-190, results in at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% reduction in UBE3A-ATS in the cell compared to a comparable untreated cell.
[0380] Embodiment 195. The method of any of embodiments 191-194, wherein reduction in UBE3-ATS is measured by quantitative polymerase chain reaction.
[0381] Embodiment 196. An in vivo or in vitro method for inducing ubiquitin-protein ligase E3A (UBE3A) expression in a cell where UBE3A-ATS is expressed, the method comprisingadministering an effective amount of a nucleic acid cassette of any one of embodiments 124- 183 or the vector of any one of embodiments 184-190.
[0382] Embodiment 197. The method of embodiment 196, wherein expression of UBE3A in the cell is increased compared to a comparable cell not treated with the nucleic acid cassette of any one of embodiments 124-183 or the vector of any one of embodiments 184-190.
[0383] Embodiment 198. The method of embodiment 196 or 197, wherein expression of UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, or more than 3 fold compared to a comparable untreated cell.
[0384] Embodiment 199. The method of any of embodiments 196-198, wherein expression of paternal UBE3A in the cell is increased compared to a comparable cell not treated with the nucleic acid cassette of any one of embodiments 124-183 or the vector of any one of embodiments 184-190.
[0385] Embodiment 200. The method of embodiment 199, wherein expression of paternal UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, 4 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, or more than 10 fold compared to a comparable untreated cell.
[0386] Embodiment 201. The method of any one of embodiments 191-200, wherein the cell is a cultured cell.
[0387] Embodiment 202. The method of embodiment 201, wherein the cell is a primary neuron, an IPSC derived neural cell, a neuronal cell line, an engineered cell line or a neural stem cell.
[0388] Embodiment 203. The method of any one of embodiments 191-200, wherein the cell is in vivo.
[0389] Embodiment 204. The method of embodiment 203, wherein the cell is a neuron.
[0390] Embodiment 205. The method of embodiment 204, wherein the cell is a neuron in the central nervous system (CNS), or a cell in contact with cerebral spinal fluid.
[0391] Embodiment 206. The method of any one of embodiments 191-205, wherein contacting the cell comprises delivering the nucleic acid cassette to the CNS or cerebral spinal fluid (CSF).
[0392] Embodiment 207. The method of any one of embodiments 191-206, wherein contacting the cell comprises delivering the nucleic acid cassette by intraparenchymal injection, intrathecal injection, intra-cisterna magna injection, or intracerebroventricular injection.
[0393] Embodiment 208. A method for treating or preventing a neurological condition or disorder in a subject comprising administering a therapeutically or prophylactically effectiveamount of a pharmaceutical composition comprising a nucleic acid cassette of any one of embodiments 124-183 or the vector of any one of embodiments 184-190.
[0394] Embodiment 209. The method of embodiment 208, wherein the neurological condition or disorder is Angelman syndrome.
[0395] Embodiment 210. The method of embodiment 208 or 209, wherein the method comprises administering the pharmaceutical composition to the subject via intrap arenchymal injection, intrathecal injection, intra-cistema magna injection, intravenous injection, or intracerebro ven trie ular injection .
[0396] Embodiment 211. The method of any one of embodiments 208-210, wherein the method further comprises administering an immunosuppressive co-therapy.
[0397] Embodiment 212. The method of embodiment 211, wherein the immunosuppressive cotherapy is a steroid.
[0398] Embodiment 213. The method of embodiment 212, wherein the steroid is prednisone, bethamethasone, prednisolone, triamcinolone, methylprednisolone or dexamethasone
[0399] Embodiment 214. A use of the nucleic acid cassette of any one of embodiments 124-183 or the vector of any one of embodiments 184-190, in the manufacture of a medicament for the treatment of a neurological condition or disorder.
[0400] Embodiment 215. A nucleic acid cassette comprising a sequence of SEQ ID 130, 131 or 132.
[0401] Embodiment 216. The nucleic acid cassette of embodiment 215, further comprising a sequence of SEQ ID NO: 40-70.
[0402] Embodiment 217. The nucleic acid cassette of embodiment 215 or 216, further comprising a miRNA scaffold.
[0403]
[0404] Embodiment 218. A nucleic acid cassette comprising a staffer sequence and a transgene encoding a pri-miRNA which comprises an RNA and a miRNA scaffold, wherein the nucleotide sequence of the miRNA scaffold is at least 80% identical to, at least 90% identical, or at least 95% identical the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132, or is identical to the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132.
[0405] Embodiment 219. The nucleic acid cassette of embodiment 218, wherein the staffer comprises a sequence of any one SEQ ID NOs: 130-132.
[0406] Embodiment 220. A nucleic acid cassette comprising a U6 promoter and a transgene encoding a pri-miRNA which comprises an RNA and a miRNA scaffold, wherein the nucleotide sequence of the miRNA scaffold is at least 80% identical to, at least 90% identical, or at least 95% identical the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132, or is identical to the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132.
[0407] Embodiment 221. A nucleic acid cassette comprising a U6 promoter and a stuffer sequence.
[0408] Embodiment 222. An ssAAV comprising a sequence of SEQ ID NO 40-70.
[0409] Embodiment 223. An sAAV comprising a sequence of SEQ ID NO: 130.
[0410]
[0411] Embodiment 224. An scAAV comprising a sequence of SEQ ID NO 40-70.
[0412] Embodiment 225. An scAAV comprising a sequence of SEQ ID NO: 131.
[0413] Embodiment 226. An AAV genome comprising a sequence of SEQ ID NOS: 130-132.
[0414] Embodiment 227. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 137.
[0415] Embodiment 228. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 138.
[0416] Embodiment 229. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 139.
[0417] Embodiment 230. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 149.
[0418] Embodiment 231. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 141.
[0419]
[0420] Embodiment 232. A viral vector comprising any one of the nucleic acid cassettes of embodiments 227-231, optionally wherein the viral vector is a lentiviral vector or an adeno- associated virus (AAV) vector.
[0421] Embodiment 233. The viral vector of embodiment 232, wherein the viral vector is an adeno-associated virus (AAV) vector.
[0422] Embodiment 234. The vector of embodiment 233, wherein the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV-DJ.
[0423] Embodiment 235. The vector of embodiment 233, wherein the AAV is AAV9.
[0424] Embodiment 236. The vector of embodiment 233, wherein the AAV vector comprises anAAV capsid variant that has enhanced tropism for a central nervous system (CNS) tissue or cell, optionally wherein the AAV capsid variant is selected from the group consisting of: bCapl, AAV-B1, AAV-S, AAV-TT, VCAP-101, VCAP-102, and variants or hybrids thereof.EXAMPLESEXAMPLE 1: RNA OLIGONUCLEOTIDE SCREENING
[0425] Oligonucleotide sequences capable of decreasing UBE3A-ATS expression were identified by designing sequences complementary to regions of the UBE3A-ATS and screening for activity in iPSC derived neural cells.
[0426] Oligonucleotide sequences were designed to be complementary to various regions of the UBE3A-ATS transcript. For administration of the oligonucleotides an AAV virus approach was used. Briefly, nucleic acid cassettes were designed incorporating a promoter, a miRNA scaffold, and a sequence encoding the desired oligonucleotide. AAV particles were produced for each of SEQ ID NOS: 9-38 and a scrambled control sequence SEQ ID NO: 39 using the AAV serotype AAVDJ.
[0427] iPSC glutamatergic neurons were purchased from Fujifilm Cellular Dynamics (iCell GlutaNeurons, 01279 (Catalog #: R10) and thawed according to the manufacturer’s directions. A 96 well plate was precoated with 0.01% Poly-L-Ornithine (PLO) and 0.28 mg / mL Matrigel (Coming Life Sciences). Cells were plated at 60,000 cells / well in the precoated 96 well plate.50% of the culture media was replaced at after 24 hours, and AAVs were added to the respective wells, diluted according to the multiplicity of infection (MOI) calculations. Further control wells were transduced with an AAV expressing green fluorescent protein under the control of a chicken beta actin promoter (AAVDJ-CBA-GFP) and monitored until DIV4-5 for general cell health. Additionally, scrambled miRNA treated neurons and unmanipulated neurons were also taken along as controls. Neurons were maintained according to manufacturer’s protocol, with 50% media replaced every 48h, until they were harvested at DIV8 (7-day transduction).
[0428] The iPSC derived glutamatergic neurons were infected with AAV encoding SEQ ID NOS: 15, 17-19, and 39, at a MOI of 10A6. Biological replicates were included for eachconstruct. RNA was extracted using an RNAeasy kit (Qiagen) and ~40ng was used for cDNA generation using a VILO Superscript IV kit (ThermoFisher Scientific). qPCR was set up with Reverse Transcriptase + (RT+, template) and Reverse Transcriptase- (RT-, control) conditions for each sample using SYBR green based detection of amplification. The following primer sets were used for each target: UBE3A-ATS (SEQ ID NOS: 72-73), GAPDH (SEQ ID NOS: 74-75).Delta-delta Ct method was used to calculated expression of UBE3A-ATS and UBE3A relative to scrambled control treated neurons.
[0429] The results of this experiment are shown in Figure 1, which shows strong knock down of UBE3A-ATS expression by SEQ ID NOS: 17, 18 and 19 as compared to the scrambled sequence (SEQ ID NO: 39). SEQ ID NO: 15 shows a trend towards knockdown.EXAMPLE 2: RNA OLIGONUCLEOTIDE SCREENING
[0430] A second experiment comprised two biological replicates with two technical transduction replicates performed. Cells for each biological replicate were plated and transduced one day apart. iPSC derived glutamatergic neurons were plated at 5X10A5 cells per well in 24 well tissue culture plates, pretreated as in Example 1. 100% of the culture media was replaced at 24h postplating and D1V1 neurons were transduced with AAVs at an MOI of 10A6. Neurons were maintained with a 100% media exchange every other day after the transduction, until harvest at 7 days post-transduction (DIV8).
