Design of selectively translated mrnas in eukaryotes

Abstract

Methods of designing a synthetic RNA molecule that expresses a protein of interest in a cancerous cell and not in a noncancerous cell are provided. Synthetic RNA molecules and their use and computer program products for perform a method of the invention are also provided.

Description

DESIGN OF SELECTIVELY TRANSLATED MRNAS IN EUKARYOTESCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 575,749 filed on April 7, 2024, the contents of which are all incorporated herein by reference in their entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (RMT-P-034-PCT.xml; Size: 752,083 bytes; and Date of Creation: April 2, 2025) is herein incorporated by reference in its entirety.FIELD OF INVENTION

[0003] The present invention is in the field of mRNA translational regulation in eukaryotes.BACKGROUND OF THE INVENTION

[0004] The use of RNA as a therapeutic tool is a new frontier in the broad view of disease treatment and prevention. RNA-based therapies hold the potential to revolutionize fields such as vaccines, personalized medicine and cancer therapy. Since RNA is easy to manufacture, safe, modular, cost effective and holds the ability to target previously untreatable pathologies, RNA-based treatments could serve as the future standard in medicine.

[0005] One of the big challenges faced by such treatments is a lack of specificity. Current delivery methods are general, where the RNA molecules are delivered with nonspecific vehicles and arrive not only to the target cells but many more. In that case, the protein of interest is expressed in unwanted cells, which can result in high toxicity.

[0006] In recent years, various strategies were developed for control over mRNA translation, most are based on designing a switch module for sensing and responding to a specific endogenous RNA trigger that appears mainly in the target cell (e.g., the cancer cell). Among others, a toehold switch is based on the interplay between the self-folding of the mRNA and its hybridization with the trigger RNA. However, one of the main limitations for thesetoehold switches has been their dynamic range. Work done in prokaryotes showed that rational design of the RNA sequence can yield switches with over 400-fold mean dynamic range. Minimal work has been done with toeholds in eukaryotes and the dynamic range remains the limiting factor, as a maximum of 2 -fold dynamic range was achieved with toeholds that are based on miRNA as their triggers. A new method, and computational model, for toehold switch design that increases the dynamic range in eukaryotes, making them applicable in RNA therapeutics is therefore greatly needed.SUMMARY OF THE INVENTION

[0007] The present invention provides methods of designing a synthetic RNA molecule. Synthetic RNA molecules and their use are also provided. Computer program products for performing a method of the invention are also provided.

[0008] According to a first aspect, there is provided a method of designing a synthetic RNA molecule, the method comprising: a. obtaining a coding sequence encoding a protein of interest; b. obtaining a first RNA sequence expressed in a cancerous cell and not expressed or lowly expressed in a noncancerous cell; c. obtaining a second RNA sequence expressed in the cancerous cell and not expressed or lowly expression in the noncancerous cell; and d. producing a sequence of a synthetic RNA molecule comprising from 5’ to 3’: i. a reverse complement to the first sequence comprising a first 5’ unhybridized region and a first 3’ hybridized region; ii. a first loop region that does not hybridize to any of (i), (ii) and (iii); iii. a region reverse complementary to the first 3 ’ hybridized region of (i);iv. a reverse complement to the second sequence comprising a second 5’ unhybridized region and a second 3’ hybridized region; v. a second loop region that does not hybridize to any of (iv), (v) and (vi); vi. a region reverse complementary to the second 3’ hybridized region of (iv); and vii. the obtained coding sequence encoding a protein of interest; thereby designing a synthetic RNA molecule.

[0009] According to some embodiments, the synthetic RNA molecule produces the protein of interest in the cancerous cell and does not produce or lowly produces the protein of interest in the noncancerous cell.

[0010] According to some embodiments, the first RNA sequence expressed in a cancerous cell, the second RNA sequence expressed in a cancerous cell or both is not a microRNA (miRNA).[Oi l] According to some embodiments, the first RNA sequence expressed in a cancerous cell, the second RNA sequence expressed in a cancerous cell or both is a sequence from a messenger RNA (mRNA).

[0012] According to some embodiments, the first sequence, the second sequence or both comprise an oncogenic mutation.

[0013] According to some embodiments, the oncogenic mutation is highly expressed in the cancerous cell and is a somatic mutation.

[0014] According to some embodiments, the oncogenic mutation in the first sequence is reverse complementary to a base in the first 5’ unhybridized region, the oncogenic mutation in the second sequence is reverse complementary to a base in the second 5’ unhybridized region or both.

[0015] According to some embodiments, the first RNA sequence and the second RNA sequence are from different mRNAs.

[0016] According to some embodiments, the first sequence, the second sequence or both is in an unfolded region of the RNA.

[0017] According to some embodiments, an unfolded region is a region with a local folding energy above a predetermined threshold.

[0018] According to some embodiments, the folding is determined for the first sequence, the second sequence or both.

[0019] According to some embodiments, selecting an unfolded region comprises performing a window search algorithm that produces a folding matrix indicating the probability of each nucleotide of the sequence of an RNA hybridizing to another nucleotide of the sequence of an RNA and selecting a window predicted to not hybridize.

[0020] According to some embodiments, selecting a region comprises evaluating the local folding energy of windows adjacent to the region and / or the folding of the region to windows adjacent to the region.

[0021] According to some embodiments, the first sequence, the second sequence or both is between 20 and 100 nucleotides, optionally wherein the first sequence, the second sequence or both is between 20-30 nucleotides.

