Antigen-binding molecule binding to CD19 and / or CD22, and use thereof

Abstract

An antigen-binding molecule binding to CD19 and / or CD22, comprising an antigen-binding molecule binding to CD19, an antigen-binding molecule binding CD22, and a bispecific binding molecule simultaneously binding CD19 and CD22. The CD19- or CD22-binding molecule comprises a nanobody or an antigen-binding fragment thereof, the complementarity-determining regions (CDRs) of the nanobody comprising CDR1, CDR2 and CDR3. The provided bispecific antigen-binding molecule comprises a bispecific antibody or an antigen-binding fragment thereof, and the bispecific antibody comprises: a first functional domain targeting CD19, and a second functional domain targeting CD22, the first functional domain being an anti-CD19 heavy chain antibody or an antigen-binding fragment thereof, and the second functional domain being an anti-CD22 heavy chain antibody or an antigen-binding fragment thereof.

Description

Antigen binding molecules binding to CD19 and / or CD22 and uses thereof

[0001] This application claims priority to Chinese Patent Application No. 202410429871.9, filed April 10, 2024, Chinese Patent Application No. 202410429873.8, filed May 31, 2024, and Chinese Patent Application No. 202411033543.3, filed July 30, 2024, which are incorporated by reference herein in their entireties. TECHNICAL FIELD

[0002] The present application relates to the field of biological immunotherapy, in particular to antigen binding molecules binding to CD19 and / or CD22 and uses thereof. BACKGROUND

[0003] CD19 molecule is one of the earliest discovered B lymphocyte surface markers. CD19 is expressed from bone marrow B progenitor cells, and continues throughout the B cell maturation period until it disappears when it is differentiated into plasma cells. It mainly regulates B cell activation and development, and is widely distributed on the surface of B lymphocytes. It is a functional receptor molecule. CD19 is one of the most reliable surface biomarkers of B lymphocytes. Its expression in mature B cells is 3 times higher than that in immature B cells, and its expression in B1 cells is slightly higher than that in B2 cells. It is expressed from pre-B cells until it is finally differentiated into plasma cells. CD19 molecule, as a receptor that specifically transduces signals on the surface of B lymphocytes, exists in all stages of normal B cell maturation, and is highly expressed on most non-Hodgkin lymphoma (NHL), many leukemias including acute lymphoblastic leukemia (ALL) and chronic lymphocytic leukemia (CLL) and other malignant B cells. It has become an important target for immunotherapy.

[0004] CD22, also known as Siglec-2, is widely present in normal B cells and B cell malignancies. CD22 is mainly expressed in mature B cells and is a cell surface adhesion molecule that regulates B cell activation, which helps control the sensitivity of B cells to antigen response. CD22 molecule is one of the inhibitory auxiliary receptors on the surface of B cells, which is closely related to the development, differentiation and function of B cells. CD22 is restrictedly expressed on the surface of mature B cells and most B lymphoma cells.

[0005] CAR (Chimeric Antigen Receptor) is an artificial receptor molecule manufactured by genetic engineering technology, which can endow immune effector cells (such as T lymphocytes) with specificity for a certain target antigen epitope, thereby enhancing the function of T lymphocytes in recognizing antigen signals and activation, and then returning lymphocytes to achieve the effect of anti-tumor. Kymriah and Yescarta, as representatives of multiple chimeric antigen receptor T cell (CAR-T) drugs, have been approved for marketing, and cell therapy has made breakthrough progress in the treatment of hematological tumors, constantly bringing new hope to tumor patients. Studies have shown that multiple cell surface antigen targets have been discovered and applied to related CAR cell therapy, such as CD19, BMCA, and other popular targets, which have achieved great success in hematological malignancies, especially relapsed / refractory B-cell malignancies. However, CAR-T also has drug resistance in clinical application. For example, in patients with B-cell acute lymphoblastic leukemia (B-ALL) treated with CD19-targeted CAR-T cells, up to 25% of patients relapsed, showing CD19-negative or low CD19. This phenomenon is called antigen escape. The main reason is that the single target is down-regulated or lost, and the treatment effect is not as expected.

[0006] Multi-target CAR-T cells, mainly designed to target different tumor antigens, including double CAR-T cells with two CARs or tandem CAR-T cells with multiple antibodies. This multi-target CAR-T can theoretically overcome tumor antigen heterogeneity and tumor antigen escape, and this assumption has been verified in clinical practice. Currently, FDA has approved a total of 6 CAR-T cells, in addition to two products targeting BCMA (Abecma and Carvykti), the remaining four are CD19 single-target CAR-T. Therefore, developing double-target CAR-T cells based on CD19 CAR-T cells is the most common development route. The most common target combination is CD19 / CD22. The CD19 / CD22 target combination can cover various cell subgroups of patients with primary and relapsed B-cell hematological malignancies. At the same time, in the case of CD19 loss, CD19 / CD22 CAR-T can also control the disease by combining CD22 to prevent disease progression and tumor recurrence; the possibility of tumor cells losing both CD19 and CD22 is very low.

[0007] In summary, developing multi-target CAR-T is a very promising research direction to improve the efficacy of CD19 CAR-T. SUMMARY

[0008] The present application provides in a first aspect a CD19 binding molecule comprising an anti-CD19 Nanobody or antigen binding fragment thereof, the complementarity determining regions CDR of said anti-CD19 Nanobody comprising a CDR1, a CDR2 and a CDR3, wherein the CDR1 comprises a sequence as set forth in any one of SEQ ID NOs: 1-25, the CDR2 comprises a sequence as set forth in any one of SEQ ID NOs: 26-49, and the CDR3 comprises a sequence as set forth in any one of SEQ ID NOs: 50-75.

[0009] In some embodiments, the anti-CD19 Nanobody comprises a CDR1, a CDR2 and a CDR3 as set forth in any one of the SEQ ID NOs of a row of Table 1.

[0010] Table 1: SEQ ID NOs of CDR regions of CD19 Nanobodies and corresponding VHHs

[0011] In some embodiments, the heavy chain variable region sequence of the anti-CD19 Nanobody is as set forth in any one of SEQ ID NOs: 134-166. In some embodiments, the heavy chain variable region of the CD19 Nanobody is humanized, the sequence being as set forth in any one of SEQ ID NOs: 189-194, 226-227.

[0012] In some embodiments, the CD19 binding molecule comprises one, two or more anti-CD19 Nanobodies or antigen binding fragments thereof; the CD19 binding molecule is a monovalent, multivalent or multispecific Nanobody or single domain antibody. In some embodiments, the CD19 binding molecule is a CD19 single domain antibody (CD19 VHH).

[0013] The present application provides in a second aspect a CD22 binding molecule comprising an anti-CD22 Nanobody or antigen binding fragment thereof, the complementarity determining regions CDR of said anti-CD22 Nanobody comprising a CDR1, a CDR2 and a CDR3, wherein the CDR1 comprises a sequence as set forth in any one of SEQ ID NOs: 76-95, the CDR2 comprises a sequence as set forth in any one of SEQ ID NOs: 96-112, and the CDR3 comprises a sequence as set forth in any one of SEQ ID NOs: 113-133.

[0014] In some embodiments, the anti-CD22 Nanobody comprises a CDR1, a CDR2 and a CDR3 as set forth in any one of the SEQ ID NOs of a row of Table 2.

[0015] Table 2: SEQ ID NOs of CDR regions of CD22 Nanobodies and corresponding VHHs

[0016] In some embodiments, the heavy chain variable region sequence of the anti-CD22 Nanobody is as set forth in any one of SEQ ID NOs: 167-188. In some embodiments, the heavy chain variable region of the CD22 Nanobody is humanized, and the sequence is as set forth in any one of SEQ ID NOs: 195-202.

[0017] In some embodiments, the CD22 binding molecule comprises one, two or more anti-CD22 Nanobodies or antigen binding fragments thereof; the CD22 binding molecule is a monovalent, multivalent or multispecific Nanobody or single domain antibody. In some embodiments, the CD22 binding molecule is a CD22 single domain antibody (CD22 VHH).

[0018] In some embodiments, the multivalent binding molecule or multispecific binding molecule of the first and second aspects of the application comprises a plurality of Nanobodies or antigen binding fragments thereof linked by a linker. The linker consists of 1-15 amino acids selected from G and S.

[0019] The third aspect of the application provides a bispecific antigen binding molecule comprising a bispecific antibody or antigen binding fragment thereof, the bispecific antibody comprising: a first functional region targeting CD19, and a second functional region targeting CD22, wherein the first functional region is an anti-CD19 heavy chain antibody or antigen binding fragment thereof, and the second functional region is an anti-CD22 heavy chain antibody or antigen binding fragment thereof.

[0020] The complementarity determining region of the anti-CD19 heavy chain antibody comprises a CDR1 sequence, a CDR2 sequence and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26 and 50, respectively, or as set forth in SEQ ID NOs: 10, 34 and 62, respectively, or as set forth in SEQ ID NOs: 22, 46 and 71, respectively.

[0021] and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 85, 96, and 122, respectively, or a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 87, 102, and 124, respectively, or a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 88, 104, and 126, respectively, or a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 91, 107, and 128, respectively, or a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 92, 109, and 130, respectively.

[0022] In some embodiments, the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26, and 50, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 85, 96, and 122, respectively,

[0023] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26, and 50, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 87, 102, and 124, respectively,

[0024] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 87, 102, and 124, respectively,

[0025] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 87, 102, and 124, respectively,

[0026] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 85, 96, and 122, respectively,

[0027] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 85, 96, and 122, respectively,

[0028] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 88, 104, and 126, respectively,

[0029] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 88, 104, and 126, respectively,

[0030] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 91, 107, and 128, respectively,

[0031] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 92, 109, and 130, respectively,

[0032] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 91, 107, and 128, respectively,

[0033] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 92, 109, and 130, respectively,

[0034] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26, and 50, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 91, 107, and 128, respectively,

[0035] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26, and 50, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 92, 109, and 130, respectively.

[0036] Table 3: Sequences of the complementarity determining regions of the anti-CD19 heavy chain antibodies and the anti-CD22 heavy chain antibodies

[0037] In some embodiments, the anti-CD19 heavy chain antibody has a sequence as set forth in any one of SEQ ID NOs: 134, 147, 161, 189-191, 193-194, or 226-227, and / or the anti-CD22 heavy chain antibody has a sequence as set forth in any one of SEQ ID NOs: 176, 178, 180, 183, 185, 195-199, or 201.

[0038] In some embodiments, the first functional region and the second functional region are fused by a linker, preferably the linker is GGGGSGGGGSGGGGS (SEQ ID NO: 220).

[0039] In some embodiments, the bispecific antibody contains a sequence as set forth in any one of SEQ ID NOs: 203-218.

[0040] In some embodiments, the nanobody is a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody.

[0041] In some embodiments, the nanobody further comprises a heavy chain constant region.

[0042] In some embodiments, the heavy chain constant region is a constant region of a camelid heavy chain antibody, comprising CH2 and CH3. In some embodiments, the CH2 and CH3 are CH2 and CH3 of human IgG Fc, such as CH2 and CH3 of IgG4. Preferably, the heavy chain constant region is as set forth in SEQ ID NO: 219 or 228. In some embodiments, the heavy chain constant region is a constant region of a cartilaginous fish heavy chain antibody, comprising CH1, CH2, CH3, CH4 and CH5.

[0043] In some embodiments, the binding molecule of any one of the embodiments of the present application is a chimeric antibody or a fully human antibody; preferably a fully human antibody.

[0044] In some embodiments, the binding molecule is an antibody comprising the anti-nanobody as a heavy chain variable domain.

[0045] In some embodiments, the binding molecule further comprises a light chain variable domain, a heavy chain constant domain and a light chain constant domain.

[0046] In some embodiments, the antigen binding fragment of an antibody is selected from the group consisting of Fab, F(ab')2, Fv, scFv.

[0047] The present application also provides a nucleic acid molecule having a sequence selected from the group consisting of:

[0048] (1) a coding sequence of the binding molecule of any one of the embodiments herein;

[0049] (2) a complementary sequence of (1) some embodiments

[0050] The present application also provides a nucleic acid construct comprising the nucleic acid molecule described herein.

[0051] In some embodiments, the nucleic acid construct is a cloning vector, an expression vector or an integration vector.

[0052] The present application also provides a phage comprising the binding molecule of any one of the embodiments herein.

[0053] In some embodiments, the binding molecule is displayed on the surface of the phage.

[0054] The present disclosure also provides a host cell selected from the group consisting of:

[0055] (1) expressing and / or secreting a binding molecule as described in any of the embodiments herein;

[0056] (2) comprising a nucleic acid molecule as described herein; and / or

[0057] (3) comprising a nucleic acid construct as described herein.

[0058] In some embodiments, the host cell is an immune effector cell, preferably a T cell, a TIL cell or an NK cell.

[0059] The present disclosure also provides a fusion protein comprising an antigen binding molecule as described herein and a further polypeptide, the antigen binding molecule being a CD19 binding molecule, a CD22 binding molecule or a bispecific binding molecule.

[0060] In some embodiments, the further polypeptide is located N-terminal and / or C-terminal to the antigen binding molecule.

[0061] In some embodiments, the further polypeptide is selected from a polypeptide localizing the antigen binding molecule to a different organelle, a tag for purification or for an immune response, a transmembrane protein or a transmembrane region thereof, a chimeric antigen receptor or a component thereof.

[0062] In some embodiments, the fusion protein is a chimeric antigen receptor, the antigen binding domain of which comprises the antigen binding molecule. The chimeric antigen receptor comprises: an optional signal peptide sequence, the antigen binding molecule, a hinge region, a transmembrane region, an intracellular region.