[0431] Several control conditions were included in this experiment. As described in Example 1 , a well was transduced with AAVDJ-CBA-GFP at an MOI of 10A6 to monitor general cell health and A AV-driven expression until DIV8 harvest. Three different non-targeting scrambled control miRNAs (SEQ ID NOS: 39, 76 and 77) were included.
[0432] UBE3A-ATS RNA levels were quantified using a qPCR assay. Briefly, RNA was extracted using Qiagen AllPrep DNA / RNA micro kit. 120 ng total RNA was used for cDNA generation using VILO Superscript IV kit (ThermoFisher Scientific). qPCR was set up with template (RT+) and control (RT-) conditions for each sample using SYBR green based detection of amplification. The primers were as per Example 1. The delta-delta Ct method was used to calculated expression of UBE3A-ATS, first normalized to GAPDH control and then relative to scramble control miRNA (SEQ ID NO: 39) treated sample.
[0433] The results of this experiment are shown in Figure 2, which shows strong knock down of UBE3A-ATS expression by all constructs except SEQ ID NOS: 24 and 25.EXAMPLE 3: RNA OLIGONUCLEOTIDE SCREENING
[0434] A further experiment was conducted using the same conditions as Example 2. Cells for each biological replicate were plated and transduced one day apart. Cells were thawed, plated, infected, cultured, and RNA extracted ,and analyzed, as above. The AAVs used expressed oligonucleotides of SEQ ID NOS: 12-14, 16, 22, 26-29, 32 and 38 (scrambled control). The UBE3A-ATS expression (relative to the scrambled control) is shown in Figure 3. Most of the constructs exhibited high levels of UBE3A-ATS knockdown, particularly SEQ ID NOS: 12, 22, 27, 30 and 32 which all resulted in more than 50% knockdown. Further analysis of SEQ ID NO: 16 revealed the presence of a transcription termination sequence within the oligonucleotide encoding sequence, which may account for the failure of this construct to show UBE3A-ATS knockdown.EXAMPLE 4: OLIGONUCLEOTIDE SCREENING IN HELA CELLS[004351 To broaden the assays beyond iPSC derived neurons a HeLa-cell based model was developed. HeLa cells do not usually express UBE3A-ATS, however deletion of the region from 24,958,811-25,264,503 of chromosome 15 results in expression of UBE3A-ATS. Creation of a HeLa cell line with a CR1SPR mediated knockout of the genome region 24,958,811- 25,264,503 of chromosome 15 allowed transfection with plasmids containing the nucleic acid cassettes of Example 1, rather than AAV. This experiment comprised of 2 transfection replicates. Cells were plated at 50,000 cells per well in tissue culture plates. 500ng miR-E plasmid DNA and lOOng mCherry plasmid was transfected into each well with Eugene transfection reagent at a ratio of 3:1 (Fugene:DNA).
[0436] 72h post transfection, cells were harvested in RLT+BME lysis buffer and processed withRNAeasy Plus extraction kit (Qiagen). 160ng total RNA was used for cDNA generation using VILO Superscript IV kit (ThermoFisher Scientific). qPCR was set up with template (RT+) and control (RT-) conditions for each sample using SYBR based detection of amplification, as primers as above. Data were analyzed with delta delta Ct method and all samples were normalized to scrambled control miRNA (SEQ ID NO: 76).
[0437] Results from this experiment are shown in Figure 4. Both oligonucleotides tested, SEQ ID NOS: 33 and 34 resulted in strong knockdown of UBE3A-ATS by approximately 50%.EXAMPLE 5: ELECTROPORATION OF HELA CELLS
[0438] This experiment comprised of 2 biological replicates that were set up on different days, each with 1 electroporation replicate, in HeLa SI 15KO cells. 0.125ug of oligonucleotide expressing plasmid DNA was electroporated into each reaction of 150,000 cells / reaction using pulse code CM- 130 on Lonza Nucleofector X-unit. puc57 plasmid was used as filler DNA to electroporate a total of 0.5ug DNA with 10% GFP plasmid co-transfection. Immediately after electroporation, cells were rescued with 70uL of pre-warmed complete DMEM culture media and plated directly into 24-well plates. Cells were incubated at 37C for 3 days (3 cell divisions) without any media change and with daily monitoring of cell health and transfection efficiency. 72h post-electroporation, cells were harvested in RLT+BME lysis buffer and processed with RNAeasy Plus extraction kit (Qiagen). 160ng total RNA was used for cDNA generation using VILO Superscript IV kit (ThermoFisher Scientific). qPCR was set up with template (RT+) and control (RT-) conditions for each sample using SYBR based detection of amplification, using primers as above. Data were analyzed with delta delta Ct method and all samples were normalized to scrambled control miRNA. As shown in Figure 5, the oligonucleotide of SEQ ID No: 20 resulted in strong knockdown of UBE3A-ATS expression, achieving more than a 25% reduction.EXAMPLE 6: RESCUE OF UBE3A EXPRESSION
[0439] To determine expression of UBE3A in response to UBE3A-ATS knockdown an experiment was conducted in iPSC derived GABAergic neurons (Fujifilm Cellular Dynamics) which contained a polymorphism in one allele of the UBE3A gene. 250,000 cells / well were plated in a 24-well plate, pre-coated with 0.01% PLO and 10 pg / ml laminin. 100% of the culture media was replaced at DIV1. AAVs, expressing oligonucleotides as described in Example 1, were diluted according to the MOI calculator and added to the respective wells. Scrambled miRNA treated neurons and unmanipulated neurons were included as controls. Neurons were maintained according to manufacturer’s protocol, with 50% media replaced every 3-5 days, until they were harvested at DIV21 (20-day transduction).
[0440] RNA was extracted using RNAeasy micro kit (Qiagen) and ~40ng of RNA was used for cDNA generation using VILO Superscript IV kit (ThermoFisher Scientific). ddPCR was set up with template (RT+) and control (RT-) conditions. A UBE3A allele- specific probe set (ThermoFisher Scientific, Assay ID: ANYMTRK) was used to assay paternal and maternalUBE3 A transcripts, taking advantage of a SNP present in UBE3A of the cell donor. This experiment comprised biological replicates plated across different days.
[0441] As shown in Figure 6, all of the oligonucleotides resulted in strong upregulation of paternal UBE3A expression. SEQ ID NO: 20 resulted in more than 2 fold upregulation of paternal UBE3A expression, while SEQ ID NOS: 13, 14, 35 and 36 all resulted in more than 3 fold upregulation and SEQ ID NO: 12 achieved a more than 4 fold upregulation of paternal UBE3A.
[0442] A further experiment was performed to screen oligonucleotides of SEQ ID NOS: 38, 79, 80 and 81. AAVs expressing an RNA oligonucleotide of SEQ ID NOS: 38, 79, 80 and 81 were generated. iPSC derived gabaergic neurons (iCell GABANeurons, 01434 (Catalog #: R1013)) were plated in 96 well tissue culture plates, and DIV1 neurons were transduced with AAV at an MOI of 10A6. Neurons were maintained with a 50% media exchange every other day after the transduction, until harvest 13 days post-transduction (DIV14).
[0443] Paternal UBE3A and UBE3A-ATS RNA levels were quantified using ddPCR assays.Briefly, cells were lysed using ThermoFisher Cells-to-Ct kit and lysate used for cDNA generation using Cells-to-Ct reagents according to manufacturer's protocols. ddPCR was set up with template (RT+) and control (RT-) conditions for each sample and Taqman probes were used for target detection. Paternal UBE3A allelic frequency was calculated by dividing paternal UBE3A by the sum of paternal and maternal UBE3A. Relative UBE3A-ATS expression was calculated by first normalizing to GAPDH control and then relative to unmanipulated control samples.
[0444] Expression of the oligonucleotide of SEQ ID NO: 38 in the iPSC derived gabaergic neurons resulted in a paternal UBE3A allelic frequency of -39% indicating strong knockdown of UBE3A-ATS and rescue of paternal UBE3A expression. Further, expression of the oligonucleotide of SEQ ID NO: 38 resulted in relative UBE3A-ATS expression of -13% relative to unmanipulated control samples. Expression of the oligonucleotides of SEQ ID NOS: 79-81 in the iPSC derived gabaergic neurons did not result in a significantly increased paternal UBE3A allele frequency.EXAMPLE 7: RESCUE OF UBE3A EXPRESSION
[0445] Similarly to Example 6, iPSC derived GABAergic neurons were thawed and plated in a 96-well plate at 60,000 cells / well. The 96-well plate was pre-coated with 0.01% PLO and 10 pg / ml laminin. The experiment comprised of 3 biological replicates plated across different days. 100% culture media was replaced at DIV1. AAVs diluted to a MOI of 10A6 according to the MOI calculator were added to the respective wells. Scrambled miRNA treated neurons and unmanipulated neurons were included as controls. Neurons were maintained according to manufacturer’s protocol, with 50% media replaced every 3-5 days, until they were harvested at DIV 14 (13-day transduction).
[0446] Cells were harvested using Cells to Ct kit (Catalog number: AM 1729) and lysates used with RT reaction reagents provided in the kit to generate cDNA. ddPCR was set up with template (RT+) and control (RT-) conditions. A UBE3A allele- specific (Assay ID: ANYMTRK) probe set was used to assay paternal and maternal UBE3A transcripts, taking advantage of a SNP present in UBE3A of the cell donor.