[0022] According to some embodiments, the window is an outer window and wherein each outer window is subdivided into inner windows consisting of a portion that is less than 100% of the outer window and wherein the producing a folding matrix is producing a folding matrix for each inner window.

[0023] According to some embodiments, the selecting an unfolded region further comprises summing the folding energies for each inner window across all outer windows to produce an inner window folding value, summing the inner window folding values of all inner windows in each outer window to produce an outer window folding value and selecting an outer window with a folding value beyond a predetermined threshold.

[0024] According to some embodiments, the sequence of a synthetic RNA comprises a spacer between region (iii) and region (iv) such that regions i-iii form a first stem-loop structure and regions iv-vi form a second stem-loop structure and the structures are separated by a linear stretch of sequence that is the spacer, optionally wherein the spacer comprises at least 10 linear nucleotides.

[0025] According to some embodiments, the method further comprises confirming formation of a stem-loop structure comprising the first 3’ hybridized region, the first loop region and the first region reverse complementary to the 3’ hybridized region and a stem-loop structure comprising the second 3’ hybridized region, the second loop region and the second region reverse complementary to the 3’ hybridized region.

[0026] According to some embodiments, the confirming comprises performing a sliding window RNA folding prediction algorithm across the full sequence of the synthetic RNA and selecting the most probable secondary structure.

[0027] According to some embodiments, the method further comprises optimizing stem size, loop size, folding energy in the absence of the first and / or the second RNA, folding energy in the presence of the first and / or the second RNA, hybridization energy of the first sequence to the reverse complement to the first sequence, hybridization energy of the second sequence to the reverse complement to the second sequence or a combination thereof by performing a sliding window RNA folding prediction algorithm across the full sequence of the synthetic RNA and selecting an optimized secondary structure.

[0028] According to some embodiments, a start codon of the coding sequence is located within 20 nucleotides of region vi.

[0029] According to some embodiments, synthetic RNA sequence between a start codon of the coding sequence and the obtained coding sequence is codon optimized to match a codon usage of the coding sequence encoding a protein of interest.

[0030] According to some embodiments, the codon optimization comprises codon usage bias (CUB) optimization or typical decoding rate (TDR) optimization.

[0031] According to some embodiments, a start codon of the coding sequence encoding a protein of interest is separated from the rest of the coding sequence by a linker.

[0032] According to some embodiments, the start codon is in the loop of region v and the linker is within the region vi reverse complementary to the second 3’ hybridized region.

[0033] According to some embodiments, the method comprises optimizing the linker to be as short as possible while expression of the protein of interest is still inhibited in the absence of the first and second RNAs.

[0034] According to some embodiments, the synthetic RNA comprises an unhybridized region between a first and second part of the first 3’ hybridized region, a first and second part of the second 3’ hybridized region, a first and second part of the first region reverse complementary to the 3’ hybridized region, a first and second part of the second region reverse complementary to the 3’ hybridized region or a combination thereof.

[0035] According to some embodiments, the start codon is located in the unhybridized region between a first and second part of the second region reverse complementary to the 3 ’ hybridized region.

[0036] According to some embodiments, the linker comprises the second part of the second region reverse complementary to the second 3’ hybridized region which is 3’ to the start codon.

[0037] According to some embodiments, the method further comprises confirming the synthetic RNA molecule produces the protein of interest in the cancerous cell and does not produce or lowly produces the protein of interest in the non-cancerous cell.

[0038] According to some embodiments, the method comprises applying a trained regressor algorithm to predict protein of interest production.

[0039] According to some embodiments, the protein of interest is a toxin or tumor suppressor.

[0040] According to some embodiments, the protein of interest is a Klotho protein comprising or consisting of SEQ ID NO: 577 or a fragment thereof comprising SEQ ID NO: 578 or SEQ ID NO: 579.

[0041] According to some embodiments, the first RNA sequence, the second RNA sequence or both comprise or consist of a sequence selected from SEQ ID NO: 1-288 and 580 and the regions i-iii, the regions iv-vi or both comprise or consist of a sequence that can hybridize the first RNA sequence, the second RNA sequence or both selected from SEQ ID NO: 289- 576 and 581.

[0042] According to some embodiments, the loop region is not a bulge region.

[0043] According to some embodiments, the noncancerous cell is of the same cell type or tissue as the cancerous cell.

[0044] According to another aspect, there is provided a computer program product comprising a non-transitory computer-readable storage medium having program code embodied thereon, the program code executable by at least one hardware processor to perform a method of the invention.

[0045] According to another aspect, there is provided a synthetic RNA molecule produced by a method of the invention.

[0046] According to another aspect, there is provided a synthetic RNA comprising a 5’ cap and a coding sequence encoding a protein of interest, wherein a toehold sequence selected from SEQ ID NO: 289-576 and 581 is present 5’ to start codon of the coding sequence.

[0047] According to some embodiments, the start codon is not more than 20 bases 3’ to the toehold sequence.

[0048] According to another aspect, there is provided a method of producing expression of a sequence of interest in a cancerous cell and not in a noncancerous cell of the same cell type or tissue as the cancerous cell, the method comprising introducing the synthetic RNA molecule of the invention into the cancerous cell and the noncancerous cell, thereby producing expression of a sequence of interest in a cancerous cell and not in a noncancerous cell.

[0049] According to some embodiments, the method is a method of treating cancer in a subject in need thereof, wherein the introducing comprises administering the synthetic RNA molecule or a DNA molecule that encodes the synthetic RNA molecule to the subject.