[0063] In some embodiments, the chimeric antigen receptor comprises: an optional CD8 signal peptide, the antigen binding molecule, a CD8 hinge region, a CD8 transmembrane region, a 4-1BB costimulatory domain, and a CD3 zeta intracellular signaling domain.

[0064] In some embodiments, the amino acid sequence of the CD8 signal peptide is set forth in SEQ ID NO: 221, the amino acid sequence of the CD8 hinge region is set forth in SEQ ID NO: 222, the amino acid sequence of the CD8 transmembrane region is set forth in SEQ ID NO: 223, the amino acid sequence of the 4-1BB costimulatory domain is set forth in SEQ ID NO: 224, and the amino acid sequence of the CD3 zeta intracellular signaling domain is set forth in SEQ ID NO: 225.

[0065] In some embodiments, the amino acid sequence of the chimeric antigen receptor is set forth in any one of SEQ ID NOs: 230, 232-234.

[0066] The present disclosure also provides a method of producing a binding molecule of any of the embodiments herein, comprising:

[0067] culturing a host cell described herein under conditions suitable for production of a binding molecule (e.g., a nanobody or antigen binding fragment thereof, a monovalent or multivalent nanobody or single domain antibody, or a multispecific nanobody or single domain antibody), and optionally purifying the binding molecule from the culture, or

[0068] incubating a nucleic acid molecule encoding a binding molecule of any of the embodiments herein under conditions suitable for translation of the DNA or RNA in a non-cellular system (e.g., in solution).

[0069] The present application also provides a pharmaceutical composition comprising a binding molecule, nucleic acid molecule, nucleic acid construct, phage or host cell described in any of the embodiments herein, and a pharmaceutically acceptable excipient.

[0070] In some embodiments, the pharmaceutical composition is for treating a disease or condition associated with CD19 and / or CD22 expression, e.g., a cancer.

[0071] The present application also provides the use of a binding molecule, nucleic acid molecule, nucleic acid construct, phage or host cell described in any of the embodiments herein in the manufacture of an engineered immune cell (e.g., a T cell, TIL cell or NK cell).

[0072] The present application also provides the use of a binding molecule, nucleic acid molecule, nucleic acid construct, phage or host cell described in any of the embodiments herein in the manufacture of a medicament for preventing or treating a disease or condition associated with CD19 and / or CD22 expression.

[0073] In some embodiments, the disease or condition is a cancer, e.g., B-cell acute lymphoid leukemia (“BALL”), T-cell acute lymphoid leukemia (“TALL”), acute lymphocytic leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), non-Hodgkin’s lymphoma, diffuse large B-cell lymphoma (DLBCL), multiple myeloma, follicular lymphoma, splenic, marginal zone lymphoma, mantle cell lymphoma, indolent B-cell lymphoma, or Hodgkin’s lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, relapsed or refractory acute lymphoblastic leukemia (r / r ALL), relapsed or refractory diffuse large B-cell lymphoma (r / r DLBCL), relapsed or refractory follicular lymphoma (r / r FL), preferably relapsed or refractory acute lymphoblastic leukemia (r / r ALL); relapsed or refractory diffuse large B-cell lymphoma (r / r DLBCL); relapsed or refractory follicular lymphoma (r / r FL), etc.

[0074] The present application also provides a method of treating or preventing a disease or condition associated with CD19 and / or CD22 expression, comprising administering to a patient in need thereof a therapeutically effective amount of a binding molecule, nucleic acid molecule, nucleic acid construct or host cell according to any embodiment of the present application, or a pharmaceutical composition according to any embodiment of the present application.

[0075] In some embodiments, the disease or condition is a cancer, such as B-cell acute lymphoid leukemia ("BALL"), T-cell acute lymphoid leukemia ("TALL"), acute lymphocytic leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), non-Hodgkin's lymphoma, diffuse large B-cell lymphoma (DLBCL), multiple myeloma, follicular lymphoma, splenic, marginal zone lymphoma, mantle cell lymphoma, indolent B-cell lymphoma or Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, relapsed or refractory acute lymphoblastic leukemia (r / r ALL), relapsed or refractory diffuse large B-cell lymphoma (r / r DLBCL), relapsed or refractory follicular lymphoma (r / r FL), preferably relapsed or refractory acute lymphoblastic leukemia (r / r ALL); relapsed or refractory diffuse large B-cell lymphoma (r / r DLBCL); relapsed or refractory follicular lymphoma (r / r FL), and the like.

[0076] The present application also provides a kit for detecting CD19 and / or CD22, for example for assessing the efficacy of a drug treatment or for diagnosing a cancer, comprising a binding molecule, nucleic acid molecule, nucleic acid construct or host cell according to any embodiment herein.

[0077] In some embodiments, the kit further comprises a reagent for detecting the binding of CD19 and / or CD22 to the binding molecule. For example, a reagent for detecting the binding by enzyme-linked immunoassay.

[0078] In some embodiments, the reagent for detecting the binding is a detectable label that can be attached to the binding molecule, such as biotin. The detectable label can be attached to the binding molecule or present separately in the kit.

[0079] The present application also provides a non-diagnostic method for detecting the presence of CD19 and / or CD22 in a sample, comprising: incubating a sample with a binding molecule as described in any of the embodiments herein, and detecting the binding of CD19 and / or CD22 to the binding molecule, thereby determining the presence of CD19 and / or CD22 in the sample. The detection is by enzyme-linked immunoassay.

[0080] The present application also provides the use of a binding molecule as described in any of the embodiments herein in the manufacture of a kit for detecting CD19 and / or CD22 in a sample, assessing the effect of a drug treatment, or diagnosing cancer. BRIEF DESCRIPTION OF DRAWINGS

[0081] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings required to be used in the embodiments will be briefly introduced as follows. It should be understood that the following drawings only show some of the embodiments of the present application, and therefore should not be considered as a limitation on the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.

[0082] Figure 1: Llama antiserum titer detection against CD19 protein.

[0083] Figure 2-3: Llama antiserum titer detection against CD19 positive cell lines.

[0084] Figure 4-5: Binding detection of candidate antibodies to CD19 protein overexpressing cell lines.

[0085] Figure 6-7: Binding detection of candidate antibodies to Raji tumor cell lines.

[0086] Figure 8: ELISA binding curve of humanized CD19 nanobody to human CD19 antigen.

[0087] Figure 9: ELISA binding curve of humanized CD19 nanobody to cynomolgus monkey CD19 antigen.

[0088] Figure 10: CD19 CAR-T cell proliferation results.

[0089] Figure 11: Cell lysis of CD19 CAR-T killing tumor cells for 96h at different effector to target ratios (8:1 and 4:1).

[0090] Figure 12: Llama antiserum titer detection against CD22 protein.

[0091] Figure 13: Llama antiserum titer detection against CD22 overexpressing cell lines.

[0092] Figure 14: Binding detection of candidate CD22 antibodies to 293T-hCD22 overexpressing cell lines.

[0093] Figure 15: Binding detection of candidate CD22 antibodies to Raji tumor cell line.

[0094] Figure 16: Binding detection of candidate CD22 antibodies to Daudi tumor cell line.

[0095] Figure 17: Cell lysis of tumor cells by CD22 CAR-T at different effector to target ratios (16:1 and 8:1) for 96h.

[0096] Figure 18: Binding detection of bispecific candidate antibodies to Raji WT cells.

[0097] Figure 19: Binding detection of bispecific candidate antibodies to Raji CD19 KO cells.

[0098] Figure 20: Binding detection of bispecific candidate antibodies to Raji CD22 KO cells.

[0099] Figure 21: Binding detection of bispecific, monospecific antibodies to Raji WT cells.

[0100] Figure 22: Binding detection of bispecific, monospecific antibodies to Raji CD22 KO cells.

[0101] Figure 23: BiAb CAR-T killing wt Raji cells at different effector to target ratios (16:1 and 4:1).

[0102] Figure 24: BiAb CAR-T killing CD19 KO Raji cells at different effector to target ratios (16:1 and 4:1).

[0103] Figure 25: BiAb CAR-T cell proliferation with tumor cells co-culture CAR+ positive cells.

[0104] Figure 26: BiAb CAR-T tumor killing in mice at very low, low, medium, high different injected doses.

[0105] Figure 27: Binding detection of humanized bispecific antibody z170-998 to Raji WT cells.

[0106] Figure 28: Binding detection of humanized bispecific antibody z170-998 to CD19 KO Raji cells.

[0107] Figure 29: Binding detection of humanized bispecific antibody z170-998 to CD22 KO Raji cells. DETAILED DESCRIPTION

[0108] The present disclosure is based on extensive and in-depth research and a large number of screenings, and a class of anti-CD19 and anti-CD22 single-domain antibodies and antigen-binding fragments thereof are found, which can specifically recognize CD19 or CD22 and bind with high affinity. The present disclosure uses protein immunization of alpacas to obtain a high-quality single-domain antibody gene library. Then, the phage display technology is used to screen the antibody gene library, thereby obtaining a specific single-domain antibody gene. The gene is then transferred to mammalian cells, thereby obtaining an antibody strain that can be efficiently expressed in mammalian cells and has high specificity. Then, high-affinity, high-specificity, and high-functional-activity nanobodies are identified by ELISA, molecular interaction analysis, and blocking test methods.

[0109] The present inventors creatively recombine different humanized single-domain antibodies into new antibodies, and obtain humanized bispecific antibodies that can bind to CD19 and CD22, effectively bind to cells expressing CD19 and / or CD22, have good functional activity, and have no cross-reaction with tissues.

[0110] Antibodies

[0111] In the present disclosure, a "CD19 binding molecule" is a protein that specifically binds to CD19, including but not limited to an antibody, a heavy chain antibody, a nanobody, or an antigen-binding fragment thereof. In the present disclosure, a "CD22 binding molecule" is a protein that specifically binds to CD22, including but not limited to an antibody, a heavy chain antibody, a nanobody, or an antigen-binding fragment thereof.

[0112] In the present disclosure, the term "antibody" includes a monoclonal antibody (including a full-length antibody having an immunoglobulin Fc region), an antibody composition having a polyepitope specificity, a multispecific antibody (e.g., a bispecific antibody), a diabody, and a single-chain molecule, as well as an antibody fragment, especially an antigen-binding fragment, such as Fab, F(ab')2, and Fv. In the present disclosure, "antibody" and "immunoglobulin" are used interchangeably.

[0113] Conventional "antibodies" contain a basic 4-chain antibody unit comprising an heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. Each of the heavy chains has at its N-terminus a variable domain (VH) followed by three constant domains (CH1, CH2, and CH3) and a hinge region between CH1 and CH2 domains. Each of the light chains has at its N-terminus a variable domain (VL) followed by a constant domain (CL) at its other end. The pairwise combinations of VHand VLtogether form an antigen binding site. See, e.g., Basic and Clinical Immunology, 8th Ed., Daniel P. Sties, Abba I. Terr and Tristram G. Parslow, eds., Appleton & Lange, Norwalk, CT, 1994, p. 71 and Chapter 6 regarding the structure and properties of different classes of antibodies. The light chains from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequences of their constant domains. Depending on the CH sequence and function, the gamma and alpha classes can be further divided into subclasses, e.g., humans express the following subclasses: IgGl, IgG2A, IgG2B, IgG3, IgG4, IgAl, and IgA2.

[0114] A "heavy chain antibody" as described herein is an antibody derived from a Camelid or a Cartilaginous fish. In contrast to the above 4-chain antibodies, heavy chain antibodies lack a light chain and a heavy chain constant region 1 (CH1), and comprise only two heavy chains, each consisting of a variable region (VHH) and other constant regions, which are connected to the constant regions by a hinge-like structure. Each heavy chain of a Camelid heavy chain antibody comprises one variable region (VHH) and two constant regions (CH2 and CH3), and each heavy chain of a Cartilaginous fish heavy chain antibody contains one variable region and five constant regions (CH1-CH5). Antigen binding fragments of heavy chain antibodies include VHH and single chain heavy chain antibodies. By fusing with the constant region of human IgG Fc, heavy chain antibodies can have CH2 and CH3 of human IgG Fc.

[0115] As used herein, the terms "single domain antibody", "heavy chain variable region domain of a heavy chain antibody", "VHH" are used interchangeably to refer to a VHH that specifically recognizes and binds to an antigen. A VHH is a variable region of a heavy chain antibody. Typically, a VHH contains three CDRs and four FRs.

[0116] In specific embodiments of the application, the complementarity determining regions CDR of the CD19 single domain antibody comprise a CDR1, a CDR2 and a CDR3, wherein the CDR1 comprises a sequence as set forth in any one of SEQ ID NOs: 1-25, the CDR2 comprises a sequence as set forth in any one of SEQ ID NOs: 26-49, and the CDR3 comprises a sequence as set forth in any one of SEQ ID NOs: 50-75. In specific embodiments, the anti-CD19 single domain antibody contains the CDR1, CDR2 and CDR3 sets as set forth in the SEQ ID NOs of any one row of Table 1. The antibody number and SEQ ID NO of the VHH of the anti-CD19 single domain antibody containing the CDR1, CDR2 and CDR3 sets of each row are shown in Table 1.

[0117] In specific embodiments of the application, the complementarity determining regions CDR of the CD22 single domain antibody comprise a CDR1, a CDR2 and a CDR3, wherein the CDR1 comprises a sequence as set forth in any one of SEQ ID NOs: 76-95, the CDR2 comprises a sequence as set forth in any one of SEQ ID NOs: 96-112, and the CDR3 comprises a sequence as set forth in any one of SEQ ID NOs: 113-133. In specific embodiments, the anti-CD22 single domain antibody contains the CDR1, CDR2 and CDR3 sets as set forth in the SEQ ID NOs of any one row of Table 2. The antibody number and SEQ ID NO of the VHH of the anti-CD19 single domain antibody containing the CDR1, CDR2 and CDR3 sets of each row are shown in Table 2.