[0447] As shown in Figure 7, the oligonucleotides of SEQ ID NOS: 12, 20 and 37 all induced strong upregulation of paternal UBE3A, with SEQ ID NOS: 12 and 37 both resulting in more than 3-fold upregulation.EXAMPLE 8: EVALUATION OF ALTERNATIVE SCAFFOLDS
[0448] To determine the effectiveness of different miRNA scaffolds the olidonucleotide of SEQ ID NO: 12 was cloned into scaffolds derived from mir-33, mir-1-1, miR-130a, miR-132 and miR-190, as well as the miR-E scaffold. In each case the guide sequence was SEQ ID NO: 12, and the passenger sequence was determined using the rules in Table: 1. These constructs were linked to a ubiquitous promoter and used to prepare AAV-DJ virons. iPSC derived GABAergic neurons (Fujifilm Cellular Dynamics), which contained a polymorphism in one allele of the UBE3A gene, were plated in a 24-well plate, pre-coated with 0.01% PLO and 10 pg / ml laminin, at 250,000 cells / well. 100% of the culture media was replaced at DIVE AAV-DJ virons with the oligonucleotides as described, were diluted according to the MOI calculator and added to the respective wells at the indicated concentrations. Scrambled miRNA treated neurons and unmanipulated neurons were included as controls. Neurons were maintained according to manufacturer’s protocol, with 50% media replaced every 3-5 days, until they were harvested at day 7.
[0449] RNA was extracted using RNAeasy micro kit (Qiagen) and ~40ng of RNA was used for cDNA generation using VILO Superscript IV kit (ThermoFisher Scientific). ddPCR was set up with template (RT+) and control (RT-) conditions. A UBE3A allele- specific probe set (ThermoFisher Scientific, Assay ID: ANYMTRK) was used to assay paternal and maternal UBE3A transcripts, taking advantage of a SNP present in UBE3A of the cell donor.
[0450] As seen in Figure 8 each of the new scaffolds demonstrated considerable improvements in potency and target engagement over the miR-E scaffold. At the 1E4 dose each of the new scaffold candidates resulted in almost complete unsilencing of paternal UBE3A (complete unsilencing would be expected to result in -50% paternal expression). Further, Figure 23 shows quantification of paternal UBE3A upregulation in WT hiPSC GABA neurons 7 days post treatment with designated candidates expressing SEQ ID NO: 12 from the indicated scaffolds. The iPSC-derived neurons were plated and transduced with the indicated AAVs on DIV1, with N=2-4 biological replicates. The new scaffolds, miR-33, miR-1-1, miR130, miR132 and miR- 190, demonstrated the ability to upregulate paternal UBE3A at a 10,000-fold lower dose than the mir-E candidate in vitro, 7 days post dosing, marking a significant improvement in potency. As shown in Figure 23 the miR-E scaffold achieved 0.23 allelic frequency at a dose of 10E6, while all the new scaffolds achieved comparable allelic frequencies (0.18-0.23) at a dose of 10E2, 10,000-fold lower.
[0451] To further study the miRNA scaffold properties iPSC derived GABAergic neurons (Fujifilm Cellular Dynamics) were plated in a 6-well plate, pre-coated with 0.01% PLO and 10 pg / ml laminin, at 1,000,000 cells / well. 100% of the culture media was replaced at DIV1 with AAVDJ containing media. AAVDJ was diluted with culture media according to the MOI calculator and added to the respective wells at a concentration of 1E4. Neurons were maintained according to manufacturer’s protocol, with 50% media replaced every 3-5 days, until they were harvested at DIV7 and total RNA was extracted using MagMax mirVana Total RNA Isolation Kit. Small RNAseq library was prepared with Illumina’s Small RNA Library Preparation Kit and sequenced at 2xl50bp with 350M PE reads. Reads are first processed by trimming off the 3’ adapter and low-quality bases using cutadapt. The minimum length for cutadapt is 18. The sequence of mature miRNA was extended 4bp in both 5’ and 3’ terminals. Bowtie was used for the alignment of the trimmed reads to the extended mature miRNA. The max mismatch allowed parameter of bowtie was set 2. The counts and cutting site was calculated based on the mappedreads in the bam file. Figure 9 shows the artificial guide miRNA as a percentage of the endogenous miRNA level plotted on a log scale. As shown in Figure 9 scaffolds derived from miR-130a, miR-33, miR-190 and miR-1-1 all resulted in higher expression of SEQ ID NO: 12 as a percentage of endogenous miRNA than the miR-E scaffold. Further, as seen in Figure 10, the miR-130a, miR-33 and miR-1-1 derived scaffolds resulted in higher ratios of guide to passenger production, (i.e. SEQ ID NO: 90 compared to SEQ ID NO: 97; SEQ ID 90 compared to SEQ ID 92, and SEQ ID NO: 12 compared to SEQ ID NO: 109) than the miR-E scaffold (SEQ ID NO: 12 compared to SEQ ID NO: 84). The miR-190 derived scaffold resulted in a slightly lower guide to passenger ratio (i.e. SEQ ID NO: 12 compared to SEQ ID NO: 104) than the miR-E scaffold (SEQ ID NO: 12 compared to SEQ ID NO: 84). Further, as shown in Figure 11 all 5 of the tested scaffolds resulted in very high levels (>99%) of 5’ guide precision.
[0452] Figures 12A-C show the size distribution of mature guide miRNAs produced by different scaffolds. Figure 12A shows the percentage frequency of each different length of mature guide miRNA produced by an expression construct comprising the indicated scaffold sequence and an RNA sequence of SEQ ID NO: 12. Figure 12B shows the percentage frequency of each different length of mature guide miRNA produced by an expression construct comprising the indicated scaffold sequence and an RNA sequence of SEQ ID NO: 36. Figure 12C shows the percentage frequency of each different length of mature guide miRNA produced by an expression construct comprising the indicated scaffold sequence and an RNA sequence of SEQ ID NO: 37.EXAMPLE 9: SCAFFOLD GUIDE RNA INTERACTIONS
[0453] To investigate possible interactions between the miRNA scaffolds and guide RNAs a series of different RNAs (SEQ ID NOS: 12-14 and 36-38) were prepared in each of a miR-33 derived scaffold, a miR-1-1 derived scaffold, a miR-130a derived scaffold and a miR-190a derived scaffold. Paternal expression of UBE3A mRNA was assessed as above at 7 days post infection and is shown in Figure 13A. Interestingly the pattern of relative expression between the scaffolds is different with different RNAs expressed.
[0454] Similar results are seen at 3 weeks post infection, as shown in Figure 13B.EXAMPLE 10: NHP STUDY
[0455] Five different AAV9 vectors Candidate 1 (SEQ ID NO: 125), Candidate 2 (SEQ ID NO: 126), Candidate 3 (SEQ ID NO: 127), Candidate 4 (SEQ ID NO: 128), and Candidate 5 (SEQ IDNO: 129) were developed to increase expression of UBE3A by gene upregulation. Twelve juvenile male cynomolgus monkeys with a heterologous SNP in UBE3A, as in Example 6, were administered an AAV candidate or vehicle control via unilateral intraparenchymal (IP) injections in the right hemisphere at 1.2E11 vg / animal across six cortical injection sites in addition to a unilateral ICV injection in the left hemisphere at 5.0E13 vg / animal. Necropsies were performed 60+7 days post-injection. Following euthanasia, animals were transcardially perfused with chilled saline until clear of blood. The brain was removed and cut 4-6 mm coronal sections. Tissue punches (4 mm) covering 5 brain regions, spinal cord, and DRG, were collected from interleaving even coronal brain slabs and used for simultaneous DNA and RNA isolation and subsequent ddPCR analysis. The odd slabs (and the even brain slab containing the likely injection site, when applicable) were split into two hemispheres and placed in 4% paraformaldehyde (PFA) for 24 to 48 hours and then transferred to 70% ethanol (stored at 2 to 8°C). The brain slabs were trimmed and embedded as coronal hemi-sections in paraffin within 14 days from its date of placement in 70% ethanol. Tissues were collected and frozen in RNAlater for nucleic acid extraction. DNA and RNA including miRNA were simultaneously isolated from all brain, SC, DRG and peripheral tissues. Extracted DNA was evaluated for biodistribution by a droplet digital PCR (ddPCR)-based assay. Extracted RNA was evaluated for miRNA abundance, transcript levels of ATS, paternal UBE3A, and total UBE3A by reversetranscription ddPCR (RT-ddPCR)-based methods.
[0456] Figure 14 shows miRNA expression from the five candidates in different regions of the brain. Candidate 4 consistently shows high expression. Figures 15 and 16 show relative UBE3A- ATS expression and paternal UBE3A expression, respectively, across the different brain areas. These results are also summarized in Figures 17 and 18 which show relative UBE3A-ATS expression and paternal UBE3A expression, respectively, averaged across the entire brain. Candidate 4 was the only candidate to result in statistically significant knockdown of UBE3A- ATS (P<0.05) and upregulation of paternal UBE3A (P<0.01) as compared to vehicle treated animals.
[0457] To further compare efficacy of some of the different constructs miRNA abundance was measured in multiple cortex regions and within the hippocampus by two-tailed ddPCR. An average was derived across these regions for each candidate (n=2 animals), and a fold change was established by comparing to miR-E-dosed animals (which received the same dose viathe same ROA). As shown in Table 3 the constructs with the new scaffolds demonstrated improved activity in NHPs relative to the miR-E containing construct.Table 3
[0458] Quantification of paternal UBE3A expression was conducted in the neurons of relevant tissues by snRNAseq analyses for the vehicle treated and miR-190 scaffold treated animals. As shown in Figure 24 the percentage of paternal derived UBE3A was higher in all brain regions in the animals treated with the AAV comprising the miR-190 scaffold expressing SEQ ID NO: 12.
[0459] In vitro, in-life and post-mortem safety assays to assess the safety profile of the lead human candidate included an array of in-life assays and observations, histopathology of brain, dorsal root ganglia (DRG), spinal cord and other significant peripheral organs, as well in vitro off-target analysis. The miR-190 construct was well-tolerated in NHPs, with no associated clinical observations, changes in motor, gait, or cranial / cervical / lumbo sacral spinal assessments, or microscopic findings in brain or peripheral tissues. Minimal to occasionally mild DRG microscopic findings were observed in DRG, consistent with a known AAV class effect. These changes were not associated with functional effects on nerve conductance. Further, this construct showed an acceptable in vitro off-target profile.