[0050] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figures 1A-1B: Schematics of two toehold switchs. During OFF state the unstranslated regions fold into two hairpin structures and translation is repressed. In the presence of two mutated mRNA molecules that serve as triggers, the ON state occurs when each trigger binds near the beginning of the hairpins and allows for hybridization and the opening of the structure. The ribosome then can bind the mRNA and initiate translation of the protein of sequence of interest in the cancerous cell. The two triggers can be either (1A) two different RNAs or (IB) the same RNA.

[0052] Figure 2: Schematic of the toehold switch in the presence of only 1 trigger mRNA. The toehold switch relies on the presence of both triggers to transition to the ON state. If only one trigger is present, the system will remain in the OFF state.

[0053] Figure 3: Block diagram of one embodiment of the optimal trigger selection method of the invention.

[0054] Figure 4: Block diagram of one embodiment of the toehold design method of the invention.DETAILED DESCRIPTION OF THE INVENTION

[0055] The present invention, in some embodiments, provides methods of designing synthetic RNA molecules that express a protein of interest in a cancerous cell and don’t express or lowly express the protein of interest in a noncancerous cell. The present invention further concerns synthetic RNA molecules produced by a method of the invention and other synthetic RNA molecules comprising toehold sequences of the invention. The methods of using these synthetic RNA molecules for expressing a protein of interest in a cancerous cell or treating cancer are also provided. Computer program products for performing a method of the invention are also provided.

[0056] By a first aspect, there is provided a method of designing an RNA molecule, the method comprising: a. obtaining a coding sequence; b. obtaining a first RNA sequence expressed in a cancerous cell and lowly expressed in a noncancerous cell; c. obtaining a second RNA sequence expressed in the cancerous cell and lowly expressed in the noncancerous cell; and d. producing a sequence of an RNA molecule comprising: i. a reverse complement to the obtained first sequence comprising a first 5’ unhybridized region and a first 3’ hybridized region; ii. a region reverse complementary to the first 3’ hybridized region of (i); iii. a reverse complement to the obtained second sequence comprising a second 5’ unhybridized region and a second 3’ hybridized region;iv. a region reverse complementary to the second 3’ hybridized region of (iii); and v. the obtained coding sequence; thereby designing a synthetic RNA molecule.

[0057] By another aspect, there is provided a method designing an RNA molecule, the method comprising: a. obtaining a coding sequence; b. obtaining a first RNA sequence expressed in a cancerous cell and lowly expressed in a noncancerous cell; c. obtaining a second RNA sequence expressed in the cancerous cell and lowly expressed in the noncancerous cell; and d. producing a sequence of an RNA molecule comprising: i. a reverse complement to the obtained first sequence comprising a first 3’ unhybridized region and a first 5’ hybridized region; ii. a region reverse complementary to the first 5’ hybridized region of (i); iii. a reverse complement to the obtained second sequence comprising a second 3’ unhybridized region and a second 5’ hybridized region; iv. a region reverse complementary to the second 5’ hybridized region of (iii); and v. the obtained coding sequence; thereby designing a synthetic RNA molecule.

[0058] In some embodiments, the method is an in vitro method. In some embodiments, the method is an in silico method. In some embodiments, the method is an ex vivo method. In some embodiments, the method is a computerized method. In some embodiments, the method cannot be performed in a human mind. In some embodiments, the method is a method of producing a synthetic RNA molecule. In some embodiments, the method further comprises producing the synthetic RNA molecule from the designed sequence. In someembodiments, producing the molecule is synthesizing the molecule. In some embodiments, the designed sequence is the produced sequence. Methods of nucleic acid molecule synthesis are well known in the art and are available commercially. Any such method may be used to synthesize the synthetic RNA of the invention. In some embodiments, the method further comprises producing a DNA molecule that encodes the designed synthetic RNA molecule.

[0059] In some embodiments, the RNA molecule is a synthetic RNA molecule. In some embodiments, the RNA molecule is an engineered RNA molecule. In some embodiments, the RNA molecule is a chimeric RNA molecule. In some embodiments, the RNA molecule comprises a 5’ cap. In some embodiments, a 5’ cap is a m7GpppN cap. In some embodiments, the RNA molecule comprises a 3’ UTR. In some embodiments, the RNA molecule comprises a polyA tail. In some embodiments, the RNA molecule is a toehold molecule. In some embodiments, the toehold molecule is a dual toehold molecule. In some embodiments, the RNA molecule comprises a toehold. In some embodiments, the RNA molecule comprises at least two toeholds. In some embodiments, at least two is two. In some embodiments, at least two is 2, 3, 4, 5, 6, 7, 8, 9 or 10 toeholds. Each possibility represents a separate embodiment of the invention. In some embodiments, the RNA molecule is translated in the cancerous cell. In some embodiments, a cancerous cell is a cancer. In some embodiments, the RNA molecule produces protein in the cancerous cell. In some embodiments, translated is highly translated. In some embodiments, producing protein is highly producing protein. In some embodiments, highly is above a predetermined threshold. In some embodiments, the RNA molecule is lowly translated in the noncancerous cell. In some embodiment, lowly translated is untranslated. In some embodiments, the RNA molecule lowly produces protein in the noncancerous cell. In some embodiments, lowly produces is does not produce. In some embodiments, lowly is below a predetermined threshold.