[0118] Herein, "nanobody" refers to a VHH-based immunomolecule containing the CDRs or CDR combinations described herein. It can be a heavy chain antibody as described above, but also a multivalent or multispecific molecule containing multiple VHHs, or a recombinant molecule obtained by recombination of a VHH and an antibody Fc (e.g. CH2 and CH3 or CH2, CH3 and CH4).

[0119] Binding molecules comprising two or more single domain antibodies are multivalent single domain antibodies; binding molecules comprising two or more single domain antibodies of different specificity are multispecific single domain antibodies. Multivalent single domain antibodies or multispecific single domain antibodies comprise multiple single domain antibodies connected by a linker. The linker typically consists of 1-15 amino acids selected from G and S.

[0120] Herein, heavy chain antibodies and antibodies (traditional four-chain antibodies) are intended to distinguish between different combinations of antibodies. Since the structures of both have similarities, the following structural description for antibodies applies to heavy chain antibodies as well, except for the light chain.

[0121] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domains of the heavy or light chain of an antibody. The variable domains of the heavy chain and light chain can be referred to as "VH" and "VL", respectively. These domains are generally the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen binding sites.

[0122] The term "variable" refers to the broad variability found in the sequence of certain segments of the variable domains among antibodies of the same type. The variable domains mediate antigen binding and define specificity of a particular antibody for a particular antigen. However, the variability is not evenly distributed throughout the variable domains; it is concentrated in three segments called hypervariable regions (HVRs) both in the light chain and the heavy chain variable domains, i.e., HCDR1, HCDR2, HCDR3 in the heavy chain variable domain (which can be referred to as CDR1, CDR2, CDR3 in heavy chain antibodies) and LCDR1, LCDR2, and LCDR3 in the light chain variable domain. The more highly conserved portions of the variable domains are referred to as framework regions (FRs). The variable domains of the naturally occurring heavy and light chains each comprise four FR regions, FR1, FR2, FR3, and FR4, connected by three HVRs. The HVRs in each chain are held together in close proximity by the FR regions and, with the HVRs from the other chain, contribute to the formation of the antigen binding site of antibodies. In general, the structure of light chain variable regions is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of heavy chain variable regions is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions. There are various numbering schemes for variable regions, including Chothia, Kabat, IMGT, and Contact. The IMGT numbering scheme is used illustratively herein.

[0123] “Fc region” (fragment, crystallizable region) or “Fc domain” or “Fc” refers to the C-terminal region of an antibody heavy chain that mediates the binding of the immunoglobulin to host tissues or factors including binding to Fc receptors (FcRs) located on various cells of the immune system (e.g., effector cells) or to the first component (Clq) of the classical complement system. In IgG, IgA and IgD antibody isotypes, the Fc region is composed of two identical protein fragments from the CH2 and CH3 domains of each of the antibody’s two heavy chains; the Fc region of IgM and IgE comprises three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. While the boundaries of the Fc region of an immunoglobulin heavy chain might vary, the human IgG heavy chain Fc region is usually defined as spanning from an amino acid residue at position C226 or P230 of the heavy chain to the carboxy-terminus, wherein the numbering is according to the EU index as in Kabat. As used herein, the Fc region can be a native sequence Fc or a variant Fc.

[0124] “Antibody fragment” comprises a portion of an intact antibody, preferably the antigen binding and / or variable region of the intact antibody. The antibody fragment is preferably an antigen binding fragment of an antibody. Examples of antibody fragments include Fab, Fab’, F(ab')2, Fd, and Fv fragments, disulfide-linked Fvs; diabodies; linear antibodies; single-chain antibody molecules; scFv-Fc fragments; multi-specific antibodies formed from antibody fragments; and any fragments that should be able to increase the half-life by chemical modification or by incorporation into liposomes. Antigen binding fragments can be produced by a variety of techniques, including, but not limited to, proteolytic digestion of whole antibodies, as well as production by recombinant expression of immunoglobulin fragments.

[0125] “Fv” is the minimum antibody fragment that contains a complete antigen recognition and binding site. This fragment consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. From the folding of these two domains emanate six hypervariable loops (3 loops each from the H and L chain) that contribute most of the antigen binding specificity and diversity of antibody-antigen interactions. However, even a single variable domain (or half of an Fv comprising only three HVRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site. “Single-chain Fv” also abbreviated as “sFv” or “scFv” are antibody fragments that comprise the VHand VLdomains of antibody, linked by a polypeptide linker as a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker between the VHand VLdomains, which enables the sFv to form the desired structure for antigen binding. For heavy chain antibodies or nanobodies, scFv is VHH.

[0126] Herein, the term "monoclonal antibody" refers to an antibody obtained from a group of substantially homogeneous antibodies, i.e., except for possible natural mutations and / or post-translational modifications (e.g., isomerization, amidation) that may exist in small quantities, the individual antibodies constituting the group are identical. Monoclonal antibodies are highly specific, directed against a single antigenic site. Compared with polyclonal antibody preparations (which typically include different antibodies directed against different determinants (epitopes)), each monoclonal antibody is directed against a single determinant on the antigen. Except for their specificity, the advantage of monoclonal antibodies is that they are synthesized by hybridoma culture and are not subject to the contamination of other immunoglobulins. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody group and should not be construed as requiring production of antibodies by any ad hoc method. For example, the monoclonal antibody used according to the present invention can be generated by various techniques, including, for example, hybridoma method, phage display method, recombinant DNA method, and technology, single cell sequencing method for generating human or human-like antibodies from animals with part or all of the human immunoglobulin locus or the gene encoding human immunoglobulin sequence.

[0127] Monoclonal antibodies herein also include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to the corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.

[0128] The "humanized" form of a non-human (e.g., mouse) antibody refers to a chimeric antibody that minimally contains sequences derived from non-human immunoglobulins. Therefore, a "humanized antibody" generally refers to a non-human antibody in which the variable domain framework region is exchanged with sequences found in human antibodies. Typically, in a humanized antibody, the entire antibody (except the CDRs) is encoded by a polynucleotide of human origin or is identical to such an antibody (except the CDRs). The CDRs (some or all of which are encoded by nucleic acids derived from non-human organisms) are transplanted into the β-pleated skeleton of the human antibody variable region to produce an antibody, the specificity of which is determined by the transplanted CDRs. Methods for producing such antibodies are well known in the art, for example, using mice with genetically engineered immune systems. In the present invention, antibodies, single domain antibodies, heavy chain antibodies, etc. all include humanized variants of each of the antibodies.

[0129] A "human antibody" refers to an antibody having an amino acid sequence that corresponds to that of an antibody produced by a human and / or produced using any of the techniques disclosed herein for making human antibodies. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues. Human antibodies can be produced using various techniques known in the art, including phage display libraries. The heavy chain variable region sequence of the anti-CD19 Nanobody is set forth in any one of SEQ ID NOs: 134-166; the heavy chain variable region of the anti-CD19 Nanobody is humanized, the sequence of which is set forth in any one of SEQ ID NOs: 189-194, 226-227. The heavy chain variable region sequence of the anti-CD22 Nanobody is set forth in any one of SEQ ID NOs: 167-188; the heavy chain variable region of the anti-CD22 Nanobody is humanized, the sequence of which is set forth in any one of SEQ ID NOs: 195-202.

[0130] A Nanobody is a heavy chain antibody comprising a single domain antibody as described herein when the single domain antibody is linked to a heavy chain constant region. The heavy chain constant region can be the constant region of a camelid heavy chain antibody, comprising CH2 and CH3. Preferably, the antibody constant region is derived from the constant region of any one of IgGl, IgG2, IgG3, IgG4, IgA, IgM, IgE, and IgD, more preferably from the constant region of any one of IgGl, IgG2, IgG3, IgG4. In some embodiments, the heavy chain constant region is CH2 and CH3 of human IgG Fc, for example CH2 and CH3 of IgG4 or IgGl, as set forth in SEQ ID NO: 219 or 228.

[0131] A CD19 binding molecule described herein comprises one, two or more anti-CD19 Nanobodies or antigen binding fragments thereof; the CD19 binding molecule is a monovalent, multivalent or multispecific Nanobody or single domain antibody. The multispecificity can be to CD19 and another antigen, or to two different epitopes of CD19. In some embodiments, the CD19 binding molecule is a CD19 VHH.

[0132] A CD22 binding molecule described herein comprises one, two or more anti-CD22 Nanobodies or antigen binding fragments thereof; the CD22 binding molecule is a monovalent, multivalent or multispecific Nanobody or single domain antibody. The multispecificity can be to CD22 and another antigen, or to two different epitopes of CD22. In some embodiments, the CD22 binding molecule is a CD22 VHH.

[0133] The bispecific antigen binding molecules provided herein are capable of binding to CD19 and CD22 and can also be referred to as CD19 and / or CD22 binding molecules. The bispecific antigen binding molecules, including bispecific antibodies or antigen binding fragments thereof, comprise a first functional region targeting CD19 and a second functional region targeting CD22. The first functional region targeting CD19 can be any of the CD19 Nanobodies or antigen binding fragments thereof described herein, and the second functional region targeting CD22 can be any of the CD22 Nanobodies or antigen binding fragments thereof described herein. Preferably, the first functional region is an anti-CD19 heavy chain antibody or antigen binding fragment thereof, and the second functional region is an anti-CD22 heavy chain antibody or antigen binding fragment thereof.

[0134] In some embodiments, the first functional region is an anti-CD19 heavy chain antibody formed by linking a CD19 VHH to a heavy chain constant region, and the second functional region is an anti-CD22 heavy chain antibody formed by linking a CD22 VHH to a heavy chain constant region, and the anti-CD19 heavy chain antibody and the anti-CD22 heavy chain antibody form a heterodimer, thereby resulting in a bispecific antigen binding molecule. In some embodiments, the bispecific antigen binding molecule is a fusion of a CD19 VHH and a CD22 VHH linked by a linker.

[0135] The complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26, and 50, respectively, or as set forth in SEQ ID NOs: 10, 34, and 62, respectively, or as set forth in SEQ ID NOs: 22, 46, and 71, respectively;

[0136] and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 85, 96, and 122, respectively, or as set forth in SEQ ID NOs: 87, 102, and 124, respectively, or as set forth in SEQ ID NOs: 88, 104, and 126, respectively, or as set forth in SEQ ID NOs: 91, 107, and 128, respectively, or as set forth in SEQ ID NOs: 92, 109, and 130, respectively.

[0137] In some embodiments, the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26, and 50, respectively, the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 85, 96, and 122, respectively,

[0138] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26, and 50, respectively, the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 87, 102, and 124, respectively,

[0139] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 87, 102, and 124, respectively,

[0140] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 87, 102, and 124, respectively,

[0141] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 85, 96, and 122, respectively,

[0142] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 85, 96, and 122, respectively,

[0143] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 88, 104, and 126, respectively,

[0144] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 88, 104, and 126, respectively,

[0145] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 91, 107, and 128, respectively,

[0146] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 92, 109, and 130, respectively,

[0147] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 91, 107, and 128, respectively,

[0148] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 92, 109, and 130, respectively,

[0149] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26, and 50, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 91, 107, and 128, respectively,

[0150] or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 1, 26, and 50, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as set forth in SEQ ID NOs: 92, 109, and 130, respectively.

[0151] In some embodiments, the anti-CD19 heavy chain antibody has a sequence as set forth in any one of SEQ ID NOs: 134, 147, 161, 189-191, or 193-194, and / or the anti-CD22 heavy chain antibody has a sequence as set forth in any one of SEQ ID NOs: 176, 178, 180, 183, 185, 195-199, or 201.

[0152] In some embodiments, the first functional region and the second functional region are fused by a linker, preferably the linker is GGGGSGGGGSGGGGS (SEQ ID NO: 219).

[0153] In some embodiments, the bispecific antibody contains a sequence as set forth in any one of SEQ ID NOs: 203-218.

[0154] The present application also includes derivatives and analogs of the binding molecules. By "derivatives" and "analog" is meant polypeptides that substantially retain the same biological function or activity of the binding molecules of the present application. Derivatives or analogs of the present application can be (i) polypeptides having substituent groups at one or more amino acid residues, or (ii) polypeptides formed by fusing the mature polypeptide to another compound, such as a compound that increases the half-life of the polypeptide, for example, a polyethylene glycol, or (iii) polypeptides formed by fusion of additional amino acid sequences to either the N- or C-terminus of the polypeptide (such as a leader or secretory sequence or a sequence for purification of the polypeptide or a proprotein sequence, or a fusion protein with a 6His tag). These derivatives and analogs are within the scope of those of ordinary skill in the art from the teachings herein.

[0155] Without materially affecting the activity of the binding molecule, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) amino acids can be altered in the sequence of a binding molecule of the application by one skilled in the art to obtain a variant of the sequence of the binding molecule or a functional fragment thereof. These variants include, but are not limited to, deletion, insertion, and / or substitution of one or more (typically 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10) amino acids, as well as addition of one or several (typically within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and / or the N-terminus. In the art, conservative substitutions with similar or identical properties are often made without altering the function of the protein. For example, amino acids with similar properties are substituted in the FR and / or Fc regions. Amino acid residues that can be conservatively substituted are well known in the art. Such substituted amino acid residues can or can not be encoded by the genetic code. Also, addition of one or several amino acids at the C-terminus and / or the N-terminus often does not alter the function of the protein. All of these are considered to be within the scope of the application.