[0460] As shown in Figure 32 expression of UBE3A-ATS is lower across multiple brain regions in the animals treated with the AAV comprising the miR-190 scaffold expressing SEQ ID NO: 12 compared to the vehicle treated animals. Expression is shown relative to the expression level in the vehicle treated animals and measured by quantitative PCR. Correspondingly the percentage of paternal UBE3A is higher in the animals treated with the AAV comprising the miR-190 scaffold expressing SEQ ID NO: 12 compared to the vehicle treated animals, (Figure 33). Quantification of paternal UBE3A expression was conducted in the neurons of relevant tissues by snRNAseq analyses for the vehicle treated and miR-190 scaffold treated animals. Asshown in Figure 24 the percentage of paternal derived UBE3A was higher in all brain regions in the animals treated with the AAV comprising the miR-190 scaffold expressing SEQ ID NO: 12.
[0461] In vitro, in-life and post-mortem safety assays to assess the safety profile of the lead human candidate included an array of in-life assays and observations, histopathology of brain, dorsal root ganglia (DRG), spinal cord and other significant peripheral organs, as well in vitro off-target analysis. The miR-190 construct was well-tolerated in NHPs, with no associated clinical observations, changes in motor, gait, or cranial / cervical / lumbosacral spinal assessments, or microscopic findings in brain or peripheral tissues. Minimal to occasionally mild DRG microscopic findings were observed in DRG, consistent with a known AAV class effect. These changes were not associated with functional effects on nerve conductance. Fruther this construct showed an acceptable in vitro off-target profile.
[0462] Neuropathology profiles were performed by Northern Biomedical Research (NBR) and scored each of the findings in Figures 19A, 19B, 20A, 20B, 20C, and 20D on a scale from 0-5: 0 (empty cell) = no finding, 1 = minimal, 2 = mild, 3 = moderate, 4 = marked, and 5 = severe. As seen in Figures 19A, 19B, 20A, 20B, 20C, and 20D Candidates 2 and 4 resulted in the least neuropathology findings.
[0463] 5 um sections were cut to slide at Cureline BioPathlogy for in situ hybridization (ISH) staining. For ISH detection of miRNA, a custom probe (SR-siRNA-EG41-P-565-Sl Cat. NO: 1258411-S1) was designed by Advanced Cell Diagnostics, Inc. (ACD) targeting base pairs 2-22 of SEQ ID NO: 12 or SEQ ID NO: 37. Positive control probe to RNU6 (SR-RNU6-S1 Cat. NO: 727871-S1) was included to ensure miRNA integrity as well as a negative control (SR-Scramble- S1 Cat. NO: 727881-S1). ISH was performed using the miRNAscope TM HD Reagent Kit - RED (Cat. NO: 324510) following recommended protocol. Standard pretreatment assay conditions using RNAscope Target Retrieval Buffer for 15 minutes at 95 °C and Protease III for 30 minutes at 40 °C were determined to be optimal. Sample controls showed very high miRNA integrity and little to no background staining. Whole slide images were scanned at 20x magnification using a Vectra Polaris TM Automated Quantitative Pathology Imaging System from Akoya Biosciences. Image quantification was performed using Halo software v.3.6.4134 from Indica Labs. Entire cortical regions in whole slides were outlined and nuclei were identified with a custom nuclear segmentation algorithm using the hematoxylin counterstain. Once nuclei were identified, an Al Phenotyper classifier was trained to identify ISH positive nuclei.Percentages of ISH positive nuclei were calculated as a percentage of the total nuclei and values were plotted in Graphpad Prism software. Figure 21 and 22 show the percentage of nuclei in the cortex and hippocampus, respectively, which are positive for the AAV expressed miRNA. Candidate 4 shows the strongest expression in both tissues.EXAMPLE 11: MOUSE-SPECIFIC VECTORIZED MIRNA UPREGULATED UBE3A RNA AND PROTEIN AND RESCUED MULTIPLE DISEASE PHENOTYPES IN A MOUSE MODEL OF ANGELMAN SYNDROME
[0464] To test the effectiveness of the vectorized miRNA delivery in treating AngelmanSyndrome a miRNA, SEQ ID NO: 120, was designed against the mouse UBE3A-ATS sequence. SEQ ID NO: 120 was expressed from the miR-E scaffold, as indicated in SEQ ID NO: 121. An Angelman Syndrome mouse model was developed by Jiang et. Al. which has a maternal Ube3A deficiency (UBE3A m- / p+) and reproduces some aspects of Angelman syndrome. Jiang, Yong- hui, et al. "Mutation of the Angelman ubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation." Neuron 21.4 (1998): 799-811.
[0465] Ube3A m+ / p+ and Ube3A m- / p+ animals were left untreated or treated with A A Vs comprising SEQ ID NO: 83 (AAV-miR) at 3.6E11, or control, via ICV delivery at postnatal day 1. An open field assay was conducted at 7-8 weeks of age and a PTZ seizure assay was conducted at 12-13 weeks of age. Following the PTZ assay the animals were sacrificed to assess brain expression of UBE3A-ATS and UBE3A. Animals were weighed at sacrifice. UBE3A-ATS expression was measured by qPCR using an assay purchased from ThermoFisher (ID Mm02019987_sl), Ube3a mRNA was measured by qPCR using primers SEQ ID NO: 122 and 123 and a probe of SEQ ID NO: 124. Ube3A protein expression was assessed by immuno staining using an anti-UBE3A mouse monoclonal antibody by Sigma- Aldrich (SAB 1404508, clone 3E5). As shown in Figures 25 and 26 treatment with a single ICV delivery of AAV9-miR knocked down expression of Ube3a-Ats and increased Ube3a RNA by 10%, relative to WT levels. Protein levels in brain tissue were quantified by immunoassays utilizing electrochemiluminescent technology from Meso-Scale Discovery (MSD, Gaithersburg, Md.). As seen in Figure 31 the AS animals treated with the AAV-miR showed increased UBE3A protein levels compared to AS untreated or control treated animals. Further, as shown in Figure 27 Ube3a protein was detected across the cortex and hippocampus of AS-treated mice, compared to the lack of expression observed in untreated AS mice. The levels of Ube3A induced via the AAV-miR treatment rescued body weight in the AS mice, as seen in Figure 28.
[0466] To assess the impact on Angelman Syndrome related phenotypes an open field assay and a seizure assay were conducted. The open-field assay, to assess locomotor activity and anxiety, was conducted at low lighting and continuation of 50dB white noise in the background. At the beginning of the trial, the mouse was placed in the center of an opaque blue arena (40x 40 cm) and allowed to freely explore the empty area for 30 minutes. The movement was recorded by a camera positioned directly above the arena and tracking was conducted using the EthoVision software. After each trial, the animals were returned to home cages and the apparatus was cleaned with 70% ethanol. Using the video tracking system the total distance moved was determined.
[0467] As shown in Figure 29 levels of Ube3a induced via AAV-miR treatment rescued the hypoactivity seen in AS mice in the open field assay.
[0468] PTZ is a chemoconvulsant drug that was used to induce tonic-clonic forebrain seizures in a terminal assay performed before necropsy. Mice were weighed and acclimated, then were induced with PTZ by subcutaneous injection at a concentration of 75-80 mg / kg . The animals were monitored for time to onset of continuous seizure. The Mantel-Cox test was used to compare groups to the untreated AS control. As seen in Figure 30 the AAV-miR treatment resulted in significant rescue of seizure activity.
[0469] Rotarod is a measure of motor coordination and motor learning. Animals were assessed using a rotarod device, briefly animals are placed onto a stationary rotarod and allowed to acclimate before the rotarod is switched on. Once started the rotarod rotates at a starting speed of 4 rpm and accelerates to 40 rpm over the course or 5 minutes. The time at which an animal falls off is recorded. As shown in Figure 34 the time until fall for the AS AAV-miR treated animals was improved compared to the AS untreated animals.
[0470] These results confirm the potential of this strategy to treat the underlying cause of Angelman Syndrome.EXAMPLE 12: MOUSE-SPECIFIC VECTORIZED MIRNA
[0471] A further mouse study was performed using the AAV-miR and methods described in Example 11. Ube3A m- / p+ (AS) animals were treated with AAVs comprising SEQ ID NO: 83 (AAV-miR) via ICV delivery at postnatal day 1. The wildtype control mice and AS control mice were either injected with PBS or not injected. The AS treated mice were injected with the AAV- miR at a dose of 1.8E11 vg / animal or 3.6E11 vg / animal. An open field assay was conductedbetween post natal days 41 and 69. The animals were sacrificed to assess brain expression of Ubc3a-Ats and Ubc3a mRNA between post natal days 73 and 100. Animals were weighed at sacrifice. Ube3a-Ats, Ube3a mRNA and Ube3A protein expression was assessed as described above. As shown in Figures 35 A and 35B treatment with a single ICV delivery of AAV9-miR increased Ube3a RNA to approximately 30% of WT levels, and knocked down expression of Ube3a-Ats to 52% of WT levels. This level of Ube3a mRNA expression was capable of correcting disease-associated phenotypes including body weight, as shown in Figure 36, and locomotion, as shown in Figure 37.EXAMPLE 13: ANGELMAN SYNDROME DERIVED IPSC CELLS
[0472] Angelman syndrome patient derived iPSCs (AS-iPSC) were differentiated into cortical neural progenitor cells (iNPCs) by Reprocell and were plated at DIVO at 160K cells / well in a 24- well plate, precoated with ReproNeuro Coat Solution (RCDN201) and 0.0033% of PLL solution (Sigma P4832). Neurons were maintained with 50% media change on DIV3 and DIV7, then regular complete media change once per week after DIV7 until level of UBE3A-ATS were detectable by DIV73, then an scAAV9 expressing SEQ ID NO: 128 was added to the cells, diluted according to the multiplicity of infection calculations. Neurons were then harvested on DIV80 (7-day transduction) for downstream assays which were performed as described above. As shown in Figure 38 the scAAV9 expressing SEQ ID NO: 128 demonstrated potent, dosedependent knockdown of UBE3 A-ATS RNA and dose-dependent unsilencing of UBE3A mRNA. Figure 39 shows a similar dose dependent increase in UBE3A protein.EXAMPLE 14: OFF-TARGET EFFECTS
[0473] iPSC derived GABAergic neurons (Fujifilm Cellular Dynamics) were plated in a 6-well plate, pre-coated with 0.01% PLO and 10 pg / ml laminin, at 1,000,000 cells / well. 100% of the culture media was replaced at DIV1 with ETX201 containing media. scAAV9 expressing SEQ ID NO: 128 was diluted with culture media according to the MOI calculator and added to the respective wells at a concentration of 1E3. Neurons were maintained according to manufacturer’s protocol, with 50% media replaced every 3-5 days, until they were harvested at DIV7 and total RNA was extracted using MagMax mirVana Total RNA Isolation Kit. Whole genome sequencing and differential expression analysis was performed. Of over 57,000 genes evaluated, 79 were assessed due to being computationally-predicted off- target genes based ontheir complementarity to the miRNA sequence in SEQ ID NO: 128 (SEQ ID NO: 12). However, none of these genes significantly changed in expression post AAV treatment. As seen in the volcano plot in Figure 40 only two genes were significantly differentiated and met the 2-fold cutoff criteria. These genes were UBE3A-ATS (triangle), which decreased in expression post treatment, and paternal UBE3A (circle), which increased in expression. This emphasized the specificity of SEQ ID NO: 12 for its target sequence.EXAMPLE 15: NHP STUDY
[0474] Seven juvenile male cynomolgus monkeys with a heterologous SNP in UBE3A, as in Example 10, were administered an AAV candidate or vehicle control via unilateral ICV injection at 5.0E13 vg / animal or 1.0E14 vg / animal. Blood samples were collected throughout the study. Necropsies were performed 60 days post-injection and tissues were collected and assayed as described above. No clinical or abnormal findings were observed in life or in laboratory parameters, and no adverse microscopic findings were noted.
