Optogenetic modulation for vision restoration
The rAAV delivery of OPN5 in retinal cells addresses the limitations of existing IRD therapies by enhancing light sensitivity and restoring vision through optimized expression of opsin5 in retinal cells.
Patent Information
- Application Number
- PCT/CN2025/088056
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-10
- Filing Date
- 2025-04-09
- Publication Date
- 2026-02-05
AI Technical Summary
Inherited retinal degenerations (IRDs) cause blindness due to the degeneration of photoreceptor cells, and existing gene therapies are limited by the low prevalence of specific mutations, making it unfeasible to develop targeted treatments for all forms of IRDs.
A polynucleotide construct encoding opsin5 (OPN5) is expressed in retinal cells using a recombinant adeno-associated virus (rAAV) to restore light sensitivity, which includes a nucleotide sequence optimized for expression and linked to a promoter, enhancer, and intron, and can be co-expressed with a fluorescent protein.
The rAAV delivery of OPN5 in retinal cells enhances light sensitivity, potentially restoring vision in conditions like Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, and Leber Congenital Amaurosis by converting light into electro-chemical signals.
Smart Images

Figure PCTCN2025088056-FTAPPB-I100001 
Figure PCTCN2025088056-FTAPPB-I100002 
Figure PCTCN2025088056-FTAPPB-I100003
Abstract
Description
Optogenetic Modulation for Vision RestorationTechnical Field
[0001] The present disclosure relates to molecular biology. In particular, the present disclosure relates to the gene therapy for treating inherited retinal degenerations (IRD) by expressing an opsin5 in retinal cells.Background
[0002] Inherited retinal degenerations (IRDs) are the leading cause of blindness, affecting 1 in 4,000 people worldwide (~1.75M in total) . Along with the progression of IRDs, the photoreceptors (e.g., rods and cones) that are responsible for conversion of light into electro-chemical signals, are degenerated. This prevents the generation of photo-induced signals in retina, breaking the vision-sensory related cascade of events within the visual system. Loss of photoreceptor cells and / or loss of photoreceptor cell function are the primary causes of reduced light sensitivity and blindness.
[0003] Numerous clinical trials have been initiated in recent years, providing AAV vector gene supplementation strategies for forms of IRD, leading to the first FDA-approved gene therapy product, Luxturna for the deficiency of RPE65 gene, which has been very well studied in the phototransduction pathway, and is the therapeutic agent for the Leber Congenital Amaurosis (LCA) patients.
[0004] However, IRDs can result from different mutations in more than 300 genes and many identified forms have very low prevalence, which makes it unfeasible to develop gene specific treatments for all forms of IRDs.
[0005] It was reported that the expression of an opsin in retinal cells, such as retinal ganglion cells (RGCs) can enable the conversion of light into electro-chemical signals, thereby restoring the loss of vision caused by an IRD or other retinal degenerative diseases, in which the loss of photoreceptor cells and / or loss of photoreceptor cell function occur.
[0006] There is a need of a new therapy for restoring vision, such as a gene therapy for delivering the coding sequence of an opsin, particularly an opsin with having a higher sensitivity to light and expressing the same in retina to provide an improved therapeutic effect.Summary of the Invention
[0007] In a first aspect, the present disclosure provides a polynucleotide construct comprising an expression cassette comprising a nucleotide sequence encoding a polypeptide comprising an opsin5 (OPN5) , operably linked to a promoter.
[0008] In some embodiments, the OPN5 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8 and 10.
[0009] In some embodiments, the nucleotide sequence encodes a fusion polypeptide comprising the OPN5 and a fluorescent protein. In some embodiments, the fluorescent protein is a GFP or an RFP.
[0010] In some embodiments, the promoter comprises a nucleotide sequence of SEQ ID NO: 19.
[0011] In some embodiments, the expression cassette further comprises an enhancer comprising the nucleotide sequence of SEQ ID NO: 20 upstream of the promoter.
[0012] In some embodiments, the expression cassette further comprises an intron comprising the nucleotide sequence of SEQ ID NO: 21 between the promoter and the nucleotide sequence.
[0013] In some embodiments, the expression cassette further comprises a polyadenylation signal sequence comprising the nucleotide sequence of SEQ ID NO: 22 downstream of the nucleotide sequence.
[0014] In some embodiments, the polynucleotide construct further comprises an expression cassette comprising a nucleotide sequence encoding a fluorescent protein.
[0015] In some embodiments, the fluorescent protein is a GFP or an RFP.
[0016] Also provided is a vector comprising the polynucleotide construct of the present disclosure.
[0017] In a second aspect, the present disclosure provides a recombinant adeno-associated virus (rAAV) comprising a genome comprising the polynucleotide construct of the present disclosure.
[0018] In some embodiments, the genome further comprises a 5’-ITR of SEQ ID NO: 23 and a 3’-ITR of SEQ ID NO: 24.
[0019] In some embodiments, the rAAV comprises a modified AAV2 capsid encoded by SEQ ID NO: 27.