[0060] It will be understood that the cell is a eukaryotic cell as cancer does not exist in prokaryotes. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, a cancerous cell is a cancer cell. In some embodiments, the cancerous cell is a cancer. In some embodiments, the RNA is highly expressed in a particular cancer. As used herein "cancer" is a disease associated with overactive cell proliferation. Non-limiting types of cancer include carcinoma, sarcoma, lymphoma, leukemia, blastoma and germ cells tumors. In some embodiments, the cancer is selected from hepato-biliary cancer, biliary tract cancer, cervical cancer, urogenital cancer (e.g., urothelial cancer), testicular cancer, prostate cancer, thyroid cancer, ovarian cancer,nervous system cancer, ocular cancer, lung cancer, soft tissue cancer, bone cancer, pancreatic cancer, bladder cancer, skin cancer, intestinal cancer, hepatic cancer, rectal cancer, colorectal cancer, colon cancer, esophageal cancer, gastric cancer, gastroesophageal cancer, breast cancer (e.g., triple negative breast cancer), renal cancer (e.g., renal carcinoma), skin cancer, head and neck cancer, leukemia and lymphoma. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a tumor. In some embodiments, the cancer is a hematopoietic cancer. In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is selected from breast cancer, colon cancer, urinary cancer, cervical cancer, gastric cancer and biliary tract cancer.

[0061] In some embodiments, a noncancerous cell is a healthy cell. In some embodiments, a noncancerous cell is a control cell. In some embodiments, the noncancerous cell is of the same tissue as the cancerous cell. In some embodiments, the noncancerous cell is of the same cell type as the cancerous cell. In some embodiments, the cancerous cell and the noncancerous cell originate from the same tissue or cell type.

[0062] In some embodiments, highly is above a predetermined threshold. In some embodiments, highly is higher than in the noncancerous cell. In some embodiments, highly is detectably. In some embodiments, lowly is below a predetermined threshold. In some embodiments, lowly is lower than in the noncancerous cell. In some embodiments, lowly is undetectably. In some embodiments, highly is to produce a functional amount. In some embodiments, lowly is to produce an amount of protein that is not functional.

[0063] In some embodiments, the protein is at least 5, 10, 20, 30, 40,50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900 or 1000 times more greatly produced in the first tissue or cell type than the second tissue or cell type. Each possibility represents a separate embodiment of the invention. In some embodiments, the protein is at least 10 times more greatly produced in the first tissue or cell type than the second tissue or cell type. In some embodiments, the dynamic range of expression of the protein between the two tissues is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900 or 1000. Each possibility represents a separate embodiment of the invention. In some embodiments, the dynamic range of expression of the protein between the two tissues is greater than 2. In some embodiments, the dynamic range of expression of the protein between the two tissues is greater than 10.

[0064] In some embodiments, the RNA is at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900 or 1000 times more greatly produced in the first tissue or cell type than the second tissue or cell type. Each possibility represents a separate embodiment of the invention. In some embodiments, the RNA is at least 10 times more greatly produced in the first tissue or cell type than the second tissue or cell type. In some embodiments, the dynamic range of expression of the RNA between the two tissues is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900 or 1000. Each possibility represents a separate embodiment of the invention. In some embodiments, the dynamic range of expression of the RNA between the two tissues is greater than 2. In some embodiments, the dynamic range of expression of the RNA between the two tissues is greater than 10.

[0065] Examples of genes overexpressed in different human cancers are provided in Appendix 1 of US provisional patent US63 / 575,749, the contents of which are hereby incorporated by reference in its entirety. In some embodiments, the protein is selected from a protein provided in Appendix 1 of US63 / 575,749. In some embodiments, the RNA is an RNA selected from an RNA provided in Appendix 1 of US63 / 575,749. In some embodiments, an RNA is an mRNA. In some embodiments, the RNA is a transcript of a gene selected from a gene provided in Appendix 1 of US63 / 575,749. In some embodiments, the gene is selected for a specific cancer. In some embodiments, a specific cancer is a cancer from a specific tissue. In some embodiments, the protein / RNA / gene is specific to a specific tissue and is selected from the genes / RNA / proteins overexpressed in various tissues provided in Appendix 1 of US63 / 575,749. In some embodiments, the first and second RNAs are overexpressed in the same tissue. In some embodiments, the first and second RNAs are both from a list in Appendix 1 of US63 / 575,749 for a specific tissue.

[0066] Examples of genes overexpressed in different human cancers are provided in Appendix 4 of US63 / 575,749 the contents of which are hereby incorporated by reference in its entirety. In some embodiments, the protein is selected from a protein provided in Appendix 4 of US63 / 575,749. In some embodiments, the RNA is an RNA selected from an RNA provided in Appendix 4. In some embodiments, an RNA is an mRNA. In some embodiments, the RNA is a transcript of a gene selected from a gene provided in Appendix 4 of US63 / 575,749. In some embodiments, the gene is selected for a specific cancer. In some embodiments, a specific cancer is a cancer from a specific tissue. In some embodiments, the protein / RNA / gene is specific to a specific tissue and is selected from the genes / RNA / proteins overexpressed in various tissues provided in Appendix 4 ofUS63 / 575,749. In some embodiments, the first and second RNAs are overexpressed in the same tissue. In some embodiments, the first and second RNAs are both from a list in Appendix 4 of US63 / 575,749 for a specific tissue.

[0067] In some embodiments, the coding sequence encodes the protein. In some embodiments, the protein is a protein of interest. In some embodiments, the protein of interest is a therapeutic protein. In some embodiments, the protein of interest is a toxic protein. In some embodiments, the therapeutic protein is an anticancer protein. In some embodiments, the protein of interest treats cancer. In some embodiments, the therapeutic protein is a vaccine. In some embodiments, the therapeutic protein is a protein of a pathogen. In some embodiments, the protein of interest is a reporter protein. In some embodiments, a reporter protein is a fluorescent protein.