[0156] Variants of the binding molecules described herein include homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridizes to the DNA encoding the binding molecules of the application under high or low stringency conditions, and polypeptides or proteins obtained using antisera against the binding molecules of the application. In some embodiments, the sequences of the variants of the application can have at least 95%, 96%, 97%, 98%, or 99% identity to the sequences from which they are derived. The sequence identity of the sequences of the application can be measured using sequence analysis software, for example, the computer program BLAST, particularly BLASTP or TBLASTN, using default parameters. The application also includes molecules having the variable region of the heavy chain of an antibody with CDRs, as long as the CDRs have more than 90% (preferably more than 95%, most preferably more than 98%) homology to the CDRs identified herein.

[0157] The binding molecules of the application (e.g., nanobodies) can be prepared using methods conventional in the art, such as hybridoma technology, phage display technology. Alternatively, the nanobodies of the application can be expressed in other cell lines. A suitable mammalian host cell can be transformed with a sequence encoding a binding molecule of the application, and the host cell is then cultured and the binding molecule purified. Transformation can be performed using any known method, including, for example, packaging the polynucleotide in a virus (or viral vector) and transducing a host cell with the virus (or vector). The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art, including dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide in liposomes, and direct microinjection of the DNA into nuclei. Mammalian cell lines useful as hosts for expression are well known in the art, including, but not limited to, a variety of immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), and the like.

[0158] The application also includes fusion proteins of the antigen binding molecules described herein and other polypeptides, which are CD19 binding molecules, CD22 binding molecules, or bispecific binding molecules. In some embodiments, the other polypeptide is N-terminal and / or C-terminal to the binding molecule. In some embodiments, the other polypeptide includes a polypeptide that localizes the binding molecule to a different organelle, a tag for purification or for an immune response, a transmembrane protein or transmembrane region thereof, a chimeric antigen receptor or component thereof (extracellular domain, hinge region, transmembrane region, signal transduction domain, costimulatory domain, etc.). In some embodiments, the fusion protein is a chimeric antigen receptor whose antigen binding domain comprises the antigen binding molecule. The chimeric antigen receptor comprises: an optional signal peptide sequence, an antigen binding molecule, a hinge region, a transmembrane region, an intracellular region.

[0159] The chimeric antigen receptor also has one or more features selected from the group consisting of:

[0160] The signal peptide comprises a CD8 signal peptide, a CD28 signal peptide, a CD4 signal peptide, or a light chain signal peptide,

[0161] The hinge region comprises a CD8 hinge region, an IgD hinge region, an IgGl Fc CH2CH3 hinge region, or an IgG4 Fc CH2CH3 hinge region,

[0162] The transmembrane region comprises a CD28 transmembrane region, a CD8 transmembrane region, a CD3 zeta transmembrane region, a CD134 transmembrane region, a CD137 transmembrane region, an ICOS transmembrane region, or a DAP10 transmembrane region,

[0163] the intracellular region comprises an intracellular costimulatory domain and / or an intracellular signaling domain,

[0164] the intracellular costimulatory domain comprises an intracellular domain of CD28, CD134 / OX40, CD137 / 4-1BB, lymphocyte-specific protein tyrosine kinase, inducible T-cell costimulator (ICOS), or DNAX-activating protein 10,

[0165] the intracellular signaling domain comprises a CD3 zeta intracellular signaling domain or a Fc epsilon RI gamma intracellular signaling domain.

[0166] In some embodiments, the chimeric antigen receptor comprises: an optional CD8 signal peptide, an antigen binding molecule, a CD8 hinge region, a CD8 transmembrane region, a 4-1BB costimulatory domain, and a CD3 zeta intracellular signaling domain.

[0167] In some embodiments, the CD8 signal peptide has an amino acid sequence of SEQ ID NO: 221, the CD8 hinge region has an amino acid sequence of SEQ ID NO. 222, the CD8 transmembrane region has an amino acid sequence of SEQ ID NO: 223, the 4-1BB costimulatory domain has an amino acid sequence of SEQ ID NO: 224, and the CD3 zeta intracellular signaling domain has an amino acid sequence of SEQ ID NO: 225.

[0168] In some embodiments, the chimeric antigen receptor has an amino acid sequence of any one of SEQ ID NOs: 153-156.

[0169] Nucleic acid

[0170] The present application also provides polynucleotides encoding the binding molecules described herein. The polynucleotides of the present application can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be the coding strand or the non-coding strand. The present application also includes degenerate variants of the polynucleotide sequence encoding the fusion protein, i.e., nucleotide sequences that encode the same amino acid sequence but differ in nucleotide sequence. The RNA can be mRNA that expresses the binding molecule in vivo and / or in vitro.

[0171] Accordingly, the present application also relates to polynucleotides which hybridize to the above polynucleotide sequences and which are at least 50%, preferably at least 70%, more preferably at least 80% identical between the two sequences. In particular, the present application relates to polynucleotides which hybridize to the polynucleotides of the present application under stringent conditions. In the present application, "stringent conditions" means: (1) hybridization and washing at low ionic strength and high temperature, such as 0.2 x SSC, 0.1% SDS, 60°C; or (2) hybridization in the presence of a denaturing agent, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C; or (3) hybridization only when the identity between the two sequences is at least 90%, more preferably 95%. Furthermore, the polypeptides encoded by the hybridizable polynucleotides have the same biological function and activity as the mature polypeptides.

[0172] The nucleotide full-length sequences of the binding molecules of the present application or fragments thereof can be obtained by PCR amplification, recombination or artificial synthesis. One feasible method is to synthesize the relevant sequences by artificial synthesis, especially when the length of the fragments is short. Generally, the longer fragments can be obtained by first synthesizing a plurality of small fragments and then ligating them together. In addition, the coding sequence of the heavy chain can be fused with an expression tag (such as 6His) to form a fusion protein. The sequence of each part of the fusion protein can be obtained as described above and then ligated to obtain the full-length fusion protein.

[0173] Once the relevant sequences are obtained, the relevant sequences can be obtained in large quantities by recombination. This is usually achieved by cloning the relevant sequences into vectors, transforming the vectors into cells, and then isolating the relevant sequences from the proliferated host cells by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present application include biomolecules in isolated form. At present, the DNA sequences encoding the proteins (or fragments thereof, or derivatives thereof) of the present application can be completely obtained by chemical synthesis. The DNA sequences can then be introduced into various existing DNA molecules (or vectors, etc.) and cells known in the art. In addition, mutations can be introduced into the protein sequences of the present application by chemical synthesis. The parts of the fusion protein can be cloned into vectors sequentially or can be cloned as a full-length fusion protein.

[0174] The present application also relates to nucleic acid constructs comprising the polynucleotide sequences described herein, and one or more control sequences operably linked to the sequences, such as control sequences suitable for expressing the DNA or RNA as a binding molecule in vivo or in vitro. The polynucleotide sequences described in the present application can be manipulated in a variety of ways to produce the binding molecules. The nucleic acid constructs can be manipulated before being inserted into vectors according to the different or requirements of the expression vectors. Techniques for modifying polynucleotide sequences using recombinant DNA methods are known in the art.

[0175] The regulatory sequences can be suitable promoter sequences. A promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter can be any nucleotide sequence which shows transcriptional activity in the host cell of choice and includes mutant, truncated, and hybrid promoters, and can be derived from genes either homologous or heterologous to the host cell. One example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation factor- 1 alpha (EF-1 alpha). However, other constitutive promoter sequences can also be used, including but not limited to the simian virus 40 (SV40) early promoter, the mouse mammary tumor virus (MMTV), the human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the Epstein-Barr virus immediate early promoter, the Rous Sarcoma Virus promoter, and human gene promoters such as, but not limited to, the actin promoter, the myoglobin promoter, the hemoglobin promoter, and the creatine kinase promoter. Further, the use of inducible promoters can also be contemplated. The use of inducible promoters provides a molecular switch that can turn on expression of a polynucleotide sequence operably linked to the inducible promoter at a time of choice, and turn off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

[0176] The regulatory sequences can also be suitable transcription terminator sequences, sequences recognized by a host cell to terminate transcription. A terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice can be used in the present application. The regulatory sequences can also be suitable leader sequences, untranslated regions of mRNA important for translation by the host cell. A leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice can be used in the present application.

[0177] Other regulatory sequences that are suitable for in vivo or in vitro expression of DNA or RNA are routine in the art.

[0178] In certain embodiments, the nucleic acid construct is a vector, such as a cloning vector, an expression vector, and an integrating vector. Expression of the polynucleotide sequences of the application is typically achieved by operably linking the polynucleotide sequences of the application to an expression vector. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of expression of the desired nucleic acid sequences. Integrating vectors contain components that allow for integration of the target sequences into the genome of a cell. These vectors can be used to transform appropriate host cells to enable them to express proteins. Vectors typically contain sequences for plasmid maintenance and for cloning and expression of foreign nucleotide sequences. The sequences, which in certain embodiments are collectively referred to as "flanking sequences," generally include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence containing donor and acceptor splice sites, a sequence encoding a leader sequence for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a polylinker region for insertion of nucleic acids encoding binding molecules to be expressed, and an optional marker element.

[0179] Furthermore, the type of vector is not limited, for example, plasmid, phagemid, phage derivative, animal virus, and cosmid, and can be changed depending on the host cell to be introduced. Viral vector technology is well known in the art and described in, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

[0180] In order to assess expression of the polypeptide or portion thereof, the vector introduced into the cell can also contain either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of the expressing cells from the population of cells sought to be transfected or infected by the viral vector.

[0181] Cells

[0182] Host cells suitable for introduction of the nucleic acid constructs described herein can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: E. coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells, such as yeast; insect cells, such as Drosophila S2 or Sf9; animal cells, such as CHO, COS7, 293 cells, and the like. Examples of mammalian cells include immune cells, preferably immune effector cells. An "immune effector cell" is an immune cell that can perform an immune effector function, including: T cells, NK cells, peripheral blood mononuclear cells (PBMCs), neutrophils, eosinophils, hematopoietic stem cells. T cells suitable for use in the application can be of various types and from various sources.

[0183] Methods for introducing nucleic acids or vectors into mammalian cells are known in the art, and the vectors can be introduced into the cells by physical, chemical, or biological means. When the host is a prokaryote, such as E. coli, a competent cell that can take up DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. When the host is a eukaryote, DNA transfection methods such as calcium phosphate co-precipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, and the like can be used. In some embodiments, the transduced or transfected immune effector cells are propagated ex vivo after introduction of the nucleic acid or vector.

[0184] The fusion protein is a chimeric antigen receptor (CAR) whose antigen binding domain comprises the antigen binding molecule, and the chimeric antigen receptor-expressing cell can be prepared by: (1) activating the cell by contacting the cell with an activator; (2) introducing a nucleic acid molecule encoding the CAR into the cell by contacting the cell with the nucleic acid molecule encoding the CAR on a vector to introduce the nucleic acid molecule into the cell; and (3) harvesting the cell. The chimeric antigen receptor-expressing cell can be prepared in vitro by a viral vector or a non-viral vector, or directly generated in vivo in a patient by a viral vector. In some embodiments, the nucleic acid molecule encoding the CAR is DNA, and the vector is a plasmid vector. In some embodiments, the nucleic acid molecule encoding the CAR is RNA, such as mRNA, saRNA, and the vector is LNP, LPX, VLP, inorganic nanoparticle, or exosome. In some embodiments, the vector is a plasmid vector containing a transposon comprising the nucleic acid molecule encoding the CAR, and the step (2) further comprises contacting the cell with a transposase or a nucleic acid molecule encoding the transposase. The transposon and the transposase belong to the same transposon system, which is selected from the group consisting of: a Tolll transposon system, a Tol2 transposon system, a Frog Prince transposon system, a Minos transposon system, a Hsmarl transposon system, a Helraiser transposon system, a ZB transposon system, a BZ transposon system, an Intruder transposon system, a SPINON transposon system, a TcBuster transposon system, a Passer transposon system, a JL transposon system, a Yabusame-1 transposon system, a Uribo2 transposon system, a PiggyBac (PB) transposon system, a Sleeping Beauty (SB) transposon system, and various variants or derivatives of the above transposon systems. In some embodiments, the transposon system is a PB transposon system, a BZ transposon system, or a JL transposon system. In some embodiments, the nucleic acid molecule encoding the transposase is DNA or RNA. In some embodiments, the cell is contacted with the transposase or the nucleic acid molecule encoding the transposase by electroporation for cell transduction. In some embodiments, the introduction is performed by electroporation. The step (2) comprises: contacting the cell with a DNA vector comprising a PB transposon and an mRNA encoding a PB transposase, wherein the PB transposon comprises a CAR gene expression cassette and terminal inverted repeats flanking the CAR gene expression cassette. In some embodiments, the CAR gene expression cassette is loaded on a viral vector for infecting T cells, and the viral vector is injected into a patient to directly generate CAR-T in vivo.

[0185] The transformants obtained can be cultured in conventional media using standard procedures to express the binding molecules encoded by the genes of the application. The medium used will vary according to the host cell selected, and can include various conventional media. Cultures are incubated at conditions appropriate for growth of the host cell. When the host cell has grown to an appropriate density, the selected promoter is induced using a suitable method (e.g., temperature shift or chemical induction) and the cells are incubated for an additional period.

[0186] The polypeptides in the above methods can be expressed intracellularly, or on the cell membrane, or secreted outside of the cell. If desired, the recombinant proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with protein precipitants (salting-out method), centrifugation, osmotic lysis, ultratreatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and other various liquid chromatography techniques, and combinations of these methods.

[0187] Uses and methods

[0188] By constructing a nanobody library, the inventors screened for nanobodies and variants thereof that can bind to CD19 and / or CD22. The binding ability of these antibodies to the antigens was verified by protein level binding assays, affinity assays, and competition blocking experiments and tissue cross reactivity.