[0020] In a third aspect, the present disclosure provides a pharmaceutical composition comprising the rAAV of the present disclosure.
[0021] In a fourth aspect, the present disclosure provides a method of treating vision loss caused by inherited retinal degenerations (IRD) , such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis, Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies in a subject, comprising administering the rAAV or the pharmaceutical composition of the present disclosure to an eye of the subject.
[0022] The present disclosure also provides use of the rAAV or the pharmaceutical composition of the present disclosure to in the preparation of a medicament for treating vision loss caused by IRD, such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis, Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies in a subject.
[0023] The present disclosure also provides the rAAV or the pharmaceutical composition of the present disclosure, for use in treating vision loss caused by IRD, such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis, Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies in a subject.
[0024] In some embodiment, the rAAV or the pharmaceutical composition is administered by intravitreal injection.Brief Description of the Drawings
[0025] Fig. 1 shows the maps of the helper plasmid (Fig. 1A) , the packaging plasmid (Fig. 1B) and an exemplified transgene plasmid (Fig. 1C) .
[0026] Figs. 2 and 3 show the ERG detection in rd1 mice injected with rAAVs encoding opsin5 on Day 14 post-injection.Detailed Description of the Invention
[0027] 1. Definition
[0028] Unless otherwise indicated, all terms used herein have the same meaning as they would to one skilled in the art, and the practice of the present disclosure will employ conventional techniques of microbiology and recombinant DNA technology, which are within the knowledge of those of skill in the art.
[0029] As used herein, the term “optogenetic modulation” refers to a technology that combines optics and genetics, based on a principle that photosensitive proteins (e.g., opsins) , which serve as the channels for cations or anions such as Cl-, Na+, H+, K+ through cellular membrane, are stimulated by light of specific wavelengths, resulting in changes in the membrane potential of the cell, thereby selectively exciting or inhibiting the cell. Optogenetic modulation has a very high accuracy that it can achieve a modulation a single cell in the time at a sub-millisecond level. Optogenetic modulation generally involves the construction of opsins, the expression of opsins, and the delivery of light. Due to the translucency of the eye structures, the delivery of light will not be a problem optogenetic modulation in eyes.
[0030] “Opsin” is a membrane protein with a molecular weight of approximately 30-50 kDa, which generally comprises one extracellular amino terminal, seven transmembrane regions, and one intracellular carboxyl terminal. Opsins are members of G protein coupled receptor (GPCR) superfamily. Opsins can be found in animals and microorganisms. Non-animal opsins, such as those from archaea, bacteria, and fungi, have similar tertiary structures to animal opsins, but they are significantly different in amino acid sequences. In addition to native opsins, opsins include modified and artificial ones. Examples for opsins include but not limited to those listed in Table 1.
[0031] Table 1. Exemplified opsins
[0032] Adeno-associated virus (AAV) is a member of Parvoviridae family. It is a simple single-stranded DNA virus, and requires a helper virus (such as adenovirus) for replication. The genome of a wildtype AAV contains approximately 4.7 kilobases (kb) , comprising the cap and rep genes between two inverted terminal repeat (ITR) sequences, approximately 145 nucleotides in length, with interrupted palindromic sequences that can fold into hairpin structures that function as primers during initiation of DNA replication. The cap gene encodes the viral capsid protein, and the rep gene is involved in the replication and integration of AAV. AAV can infect a variety of cells, and the viral DNA can be integrated into human chromosome 19 in the presence of the rep product.
[0033] As used herein, the term “inverted terminal repeats” or “ITRs” as used herein refers to AAV viral cis-elements named due to their symmetry. These elements are essential for efficient multiplication of an AAV genome. In the present disclosure, the term “ITR” refers to ITRs of known natural AAV serotypes, to chimeric ITRs formed by the fusion of ITR elements derived from different serotypes, and to functional variant thereof.
[0034] The production of a recombinant AAV particle may involve three plasmids, a transgene plasmid comprising an expression construct for expressing an exogenous polynucleotide, a packaging plasmid encoding the REP and / or CAP proteins, and a helper plasmid.
[0035] As used herein, the term “expression construct” refers to a single-stranded or double-stranded polynucleotide, which is isolated from a naturally occurring gene or modified to contain a nucleic acid segment that does not naturally occur. The expression construct may contain the control sequences required to express the coding sequence of the present disclosure.
[0036] As used herein, the term “polynucleotide” usually refers to generally a nucleic acid molecule (e.g., 100 bases and up to 30 kilobases in length) and a sequence that is either complementary (antisense) or identical (sense) to the sequence of a messenger RNA (mRNA) or miRNA fragment or molecule. The term can also refer to DNA or RNA molecules that are either transcribed or non-transcribed.
[0037] The term “exogenous polynucleotide” as used herein refers to a nucleotide sequence that does not originate from the host in which it is placed. It may be identical to the host’s DNA or heterologous. An example is a sequence of interest inserted into a vector. Such exogenous DNA sequences may be derived from a variety of sources including DNA, cDNA, synthetic DNA, and RNA. Exogenous polynucleotides also encompass DNA sequences that encode antisense oligonucleotides.