[0475] Figure 41 shows a representative image of SEQ ID NO: 12 miRNA staining in brain tissue of a treated animal, showing broad miRNA distribution.
[0476] SEQ ID NO: 12 miRNA was also assayed in CSF and serum. Exosomes transport cytoplasmic cargo between cells, and commonly carry endogenous miRNAs. Extracellular vesicle (EV) RNA isolation from CSF and serum was performed as follows. Samples were thawed on ice and brought to room temperature immediately prior to isolation. Samples were centrifuged for 5 minutes at 3,000 ref to render them acellular. Extracellular vesicles were isolated from 100 pL of CSF or serum by membrane-based affinity columns (Qiagen exoRNEasy kit). Total vesicular RNA including miRNA was extracted with 1 pg yeast carrier RNA by phenol / guanidine-based lysis and elution in 14 pL nuclease-free water.
[0477] To control for extraction quality, separate extractions of positive control (synthetic miRNAhUBE3A-ATS) and negative control (nuclease-free water blank) were performed per extraction round. For positive control, a 100 pM aliquot of the synthetic miRNAhUBE3A-ATS was thawed from -80 °C and diluted freshly in water on the day of extraction to a final input of 1.17E8 copies spiked into the Qiazol lysis buffer. One pg yeast carrier RNA was also used per extraction, and control isolations followed the same protocol as the samples. Up to 12 pL of eluted RNA were immediately used for cDNA synthesis and assessed by qPCR. As shown in Figure 42 dose dependent expression of SEQ ID NO: 12 miRNA was detected in CSF.Furthermore Figure 43 shows a time course of SEQ ID NO: 12 miRNA expression in serum of treated animals and shows that miRNA levels peaked in expression as early as 8 days post treatment for both doses and sustained this level of expression until the end of the study.
[0478] Figure 44 shows knockdown of UBE3A-ATS in both treatment groups. Figure 45 shows dose-dependent UBE3A mRNA upregulation in the cortex, with an almost 20% increase in total UBE3A at the higher dose (Dose 2, 1.0E14 vg / animal) tested. The treatment also resulted in a robust, widespread, dose-dependent unsilencing of paternal UBE3A in disease-relevant brain regions including multiple pails of the cortex and hippocampus, as shown in Figure 46.EXAMPLE 16: scAAV STUDY
[0479] iPSC derived GABAergic cells were plated and treated at division 1 with an scAAV9 expressing SEQ ID NO: 128 at a range of doses. Cells were harvested at division 7 and the expressed miRNA, paternal UBE3A and UBE3A-ATS expression levels were assessed as described previously. As shown in Figure 47 relative abundance of the expressed miRNA increased exponentially with the multiplicity of infection, and did not saturate within the doses assessed. Figure 48 shows the abundance of the paternal UBE3A allele as a fraction of total UBE3A expression. At the highest tested dose of 10E6 MOI the paternal UBE3A expression is almost 50% of total UBE3A expression, indicating almost complete unsilencing of the paternal allele at this dose. Figure 49 shows relative expression of UBE3A-ATS decreasing at the virus dose increases.
[0480] Small RNAseq was performed as described in Example 8 to assess the miRNAs produced by ssAAV9 and scAAV9 expressing SEQ ID NO: 128. As shown in Figure 50A and 50C both vectors expressed similar levels of miRNA and similar 5’ precision. Figure 50B shows that both constructs resulted in higher levels of guide strand production compared to passenger. The length distributions of the processed miRNAs are very similar, as shown in Figure 51.
Claims
CL IMSWhat is claimed is:
1. A nucleic acid cassette comprising a transgene encoding a pri-miRNA which comprises an RNA and a miRNA scaffold, wherein the RNA binds a sequence in a UBE3A-ATS transcript, and the nucleotide sequence of the miRNA scaffold is at least 80% identical to, at least 90% identical, or at least 95% identical the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132, or is identical to the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132.
2. The nucleic acid cassette of claim 1, wherein the RNA binds a sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
3. The nucleic acid cassette of claim 1, wherein the RNA binds a repeated sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
4. The nucleic acid cassette of any prior claim, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
5. The nucleic acid cassette of any prior claim, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
6. The nucleic acid cassette of any prior claim, wherein the RNA is complementary to a 10- 30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15, with the optional exception of 1, 2, 3 or 4 mismatches.
7. The nucleic acid cassette of claim 1, wherein the RNA binds a region of UBE3A-ATS that contains a SNORD115 transcript.
8. The nucleic acid cassette of claim 7, wherein the RNA binds a repeated sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
9. The nucleic acid cassette of claim 7 or 8, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
10. The nucleic acid cassette of any of claims 7-9, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
11. The nucleic acid cassette of any of claims 7-10, wherein the RNA is complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD115 transcript, with the optional exception of 1, 2, 3 or 4 mismatches.
12. The nucleic acid cassette of claim 1, wherein the RNA binds a spliced or unspliced SNORD115 transcript.
13. The nucleic acid cassette of claim 12, wherein the RNA binds within a 3’ region, intron, exon or 5’ region of the SNORD115 transcript.
14. The nucleic acid cassette of claim 12 or 13, wherein the RNA binds a repeated sequence of the spliced or unspliced SNORD1 15 transcript.
15. The nucleic acid cassette of any one of claims 12-14, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript.
16. The nucleic acid cassette of any of claims 12-15, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript.
17. The nucleic acid cassette of any of claims 12-16, wherein the RNA is complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript with the optional exception of 1, 2, 3 or 4 mismatches.
18. The nucleic acid cassette of claim 1, wherein the RNA binds to a 10-30 nucleotide sequence of SEQ ID NO: 1.
19. The nucleic acid cassette of claim 18, wherein a 10 to 30 nucleotide sequence of the RNA is at least 90% complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1.
20. The nucleic acid cassette of claim 18 or 19, wherein a 10 to 30 nucleotide sequence of the RNA is at least 95% complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1.
21. The nucleic acid cassette of any of claims 18-20, wherein a 10 to 30 nucleotide sequence of the RNA is complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1, with the optional exception of 1, 2, 3 or 4 mismatches.
22. The nucleic acid cassette of any of claims 18-21, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1.
23. The nucleic acid cassette of any of claims 18-22, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1.
24. The nucleic acid cassette of any of claims 18-23, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1, with the optional exception of 1, 2, 3 or 4 mismatches.
25. The nucleic acid cassette of claim 1, wherein the RNA targets SEQ ID NO: 2, 3, 77 or 78.
26. The nucleic acid cassette of claim 25, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 2, 3, 77, or 78.
27. The nucleic acid cassette of claim 25 or 26, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 2, 3, 77, or 78.
28. The nucleic acid cassette of any of claims 25-27, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 2, 3, 77, or 78, with the optional exception of 1, 2, 3 or 4 mismatches.
29. The nucleic acid cassette of claim 1, wherein the RNA comprises at least 90% sequence identity to SEQ ID NO: 9-38.
30. The nucleic acid cassette of claim 29, wherein the RNA comprises at least 95% sequence identity to SEQ ID NO: 9-38.
31. The nucleic acid cassette of claim 29, wherein the RNA comprises a sequence of SEQ ID NO: 9-38, with the optional exception of 1, 2, 3 or 4 mismatches.
32. The nucleic acid cassette of claim 1, wherein the transgene comprises a sequence having at least 90% sequence identity to SEQ ID NO: 40-70.
33. The nucleic acid cassette of claim 32, wherein the transgene comprises a sequence having at least 95% sequence identity to SEQ ID NO: 40-70.
34. The nucleic acid cassette of claim 32 or 33, wherein the transgene comprises a sequence of SEQ ID NO: 40-70, with the optional exception of 1, 2, 3 or 4 mismatches.
35. The nucleic acid cassette of claim 1, wherein the RNA binds a nucleotide sequence between positions 25266431and 25271534 on human chromosome 15.
36. The nucleic acid cassette of claim 35, wherein the miRNA is at least 90% complementary to a 10-30 nucleotide sequence between positions 25266431and 25271534 on human chromosome 15.