[0189] All aspects of the binding molecules, encoding sequences, nucleic acid constructs, and cells described herein can be used to prepare a medicament for preventing or treating various conditions and diseases described herein, which are diseases or conditions associated with CD19 and / or CD22 expression, which refers to diseases directly or indirectly caused by abnormal expression of CD19 and / or CD22, typically diseases caused by overexpression of CD19 and / or CD22, such as cancer, including but not limited to: B-cell acute lymphoid leukemia (“BALL”), T-cell acute lymphoid leukemia (“TALL”), acute lymphocytic leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), non-Hodgkin’s lymphoma, diffuse large B-cell lymphoma (DLBCL), multiple myeloma, follicular lymphoma, splenic, marginal zone lymphoma, mantle cell lymphoma, indolent B-cell lymphoma or Hodgkin’s lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, relapsed or refractory acute lymphoblastic leukemia (r / r ALL), relapsed or refractory diffuse large B-cell lymphoma (r / r DLBCL), relapsed or refractory follicular lymphoma (r / r FL), etc.

[0190] The binding molecules, nucleic acids, or cells of the present application can be administered alone or in combination with diluents and / or with other components such as related cytokines or cell populations as a pharmaceutical composition. In this respect, the pharmaceutical compositions can be prepared for use in a freeze-dried formulation or in an aqueous solution by mixing the active agent having the desired degree of purity with optional pharmaceutically-acceptable carriers, excipients or diluents. Pharmaceutically-acceptable carriers include at least one of buffers (e.g., neutral buffered saline, sulfate -buffered saline), antioxidants, preservatives, isotonifiers, stabilizers, chelators (e.g., EDTA or glutathione), adjuvants (e.g., aluminum hydroxide), and surfactants. In addition, to be useful for in vivo administration, the pharmaceutical compositions must be sterile. The pharmaceutical compositions can be rendered sterile by filtration through a sterile filtration membrane.

[0191] In some embodiments, the pharmaceutical compositions can contain at least one additive of a cytotoxic agent, a chemotherapeutic agent, a cytokine, an immunosuppressive agent, a growth inhibitory agent, and an active agent required for the particular indication to be treated. The specific amount of additive added can be adjusted as necessary.

[0192] The pharmaceutical compositions of the present application can be administered in an "immunologically effective amount," an "anti-tumor effective amount," a "tumor-inhibiting effective amount," or a "therapeutic amount." "Treatment" refers to the adoption of a therapeutic regimen by a subject to achieve at least one positive therapeutic effect (e.g., a reduction in the number of cancer cells, a reduction in tumor size, a reduction in the rate of infiltration of cancer cells into peripheral organs, or a reduction in the rate of tumor metastasis or tumor growth). When referring to an "immunologically effective amount," an "anti-tumor effective amount," a "tumor-inhibiting effective amount," or a "therapeutic amount," the precise amount of the composition of the present application to be administered can be determined by a physician with consideration given to, among other factors, the age, weight, tumor size, extent of infection or metastasis, and individual condition of the patient (subject). Generally, the pharmaceutical compositions including the T cells described herein can be administered at a dose of 10 4 to 10 9 cells / kg body weight, preferably 10 5 to 10 6 cells / kg body weight. The T cell compositions can also be administered multiple times at these doses. The cells can be administered by using infusion techniques well known in the art of immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319: 1676, 1988). The optimal dosage and treatment regimen for a particular patient can be readily determined by monitoring the patient's disease signs and adjusting the treatment accordingly, by those skilled in the medical arts.

[0193] Administration of the compositions can be carried out in any convenient manner, including by spray, injection, ingestion, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intraspinally, intramuscularly, by intravenous injection or intraperitoneally. The compositions can be injected directly into a tumor, lymph node or site of infection.

[0194] In some embodiments of the application, the compositions of the application can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy and immunosuppressive agents. For example, treatment can be combined with radiation or chemotherapy agents known in the art to treat CD19 and / or CD22 mediated diseases.

[0195] As used herein, "anti-tumor effect" refers to a biological effect that can be indicated by a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

[0196] "Patient," "subject," "individual," and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

[0197] The application is further described by reference to the following experimental examples. These examples are provided for purposes of illustration only and are not intended to be limiting unless otherwise specified. Thus, the application should in no way be limited to the following examples, but rather should be given the broadest possible interpretation within the limits of the following description. Methods and reagents used in the examples are routine in the art unless otherwise specified.

[0198] Diagnosis, Detection and Kits

[0199] The binding molecules of the application, due to their high affinity for CD19 and / or CD22, can be used in assays, such as binding assays, to detect and / or quantify CD19 and / or CD22 expressed in tissues or cells. The binding molecules, such as single domain antibodies, can be used in research to further study the role of CD19 and / or CD22 in disease. Methods of detecting CD19 and / or CD22 are generally as follows: obtain a sample of cells and / or tissue; detect the level of CD19 and / or CD22 in the sample.

[0200] The CD 19 and / or CD22 binding molecules of the present application can be used for diagnostic purposes to detect, diagnose or monitor diseases and / or conditions associated with CD 19 and / or CD22. The present application provides for the detection of the presence of CD 19 and / or CD22 in a sample using classical immunohistological methods known to those skilled in the art. Detection of CD 19 and / or CD22 can be performed in vivo or in vitro. Examples of methods suitable for detecting the presence of CD 19 and / or CD22 include ELISA, FACS, RIA, and the like.

[0201] For diagnostic applications, the binding molecules, e.g., single domain antibodies, are typically labeled with a detectable label group. Suitable label groups include, but are not limited to, the following: a radioisotope or radionuclide (e.g.,3H,14C,15N,35S,90Y,99Tc,111In,125I,131I), a fluorescent group (e.g., FITC, rhodamine, lanthanide phosphors), an enzymatic group (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), a chemiluminescent group, a biotinyl group, or a predetermined polypeptide epitope recognized by a secondary reporter (e.g., a leucine zipper pair sequence, a binding site for a secondary antibody, a metal binding domain, an epitope tag), an MRI (magnetic resonance imaging) or CT (computerized tomography) contrast agent. Various methods for labeling proteins are known in the art and can be used to practice the present application.

[0202] Another aspect of the present application provides a method of detecting the presence of a test molecule that competes with the binding molecules of the present application for binding to CD 19 and / or CD22. One example of such an assay would involve detecting the amount of free binding molecule in a solution containing a certain amount of CD 19 and / or CD22 in the presence or absence of the test molecule. An increase in the amount of free binding molecule (i.e., binding molecule that is not bound to CD 19 and / or CD22) would indicate that the test molecule is able to compete with the binding molecule for binding to CD 19 and / or CD22. In one embodiment, the antibody is labeled with a label group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence or absence of the binding molecule.

[0203] The present application also provides a test kit for detecting the level of CD 19 and / or CD22, which kit comprises a CD 19 and / or CD22 binding molecule, a lysing medium for solubilizing a sample, and general reagents and buffers required for detection, such as various buffers, detection labels, detection substrates, and the like. The test kit can be an in vitro diagnostic device.

[0204] The application will be illustrated hereinafter in the context of specific examples. It will be understood that these examples are merely illustrative and are not intended to limit the scope of the application. The methods and materials used in the examples are those that are conventional in the art, unless otherwise specified.

[0205] Example

[0206] Example 1, CD19 llama immunization

[0207] 1.1 Preparation of immunogen:

[0208] The antigen used for immunization in this project was purchased from R&D SYSTEMS (Cat: 9269-CD, Lot: DCOY021909A). After identification of purity by SDS-PAGE gel and HPLC, and activity by ELISA, it was aliquoted and stored at -80°C for subsequent immunization. The cells used for immunization were K562-CD19 cell line, purchased from AKD Biotechnology Co., Ltd. (AKD009A)

[0209] 1.2 Llama immunization:

[0210] The first immunogen (K562-CD19) was 1E8 cells, mixed with adjuvant (IFA), and selected for subcutaneous injection at four points on the back of the llama, with an immunization amount of 1 mL per point. The second to third immunizations: the immunogen (K562-CD19) was 1E8 cells, mixed with adjuvant (CFA), and the fourth to fifth immunizations: the antigen (CD19.hFc) was 100 μg, mixed with adjuvant (GERBU FAMA), and selected for subcutaneous injection at four points on the back of the llama, with an immunization amount of 0.5 mL per point. The sixth immunogen was a mixture of (CD19.hFc) 100 μg and (K562-CD19) 5E7 cells, and the interval between each immunization was one week.

[0211] 1.3 Detection of serum titer:

[0212] 1.3.1 Protein level titer detection

[0213] The CD19.His antigen was coated at 4°C overnight, after blocking and washing, the gradient-diluted serum was added to the ELISA plate for incubation, then anti-llama IgG HRP (Abeam) antibody was used for incubation, after washing, TMB color developing liquid was added for color development, 2M HC was used to terminate the reaction, and then the OD450 nanometer absorbance value was detected by the enzyme label instrument. The experimental results are shown in Figure 1, and the titer of the llama reached a high level (>81000) after 7 immunizations.

[0214] 1.3.2 Cell level titer detection

[0215] Raji / Raji CD19 KO cells were plated in a 96-well plate, with a cell amount of 3x10 5Cells / well. Then the cells were incubated with 3-fold gradient diluted serum. After incubation and washing, anti-llama IgG PE (Jackson) antibody was added for incubation, and after washing, the cells were resuspended with PBS, and then the fluorescence intensity (MFI) was detected by flow cytometry (Beckman). The results are shown in Figures 2-3, which show that the MFI value of the alpaca after 8 times of immunization can reach 60000 in the cell level titer detection.

[0216] Example 2, Construction and Screening of CD19 Nanobody Immunization Library Against Antigen

[0217] (1) After 8 times of immunization, 100 mL of camel peripheral blood lymphocytes were extracted and total RNA was extracted. The extraction of RNA was performed according to the instructions of RNAiso reagent of TAKARA company.

[0218] (2) The first strand of cDNA was synthesized by using RNA as a template and oligo dT as a primer according to the instructions of reverse transcriptase of TAKARA company.

[0219] (3) The variable region encoding gene of heavy chain antibody was obtained by nest PCR using PrimeSTAR high-fidelity DNA polymerase. The variable region fragment of heavy chain antibody was amplified by nest PCR:

[0220] First round PCR:

[0221] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC (SEQ ID NO: 235)

[0222] Downstream primer: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 236)

[0223] The fragment between the guide peptide of heavy chain antibody and the antibody CH2 was amplified at 55°C annealing for 30 cycles, and about 600 bp of DNA fragment was recovered as a template for the second round of PCR.

[0224] Second round PCR:

[0225] Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID NO: 237)

[0226] Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT (SEQ ID NO: 238)

[0227] Amplification of the fragment between the heavy chain FR1 region and long, short hinge region (long and short fragments), annealing at 55°C, 30 cycles, recover the target fragment, the results show that the size of the fragment is about 500bp, i.e. nanobody gene electrophoresis band is about 500bp.

[0228] (4) Phagemid pME207 and PCR amplification product were digested with Sfi I and Not I (NEB) respectively, recovered and quantified, then the two fragments were ligated with T4 DNA ligase (TaKaRa) at a 1:3 molar ratio, and ligated at 16°C overnight.

[0229] (5) The ligation product was precipitated with ethanol, dissolved in 100 μL sterile water, and then transformed into E. coli TG1 by electroporation in ten times. 100 μL of the bacteria after electroporation and culture were diluted by a certain ratio, spread on ampicillin LB plates, and the library capacity was calculated. The rest was spread on ampicillin 2xYT plates, and cultured at 37°C for 13-16 h. The bacteria on the plates were scraped and washed with 10 mL of 2xYT medium, and then 25% glycerol was added to a final concentration, and the mixture was aliquoted and stored at -80°C for later use. The library capacity was 4.3x10 9 To detect the insertion rate of the library, 48 clones were randomly selected for colony PCR, and the results showed that the insertion rate had reached more than 90%.

[0230] (6) According to the calculated library capacity, 10 times the library capacity of live cells were inoculated into 200 mL of 2xYT (containing 2% glucose, 100 μg / mL ampicillin), and cultured at 37°C and 200 r / min until the OD600 reached 0.5. Then helper phage was added at a multiplicity of infection of 20:1, and the mixture was incubated at 37°C for 30 min, and then at 37°C and 200 r / min for 30 min. The culture was centrifuged, resuspended in 200 mL of 2xYT (containing 100 μg / mL ampicillin and 50 μg / mL kanamycin), and then cultured at 37°C and 250 r / min overnight. The supernatant was obtained by centrifugation at 8000 rpm, 5x PEG / NaCl solution was added, and the mixture was placed on ice for 60 min, and then centrifuged at 8000 rpm for 30 min. The precipitate was resuspended in 5 mL of PBS to obtain the anti-CD19 single-domain heavy chain antibody (VHH) immunization library. The titer was determined by taking 10 μL, and the rest was aliquoted and stored at -80°C for later use.

[0231] (7) Using CD19 protein with length of 272 amino acids (GenBank: P15391-1, 20-291), the CD19 protein was coated on the enzyme-labeled plate at 2 μg / mL, 100 μL per well, and placed at 4°C overnight, while a negative control was set up. The next day, 200 μL of 3% BSA was added to five wells, and the room temperature was blocked for 2 hours. After 2 hours, PBST (0.05% Tween 20 in PBS) was washed 3 times. After washing the plate, 100 μL of phage (2-3 x 10 11 The phage (2-3 x 10 TM (8) After sequence analysis, a total of 36 clones that could bind CD19-positive Raji cells were obtained, as shown in Table 4.

[0232] (8) After sequence analysis, a total of 36 clones that could bind CD19-positive Raji cells were obtained, as shown in Table 4.