[0038] As used herein, the term “expression” includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0039] A “control sequence” includes all elements necessary or beneficial for the expression of the polynucleotide encoding the polypeptide of the present disclosure. Each control sequence may be natural or foreign to the nucleotide sequence encoding the polypeptide, or natural or foreign to each other. Such control sequences include, but are not limited to, leader sequence, polyadenylation sequence, propeptide sequence, promoter, enhancer, signal peptide sequence, and transcription terminator. At a minimum, control sequences include a promoter and signals for the termination of transcription and translation.
[0040] For example, the control sequence may be a suitable promoter sequence, a nucleotide sequence recognized by the host cell to express the polynucleotide encoding the polypeptide of the present disclosure. The promoter sequence contains a transcription control sequence that mediates the expression of the polypeptide. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the selected host cell, for example, lac operon of E. coli. The promoters also include mutant, modified and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides, which are homologous or heterologous to the host cell.
[0041] In some cases, an intron can be included in the construct to improve the expression of the coding sequence. The intron can be a native intron from a gene. Alternatively, the intron can be an artificial one, such as a chimeric intron comprising a native intron and an exon, e.g., an exon from another gene.
[0042] As used herein, the term “operably linked” herein refers to a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence, whereby the control sequence directs the expression of the polypeptide coding sequence.
[0043] The polynucleotide encoding the opsin such as OPN5 of the present disclosure can be subjected to various manipulations to improve the expression of the polypeptide. Before the insertion thereof into a vector, manipulation of the polynucleotide according to the expression vector or the host, such as codon optimization, is desirable or necessary.
[0044] The term “recombinant” as used herein refers to nucleic acids, vectors, polypeptides, or proteins that have been generated using DNA recombination (cloning) methods and are distinguishable from native or wild-type nucleic acids, vectors, polypeptides, or proteins.
[0045] The terms “polypeptide” and “protein” are used interchangeably herein and refer to a polymer of amino acids and includes full-length proteins and fragments thereof.
[0046] As used herein, the term “host cell” refers to, for example microorganisms, yeast cells, insect cells, and mammalian cells, that can be, or have been, used as recipients of rAAV vectors. The term includes the progeny of the original cell which has been transduced. Thus, a “host cell” as used herein generally refers to a cell which has been transduced with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to natural, accidental, or deliberate mutation.
[0047] The term “pharmaceutically acceptable” as used herein refers to molecular entities and compositions that are physiologically tolerable and do not typically produce toxicity or an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
[0048] The term “subject” as used herein includes, but is not limited to, humans, nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.
[0049] 2. Polynucleotide construct
[0050] The inventor founds that the cells transfected with a vector expressing an OPN5 showed higher light sensitivity than cells transfect with fusion polypeptide of opsins sensitive to various wavelength, while the fusion polypeptide showed improved light sensitivity as compared to the chimeric opsin reported in the prior art (WO 2018 / 106369) .
[0051] In a first aspect, the present disclosure provides a polynucleotide construct comprising an expression cassette comprising a nucleotide sequence encoding a polypeptide comprising an opsin5 (OPN5) , operably linked to a promoter. Preferably, the nucleotide sequence is codon optimized to improve the expression of the fusion polypeptide in mammal cells, e.g., human cells.
[0052] In some embodiments, the OPN5 is sensitive to blue light, e.g., the OPN5 has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the first wavelength is 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm.
[0053] In some embodiments, the OPN5 is an OPN5 from Accipiter gentilis (AGOPN5) , Alligator mississippiensis (AMOPN5) , Gallus gallus (cOPN5 / GGOPN5) , Pipistrellus kuhlii (PKOPN5) , or Serinus canaria (SCOPN5) . In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 2, 4, 6, 8 and 10.
[0054] Preferably, the OPN5 is responsive to red light, e.g., the OPN5 has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm.
[0055] In some embodiments, the OPN5 is AMOPN5, PKOPN5 or SCOPN5. In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 4, 8 and 10.
[0056] In some embodiments, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 1, 3, 5, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 1, 3, 5, 7 and 9. Preferably, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 3, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 3, 7 and 9.
[0057] The inventor found that the expression of a fluorescent protein in a cell can increase the light intensity in the cell. Therefore, the co-expression of a fluorescent protein with the OPN5. The fluorescent protein can be co-expressed with the OPN5 in a single expression cassette, or in separate cassettes.
[0058] In some embodiments, the polynucleotide construct comprises an expression cassette comprising a nucleotide sequence encoding the OPN5 and the fluorescent protein. In some embodiments, the OPN5 and the fluorescent protein are encoded as a fusion polypeptide, in which the OPN5 is linked to the fluorescent protein by a linker. In some embodiments, the linker comprises a GS linker such as GSG. In a particular embodiment, the linker further comprises a cleavable site, such as Furin site (e.g., SEQ ID NO: 14) and / or a 2A peptide (e.g., T2A of SEQ ID NO: 16) . In some embodiments, the linker comprises SEQ ID NO: 14, GSG, and SEQ ID NO: 16 from N terminus to C terminus.