[0068] In some embodiments, the protein of interest is a toxin. In some embodiments, the protein of interest is a tumor suppressor. In some embodiments, the tumor suppressor is Klotho or an anticancer fragment thereof. Klotho is a tumor suppressor enzyme and longevity factor. The human Klotho gene is disclosed in Entrez Gene ID 9365 and the human Klotho protein is disclosed in Uniprot entry Q9UEF7. The human mRNA sequence encoding Klotho can be found in NM_004795 and NM_153683. The human protein sequence of Klotho can be found in NP_004786. In some embodiments, the human Klotho protein sequence comprises SEQ ID NO: 577. In some embodiments, the human Klotho protein sequence consists of SEQ ID NO: 577. The signal peptide of Klotho is amino acids 1-33 of SEQ ID NO: 577. In some embodiments, Klotho comprises a heterologous signal peptide and amino acids 34-1012 of SEQ ID NO: 577. In some embodiments, a fragment of Klotho is an apoptosis inducing fragment of Klotho. In some embodiments, a fragment of Klotho is an anticancer fragment of Klotho. In some embodiments, the fragment of Klotho comprises the KL1 domain of Klotho. In some embodiments, the fragment of Klotho comprises amino acids 34-503 of SEQ ID NO: 577. In some embodiments, the KL1 domain of Klotho comprises amino acids 34-503 of SEQ ID NO: 577. In some embodiments, the fragment of Klotho consists of amino acids 34-503 of SEQ ID NO: 577. In some embodiments, the fragment of Klotho comprises SEQ ID NO: 578. In some embodiments, the fragment of Klotho consists of SEQ ID NO: 578. In some embodiments, the fragment of Klotho comprises amino acids 34-340 of SEQ ID NO: 577. In some embodiments, the fragment of Klotho consists of amino acids 34-340 of SEQ ID NO: 577. In some embodiments, the fragment of Klotho comprises SEQ ID NO: 579. In some embodiments, the fragment of Klotho consists of SEQ ID NO: 579.

[0069] In some embodiments, the coding sequence is codon optimized for expression in a target organism. In some embodiments, the organism is a mammal. In some embodiments, the mammal is a human. In some embodiments, the coding sequence is codon optimized for expression in the cancerous cell. In some embodiments, the coding sequence is codon deoptimized for expression in the noncancerous cell. In some embodiments, the coding sequence is codon optimized for expression in the cell type of the cancerous cell. In some embodiments, the coding sequence is codon optimized for expression in the tissue of the cancerous cell.

[0070] In some embodiments, the codon bias is optimized. In some embodiments, calculating codon usage comprises calculating codon usage bias (CUB). In some embodiments, codon bias is optimized to match the codon bias in the first organism. In some embodiments, codon bias is optimized to not match the codon bias in the second organism. In some embodiments, codon optimized comprises codon usage bias (CUB) optimization. In some embodiments, the CUB is codon bias. In some embodiments, CUB optimization comprises tRNA adaptation index (tAI) optimization. In some embodiments, CUB optimization is by tAI. In some embodiments, CUB optimization comprises codon adaptation index (CAI) optimization. In some embodiments, CUB optimization is by CAI. In some embodiments, CUB optimization comprises typical decoding rate (TDR) optimization. In some embodiments, CUB optimization is by TDR. Performance of CUB, tAI, CAI, TDR and other algorithmic optimizations are well known in the art and are further described hereinbelow. A skilled artisan with a target organism, tissue or cell type, coding sequences of genes expressed in the target organism / tissue / cell type and expression levels of those sequences in the target organism / tissue / cell type can calculate the indexes and biases recited herein. Thus, optimization may include replacing a given codon in the codon region by a synonymous but more frequently used codon in the first tissue / cell type (or organism) or a synonymous but less frequently used codon in the second tissue / cell type. In some embodiments, the frequency is calculated by tAI. In some embodiments, the frequency is calculated by CAI. In some embodiments, the frequency is calculated by TDR. In some embodiments, calculation is relative to null model. In some embodiments, the null model is a VCUB null model. Methods of generating and analyzing these null models are well known in the art.

[0071] In some embodiments, expressed is highly expressed. In some embodiments, expressed is detectably expressed. In some embodiments, expressed is expressed above a predetermined threshold. In some embodiments, the threshold is the concentration sufficientto induce translation of the RNA of the invention. In some embodiments, lowly expressed is unexpressed. In some embodiments, lowly expressed is undetectably expressed. In some embodiments, lowly expressed is expressed below a predetermined threshold.

[0072] In some embodiments, an RNA expressed in a cancerous cell and lowly expressed in a noncancerous cell is a trigger RNA. In some embodiments, the trigger RNA is a messenger RNA (mRNA). In some embodiments, the trigger RNA is not a microRNA (miRNA). In some embodiments, the trigger RNA comprises a coding region.

[0073] In some embodiments, the first trigger and the second trigger are different triggers. In some embodiments, the first trigger and the second trigger are the same triggers.

[0074] In some embodiments, obtaining a sequence of an RNA comprises performing a search algorithm. In some embodiments, the algorithm is a computerized algorithm. In some embodiments, the search algorithm is a statistical search algorithm. In some embodiments, the search algorithm is performed on RNA expression data from the cancerous cell and the noncancerous cell. In some embodiments, the expression data is sequencing data. In some embodiments, the sequencing is next generation sequencing (NGS). In some embodiments, the sequencing is deep sequencing. In some embodiments, the search algorithm ranks RNA molecules based on their ability to distinguish between the cancerous cell and the noncancerous cell.