[0233] Table 4: Clones of CD19-positive Raji cells

[0234] Example 3, expression and purification of candidate antibodies

[0235] The nanobodies were constructed into pCDNA3.4-IgG4 (IgG4 was used for subsequent purification and identification) vectors, and then expressed by ExpiCHO TM (Thermo Fisher) expression system, and the supernatant was collected after one week of expression for Protein A (GE) purification. Then the protein mass concentration was detected using Nanodrop, and the protein purity was detected using HPLC. The obtained protein purity and yield met the needs of subsequent experiments.

[0236] The amino acid sequences of the CD19 VHHs are shown in Table 5 (SEQ ID NOs: 134-166).

[0237] Table 5: Sequences of CD19 VHHs

[0238] Example 4, characterization of candidate CD19 antibodies

[0239] (1) Protein level affinity detection: Surface plasmon resonance technology (SPR) was used to determine the binding kinetics and affinity of heavy chain antibodies to human CD19.His antigen. The purified antibodies were flowed through a sensor chip pre-fixed with protein A, and the antibodies were captured by protein A, then 5 different concentrations of CD19.His protein were used as the flow phase, the binding time and dissociation time were 30 min and 60 min respectively. The association rate (kon), dissociation rate (koff) and equilibrium constant (KD) were analyzed using Biacore Evaluation Software 2.0 (GE). The FMC063 clone (BMK1) that binds CD19 was selected as a positive control (Val. 143.712-717, No. 2. July 15. 1989). The results are shown in Table 6.

[0240] Table 6: Protein level affinity detection

[0241] (2) Cell level affinity detection: CHOK1-CD19 / CHOK1 cells expressing CD19 were plated in 96-well plates at 3x10 5 cells, and then the gradient-diluted heavy chain antibodies were incubated with CHOK1-CD19 / CHOK1 cells, after incubation for half an hour, the detection secondary antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008, Lot: 145501) was added for incubation, and then CytoFLEX flow cytometry was used for detection. The EC50 of the antibody was calculated by fitting the curve. The results are shown in Figures 4-5 and Table 7.

[0242] Table 7: Cell level affinity detection

[0243] (3) Tumor cell CD19 binding detection: Raji tumor cells expressing CD19 were plated in 96-well plates at 3x10 5Cells, then gradient dilution of heavy chain antibodies were incubated with tumor cells, after incubation on ice for half an hour, detection of secondary antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008, Lot: 145501) was added for incubation, then CytoFLEX flow cytometer was used for detection. The EC50 of the antibody was calculated by fitting the curve. Isotype is the isotype control (negative control). The results are shown in Figures 6-7 and Table: 8.

[0244] Table 8: Detection of tumor cell CD19 binding

[0245] Example 5, CD19 antibody epitope competition experiment

[0246] Instrument Biacore T200 (GE) was used, detection temperature 25℃, buffer 1x HBS-EP+ (10 mM HEPES, 150 mM NaCl, 3 mM EDTA and 0.05% v / v Surfactant P20, GE), flow rate 30ul / min. CD19-His was dissolved in acetate buffer, pH 4.0 (Biacore Amine Coupling Kit, GE), to a final concentration of 10ug / ml, according to the product instructions of the Amino Coupling Kit, CD19-His was immobilized on CM5 chip (GE) channel 2 (FC-2), about 21RU. Channel 1 (FC-1) was used as a blank control. The candidate antibody and BMK1 antibody were diluted with 1x HBS-EP+ to the target concentration, and one of the above-mentioned CD19-immobilized chip FC-1 and FC-2 was injected with one of the antibodies to the saturation level, and then the other antibody was injected to the saturation to evaluate the competition relationship of the two antibodies. After the injection of the second antibody was completed, the complex was dissociated for 400s. Finally, the chip surface was regenerated by injecting 50mM NaOH for 15s. Data processing was performed using Biacore Evaluation Software 2.0 (GE), and the sensorgram was recorded using double reference subtraction, FC2-1 signal. The results are shown in Table 9, which show that the epitopes of candidate antibodies 170, 456, 483, 501 and BMK1 (FMC063) are not the same.

[0247] Table 9: Epitope competition detection of candidate antibodies and FMC063 antibody

[0248] Note: "N" represents different epitopes, "C" represents the same or cross epitopes.

[0249] Example 6: CD19 antibody tissue cross-reactivity

[0250] Select 34 kinds of tissues to do frozen section, dry at room temperature after using acetone fixation. Use endogenous biotin blocking kit (Shenguo, E674001) reagent A and reagent B for blocking. Incubate the biotin-labeled antibody sample for 30 min, and then add horseradish peroxidase-labeled streptavidin (Abeam, ab7403) after washing for 15 min. Use DAB color development and hematoxylin counterstaining, neutral plastic mounting, natural air drying and then wait for microscopic examination. The positive control is CD19 antibody (Novus) (NBP1-43436), the negative control is biotin-labeled IgG4 isotype control, and BMK2 is the CD19 sequence in Blinatumomab double antibody. The results are shown in Table 10. Positive staining mostly exists in lymphocytes, and occasional positive staining indicates that the antibody has good specificity and no off-target binding activity.

[0251] Table 10: Tissue cross-reaction

[0252] Example 7: Humanized CD19 Nanobody

[0253] Some CD19 nanobodies are selected for humanization, and the CDR region remains unchanged. The sequence after humanization is as follows: NBL508-z53 (i.e., the humanization of NBL508-53 nanobody, the same below), SEQ ID NO: 193; NBL508-z20, SEQ ID NO: 192; NBL508-z24, SEQ ID NO: 226; NBL508-z70, SEQ ID NO: 227; NBL508-z170, SEQ ID NO: 189.

[0254] (1) Species cross ELISA results

[0255] Five humanized nanobodies were fused with human IgG1 Fc (abbreviated as HuIgG1, SEQ ID NO: 228) with His tag. The affinity of the antibodies to human CD19 antigen and cynomolgus CD19 antigen was determined using enzyme-linked immunosorbent assay (ELISA). The CD19 antigen was diluted with coating solution to 2 μg / mL, 100 μL / well was added to a 96-well plate strip, and incubated at 37°C for 2 hours. Washed 3 times. After washing, 200 μL of 3% BSA blocking solution was added to each well, and incubated at 37°C for 2 hours. Washed 3 times. 100 μL / well of humanized CD19 nanobody was added, and the antibody was diluted to an initial concentration of 4 μg / mL, 4-fold dilution in 8 gradients, and incubated at 37°C for 1 hour. Each plate was washed 3 times. 100 μL of enzyme-labeled secondary antibody was added to each well and incubated for 30 min. Washed 3 times. 100 μL of TMB was added to each well, and color developed for 5 min. 100 μL of hydrochloric acid was added to each well to stop the reaction, and the plate was read at 450 nm. The results of the ELISA of CD19 nanobodies with human CD19 antigen are shown in Figure 8, and the results of the ELISA of CD19 nanobodies with cynomolgus CD19 antigen are shown in Figure 9. It can be seen that the five nanobodies bind well to human CD19 antigen; NBL508-z70 and NBL508-z170 bind well to cynomolgus CD19 antigen, and are significantly better than BMK1 and other nanobodies.

[0256] (2) Protein level affinity detection

[0257] The binding kinetics and affinity of NBL508-z70 nanobody to human CD19.His antigen and cynomolgus CD19.His antigen were determined using surface plasmon resonance technology (SPR), and the method was the same as in Example 4. The results are shown in Table 11.

[0258] Table 11: Protein level affinity detection

[0259] Example 8: CD19 CAR-T

[0260] CAR-T preparation:

[0261] Fresh or thawed and recovered PBMCs (AUC) were subjected to electroporation using a Lonza 4D electroporator, and the electroporation process was optimized according to the operating steps of the electroporator. 5 x 10 6 to 7 x 10 6PBMC cells, 6ug pC23S-CD19 plasmid was added to the cell suspension, 20ug PBmRNA (mRNA of PB enzyme, described in SEQ ID: 229) and 200IU Rnase inhibitor were added to the electric transformation system, and electric transformation was performed by FI-115 program. After electric transformation, PBMCs were added to a 12-well plate containing 2ml 37℃ preheated AIM-V (+2% FBS) culture solution and cultured for 4-6h, then transferred to an antigen-coated six-well plate (5ug / ml CD28 antibody + 5ug / ml CD19 antigen), the culture solution was supplemented to 4ml, and IL-2 was added to a final concentration of 500IU / ml. After the electric transformed PBMCs were cultured in the above culture solution for 5 days, the first passage was carried out, and then the passage was carried out every 2-3 days, and the CAR-T cell preparation was completed on the 13th day. The PBMCs during the passage were cultured in AIM-V culture solution containing 2% FBS and 100IU / ml IL-2, and the cell density of the passage was 5x10 5 / ml.

[0262] The above-mentioned pC23S-CD19 plasmid is a plasmid containing the coding sequence of CD19 CAR (containing CD8 signal peptide, CD19 nanobody, CD8 hinge region, CD28 transmembrane region, CD28 co-stimulatory domain, CD3ζ intracellular signal domain from N terminal to C terminal). Taking NBL508-170 nanobody as an example, the amino acid sequence of CD19 CAR is shown in SEQ ID: 230: the remaining nucleotide sequence of pC23S-CD19 plasmid is shown in SEQ ID: 231. FMC063 clone (BMK1) combined with CD19 is used as a control. Six kinds of CD19 nanobody CAR-T and one kind of BMK1 CAR-T were prepared, respectively, NBL508-170, NBL508-456, NBL508-478, NBL508-483, NBL508-501 and NBL508-636. The proliferation results of CAR-T cells are shown in Figure 10, and Figure 10 shows that compared with BMK1, the proliferation of nanobody CAR-T is better.

[0263] CAR-T cell in vitro killing:

[0264] CAR-T cell killing effect on tumor cells was detected by xCELLigence RTCA device (Roche Applied Science, Canada), and the detection process was carried out according to the device operation manual. 5000 target cells (CD19KO_Raji cell) were resuspended in 50ul culture solution and inoculated into the microplate of the RTCA device. The tumor cells were cultured on the RTCA device for about 24h, and when the cell index (CI, indicating cell growth) reached about 1.5, different amounts of effector cells (CD19 CAR-T cells) were resuspended in 50ul culture solution and mixed with tumor cells according to different effector-target ratios (effector cells: target cells), and then cultured on the RTCA device for 3-5 days. The cell killing curve was recorded by the RTCA device, and the data was analyzed by RTCA Pro2.3.0 software. Figure 11 shows that after 96h of CAR-T killing of tumor cells at different effector-target ratios (8:1 and 4:1), different degrees of tumor lysis were caused. Compared with Mock-T and CD19BMK1, the tumor lysis rate of nanobody CAR-T was improved, and the technical effect of NBL508-170 nanobody was optimal.

[0265] Example 9, CD22 Llama immunization

[0266] 1.1 Preparation of immunogen:

[0267] According to the CD22 protein sequence query on NCBI, Human Siglec-2 / CD22 Protein, Llama IgG2b Fc Tag protein (Acro / SI2-H525a) from ACRO company was purchased as an immunization protein, and the protein was identified. The electrophoresis band was correct, and the purity was >90%.

[0268] 1.2 Llama immunization:

[0269] The first immunization antigen (CD22 Protein, Llama IgG2b Fc) was 400ug, mixed with adjuvant (GERBU FAMA), and selected for subcutaneous injection of four points on the back of the llama, with an immunization amount of 1mL per point. The second to tenth immunization: the amount of immunization antigen was 200ug, and the llama was selected for subcutaneous injection of four points on the back, with an immunization amount of 1mL per point. The interval time of each immunization was one week.

[0270] 1.3 Detection of serum titer:

[0271] 1.3.1 Protein level titer detection

[0272] 4°C overnight. After blocking and washing, gradient dilution of serum was added to the ELISA plate for incubation, then anti-llama IgG HRP (Abeam) antibody was used for incubation, after washing, TMB color developing liquid was added for color development, 2M HC1 was used to terminate the reaction, then the OD450nm absorbance value was detected by the enzyme label instrument. The experimental results are shown in Figure 12, after 7 immunizations, the alpaca titer reached a high level (>243000).

[0273] 1.3.2 Cell level titer detection

[0274] Raji cells were plated in a 96-well plate, the cell amount was 3x10 5 cells / well. Then 3-fold gradient dilution of serum was used for incubation with the cells. After incubation and washing, anti-llama IgG PE (Jackson) antibody was added for incubation, after washing, the cells were resuspended with PBS, then the fluorescence intensity (MFI) was detected by flow cytometry (Beckman). The results are shown in Figure 13, which shows that after 7 immunizations, the alpaca reached a cell level titer of 80000.

[0275] Example 10, Construction and screening of nanobody immunization library against CD22 antigen

[0276] Using the same method as in Example 2, nanobodies that bind to CD22 were screened, and after sequence analysis, a total of 14 clones that can bind to CD22 protein were obtained, as shown in Table 12.

[0277] Table 12: Clones that bind to CD22 protein

[0278] Note: “-” means not binding, “+” means binding (OD450<1.0), “++” means moderate binding (2>OD450>1), “+++” means strong binding (OD450>2).

[0279] Example 11, expression and purification of candidate antibodies

[0280] The nanobodies were constructed into pCDNA3.4-IgG4 vectors, then expressed by ExpiCHO TM (Thermo Fisher) expression system, after one week of expression, the supernatant was collected for Protein A (GE) purification. Then the protein mass concentration was detected by Nanodrop, and the protein purity was detected by HPLC. The obtained protein purity and yield meet the needs of subsequent experiments.

[0281] The amino acid sequences of CD22 VHH are shown in Table 13 (SEQ ID NO: 167-188).