[0059] In some embodiments, the polynucleotide construct comprises an expression cassette comprising a nucleotide sequence encoding the OPN5, and an expression cassette comprising a nucleotide sequence encoding the fluorescent protein.
[0060] In some embodiments, the fluorescent protein is a GFP or an RFP. For example, the fluorescent protein is an EGFP of SEQ ID NO: 18.
[0061] It is desired to employ a promoter that can provide more specific and / or higher expression in RGCs. The screening of such a promoter was conducted by detecting the expression of a marker such as GFP in retina driven by promoters. In some embodiments, the promoter comprises a nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19.
[0062] In some embodiments, the expression cassette further comprises an enhancer comprising the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20 upstream of the promoter.
[0063] In some embodiments, the expression cassette further comprises an intron comprising the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21 between the promoter and the nucleotide sequence.
[0064] In some embodiments, the expression cassette further comprises a polyadenylation signal sequence comprising the nucleotide sequence of SEQ ID NO: 22 downstream of the nucleotide sequence or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 22.
[0065] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 1, and SEQ ID NO: 22.
[0066] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 3, and SEQ ID NO: 22.
[0067] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 5, and SEQ ID NO: 22.
[0068] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 7, and SEQ ID NO: 22.
[0069] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 9, and SEQ ID NO: 22.
[0070] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 1, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0071] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 3, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0072] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 5, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0073] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 7, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0074] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 9, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0075] Provided are a vector comprising the polynucleotide construct of the present disclosure, and a host cell comprising the polynucleotide construct or the vector of the present disclosure.
[0076] For example, the vector can be a transgene plasmid for preparing an rAAV. Therefore, in some embodiment, the vector comprises the polynucleotide construct and AAV ITRs flanking the polynucleotide construct. In some embodiments, the vector comprises AAV2 ITRs. In some embodiments, the 5’ ITR comprises a nucleotide sequence of SEQ ID NO: 23, or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 23. In some embodiments, the 3’ ITR comprises a nucleotide sequence of SEQ ID NO: 24, or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24.
[0077] 3. Recombinant AAV
[0078] The present disclosure provides an rAAV for delivering and expressing the polynucleotide construct encoding a OPN5 in retinal cells, such as RGCs, thereby restoring the loss of vision due to the degeneration of photoreceptors such as rods and cones.
[0079] In some embodiments, the rAAV comprises a genome comprising a polynucleotide construct comprising an expression cassette comprising a nucleotide sequence encoding a polypeptide comprising an opsin5 (OPN5) , operably linked to a promoter. Preferably, the nucleotide sequence is codon optimized to improve the expression of the fusion polypeptide in mammal cells, e.g., human cells.
[0080] In some embodiments, the OPN5 is sensitive to blue light, e.g., the OPN5 has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the first wavelength is 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm.
[0081] In some embodiments, the OPN5 is an OPN5 from Accipiter gentilis (AGOPN5) , Alligator mississippiensis (AMOPN5) , Gallus gallus (cOPN5 / GGOPN5) , Pipistrellus kuhlii (PKOPN5) , or Serinus canaria (SCOPN5) . In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 2, 4, 6, 8 and 10.
[0082] Preferably, the OPN5 is responsive to red light, e.g., the OPN5 has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm.
[0083] In some embodiments, the OPN5 is AMOPN5, PKOPN5 or SCOPN5. In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 4, 8 and 10.
[0084] In some embodiments, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 1, 3, 5, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 1, 3, 5, 7 and 9. Preferably, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 3, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 3, 7 and 9.
[0085] The inventor found that the expression of a fluorescent protein in a cell can increase the light intensity in the cell. Therefore, the co-expression of a fluorescent protein with the OPN5. The fluorescent protein can be co-expressed with the OPN5 in a single expression cassette, or in separate cassettes.
[0086] In some embodiments, the polynucleotide construct comprises an expression cassette comprising a nucleotide sequence encoding the OPN5 and the fluorescent protein. In some embodiments, the OPN5 and the fluorescent protein are encoded as a fusion polypeptide, in which the OPN5 is linked to the fluorescent protein by a linker. In some embodiments, the linker comprises a GS linker such as GSG. In a particular embodiment, the linker further comprises a cleavable site, such as Furin site (e.g., SEQ ID NO: 14) and / or a 2A peptide (e.g., T2A of SEQ ID NO: 16) . In some embodiments, the linker comprises SEQ ID NO: 14, GSG, and SEQ ID NO: 16 from N terminus to C terminus.
[0087] In some embodiments, the polynucleotide construct comprises an expression cassette comprising a nucleotide sequence encoding the OPN5, and an expression cassette comprising a nucleotide sequence encoding the fluorescent protein.