[0075] In some embodiments, obtaining a sequence comprises selecting an RNA whose expression in the noncancerous cell is sufficiently low as to not induce expression of the protein in the presence of the RNA molecule of the invention. In some embodiments, expression is protein expression. In some embodiments, obtaining a sequence comprises selecting an RNA whose expression in the cancerous cell is sufficiently high as to induce expression of the protein in the presence of the RNA molecule of the invention.

[0076] In some embodiments, obtaining a sequence comprises selecting an RNA comprising a GC content below a predetermined threshold. In some embodiments, obtaining a sequence comprises selecting an RNA comprising as low a GC content as possible. In some embodiments, obtaining a sequence comprises selecting an RNA comprising RNA folding below a predetermined threshold. In some embodiments, RNA folding is local RNA folding. In some embodiments, obtaining a sequence comprises selecting an RNA comprising as little RNA folding as possible.

[0077] In some embodiments, the method further comprises selecting a region within the sequence of the RNA. In some embodiments, the method further comprises selecting aregion within the sequence of the trigger RNA. In some embodiments, the region is an unfolded region. In some embodiments, an unfolded region is a region with a folding energy above a predetermined threshold. In some embodiments, the region is the most unfolded region in the RNA. In some embodiments, unfolded comprises the highest local folding energy. In some embodiments, the highest local folding energy is the less negative local folding energy. In some embodiments, local is within a window of nucleotides. In some embodiments, the window is the region. In some embodiments, the folding is determined for the sequence of an RNA. In some embodiments, the folding is determined for the region. In some embodiments, the folding is determined for windows throughout the sequence of an RNA. In some embodiments, the folding is determined for windows throughout the region.

[0078] In some embodiments, determining local folding energy comprises inputting the sequence into a folding program. In some embodiments, a folding program is a program that predicts RNA folding. In some embodiments, a folding program is a program that models RNA folding. In some embodiments, a folding program provides a folding energy for a sequence. In some embodiments, the folding energy is local folding energy. In some embodiments, local is over a given window. In some embodiments, the window is about 40 nucleotides (nt). In some embodiments, the window is about 60 nt. In some embodiments, the window is 20-150 nt. In some embodiments, the window is 20-100 nt. In some embodiments, the window is 20-60 nt. In some embodiments, the window is 20-50 nt. In some embodiments, the window is 20-40 nt. In some embodiments, the window is 36-40 nt. In some embodiments, the window is 30-40 nt. In some embodiments, the window is 30-36 nt. In some embodiments, the window is 40-150 nt. In some embodiments, the window is 50-150 nt. In some embodiments, the window is 60-150 nt. In some embodiments, the window is 40-120 nt. In some embodiments, the window is 50-120 nt. In some embodiments, the window is 60-120 nt. In some embodiments, the window is 40-100 nt. In some embodiments, the window is 50-100 nt. In some embodiments, the window is 60-100 nt. In some embodiments, the window is the region. Examples of folding programs are well known in the art and include for example, Mfold, RNAfold, RNA123, RNAshapes, RNAstructure, RNAstructureWeb, RNAslider and UNAFold to name but a few. In some embodiments, local folding energy is determined with RNAfold.

[0079] In some embodiments, selecting an unfolded region comprises performing a search algorithm. In some embodiments, the search algorithm is a window search algorithm. In some embodiments, the algorithm produces a folding matrix. In some embodiments, the folding matrix indicates the probability that each nucleotide hybridizes to another nucleotide.

[0080] In some embodiments, each nucleotide is each nucleotide of the sequence of the RNA. In some embodiments, each nucleotide is each nucleotide of the window. In some embodiments, each nucleotide is each nucleotide of the region. In some embodiments, the another nucleotide is within the sequence of the RNA. In some embodiments, the another nucleotide is within the region. In some embodiments, the another nucleotide is within the window. In some embodiments, the another nucleotide is within the sequence of the gene of interest. In some embodiments, the another nucleotide is every other nucleotide in the molecule. In some embodiments, the molecule includes the sequence of the gene of interest. In some embodiments, the selecting an unfolding region further comprises selecting a window predicted to not hybridize. In some embodiments, the prediction is based on the probability matrix. In some embodiments, a window predicted to not hybridize is the window with the lowest probability to hybridize.

[0081] In some embodiments, selecting a region further comprises evaluating the local folding energy of a window adjacent to the region. In some embodiments, a window adjacent is both windows adjacent to the region. In some embodiments, evaluating the folding is determining local folding in the adjacent windows. In some embodiments, evaluating the folding is determining folding to the adjacent windows. In some embodiments, evaluating the folding is determining the folding from the region to the windows adjacent to the region.

[0082] In some embodiments, the window is an outer window. In some embodiments, an outer window is subdivided into inner windows. In some embodiments, the outer window comprises a plurality of inner windows. In some embodiments, an inner window is a portion of the outer window. In some embodiments, a portion is less than 100 percent. In some embodiments, an inner window is between 5-20, 6-20, 7-20, 8-20, 9-20, 10-20, 15-20, 5-18, 6-18, 7-18, 8-18, 9-18, 10-18, 15-18, 5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12, 5-10, 6-10, 7-10, 8-10, or 9-10 nucleotides in length. Each possibility represents a separate embodiment of the invention. In some embodiments, each window is 1 nucleotide shifted from another window. In some embodiments, the inner windows are produced by starting at an end of the outer window and producing a window, shifting over 1 nucleotide and producing another window and repeating and until the end of the outer window. In some embodiments, a folding matrix is produced for each inner window. In some embodiments, a folding energy is produced for each inner window. In some embodiments, a folding value is produced for each inner window. In some embodiments, a folding value is a folding score. In some embodiments, the folding energies for each inner window across all outer windows is summed. In some embodiments, the summing produces an inner windowfolding value. In some embodiments, a value is a score. In some embodiments, the inner window folding values for all inner windows in an outer window are summed. In some embodiments, the summing produces an outer window folding value. In some embodiments, the selecting comprises selecting an outer window. In some embodiments, an outer window with a folding value beyond a predetermined threshold is selected. In some embodiments, beyond is above. In some embodiments, beyond is below.