[0282] Table 13: Sequences of CD22 VHHs

[0283] Example 12, Characterization of candidate CD22 antibodies

[0284] Protein level affinity assay: The binding kinetics and affinity of heavy chain antibodies to human CD22.His antigen were determined using surface plasmon resonance technology (SPR). Purified antibodies were flowed through a sensor chip pre-immobilized with protein A, and the antibodies were captured by protein A, then 5 different concentrations of CD22.His protein were used as flow phase, the association time and dissociation time were 30 min and 60 min respectively. The association rate (kon), dissociation rate (koff) and equilibrium constant (KD) were analyzed using Biacore Evaluation Software 2.0 (GE). The m971 antibody binding to CD22 protein was selected as a positive control (NBL526-BMK) (Xiaodong Xiao et al., 2009, mAbs, 1:3, 297-303). The results are shown in Table 14.

[0285] Table 14: Protein level affinity assay

[0286] Cell level affinity assay: HEK293T cells expressing CD22 were plated in 96-well plates at 3x10 5 cells, and then gradient-diluted heavy chain antibodies were incubated with HEK293T CD22-III cells, after half an hour of incubation, detection secondary antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008, Lot: 145501) was added for incubation, and then CytoFLEX flow cytometer was used for detection. The EC50 of the antibody was calculated by fitting the curve. The results are shown in Figure 14 and Table 15. The antibody numbers in Figures 14-17 omit “NBL526-”.

[0287] Table 15: Cell level affinity assay

[0288] (3) Tumor cell CD22 binding assay: Two kinds of tumor cells, Raji and Duadi, expressing CD22 were plated in 96-well plates at 3x10 5Cells, then gradient dilution of heavy chain antibodies were incubated with tumor cells, after incubation on ice for half an hour, the detection of secondary antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008, Lot: 145501) was added for incubation, and then CytoFLEX flow cytometer was used for detection. The EC50 of the antibody was calculated by fitting the curve. Isotype is the isotype control (negative control). The results are shown in Figure 15, Figure 16 and Table 16.

[0289] Table 16: Detection of tumor cell CD22 binding

[0290] Example 13, CD22 antibody epitope competition experiment

[0291] The instrument Biacore T200 (GE) was used, the detection temperature was 25℃, the buffer was 1xHBS-EP+ (10mM HEPES, 150mM NaCl, 3mM EDTA and 0.05% v / v Surfactant P20, GE), and the flow rate was 30ul / min. CD22-His was dissolved in acetate buffer, pH 4.0 (Biacore Amine Coupling Kit, GE), to a final concentration of 10ug / ml, and CD22-His was immobilized on the CM5 chip (GE) channel 2 (FC-2) according to the product instructions of the amino coupling kit, about 21RU. Channel 1 (FC-1) was used as a blank control. The candidate and BMK antibodies were diluted to the target concentration with 1xHBS-EP+ respectively, and one of them was injected into the above-mentioned CD22 immobilized chip FC-1 and FC-2 to the saturation level, and then the other was injected to the saturation level to evaluate the competition relationship of the two antibodies. After the injection of the second antibody was completed, the complex was dissociated for 400s. Finally, the chip surface was regenerated by injecting 50mM NaOH for 15s. The data were processed using Biacore Evaluation Software 2.0 (GE), the sensorgram was double reference subtracted, and the FC2-1 signal was recorded. The results are shown in Table 17. The results show that the epitopes of the candidate molecules and BMK are basically not consistent, and there is basically no epitope cross between the selected candidate molecules.

[0292] Table 17: Epitope competition detection of candidate antibodies and m971 antibodies

[0293] Note: "C" means epitope competition, and "N" means epitope non-competition.

[0294] Example 14, CD22 antibody species cross experiment

[0295] Different species (human, cynomolgus monkey) CD22 proteins (ACROBiosystems) were coated on the enzyme-labeled plate, respectively, at a concentration of 1 μg / ml, and placed at 4°C overnight. After blocking and washing, the diluted antibody was added to the enzyme-labeled plate, and incubated at room temperature for 2 hours. After washing, goat anti-human IgG-Fc fragment antibody HRP (Bethyl) secondary antibody was added, and incubated at room temperature for 1 hour. After washing, TMB color developing liquid was added, and then the reaction was terminated with 2M HCl. The OD450 value was read using an enzyme-labeled instrument, and the results are shown in Table 18.

[0296] Table 18: Antibody binding to human, cynomolgus monkey CD22 protein

[0297] Note: "-" indicates no binding, "+" indicates binding (OD450≤1.0), "++" indicates moderate binding (2>OD450>1), and "+++" indicates strong binding (OD450>2).

[0298] Example 15: Tissue cross-reactivity

[0299] Thirty-four tissues were selected for frozen sectioning, and after air-drying at room temperature, they were fixed with acetone. Reagent A and reagent B of the endogenous biotin blocking kit (Shenguo, E674001) were used for blocking. The biotin-labeled antibody sample was incubated for 30 min, and after washing, horseradish peroxidase-labeled streptavidin (Abeam, ab7403) was added and incubated for 15 min. DAB color development and hematoxylin counterstaining were used, and neutral plastic embedding was performed. After natural air-drying, microscopic examination was performed. The positive control was Abeam Anti-CD22 antibody (ab112182), the negative control was biotin-labeled IgG4 isotype control, BMK3 was CD22 in the CD19 / CD22 double-target CAR-T of Autolus (CN114107212A), and BMK4 was NCI m971. The results are shown in Table 19, which show that: NBL526-314, NBL526-278 did not show obvious positive staining on cells. NBL526-291 was only occasionally found to have lymphoid staining positive in the spleen; NBL526-41, NBL526-65, NBL526-184, NBL526-241, NBL526-270, NBL526-275, and NBL526-590 all had good specificity. NBL526-601 had relatively extensive non-specific staining in many tissues. NBL526-BMK, NBL526-998, NBL526-1009, and NBL526-1011 had lymphocyte-like staining positive in the tonsil tissue with many lymphocytes; and lymphocyte-like staining was occasionally found in the spleen. NBL526-998 occasionally had lymphoid staining positive in the lymph node.

[0300] Table 19: CD22 Tissue Cross-Reactivity

[0301] Example 16: CD22 CAR-T

[0302] CAR-T preparation:

[0303] Fresh or frozen PBMCs (Aoneng) were electroporated using a Lonza 4D electroporator. The electroporation process was optimized according to the electroporator manual. 5 × 10 6 to 7×10 6 For PBMC cells, 6 μg of pC23S-CD22 plasmid was added to the cell suspension. 20 μg of PB mRNA (PB enzyme mRNA, the amino acid sequence of which is shown in SEQ ID: 229) and 200 IU of RNase inhibitor were added to the electroporation system and electroporation was performed using the FI-115 protocol. The electroporated PBMCs were added to 12-well plates containing 2 ml of 37°C pre-warmed AIM-V (+2% FBS) culture medium and cultured for 4-6 hours. They were then transferred to antigen-coated six-well plates (5 μg / ml CD28 antibody + 5 μg / ml CD22 antigen). The culture medium was replenished to 4 ml and IL-2 was added to a final concentration of 500 IU / ml. The electroporated PBMCs were cultured in the above culture medium for 5 days before the first passage. Thereafter, passages were performed every 2-3 days. CAR-T cell production was completed on day 13. PBMCs were cultured in AIM-V medium containing 2% FBS and 100 IU / ml IL-2 at a cell density of 5 × 10 5 / ml.

[0304] The pC23S-CD22 plasmid described above is a plasmid containing the coding sequence of CD22 CAR (containing CD8 signal peptide, CD22 nanobody, CD8 hinge region, CD28 transmembrane region, CD28 costimulatory domain, CD3 zeta intracellular signaling domain from N-terminus to C-terminus). Taking NBL526-998 nanobody as an example, the amino acid sequence of the CD22 CAR is shown in SEQ ID: 232: the remaining nucleotide sequence of the pC23S-CD22 plasmid is shown in SEQ ID: 231. NCIm971 was used as a positive control (NBL526-BMK4). Three CD22 nanobody CAR-Ts and one BMK4 CAR-T were prepared, which were NBL526-22, NBL526-998 and NBL526-1011 CAR-Ts, respectively.

[0305] CAR-T cell in vitro killing:

[0306] The killing effect of CAR-T cells on tumor cells was detected by xCELLigence RTCA device (Roche Applied Science, Canada), and the detection process was carried out according to the device operation manual. 5000 target cells (CD22KO_Raji cell) were resuspended in 50ul culture solution and inoculated into the microplate of the RTCA device. The tumor cells were cultured on the RTCA device for about 24h, and when the cell index (CI, indicating cell growth) reached about 1.5, different numbers of effector cells (CD22 CAR-T cells) were resuspended in 50ul culture solution and mixed with tumor cells according to different effector-to-target ratios (effector cells: target cells), and then cultured on the RTCA device for 3-5 days. The cell killing curve was recorded by the RTCA device, and the data was analyzed by RTCA Pro 2.3.0 software. Figure 17 shows that after 96h of CAR-T killing of tumor cells at different effector-to-target ratios (left side of each column in the figure is 16:1, right side is 8:1), different degrees of tumor cell lysis were caused. Compared with Mock-T and CD22 BMK4, NBL526-99 nanobody CAR-T has the best tumor lysis rate.

[0307] Example 17, expression and purification of candidate antibodies

[0308] In the bispecific single domain antibody provided in the embodiments, NBL508-z170 (wherein NBL508-z170 represents that it is a humanized single domain antibody of NBL508-170, the CDR regions are the same, and the FR regions are slightly different; the same below), NBL508-z10, and NBL508-z53 are CD19 VHH; NBL526-z590, NBL526-z998, NBL526-C44, NBL526-C84 and NBL526-z1011 are CD22 VHH, and the sequences are shown in Table 20:

[0309] Table 20: CD19 and CD22 VHH sequences

[0310] The single domain antibody is constructed into a double antibody through a G4S linker. The amino acid sequences of the bispecific antibodies used in the embodiments are shown in Table 21, wherein 170-590 is a bispecific antibody without humanization, z170-590 is a bispecific antibody with humanization, and 170-998 and z170-998 have similar relationships.

[0311] Table 21: Bispecific antibody names and sequences

[0312] The bispecific antibodies in Table 21 are prepared by commissioning to Baiying Biology, expressed by HEK293, purified by Ni column or ProteinA, some of the bispecific antibodies have his tags, and some of the antibodies have IgG4 Fc, and the storage solution is PBS. Then the protein mass concentration is detected by using Nanodrop, and the protein purity is detected by HPLC. The obtained protein purity and yield meet the needs of subsequent experiments.

[0313] Example 18, characterization of bispecific candidate antibodies

[0314] Protein level affinity assay: Surface plasmon resonance technology (SPR) was used to determine the binding kinetics and affinity of heavy chain antibodies to human CD19 and CD22 antigens. The purified antibodies were flowed through a sensor chip pre-immobilized with protein A, and the antibodies were captured by protein A, then 2 different concentrations of CD19 and CD22 proteins were used as the flow phase respectively, and the binding time and dissociation time were 120 s and 1200 s respectively. The association rate (kon), dissociation rate (koff) and equilibrium constant (KD) were analyzed using Biacore Evaluation Software 2.0 (GE). BMK1 (or CD19-BMK1) was used as a positive control for FMC063 clone binding to CD19 (Val. 143.712-717, No. 2. July 15. 1989) and CD22-BMK was used as a positive control for m971 antibody binding to CD22 (Xiaodong Xiao et al., 2009, mAbs, 1:3, 297-303). The results of the bispecific antibody constructed are shown in Table 22.

[0315] Table 22: Bispecific antibody protein level affinity assay

[0316] Cell level affinity assay: Raji WT, Raji CD19 KO, Raji CD22 KO cells were plated in 96-well plates at 3x10 5 cells, and then the gradient-diluted heavy chain antibodies were incubated with the cells respectively. After incubation for half an hour, the detection secondary antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008, Lot: 145501) was added for incubation, and then a CytoFLEX flow cytometer was used for detection. The EC50 of the antibody was calculated by fitting the curve. The results are shown in Figures 18-22 and Table 23.

[0317] Table 23: Bispecific antibody cell level affinity assay

[0318] Example 19, bispecific antibody tissue cross-reactivity

[0319] Thirty-four tissues were selected for frozen section, and after air-drying at room temperature, they were fixed with acetone. Reagent A and reagent B of the endogenous biotin blocking kit (Shenguo, E674001) were used for blocking. The biotin-labeled antibody sample was incubated for 30 min, and after washing, horseradish peroxidase-labeled streptavidin (Abeam, ab7403) was added and incubated for 15 min. DAB color development and hematoxylin counterstaining were used, and neutral plastic mounting was performed. After natural air-drying, microscopic examination was performed. The CD19 positive control was CD19 antibody (Novus) (NBP1-43436), the CD22 positive control was Abeam Anti-CD22 antibody (ab112182), and the negative control was biotin-labeled IgG4 isotype control. The results are shown in Table 24, indicating that most of the antibodies have good specificity on normal tissues, except that there is certain positive staining in some lymphoid follicle tissues, and the reaction of all tested antibodies in the parathyroid gland is reviewed as negative.