[0088] In some embodiments, the fluorescent protein is a GFP or an RFP. For example, the fluorescent protein is an EGFP of SEQ ID NO: 18.
[0089] It is desired to employ a promoter that can provide more specific and / or higher expression in RGCs. The screening of such a promoter was conducted by detecting the expression of a marker such as GFP in retina driven by promoters. In some embodiments, the promoter comprises a nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19.
[0090] In some embodiments, the expression cassette further comprises an enhancer comprising the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20 upstream of the promoter.
[0091] In some embodiments, the expression cassette further comprises an intron comprising the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21 between the promoter and the nucleotide sequence.
[0092] In some embodiments, the expression cassette further comprises a polyadenylation signal sequence comprising the nucleotide sequence of SEQ ID NO: 22 downstream of the nucleotide sequence or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 22.
[0093] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 1, and SEQ ID NO: 22.
[0094] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 3, and SEQ ID NO: 22.
[0095] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 5, and SEQ ID NO: 22.
[0096] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 7, and SEQ ID NO: 22.
[0097] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 9, and SEQ ID NO: 22.
[0098] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 1, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0099] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 3, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0100] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 5, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0101] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 7, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0102] In some embodiment, the polynucleotide construct comprises, from 5’ to 3’ end, SEQ ID NO: 20, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 9, SEQ ID NO: 13, GGATCCGGC, SEQ IDNO: 15, SEQ ID NO: 17, and SEQ ID NO: 22.
[0103] In some embodiments, the genome further comprises AAV ITRs flanking the polynucleotide construct. In some embodiments, the vector comprises AAV2 ITRs. In some embodiments, the 5’ ITR comprises a nucleotide sequence of SEQ ID NO: 23, or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 23. In some embodiments, the 3’ ITR comprises a nucleotide sequence of SEQ ID NO:24, or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24.
[0104] In some embodiments, the rAAV of the present disclosure can be selected from human serotype 1 AAV (hAAV1) , hAAV2, hAAV3, hAAV4, hAAV5, hAAV6, hAAV7, hAAV8, hAAV9, hAAV10, and hAAV11.26. In some embodiments, the rAAV is hAAV2. A number of modified AAV capsids derived from hAAV2 have been reported, which improve gene therapy for ocular diseases. In some embodiments, the rAAV comprises a modified AAV2 capsid, such as those described in WO2012145601, WO2016134375, WO2018022905 and WO2023155828, preferably a capsid encoded by SEQ ID NO: 27.
[0105] It is known in the art to package rAAV with a system comprising three plasmids, including i) a transgene plasmid comprising the genome of the rAAV encoding a desired gene product, ii) a packaging plasmid encoding the REP and / or CAP proteins, and iii) a helper plasmid in a host cell (see, e.g., Crosson SM et al., Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Mol Ther Methods Clin Dev. 2018; 10: 1-7) . A method of producing rAAV is also described in, for example, U.S. Patent Publication No. 2005 / 0053922 and U.S. Patent Publication No. 2009 / 0202490.
[0106] The polynucleotide construct or the vector of the present disclosure can be introduced into the host cell stably or transiently using defined techniques including, but not limited to, electroporation, calcium phosphate precipitation, liposome-mediated transfection, and the like. For stable transformation, the subject nucleic acid will typically be operably linked to a selectable marker, such as neomycin resistance gene and the like.
[0107] The host cell is a variety of cells, such as mammalian cells, including, for example, murine cells and primate cells (e.g., human cells) . Suitable mammalian cells include, but are not limited to, primary cells and cell lines, wherein suitable cell lines include, but are not limited to, 293 cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1 / 2 fibroblasts, CHO cells, etc. Non-limiting examples of suitable host cells include, for example, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2) , CHO cells (e.g., ATCC No. CRL9618, CCL61, CRL9096) , 293 cells (e.g., ATCC No. CRL-1573) , Vero cells, NIH3T3 cells (eg, ATCC No. CRL-1658) , Huh-7 cells, BHK cells (e.g., ATCC No. CCL10) , PC12 cells (ATCC No. CRL1721) COS cells, COS-7 cells (ATCC No. CRL1651) , RAT1 cells, mouse L cells (ATCC No. CCLI. 3) , human embryonic kidney (HEK) cells (ATCC No. CRL1573) , HLHepG2 cells, and the like. Bacterial cells, such as Sf9 cells, which produce AAV, can also be used to prepare the host cell of the present disclosure (see, for example, U.S. Patent No. 7,271,002; U.S. Patent Publication No. 12 / 297,958) .
[0108] 4. Pharmaceutical Composition and Medical Use
[0109] The present disclosure provides a pharmaceutical composition comprising: a) the rAAV of the present disclosure; and b) a pharmaceutically acceptable carrier, diluent, excipient or buffer. In some embodiments, a pharmaceutically acceptable carrier, diluent, excipient or buffer is suitable for use in humans.