[0083] In some embodiments, the first sequence comprises at least 10, 12, 15, 17, 18, 19, 20, 21, 22, 23 or 25 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the first sequence comprises at least 10 nucleotides. In some embodiments, the first sequence comprises at least 15 nucleotides. In some embodiments, the first sequence comprises at least 20 nucleotides. In some embodiments, the first sequence comprises at least 23 nucleotides. In some embodiments, the first sequence comprises at most 20, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 50, 60, 70, 75, 80, 90, or 100 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the first sequence comprises at most 100 nucleotides. In some embodiments, the first sequence comprises at most 50 nucleotides. In some embodiments, the first sequence comprises at most 30 nucleotides. In some embodiments, the first sequence comprises between 15-100, 15-90, 15-80, 15-70, 15-60, 15-50, 15-40, 15-30, 15-25, 20-100, 20-90, 20- 80, 20-70, 20-60, 20-50, 20-40, 20-30, 20-25, 23-100, 23-90, 23-80, 23-70, 23-60, 23-50, 23-40, 23-30 or 23-25 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the first sequence comprises between 20-100 nucleotides. In some embodiments, the first sequence comprises between 20-50 nucleotides. In some embodiments, the first sequence comprises between 20-30 nucleotides.

[0084] In some embodiments, the second sequence comprises at least 10, 12, 15, 17, 18, 19, 20, 21, 22, 23 or 25 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the second sequence comprises at least 10 nucleotides. In some embodiments, the second sequence comprises at least 15 nucleotides. In some embodiments, the second sequence comprises at least 20 nucleotides. In some embodiments, the second sequence comprises at least 23 nucleotides. In some embodiments, the second sequence comprises at most 20, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 50, 60, 70, 75, 80, 90, or 100 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the second sequence comprises at most 100 nucleotides. In some embodiments, the second sequence comprises at most 50 nucleotides. In some embodiments, the second sequence comprises at most 30 nucleotides. In some embodiments, the secondsequence comprises between 15-100, 15-90, 15-80, 15-70, 15-60, 15-50, 15-40, 15-30, 15- 25, 20-100, 20-90, 20-80, 20-70, 20-60, 20-50, 20-40, 20-30, 20-25, 23-100, 23-90, 23-80, 23-70, 23-60, 23-50, 23-40, 23-30 or 23-25 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the second sequence comprises between 20-100 nucleotides. In some embodiments, the second sequence comprises between 20-50 nucleotides. In some embodiments, the second sequence comprises between 20-30 nucleotides.

[0085] In some embodiments, the RNA molecule comprises a reverse complement to the sequence of an RNA. In some embodiments, the RNA molecule comprises a reverse complement to a selected region. In some embodiments, the RNA molecule comprises a reverse complement to the trigger. In some embodiments, the reverse complement comprises two regions. In some embodiments, the two regions are an unhybridized region and a hybridized region. In some embodiments, the unhybridized region is 5’ to the hybridized region. In some embodiments, the unhybridized region is 3’ to the hybridized region. In some embodiments, the unhybridized region is a 5’ region. In some embodiments, the unhybridized region is a 3’ region. In some embodiments, the region reverse complementary comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, 25, 30, 35, 40, 45, or 50 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the region reverse complementary comprises at most 10, 12, 15, 17, 20, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the region reverse complementary and the 3’ hybridized region are the same size. In some embodiments, the region reverse complementary and the 5’ hybridized region are the same size. In some embodiments, the reverse complement and the selected region are the same size.

[0086] In some embodiments, the RNA molecule further comprises a loop region. In some embodiments, the loop region does not hybridize to itself. In some embodiments, the loop region does not hybridize to the reverse complement of the selected region. In some embodiments, the loop region does not hybridize to the region reverse complementary to the hybridized region. In some embodiments, the loop region does not hybridize to any sequence in the RNA of the invention. In some embodiments, the loop region does not hybridize to any sequence. In some embodiments, the loop is not a bulge. In some embodiments, the loop comprises or consists of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, 25, 30, 35, 40, 45, or 50 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the loop comprises or consists of at most 10, 12, 15, 17, 20, 25, 30, 35,40, 45, 50, 60, 70, 75, 80, 90 or 100 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, a loop comprises or consists of at least 5 nucleotides. In some embodiments, a loop comprises or consists of at least 8 nucleotides. In some embodiments, a bulge comprises or consists of less than 5 nucleotides. In some embodiments, a bulge comprises or consists of less than 8 nucleotides.