[0320] Table 24: Cross-reaction of bispecific antibodies in tissues

[0321] Example 20, bispecific CAR-T

[0322] CAR-T preparation:

[0323] Fresh or cryopreserved PBMCs (Aubio) were subjected to electroporation using a Lonza 4D electroporator, and the electroporation process was optimized according to the operation steps of the electroporator instruction manual. 5x10 6 to 7x10 6PBMC cells, 6ug pC23S-CD19 / CD22 plasmid was added to the cell suspension, 20ug PBmRNA (amino acid sequence of PB enzyme is described in SEQ ID NO: 229) and 200IU Rnase inhibitor were added to the electrotransformation system, and the electrotransformation was performed by FI-115 program. After electrotransformation, the PBMCs were added to a 12-well plate containing 2ml 37℃ preheated AIM-V (+2% FBS) culture solution and cultured for 4-6h, then transferred to an antigen-coated six-well plate (5ug / ml CD28 antibody + 5ug / ml CD19 antigen), the culture solution was supplemented to 4ml, and IL-2 was added to a final concentration of 500IU / ml. After the electrotransformed PBMCs were cultured in the above-mentioned culture solution for 5 days, the first passage was carried out, and then the passage was carried out every 2-3 days, and the CAR-T cell preparation was completed on the 13th day. The PBMCs during the passage were cultured in AIM-V culture solution containing 2% FBS and 100IU / ml IL-2, and the cell density of the passage was 5x10 5 / ml. The above-mentioned pC23S-CD19 / CD22 plasmid is a plasmid containing the coding sequence of CD19 / CD22 double antibody CAR (containing CD19 / CD22 double antibody, CD8 hinge region (SEQ ID NO: 222), CD8 transmembrane region (SEQ ID NO: 223), 4-1BB costimulatory domain (SEQ ID NO: 224), CD3ζ intracellular signal domain (SEQ ID NO: 225) from N-terminal to C-terminal). The amino acid sequence of 170-998CAR is shown in SEQ ID NO: 233, and the amino acid sequence of 170-590CAR is shown in SEQ ID NO: 234. During the preparation of CAR-T, the CAR is also connected with CD8 signal peptide (SEQ ID NO: 221). The nucleotide sequence of the remaining backbone of pC23S-CD19 / CD22 plasmid is shown in SEQ ID NO: 231.

[0324] The FMC063 clone (CD19-BMK1) binding CD19 was selected to prepare CAR-T as a positive control (Val. 143.712-717, No. 2. July 15. 1989), and the m971 antibody binding CD22 protein was prepared as a positive control (CD22-BMK) (Xiaodong Xiao et al., 2009, mAbs, 1:3, 297-303), and two double antibody CAR-Ts were prepared, which were 170-998CAR-T and 170-590CAR-T, respectively. The CAR+ positive rate was detected, and the results are shown in Table 25.

[0325] Table 25: CAR+ positive rate of double antibody CAR-T

[0326] CAR-T cell killing in vitro:

[0327] CAR-T cell killing of tumor cells was detected using xCELLigence RTCA instrument (Roche Applied Science, Canada) according to the instrument operation manual. 5000 target cells were resuspended in 50ul culture solution and inoculated into the micro-well plate of the RTCA instrument. The tumor cells were cultured on the RTCA instrument for about 24h, and when the cell index (CI, indicating cell growth) reached about 1.5, different amounts of effector cells (CAR-T cells) were resuspended in 50ul culture solution and mixed with tumor cells, and then cultured on the RTCA instrument for 3-5 days.

[0328] Figure 23 shows tumor cell lysis caused by wt Raji cells after CAR-T killing of tumor cells for 96h at different effector-to-target ratios (16:1 and 4:1), and Figure 24 shows tumor cell lysis caused by CD19 KO_Raji and CD22 KO_Raji cells after CAR-T killing of tumor cells at different effector-to-target ratios (16:1 and 4:1), both of which show that 170-998 CAR-T has the best killing.

[0329] CAR-T cell co-culture with tumor cells:

[0330] Mock-T, CD19-BMK1 CAR-T, 170-998 CAR-T were co-cultured with blank control (Unsti, no stimulation group), wt Raji cells, CD19 KO_Raji and CD22 KO_Raji, single round 7 days, from 3 rounds of culture, to detect CAR+ positive cell proliferation. The results are shown in Figure 25. When co-cultured with CD19xCD22 double positive (WTRaji) or single positive (CD19KO or CD22KO) cells, 170-998 CAR-T showed good proliferation.

[0331] CAR-T cell killing of tumor cells in vivo:

[0332] WTRaji tumor cells (0.5*10 6 ) were resuspended in 100ul PBS, mixed evenly with 100ul Matrigel (BD), and then subcutaneously injected into the back of NPSG severely immunodeficient mice. When the tumor volume reached 100-150mm 3The injection of 170-998 CAR-T cells was started. The CAR-T cells were set at four different injection doses, i.e. 0.33x10 6 , 1x10 6 , 3.3x10 6 and 10x10 6 , and were resuspended in 200ul PBS and intravenously infused into the mice. The mice were observed once a week for 4 weeks, and the tumor growth of the mice was detected by fluorescence. The results are shown in Figure 26. From the 7th day, the bispecific 170-998 CAR-T showed good efficacy at the medium (3.3x10 6 ) and high (10x10 6 ) doses.

[0333] Example 21, humanization of bispecific antibodies

[0334] According to the experimental results of the CAR-T, the bispecific antibodies 170-998 and 170-590 showed good effects. The sequences of the bispecific antibodies 170-998 and 170-590 were humanized to obtain z170-998 (the sequence is shown in SEQ ID NO: 206) and z170-590 (the sequence is shown in SEQ ID NO: 204).

[0335] Taking z170-998 as an example, the binding activity of CD19-BMK1 and CD22-BMK to Raji WT, Raji CD19 KO and Raji CD22 KO cells was detected, and the results are shown in Figures 27-29. The binding activity was good.

[0336] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A CD19 binding molecule, characterized in that Comprising an anti-CD19 nanobody or an antigen-binding fragment thereof, the complementarity determining region CDR of the anti-CD19 nanobody comprises CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in any one of SEQ ID NOs: 1-25, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 26-49, and CDR3 comprises the sequence shown in any one of SEQ ID NOs: 50-75; Preferably, the CDR1, CDR2 and CDR3 contained in the anti-CD19 Nanobody are the group of CDR1, CDR2 and CDR3 shown in any row of SEQ ID NO in Table 1.

2. The CD19 binding molecule according to claim 1, wherein The heavy chain variable region sequence of the anti-CD19 nanobody is as shown in any one of SEQ ID NOs: 134-166, 189-194, 226-227, and / or The CD19 binding molecule comprises one, two or more anti-CD19 nanobodies or antigen-binding fragments thereof, and the CD19 binding molecule is a monovalent, multivalent or multispecific nanobody or single domain antibody.

3. A CD22 binding molecule, characterized in that Comprising an anti-CD22 nanobody or an antigen-binding fragment thereof, the complementarity determining region CDR of the anti-CD22 nanobody comprises CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in any one of SEQ ID NOs: 76-95, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 96-112, and CDR3 comprises the sequence shown in any one of SEQ ID NOs: 113-133; Preferably, the CDR1, CDR2 and CDR3 contained in the anti-CD22 nanobody are the group of CDR1, CDR2 and CDR3 shown in SEQ ID NO in any row of Table 2.

4. The CD22 binding molecule according to claim 3, wherein The heavy chain variable region sequence of the anti-CD22 nanobody is as shown in any one of SEQ ID NOs: 167-188, 195-202, and / or The CD22 binding molecule comprises one, two or more anti-CD22 nanobodies or antigen-binding fragments thereof, and the CD22 binding molecule is a monovalent, multivalent or multispecific nanobody or single domain antibody.

5. A bispecific antigen-binding molecule, characterized in that Comprising a bispecific antibody or an antigen-binding fragment thereof, the bispecific antibody comprises: a first functional region targeting CD19, and a second functional region targeting CD22, wherein the first functional region is an anti-CD19 heavy chain antibody or an antigen-binding fragment thereof, and the second functional region is an anti-CD22 heavy chain antibody or an antigen-binding fragment thereof; The complementarity determining regions of the anti-CD19 heavy chain antibody comprise: a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as shown in SEQ ID NOs: 1, 26, and 50, respectively, or a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as shown in SEQ ID NOs: 10, 34, and 62, respectively, or a CDR1 sequence, a CDR2 sequence, and a CDR3 sequence as shown in SEQ ID NOs: 22, 46, and 71, respectively; Furthermore, the complementarity determining regions of the anti-CD22 heavy chain antibody comprise: CDR1 sequences, CDR2 sequences, and CDR3 sequences as shown in SEQ ID NOs: 85, 96, and 122, respectively, or CDR1 sequences, CDR2 sequences, and CDR3 sequences as shown in SEQ ID NOs: 87, 102, and 124, respectively, or CDR1 sequences, CDR2 sequences, and CDR3 sequences as shown in SEQ ID NOs: 88, 104, and 126, respectively, or CDR1 sequences, CDR2 sequences, and CDR3 sequences as shown in SEQ ID NOs: 91, 107, and 128, respectively, or CDR1 sequences, CDR2 sequences, and CDR3 sequences as shown in SEQ ID NOs: 92, 109, and 130, respectively.

6. The bispecific antigen-binding molecule according to claim 5, wherein The complementary determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence shown in SEQ ID NOs: 1, 26, and 50, respectively; the complementary determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence shown in SEQ ID NOs: 85, 96, and 122, respectively. or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 1, 26, and 50, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 87, 102, and 124, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 87, 102, and 124, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 87, 102, and 124, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 85, 96, and 122, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 85, 96, and 122, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 88, 104, and 126, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 88, 104, and 126, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 91, 107, and 128, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 10, 34, and 62, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 92, 109, and 130, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 91, 107, and 128, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 22, 46, and 71, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 92, 109, and 130, respectively, or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 1, 26, and 50, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence, and CDR3 sequence as shown in SEQ ID NOs: 91, 107, and 128, respectively, Or the complementarity determining regions of the anti-CD19 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence and CDR3 sequence as shown in SEQ ID NOs: 1, 26 and 50, respectively, and the complementarity determining regions of the anti-CD22 heavy chain antibody comprise the CDR1 sequence, CDR2 sequence and CDR3 sequence as shown in SEQ ID NOs: 92, 109 and 130, respectively.

7. The bispecific antigen-binding molecule according to claim 5 or 6, wherein: The anti-CD19 heavy chain antibody has the sequence shown in any one of SEQ ID NOs: 134, 147, 161, 189-191, 193-194, or 226-227, and / or the anti-CD22 heavy chain antibody has the sequence shown in any one of SEQ ID NOs: 176, 178, 180, 183, 185, 195-199, or 201; Preferably, the bispecific antibody comprises a sequence shown in any one of SEQ ID NOs: 203-218.

8. A fusion protein, characterized in that Comprising an antigen-binding molecule and other polypeptides, the antigen-binding molecule is the CD19-binding molecule of claim 1 or 2, or the CD22-binding molecule of claim 3 or 4, or the bispecific binding molecule of any one of claims 5 to 7, Preferably, the other polypeptide is located at the N-terminus and / or C-terminus of the antigen binding molecule, Preferably, the other polypeptide is selected from polypeptides that localize the binding molecule to different organelles, tags for purification or tags for immune response, transmembrane proteins or transmembrane regions thereof, chimeric antigen receptors or components thereof, More preferably, the fusion protein is a chimeric antigen receptor.

9. A nucleic acid molecule having a sequence selected from any one of the following: (1) the coding sequence of the CD19 binding molecule of claim 1 or 2, the CD22 binding molecule of claim 3 or 4, the bispecific binding molecule of any one of claims 5 to 7, or the fusion protein of claim 8; (2) The complementary sequence of (1).

10. A nucleic acid construct comprising the nucleic acid molecule according to claim 9, Preferably, the nucleic acid construct is a cloning vector, an expression vector or an integration vector.

11. A cell, characterized in that: (1) expressing the CD19 binding molecule of claim 1 or 2, the CD22 binding molecule of claim 3 or 4, the bispecific binding molecule of any one of claims 5 to 7, or the fusion protein of claim 8; (2) comprising the nucleic acid molecule according to claim 9; and / or (3) comprising the nucleic acid construct according to claim 10, Preferably, the cell is an immune effector cell, more preferably a T cell, a TIL cell or a NK cell.

12. A method for producing an antigen-binding molecule or a fusion protein, characterized in that: include: Culturing the cell of claim 11 under conditions suitable for producing the CD19 binding molecule of claim 1 or 2, the CD22 binding molecule of claim 3 or 4, or the bispecific binding molecule of any one of claims 5 to 7, or the fusion protein of claim 8, and optionally purifying the antigen binding molecule from the culture, or The nucleic acid molecule encoding the antigen-binding molecule or the fusion protein is incubated under conditions suitable for translation of DNA or RNA in a cell-free system (eg, solution).

13. A pharmaceutical composition comprising the CD19 binding molecule of claim 1 or 2, the CD22 binding molecule of claim 3 or 4, the bispecific binding molecule of any one of claims 5-7, the fusion protein of claim 8, the nucleic acid molecule of claim 9, the nucleic acid construct of claim 10, or the cell of claim 11, and a pharmaceutically acceptable excipient.

14. Use of the CD19 binding molecule of claim 1 or 2, the CD22 binding molecule of claim 3 or 4, the bispecific binding molecule of any one of claims 5 to 7, the fusion protein of claim 8, the nucleic acid molecule of claim 9, the nucleic acid construct of claim 10, or the cell of claim 11 in preparing an engineered immune cell, Preferably, the immune cells are T cells, TIL cells or NK cells.

15. Use of the CD19 binding molecule of claim 1 or 2, the CD22 binding molecule of claim 3 or 4, the bispecific binding molecule of any one of claims 5 to 7, the fusion protein of claim 8, the nucleic acid molecule of claim 9, the nucleic acid construct of claim 10, or the cell of claim 11 in the preparation of a medicament for preventing or treating a disease or condition associated with CD19 and / or CD22 expression, Preferably, the disease or condition is cancer.

16. A kit for detecting CD19 and / or CD22, characterized in that: The kit comprises the CD19 binding molecule of claim 1 or 2, or the CD22 binding molecule of claim 3 or 4, or the bispecific binding molecule of any one of claims 5 to 7, the fusion protein of claim 8, the nucleic acid molecule of claim 9, the nucleic acid construct of claim 10, or the cell of claim 11.

Images