[0110] Such excipients, carriers, diluents, and buffers include any agent that can be administered without abnormal toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, and ethanol. Included therein may be pharmaceutically acceptable salts such as mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and salts of organic acids such as acetates, propionates, malonates, Benzoate and the like. In addition, auxiliary substances such as wetting or emulsifying agents, pH buffering substances and the like may be present in such vehicles. A wide variety of pharmaceutically acceptable excipients are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been described in detail in various publications including, for example, A. Gennaro (2000) “Remington: The Science and Practice of Pharmacy, ” 20th Edition, Lippincott, Williams, &Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) Editing by HC Ansel et al, 7th edition, Lippincott, Williams, &Wilkins; and Handbook of Pharmaceutical Excipients (2000) AH Kibbe et al., 3rd edition, Amer. Pharmaceutical Assoc.
[0111] The present disclosure provides a method of treating an ocular disease with loss of photoreceptor, the method comprising expressing an OPN5 or a fusion polypeptide comprising OPN5 in retinal cells, such as RGCs.
[0112] In some embodiments, Preferably, the nucleotide sequence is codon optimized to improve the expression of the fusion polypeptide in mammal cells, e.g., human cells.
[0113] In some embodiments, the OPN5 is sensitive to blue light, e.g., the OPN5 has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the first wavelength is 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm.
[0114] In some embodiments, the OPN5 is an OPN5 from Accipiter gentilis (AGOPN5) , Alligator mississippiensis (AMOPN5) , Gallus gallus (cOPN5 / GGOPN5) , Pipistrellus kuhlii (PKOPN5) , or Serinus canaria (SCOPN5) . In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 2, 4, 6, 8 and 10.
[0115] Preferably, the OPN5 is responsive to red light, e.g., the OPN5 has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm.
[0116] In some embodiments, the OPN5 is AMOPN5, PKOPN5 or SCOPN5. In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 4, 8 and 10.
[0117] In some embodiments, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 1, 3, 5, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 1, 3, 5, 7 and 9. Preferably, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 3, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 3, 7 and 9.
[0118] The method of expressing a polypeptide of interest in a cell includes, but is not limited to, delivering a polynucleotide encoding the polypeptide to the retinal cell, such as RGCs. The polynucleotide includes, but is not limited to, a plasmid, a viral vector, and an mRNA. In some embodiments, the viral vector is an rAAV vector.
[0119] In some embodiments, the method comprises administering to a subject in need thereof an effective amount of the rAAV or the pharmaceutical composition of the present disclosure. In some embodiments, the rAAV or the pharmaceutical composition is administered by intraocular injection or by intravitreal injection. The rAAV or the pharmaceutical composition is administered by a single-dose or a multiple-dose (e.g., 2, 3, 4 or more doses) scheme. For the multiple-dose scheme, the rAAV or the pharmaceutical composition can be administered at different intervals, such as daily, weekly, monthly, yearly, to achieve a desired level of gene expression.
[0120] Provided is an OPN5 polypeptide or a polynucleotide encoding an OPN5 polypeptide, for use in the treatment of an ocular disease with loss of photoreceptor. In some embodiments, Preferably, the nucleotide sequence is codon optimized to improve the expression of the fusion polypeptide in mammal cells, e.g., human cells.
[0121] In some embodiments, the OPN5 is sensitive to blue light, e.g., the OPN5 has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the first wavelength is 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm.
[0122] In some embodiments, the OPN5 is an OPN5 from Accipiter gentilis (AGOPN5) , Alligator mississippiensis (AMOPN5) , Gallus gallus (cOPN5 / GGOPN5) , Pipistrellus kuhlii (PKOPN5) , or Serinus canaria (SCOPN5) . In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 2, 4, 6, 8 and 10.
[0123] Preferably, the OPN5 is responsive to red light, e.g., the OPN5 has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm.
[0124] In some embodiments, the OPN5 is AMOPN5, PKOPN5 or SCOPN5. In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 4, 8 and 10.
[0125] In some embodiments, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 1, 3, 5, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 1, 3, 5, 7 and 9. Preferably, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 3, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 3, 7 and 9.
[0126] Provided is the rAAV or the pharmaceutical composition of the present disclosure, for use in the treatment of an ocular disease with loss of photoreceptor. In some embodiments, the rAAV or the pharmaceutical composition is administered by intraocular injection or by intravitreal injection. The rAAV or the pharmaceutical composition is administered by a single-dose or a multiple-dose (e.g., 2, 3, 4 or more doses) scheme. For the multiple-dose scheme, the rAAV or the pharmaceutical composition can be administered at different intervals, such as daily, weekly, monthly, yearly, to achieve a desired level of gene expression.
[0127] Provided is use of an OPN5 polypeptide or a polynucleotide encoding an OPN5 polypeptide in the preparation of a medicament for treating an ocular disease with loss of photoreceptor. Preferably, the nucleotide sequence is codon optimized to improve the expression of the fusion polypeptide in mammal cells, e.g., human cells.