37. The nucleic acid cassette of claim 35 or 36, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence between positions 25266431and 25271534 on human chromosome 15.
38. The nucleic acid cassette of any of claims 35-37, wherein the RNA is complementary to a 10-30 nucleotide sequence between positions 25266431 and 25271534 on human chromosome 15, with the optional exception of 1, 2, 3 or 4 mismatches.
39. The nucleic acid cassette of claim 1, wherein the RNA binds to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
40. The nucleic acid cassette of claim 39, wherein a 10 to 30 nucleotide sequence of the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.41 . The nucleic acid cassette of claim 39 or 40, wherein a 10 to 30 nucleotide sequence of the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
42. The nucleic acid cassette of any of claims 39-41, wherein a 10 to 30 nucleotide sequence of the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8, with the optional exception of 1, 2, 3 or 4 mismatches.
43. The nucleic acid cassette of any of claims 39-42, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
44. The nucleic acid cassette of any of claims 39-43, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
45. The nucleic acid cassette of any of claims 39-44, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8, with the optional exception of 1, 2, 3 or 4 mismatches.
46. The nucleic acid cassette of any one of claims 1-45, wherein the RNA is a miRNA or an shRNA.
47. The nucleic acid cassette of any one of claims 1-46, wherein the nucleic acid cassette is non-naturally occurring.
48. The nucleic acid cassette of any of claims 1-47, wherein the pri-miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem of SEQ ID NO: 83, the RNA; a loop of SEQ ID NO: 85, the complement of the RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87,(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, the RNA; a loop of SEQ ID NO: 91, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, the RNA; a loop of SEQ ID NO: 98, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102, the RNA; a loop of SEQ ID NO: 103, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem / flanking sequence of SEQ ID NO: 108, the RNA; a loop of SEQ ID NO: 110, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 111, andan optional 3’ flanking sequence of SEQ ID NO: 1 12;(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem / flanking sequence of SEQ ID NO: 114, the RNA; a loop of SEQ ID NO: 116, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), and a 3’ stem / flanking sequence of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118;(vii) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem / flanking sequence of SEQ ID NO: 83, the complement of an RNA any of claims 1-47 (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 85, the RNA; a 3’ stem / flanking sequence of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(viii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem / flanking sequence of SEQ ID NO: 89, the complement of an RNA of any of claims 1-47 (with the optional exception of 1, 2,3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 91, the RNA; a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(ix) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, the complement of an RNA of any of claims 1-47 (with the optional exception of 1, 2,3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 98, the RNA;a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(x) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102, the complement of an RNA of any of claims 1-47 (with the optional exception of 1, 2,3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 103, the RNA; a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 107;(xi) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem / flanking sequence of SEQ ID NO: 108, the complement of an RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 110, the RNA; a 3’ stem / flanking sequence of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112; or(xii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, the RNA, a loop of SEQ ID NO: 119, the complement of the RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
49. The nucleic acid cassette of any of claims 1-27, wherein the pri-miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82; a 5’ stem of SEQ ID NO: 83, an antisense strand of SEQ ID NO: 84,a loop of SEQ ID NO: 85, an RNA of 12, a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of SEQ ID NO: 90, a loop of SEQ ID NO: 91, an antisense strand of SEQ ID NO: 92, a 3’ stem of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem of SEQ ID NO: 96, an antisense strand of SEQ ID NO: 97, a loop of SEQ ID NO: 98, an RNA of SEQ ID NO: 90, a 3’ stem of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 103, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem of SEQ ID NO: 108, an antisense strand of SEQ ID NO: 109, a loop of SEQ ID NO: 110, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 111, andan optional 3’ flanking sequence of SEQ ID NO: 1 12; or(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem of SEQ ID NO: 114, an antisense strand of SEQ ID NO: 115, a loop of SEQ ID NO: 116, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118; or(vii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 119, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
50. The nucleic acid cassette of any one of claims 1-47, wherein the pri-miRNA comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to any one of SEQ ID NOS: 125-129.
51. The nucleic acid cassette of any one of claims 1-50, wherein the nucleic acid cassette is DNA.
52. The nucleic acid cassette of any one of claims 1-51, wherein the nucleic acid cassette comprises a promoter.
53. The nucleic acid cassette of claim 52, wherein the promoter is a U6 promoter.
54. The nucleic acid cassette of any one of claims 1-53, further comprising a stuffer sequence.
55. The nucleic acid cassette of claim 54, wherein the stuffer comprises one of SEQ ID NO:130-132.
56. The nucleic acid cassette of any one of claims 1-55, wherein the nucleic acid cassette comprises an enhancer.
57. The nucleic acid cassette of any one of claims 1-56, further comprising an AAV ITR.
58. The nucleic acid cassette of claim 57, wherein the AAV ITR sequence is selected from SEQ ID NOS: 133-135.
59. The nucleic acid cassette of claim 57, further comprising a second AAV ITR.
60. The nucleic acid cassette of any one of claims 1-59, wherein the nucleic acid cassette is a linear construct.
61. A vector comprising the nucleic acid cassette of any one of claims 1-60.
62. The vector of claim 61, wherein the vector is a plasmid.
63. The vector of claim 62, wherein the vector is a viral vector, optionally a lentiviral vector or an adeno-associated virus (AAV) vector.
64. The vector of claim 63, wherein the viral vector is an adeno-associated virus (AAV) vector.
65. The vector of claim 64, wherein the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV-DJ.
66. The vector of claim 64 or 65, wherein the AAV is an scAAV.
67. The vector of any of claims 64-66, wherein the AAV vector comprises an AAV capsid variant that has enhanced tropism for a central nervous system (CNS) tissue or cell, optionally wherein the AAV capsid variant is selected from the group consisting of: bCapl, AAV-B1, AAV-S, AAV-TT, VCAP-101, VCAP-102, and variants or hybrids thereof.
68. A method of reducing expression of UBE3A-ATS in a cell, comprising contacting the cell with an effective amount of a nucleic acid cassette of any one of claims 1-60 or the vector of any one of claims 61-67.
69. The method of claim 68, wherein expression of UBE3A-ATS in the cell is reduced compared to a comparable cell not treated with the nucleic acid cassette of any one of claims 1- 60 or the vector of any one of claims 61-67.
70. The method of claim 68 or 69, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of claims 1-60 or the vector of any one of claims 61-67, results in at least a 5% reduction in UBE3A-ATS in the cell compared to a comparable untreated cell.
71. The method of any of claims 68-70, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of claims 1-60 or the vector of any one of claims 61-67, results in at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% reduction in UBE3A-ATS in the cell compared to a comparable untreated cell.
72. The method of any of claims 68-71, wherein reduction in UBE3-ATS is measured by quantitative polymerase chain reaction.
73. An in vivo or in vitro method for inducing ubiquitin-protein ligase E3A (UBE3A) expression in a cell where UBE3A-ATS is expressed, the method comprising administering an effective amount of a nucleic acid cassette of any one of claims 1-60 or the vector of any one of claims 61-67, to the cell.
74. The method of claim 73, wherein expression of UBE3A in the cell is increased compared to a comparable cell not treated with the nucleic acid cassette of any one of claims 1-60 or the vector of any one of claims 61-67.
75. The method of claim 73 or 74, wherein expression of UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, or more than 3 fold compared to a comparable untreated cell.
76. The method of any of claims 73-75, wherein expression of paternal UBE3A in the cell is increased compared to a comparable cell not treated with the nucleic acid cassette of any one of claims 1-60 or the vector of any one of claims 61-67.
77. The method of claim 76, wherein expression of paternal UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, 4 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, or more than 10 fold compared to a comparable untreated cell.
78. The method of any one of claims 68-77, wherein the cell is a cultured cell.
79. The method of claim 78, wherein the cell is a primary neuron, an IPSC derived neural cell, a neuronal cell line, an engineered cell line or a neural stem cell.
80. The method of any one of claims 68-77, wherein the cell is in vivo.
81. The method of claim 80, wherein the cell is a neuron.
82. The method of claim 81, wherein the cell is a neuron in the central nervous system(CNS), or a cell in contact with cerebral spinal fluid.
83. The method of any one of claims 68-82, wherein the contacting the cell or the administering comprises delivering the nucleic acid cassette to the CNS or cerebral spinal fluid (CSF).
84. The method of any one of claims 68-83, wherein the contacting the cell or the administering comprises delivering the nucleic acid cassette by intrap arenchymal injection, intrathecal injection, intra-cistema magna injection, or intracerebroventricular injection.
85. A method for treating or preventing a neurological condition or disorder in a subject comprising administering a therapeutically or prophylactically effective amount of a pharmaceutical composition comprising a nucleic acid cassette of any one of claims 1-60 or the vector of any one of claims 61-67.
86. The method of claim 85, wherein the neurological condition or disorder is Angelman syndrome.
87. The method of claim 85 or 86, wherein the method comprises administering the pharmaceutical composition to the subject via intraparenchymal injection, intrathecal injection, intra-cisterna magna injection, intravenous injection, or intracerebroventricular injection.
88. The method of any one of claims 85-87, wherein the method further comprises administering an immunosuppressive co-thcrapy.
89. The method of claim 88, wherein the immunosuppressive co-therapy is a steroid.
90. The method of claim 89, wherein the steroid is prednisone, bethamethasone, prednisolone, triamcinolone, methylprednisolone or dexamethasone91. A use of the nucleic acid cassette of any one of claims 1-60 or the vector of any one of claims 61-67, in the manufacture of a medicament for the treatment of a neurological condition or disorder.
92. A nucleic acid cassette comprising a sequence of SEQ ID 130, 131 or 132.
93. The nucleic acid cassette of claim 92, further comprising a sequence of SEQ ID NO: 40- 70.
94. The nucleic acid cassette of claim 92, further comprising a miRNA scaffold.
95. A nucleic acid cassette comprising a stuff er sequence and a transgene encoding a pri- miRNA which comprises an RNA and a miRNA scaffold, wherein the nucleotide sequence of the miRNA scaffold is at least 80% identical to, at least 90% identical, or at least 95% identical the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132, or is identical to the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132.