[0128] In some embodiments, the OPN5 is sensitive to blue light, e.g., the OPN5 has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the first wavelength is 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm.
[0129] In some embodiments, the OPN5 is an OPN5 from Accipiter gentilis (AGOPN5) , Alligator mississippiensis (AMOPN5) , Gallus gallus (cOPN5 / GGOPN5) , Pipistrellus kuhlii (PKOPN5) , or Serinus canaria (SCOPN5) . In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 2, 4, 6, 8 and 10.
[0130] Preferably, the OPN5 is responsive to red light, e.g., the OPN5 has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm.
[0131] In some embodiments, the OPN5 is AMOPN5, PKOPN5 or SCOPN5. In some embodiments, the OPN comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8 and 10, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 4, 8 and 10.
[0132] In some embodiments, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 1, 3, 5, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 1, 3, 5, 7 and 9. Preferably, the expression cassette comprising a nucleotide sequence comprising SEQ ID NOs: 3, 7 and 9, or an amino acid sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to one of SEQ ID NOs: 3, 7 and 9.
[0133] The present disclosure provides use of the rAAV or the pharmaceutical composition of the present disclosure in the preparation of a medicament for treating an ocular disease with loss of photoreceptor in a subject in need thereof.
[0134] The OPN5s, the polynucleotide encoding the OPN5, the rAAV or the pharmaceutical composition of the present disclosure can be used to treat vision loss due to any degenerative retinal disease, which includes, but is not limited to, inherited retinal degenerations (IRDs) , such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis (LCA) , Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies.
[0135] Examples
[0136] The following Examples are provided for illustration only, rather than for any limitation to the present application.
[0137] Example 1. Construction of transgene plasmids and rAAVs expressing an OPN5s or a benchmark
[0138] This Example was carried out to detect the light sensitivity of OPN5s.
[0139] Transgene plasmids for expressing an OPN5 (Fig. 1C) were constructed by assembling the elements (a CMV IE enhancer of SEQ ID NO: 20, a CBA promoter of SEQ ID NO: 19, a chimeric intron of SEQ ID NO: 21, a coding sequence (consisting of OPN5, Furin, GSG and T2A) , a hGH polyA signal of SEQ ID NO: 22, and ITRs of SEQ ID NOs: 23 and 24) using Gibson assembly methodology (NEBuilder HiFi DNA Assembly Master Mix, NEB, Catalog E2621) . As shown in Fig. 1C, OPN5 is a nucleotide sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9 (encoding AGOPN5, AMOPN5, cOPN5 / GGOPN5, PKOPN5, and SCOPN5, respectively) , EGFP is a nucleotide sequence of SEQ ID NO: 17, Furin is a nucleotide sequence of SEQ ID NO: 13, T2A is a nucleotide sequence of SEQ ID NO: 12 and the GSG is encoded by GGATCCGGC. As an example, the rAAV genomes (5’ ITR to 3’ ITR) encoding the AGOPN5, AMOPN5, cOPN5 / GGOPN5, PKOPN5, and SCOPN5, respectively were shown in SEQ ID NOs: 29-33 as examples.
[0140] As benchmarks, two more transgene plasmids were constructed as described above with the coding sequence replaced by SEQ ID NO: 25 (referred to as 2838GS hereinafter) or 26 (referred to as 3210GS or SKG1101 hereinafter) , which encode two fusion polypeptides designed by the inventor, comprising an opsin sensitive to blue light, an opsin sensitive to red light, and a fluorescent protein. 2838GS and 3210GS had shown improved restoration of vision in rd1 mice as compared to the fusion polypeptide of opsins disclosed in the prior art (e.g., WO 2018 / 106369) .
[0141] rAAVs were prepared with a method similar to that described in Crosson SM et al. 2018. Briefly, 3E6 cells / ml 293VPC cells (Thermo, Catalog A35347) in serum free virus production medium OPM-293 CD05 (Shanghai OPM Biosciences Co. Ltd. Catalog: 81075-001) were triple transfected, using polyethylenimine, with the helper plasmid, the packaging plasmid encoding rep / cap, and the transgene plasmid below:
[0142] - helper plasmid ( “pHelper” containing the Ad E2A, E4, and VA RNA helper genes as described in Crosson Sm et al., the map thereof is shown in Fig. 1A) ;
[0143] - packaging plasmid, the map thereof is shown in Fig. 1B, in which “AAV2 Cap” is the nucleotide sequence encoding a modified AAV2 capsid polypeptide (SEQ ID NO: 27) , and “AAV2 Rep” is the nucleotide sequence encoding an AAV2 Rep polypeptide (SEQ ID NO: 28) ;
[0144] - transgene plasmid, those prepared above.
[0145] Following 72 h incubation at 37℃, cells were harvested, and viral particles were purified through an iodixanol gradient (see Crosson SM et al. ) .
[0146] The rAAVs were tested for titers by ddPCR, which were all at the level of 1013 viral genomes (vg) / mL. In particular, the ddPCR was carried out with Bio-Rad’s QXDx AutoDG ddPCR System and QXDx Universal Kit for AutoDG ddPCR System according to the manufacturer’s instructions. The primers and probe for the ddPCR are as follows:
[0147] GFP-F ACTACAACAGCCACAACGTCTATATCA
[0148] GFP-R GGCGGATCTTGAAGTTCACC
[0149] GFP-P 5′-6-FAM-CCGACAAGC-ZEN-AGAAGAACGGCATCA-Iowa Black FQ-3′
[0150] The transgene plasmids and rAAVs were referred to as coding sequence for the opsin or fusion polypeptide of opsin expressed thereby.
[0151] Example 2. In vivo study for the efficacy of OPN5s in rd1 mice
[0152] This Example was carried out to detect whether the OPN5s can provide a superior optogenetic modulation for vision restoration.
[0153] The rAAVs prepared in Example 1 were administered to rd1 mice (Jackson Laboratory, 004766, 6-8 week-old) by an intravitreal (IVT) injection at a dose of 7.5E9 vg / eye (12 eyes / group with wildtype mice, and rd1 mice injected with PBS as positive control and negative control) .
[0154] Electroretinogram (ERG) detection was conducted 14 days after the injection. In particular, mice were anesthetized and pupils were dilated with 1%Tropicamide and 1%Atropine. ERGs (RetiMINER-C, IRC) were recorded from the corneal surface using a pair of platinum loop electrodes, along with a ground electrode placed in the tail and a reference electrode in the anterior scalp between the eyes. A drop of Genteal Gel (Alcon) was placed on the cornea to keep it moistened. For scotopic ERG, mice were dark-adapted overnight and stimulated with flashes (white light, blue light (470nm) , green light (520nm) and red light (590nm) ) of steadily increasing light intensity (0.1, 1, and 10 log cds / m2) . The data were analyzed via RetiMINER4.0.
[0155] As shown in Figs. 2 and 3, the mice injected with rAAVs expressing OPN5s showed improved efficacy than 2838GS and 3210GS in response to blue light, while AMOPN5, SCOPN5, and PKOPN5 even showed improved efficacy than 2838GS and 3210GS in response to red light and white light.
Claims
1.A polynucleotide construct comprising an expression cassette comprising a nucleotide sequence encoding a polypeptide comprising an opsin5 (OPN5) , operably linked to a promoter.2.The polynucleotide construct of claim 1, wherein the OPN5 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8 and 10.3.The polynucleotide construct of claim 1 or 2, wherein the nucleotide sequence encodes a fusion polypeptide comprising the OPN5 and a fluorescent protein.4.The polynucleotide construct of claim 3, wherein the fluorescent protein is a GFP or an RFP.5.The polynucleotide construct of any one of claims 1-4, wherein the promoter comprises a nucleotide sequence of SEQ ID NO: 19.6.The polynucleotide construct of any one of claims 1-5, wherein the expression cassette further comprises an enhancer comprising the nucleotide sequence of SEQ ID NO: 20 upstream of the promoter.7.The polynucleotide construct of any one of claims 1-6, wherein the expression cassette further comprises an intron comprising the nucleotide sequence of SEQ ID NO: 21 between the promoter and the nucleotide sequence.8.The polynucleotide construct of any one of claims 1-7, wherein the expression cassette further comprises a polyadenylation signal sequence comprising the nucleotide sequence of SEQ ID NO: 22 downstream of the nucleotide sequence.9.The polynucleotide construct of any one of claims 1, 2, and 5-8, further comprising an expression cassette comprising a nucleotide sequence encoding a fluorescent protein.10.The polynucleotide construct of claim 9, wherein the fluorescent protein is a GFP or an RFP.11.A vector comprising the polynucleotide construct of any one of claims 1-10.12.A recombinant adeno-associated virus (rAAV) comprising a genome comprising the polynucleotide construct of any of claims 1-10.13.The rAAV of claim 12, wherein the genome further comprises a 5’-ITR of SEQ ID NO: 23 and a 3’-ITR of SEQ ID NO: 24.14.The rAAV of claim 12 or 13, comprising a modified AAV2 capsid encoded by SEQ ID NO: 27.15.A pharmaceutical composition comprising the rAAV of any one of claims 12-14.16.A method of treating vision loss caused by inherited retinal degenerations (IRD) , such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis, Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies in a subject, comprising administering the rAAV of any one of claims 12-14 or the pharmaceutical composition of claim 15 to an eye of the subject.17.The method of claim 16, wherein the rAAV or the pharmaceutical composition is administered by intravitreal injection.18.Use of the rAAV of any one of claims 12-14 or the pharmaceutical composition of claim 15 in the preparation of a medicament for treating vision loss caused by IRD, such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis, Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies in a subject.19.The rAAV of any one of claims 12-14 or the pharmaceutical composition of claim 15, for use in treating vision loss caused by IRD, such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis, Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies in a subject.