96. The nucleic acid cassette of claim 95, wherein the staffer comprises a sequence of any one SEQ ID NOS: 130-132.
97. A nucleic acid cassette comprising a U6 promoter and a transgene encoding a pri-miRNA which comprises an RNA and a miRNA scaffold, wherein the nucleotide sequence of the miRNA scaffold is at least 80% identical to, at least 90% identical, or at least 95% identical the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132, or is identical to the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132.
98. A nucleic acid cassette comprising a U6 promoter and a staffer sequence.
99. An ssAAV comprising a sequence of SEQ ID NO 40-70.
100. An sAAV comprising a sequence of SEQ ID NO: 130.
101. An scAAV comprising a sequence of SEQ ID NO 40-70.
102. An scAAV comprising a sequence of SEQ ID NO: 131.
103. An AAV genome comprising a sequence of SEQ ID NOs. 130-132.
104. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 137.
105. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 138.
106. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 139.
107. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 140.
108. A nucleic acid cassette comprising a nucleotide sequence at least 80%, 90%, 95%, or great than 95% identical to SEQ ID NO: 141.
109. A viral vector comprising any one of the nucleic acid cassettes of claims 104-108, optionally wherein the viral vector is a lentiviral vector or an adeno-associated virus (AAV) vector.
110. The viral vector of claim 109, wherein the viral vector is an adeno-associated virus (AAV) vector.
111. The vector of claim 110, wherein the AAV is AAV 1 , A A V2, AAV 3 , AAV 4, AAV 5 , AAV6, AAV7, AAV8, AAV9, or AAV-DJ.
112. The vector of claim 110, wherein the AAV vector comprises an AAV capsid variant that has enhanced tropism for a central nervous system (CNS) tissue or cell, optionally wherein theAAV capsid variant is selected from the group consisting of: bCapl , AAV-B1 , AAV-S, AAV- TT, VCAP-101, VCAP-102, and variants or hybrids thereof.
113. A nucleic acid cassette comprising a transgene encoding an RNA that binds a nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
114. The nucleic acid cassette of claim 113, wherein the RNA binds a repeated sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
115. The nucleic acid cassette of claim 113 or 114, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
116. The nucleic acid cassette of any of claims 113-115, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
117. The nucleic acid cassette of any of claims 113-116, wherein the RNA is complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15, with the optional exception of 1 , 2, 3 or 4 mismatches.
118. A nucleic acid cassette comprising a transgene encoding an RNA that binds a region of UBE3A-ATS that contains a SNORD115 transcript.
119. The nucleic acid cassette of claim 118, wherein the RNA binds a repeated sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
120. The nucleic acid cassette of claim 118 or 119, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
121. The nucleic acid cassette of any of claims 118-120, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD115 transcript.
122. The nucleic acid cassette of any of claims 1 18-121 , wherein the RNA is complementary to a 10-30 nucleotide sequence in the region of UBE3A-ATS that contains the SNORD115 transcript, with the optional exception of 1, 2, 3 or 4 mismatches.
123. A nucleic acid cassette comprising a transgene encoding an RNA that binds a spliced or unspliced SNORD115 transcript.
124. The nucleic acid cassette of claim 123, wherein the RNA binds within a 3’ region, intron, exon or 5’ region of the SNORD115 transcript.
125. The nucleic acid cassette of claim 123 or 124, wherein the RNA binds a repeated sequence of the spliced or unspliced SNORD115 transcript.
126. The nucleic acid cassette of any one of claims 123-125, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript.
127. The nucleic acid cassette of any of claims 123-126, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript.
128. The nucleic acid cassette of any of claims 123-127, wherein the RNA is complementary to a 10-30 nucleotide sequence in the spliced or unspliced SNORD115 transcript with the optional exception of 1, 2, 3 or 4 mismatches.
129. A nucleic acid cassette comprising a transgene encoding an RNA that binds to a 10-30 nucleotide sequence of SEQ ID NO: 1.
130. The nucleic acid cassette of claim 129, wherein a 10 to 30 nucleotide sequence of the RNA is at least 90% complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1.
131. The nucleic acid cassette of claim 129 or 130, wherein a 10 to 30 nucleotide sequence of the RNA is at least 95% complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1.
132. The nucleic acid cassette of any of claims 129-131 , wherein a 10 to 30 nucleotide sequence of the RNA is complementary to the 10-30 nucleotide sequence of SEQ ID NO: 1, with the optional exception of 1, 2, 3 or 4 mismatches.
133. The nucleic acid cassette of any of claims 129-132, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1.
134. The nucleic acid cassette of any of claims 129-133, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1.
135. The nucleic acid cassette of any of claims 129-134, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 1, with the optional exception of 1, 2, 3 or 4 mismatches.
136. A nucleic acid cassette comprising a transgene encoding an RNA that targets SEQ ID NO: 2, 3, 77 or 78.
137. The nucleic acid cassette of claim 136, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 2, 3, 77, or 78.
138. The nucleic acid cassette of claim 136 or 137, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 2, 3, 77, or 78.
139. The nucleic acid cassette of any of claims 136-138, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 2, 3, 77, or 78, with the optional exception of 1, 2, 3 or 4 mismatches.
140. A nucleic acid cassette comprising a transgene encoding an RNA wherein the RNA comprises at least 90% sequence identity to SEQ ID NO: 9-38.
141. The nucleic acid cassette of claim 140, wherein the RNA comprises at least 95% sequence identity to SEQ ID NO: 9-38.
142. The nucleic acid cassette of claim 140, wherein the RNA comprises a sequence of SEQ ID NO: 9-38, with the optional exception of 1, 2, 3 or 4 mismatches.
143. A nucleic acid cassette comprising a transgene comprising a sequence having at least 90% sequence identity to SEQ ID NO: 40-70.
144. The nucleic acid cassette of claim 143, wherein the transgene comprises a sequence having at least 95% sequence identity to SEQ ID NO: 40-70.
145. The nucleic acid cassette of claim 143 or 144, wherein the transgene comprises a sequence of SEQ ID NO: 40-70, with the optional exception of 1, 2, 3 or 4 mismatches.
146. A nucleic acid cassette comprising a transgene encoding an RNA that binds a nucleotide sequence between positions 2526643 land 25271534 on human chromosome 15.
147. The nucleic acid cassette of claim 146, wherein the miRNA is at least 90% complementary to a 10-30 nucleotide sequence between positions 2526643 land 25271534 on human chromosome 15.
148. The nucleic acid cassette of claim 146 or 147, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence between positions 25266431and 25271534 on human chromosome 15.
149. The nucleic acid cassette of any of claims 146-148, wherein the RNA is complementary to a 10-30 nucleotide sequence between positions 25266431 and 25271534 on human chromosome 15, with the optional exception of 1, 2, 3 or 4 mismatches.
150. A nucleic acid cassette comprising a transgene encoding a RNA that binds to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
151. The nucleic acid cassette of claim 150, wherein a 10 to 30 nucleotide sequence of the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
152. The nucleic acid cassette of claim 150 or 151, wherein a 10 to 30 nucleotide sequence of the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
153. The nucleic acid cassette of any of claims 150-152, wherein a 10 to 30 nucleotide sequence of the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8, with the optional exception of 1, 2, 3 or 4 mismatches.
154. The nucleic acid cassette of any of claims 150-153, wherein the RNA is at least 90% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
155. The nucleic acid cassette of any of claims 150-154, wherein the RNA is at least 95% complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8.
156. The nucleic acid cassette of any of claims 150-155, wherein the RNA is complementary to a 10-30 nucleotide sequence of SEQ ID NO: 4, 5, 6, 7, or 8, with the optional exception of 1, 2, 3 or 4 mismatches.
157. The nucleic acid cassette of any one of claims 113-156, wherein the RNA is a miRNA, an shRNA or an RNA antisense oligonucleotide.
158. The nucleic acid cassette of any one of claims 113-157, wherein the nucleic acid cassette is non-naturally occurring.
159. The nucleic acid cassette of any one of claims 113-158, wherein the nucleic acid cassette is DNA.
160. The nucleic acid cassette of any one of claims 113-159, wherein the nucleic acid cassette comprises a promoter.
161. The nucleic acid cassette of any one of claims 113-160, wherein the nucleic acid cassette comprises an enhancer.
162. The nucleic acid cassette of any one of claims 113-161, wherein the transgene encodes a pri-miRNA that comprises the RNA and a miRNA scaffold.
163. The nucleic acid cassette of claim 162, wherein the miRNA scaffold is derived from the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132.
164. The nucleic acid cassette of claim 162 or 163, wherein the nucleotide sequence of the miRNA scaffold is at least 80% identical to, at least 90% identical, or at least 95% identical the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132, or is identical to the scaffold of miR-E, miR-33, miR-130a, miR-190a, miR-1-1 or miR-132, with up to 15, up to 10, up to 8, or up to 5, nucleotide substitutions.
165. The nucleic acid cassette of any of claims 162-164, wherein the pri-miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem of SEQ ID NO: 83, an RNA of any of claims 1-45, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 85, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87,(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of any of claims 1-45, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 91, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, an RNA of any of claims 1-45, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions;a loop of SEQ ID NO: 98, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102, an RNA of any of claims 1-45, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1,2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 103, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem / flanking sequence of SEQ ID NO: 108, an RNA of any of claims 1-45, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1,2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 110, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a 3’ stem / flanking sequence of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112;(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem / flanking sequence of SEQ ID NO: 114, an RNA of any of claims 1-45, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1,2, 3 or 4 nucleotide substitutions; a loop of SEQ ID NO: 116, the complement of the RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), and a 3’ stem / flanking sequence of SEQ ID NO: 117, andan optional 3’ flanking sequence of SEQ ID NO: 1 18;(vii) an optional 5’ flanking sequence of SEQ ID NO: 82, a 5’ stem / flanking sequence of SEQ ID NO: 83, the complement of an RNA any of claims 1-45 (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 85, the RNA, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(viii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem / flanking sequence of SEQ ID NO: 89, the complement of an RNA of any of claims 1-45 (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 91, the RNA, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(ix) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem / flanking sequence of SEQ ID NO: 96, the complement of an RNA of any of claims 1-45 (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 98, the RNA, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(x) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem / flanking sequence of SEQ ID NO: 102,the complement of an RNA of any of claims 1-45 (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 103, the RNA, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(xi) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem / flanking sequence of SEQ ID NO: 108, the complement of an RNA (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 110, the RNA, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112; or(xii) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem / flanking sequence of SEQ ID NO: 114, the complement of an RNA any of claims 1-45 (with the optional exception of 1, 2, 3 or 4 nucleotide substitutions or bulges), a loop of SEQ ID NO: 116, the RNA, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1, 2, 3 or 4 nucleotide substitutions; a 3’ stem / flanking sequence of SEQ ID NO: 117, and an optional 3’ flanking sequence of SEQ ID NO: 118(xiii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of any of claims 1-45, e.g., any of SEQ ID NOS: 9-38, with the optional exception of 1,2, 3 or 4 nucleotide substitutions, a loop of SEQ ID NO: 119,the complement of the RNA (with the optional exception of 1 , 2, 3 or 4 nucleotide substitutions or bulges, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
166. The nucleic acid cassette of any of claims 162-165, wherein the pri-miRNA comprises:(i) an optional 5’ flanking sequence of SEQ ID NO: 82; a 5’ stem of SEQ ID NO: 83, an antisense strand of SEQ ID NO: 84, a loop of SEQ ID NO: 85, an RNA of 12, a 3’ stem of SEQ ID NO: 86, and an optional 3’ flanking sequence of SEQ ID NO: 87;(ii) an optional 5’ flanking sequence of SEQ ID NO: 88, a 5’ stem of SEQ ID NO: 89, an RNA of SEQ ID NO: 90, a loop of SEQ ID NO: 91, an antisense strand of SEQ ID NO: 92, a 3’ stem of SEQ ID NO: 93, and an optional 3’ flanking sequence of SEQ ID NO: 94;(iii) an optional 5’ flanking sequence of SEQ ID NO: 95, a 5’ stem of SEQ ID NO: 96, an antisense strand of SEQ ID NO: 97, a loop of SEQ ID NO: 98, an RNA of SEQ ID NO: 90, a 3’ stem of SEQ ID NO: 99, and an optional 3’ flanking sequence of SEQ ID NO: 100;(iv) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 103,an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence of SEQ ID NO: 106;(v) an optional 5’ flanking sequence of SEQ ID NO: 107, a 5’ stem of SEQ ID NO: 108, an antisense strand of SEQ ID NO: 109, a loop of SEQ ID NO: 110, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 111, and an optional 3’ flanking sequence of SEQ ID NO: 112; or(vi) an optional 5’ flanking sequence of SEQ ID NO: 113, a 5’ stem of SEQ ID NO: 114, an antisense strand of SEQ ID NO: 115, a loop of SEQ ID NO: 116, an RNA of SEQ ID NO: 12, a 3’ stem of SEQ ID NO: 117, and an optional 3’ Hanking sequence of SEQ ID NO: 118; or(vii) an optional 5’ flanking sequence of SEQ ID NO: 101, a 5’ stem of sequence SEQ ID NO: 102, an RNA of SEQ ID NO: 12, a loop of SEQ ID NO: 119, an antisense strand of SEQ ID NO: 104, a 3’ stem of SEQ ID NO: 105, and an optional 3’ flanking sequence SEQ ID NO: 106.
167. The nucleic acid cassette of any of claims, 113-166, wherein the transgene encodes pri- miRNA comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to any one of SEQ ID NOS: 125-129.
168. The nucleic acid cassette of any one of claims 113-167, wherein the nucleic acid cassette is a linear construct.
169. A vector comprising the nucleic acid cassette of any one of claims 113-168.
170. The vector of claim 169, wherein the vector is a plasmid.
171. The vector of claim 169, wherein the vector is a viral vector, optionally a lentiviral vector or an adeno-associated virus (AAV) vector.
172. The vector of claim 171, wherein the viral vector is an adeno-associated virus (AAV) vector.
173. The vector of claim 172, wherein the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV-DJ.
174. The vector of claim 172 or 173, wherein the AAV is an scAAV.
175. The vector of claim 172, wherein the AAV vector comprises an AAV capsid variant that has enhanced tropism for a central nervous system (CNS) tissue or cell, optionally wherein the AAV capsid variant is selected from the group consisting of: bCapl, AAV-B1, AAV-S, AAV- TT, VCAP-101, VCAP-102, and variants or hybrids thereof.
176. A method of reducing expression of UBE3A-ATS in a cell, comprising contacting the cell with an effective amount of a nucleic acid cassette of any one of claims 113-168 or the vector of any one of claims 169-175.
177. The method of claim 176, wherein expression of UBE3A-ATS in the cell is reduced compared to a comparable cell not treated with the nucleic acid cassette of any one of claims 113-168 or the vector of any one of claims 169-175.
178. The method of claim 176 or 177, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of claims 113-168 or the vector of any one of claims 169- 175, results in at least a 5% reduction in UBE3A-ATS in the cell compared to a comparable untreated cell.
179. The method of any of claims 176-178, wherein the contacting the cell with an effective amount of the nucleic acid cassette of any one of claims 113-168 or the vector of any one ofclaims 169-175, results in at least a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% reduction in UBE3A-ATS in the cell compared to a comparable untreated cell.
180. The method of any of claims 176-179, wherein reduction in UBE3-ATS is measured by quantitative polymerase chain reaction.
181. An in vivo or in vitro method for inducing ubiquitin-protein ligase E3 A (UBE3 A) expression in a cell where UBE3A-ATS is expressed, the method comprising administering an effective amount of a nucleic acid cassette of any one of claims 113-168 or the vector of any one of claims 169-175, to the cell.
182. The method of claim 181, wherein expression of UBE3A in the cell is increased compared to a comparable cell not treated with the nucleic acid cassette of any one of claims 113-168 or the vector of any one of claims 169-175.
183. The method of claim 181 or 182, wherein expression of UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, or more than 3 fold compared to a comparable untreated cell.
184. The method of any of claims 181-183, wherein expression of paternal UBE3A in the cell is increased compared to a comparable cell not treated with the nucleic acid cassette of any one of claims 1-60 or the vector of any one of claims 61-67.
185. The method of claim 184, wherein expression of paternal UBE3A in the cell is increased by at least 1.5 fold, 2, fold, 3 fold, 4 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, or more than 10 fold compared to a comparable untreated cell.
186. The method of any one of claims 176-185, wherein the cell is a cultured cell.
187. The method of claim 186, wherein the cell is a primary neuron, an IPSC derived neural cell, a neuronal cell line, an engineered cell line or a neural stem cell.
188. The method of any one of claims 176-185, wherein the cell is in vivo.
189. The method of claim 188, wherein the cell is a neuron.
190. The method of claim 189, wherein the cell is a neuron in the central nervous system (CNS), or a cell in contact with cerebral spinal fluid.
191. The method of any one of claims 176-190, wherein the contacting the cell or the administering comprises delivering the nucleic acid cassette to the CNS or cerebral spinal fluid (CSF).
192. The method of any one of claims 176-191, wherein the contacting the cell or the administering comprises delivering the nucleic acid cassette by intraparenchymal injection, intrathecal injection, intra-cistema magna injection, or intracerebroventricular injection.
193. A method for treating or preventing a neurological condition or disorder in a subject comprising administering a therapeutically or prophylactically effective amount of a pharmaceutical composition comprising a nucleic acid cassette of any one of claims 113-168 or the vector of any one of claims 169-175.
194. The method of claim 193, wherein the neurological condition or disorder is Angelman syndrome.
195. The method of claim 193 or 194, wherein the method comprises administering the pharmaceutical composition to the subject via intraparenchymal injection, intrathecal injection, intra-cisterna magna injection, intravenous injection, or intracerebroventricular injection.
196. A use of the nucleic acid cassette of any one of claims 113-168 or the vector of any one of claims 169-175, in the manufacture of a medicament for the treatment of a neurological condition or disorder.
197. A method of inducing expression of paternal UBE3A in a cell where expression of paternal UBE3A is suppressed, comprising administering to the cell an oligonucleotide that is at least 90% complementary to a 10-30 nucleotide sequence of an mRNA expressed from a region between positions 25,170,426 and 25,252,333 on human chromosome 15.
198. The method of claim 197, wherein the oligonucleotide comprises an RNA backbone, a DNA backbone, a modified backbone, or a combination of one of more backbones.
199. A method of inducing expression of paternal UBE3A in a cell where expression of paternal UBE3A is suppressed, comprising administering to the cell an oligonucleotide of at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15, a shRNA comprising a sequence at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15, or a nucleic acid capable of expressing an RNA comprising a sequence at least 90% complementary to a 10-30 nucleotide sequence between positions 25,170,426 and 25,252,333 on human chromosome 15.
200. A method of inducing expression of paternal UBE3A in a cell where expression of paternal UBE3A is suppressed, comprising administering to the cell an oligonucleotide of SEQ ID NOS: 9-38, a shRNA comprising a sequence of SEQ ID NOS: 9-38, or a nucleic acid capable of expressing an RNA comprising a sequence of SEQ ID NO: 9-38.
Citation Information
Patent Citations
Modified mirna as a scaffold for shrna
US20150018539A1
Modulation of UBE3a-ATS expression
US20150191723A1
Oligonucleotides for inducing paternal UBE3a expression
US20170191064A1
AAV-Mediated Targeting of MIRNA in the Treatment of X-Linked Disorders
US20230090989A1
UBE3a genes and expression cassettes and their use
WO2020237130A1