[0087] In some embodiments, the RNA molecule comprises at least two stem regions. In some embodiments, at least two is two. In some embodiments, each stem region has its own trigger RNA. In some embodiments, the first and second RNA sequence are different sequences. In some embodiments, the first and second RNA sequences are the same sequence. In some embodiments, the first and second RNA sequences are from different RNAs. In some embodiments, the first and second RNA sequences are from the same RNA. In some embodiments, the first RNA sequence is the first trigger RNA. In some embodiments, the second RNA sequence is the second trigger RNA. In some embodiments, the first trigger RNA is the first trigger RNA sequence. In some embodiments, the second trigger RNA is the second trigger RNA sequence. In some embodiments, the first trigger and the second trigger are the same. In some embodiments, the first trigger and the second trigger are different. In some embodiments, the first trigger RNA is a reverse complement to the first stem region. In some embodiments, the second trigger RNA is a reverse complement to the second stem region. In some embodiments, the RNA molecule comprises at least two loop regions. In some embodiments, at least two is two. In some embodiments, each stem region also has a corresponding loop region. In some embodiments, the first stem has a first loop. In some embodiments, the second stem has a second loop. In some embodiments, has is adjacent to.

[0088] Examples of possible trigger sequences and their corresponding toehold sequences are provided in Table 1. Table 1 provides: Gene: The name of the gene in which the sequence appears. Transcript ID: The Ensembl ID of the specific transcript within the gene the sequence appears in. Trigger Sequence: The actual trigger sequence. Patients Counts with mutation: The absolute number of cases containing the sequence. Toehold Sequence: The predicted toehold switch corresponding to the trigger (with the start of the gene). The percentage of cases within each cancer type containing the sequence withing the GDC database can be found in Appendix 2 of US63 / 575,749 the contents of which are hereby incorporated by reference in its entirety. Thus, using Appendix 2, a skilled artisan can select the cancer for which each toehold is most useful.

[0089] In some embodiments, the trigger sequence is selected from a trigger provided in Appendix 2 of US63 / 575,749. In some embodiments, a plurality of trigger sequences is selected from the triggers provided in Appendix 2 of US63 / 575,749. In some embodiments, the first sequence is selected from the trigger sequences provided in Appendix 2 of US63 / 575,749. In some embodiments, the second sequence is selected from the trigger sequences provided in Appendix 2 of US63 / 575,749. In some embodiments, the reverse complement of the trigger is selected from the sequences provided in Appendix 2 of US63 / 575,749. In some embodiments, the toehold sequence is selected from the toehold sequences provided in Appendix 2 of US63 / 575,749. Each trigger provided in Appendix 2 of US63 / 575,749 represents a separate embodiment of the invention. Each toehold provided in Appendix 2 of US63 / 575,749 represents a separate embodiment of the invention.

[0090] In some embodiments, the first toehold comprises regions i-iii. In some embodiments, the second toehold comprises regions iv-vi. In some embodiments, the first toehold is selected from a toehold sequence provided in Appendix 2 of US63 / 575,749. In some embodiments, the first toehold is selected from a toehold sequence provided in Table 1.

[0091] In some embodiments, the trigger sequence is selected from a trigger provided in Table 1. In some embodiments, a plurality of trigger sequences is selected from the triggers provided in Table 1. In some embodiments, the first sequence is selected from the trigger sequences provided in Table 1. In some embodiments, the second sequence is selected from the trigger sequences provided in Table 1. In some embodiments, the reverse complement of the trigger is selected from the sequences provided in Table 1. In some embodiments, the toehold sequence is selected from the toehold sequences provided in Table 1. Each trigger provided in Table 1 represents a separate embodiment of the invention. Each toehold provided in Table 1 represents a separate embodiment of the invention. In some embodiments, the first trigger is selected from SEQ ID NO: 1-288. In some embodiments, the second trigger is selected from SEQ ID NO: 1-288.

[0092] In some embodiments, the first toehold comprises regions i-iii. In some embodiments, the second toehold comprises regions iv-vi. In some embodiments, the first toehold is selected from the toehold sequences provided in Appendix 2 of US63 / 575,749. In some embodiments, the first toehold is selected from the toehold sequences provided in Table 1. In some embodiments, the second toehold is selected from the toehold sequences provided in Appendix 2 of US63 / 575,749. In some embodiments, the second toehold is selected from the toehold sequences provided in Table 1. In some embodiments, the firsttoehold is selected from SEQ ID NO: 289-576. In some embodiments, the second toehold is selected from SEQ ID NO: 289-576. In some embodiments, the first toehold is selected from SEQ ID NO: 289-576 and the trigger is selected from SEQ ID NO: 1-288 and comprises a sequence reverse complementary to the trigger. Table 1 defines the trigger and its matching toehold, thus a skilled artisan will select the toehold that matches the trigger. For example trigger SEQ ID NO: 1 matches toehold SEQ ID NO: 289 and trigger SEQ ID NO: 200 matches toehold SEQ ID NO: 488.

[0093] In some embodiments, the trigger comprises a mutation. In some embodiments, the mutation is not present in a wild-type version of the gene. In some embodiments, the mutation is a cancer- specific mutation. In some embodiments, the mutation is found in cancer cells and not healthy cells. In some embodiments, the mutation is in a highly expressed gene. In some embodiments, the mutation is a somatic mutation. In some embodiments, the mutation is a mutation that modulates splicing. In some embodiments, modulates splicing is alters the splice isoform (splicoform) of the RNA. In some embodiments, the mutation produces a difference in the mRNA form. In some embodiments, the difference in form is a truncation. In some embodiments, the difference in form is a different splicing event. In some embodiments, the difference in form is a different isoform. In some embodiments, a different isoform is a different splicoform.

[0094] In some embodiments, the mutation is selected from the mutations provided in Appendix 3 of US63 / 575,749 the contents of which are hereby incorporated by reference in its entirety. In some embodiments, the mutation is selected from the splicing mutations provided in Appendix 3 of US63 / 575,749. In some embodiments, the mutation is selected from the general mutations provided in Appendix 3 of US63 / 575,749. In some embodiments, the mutation is selected from the exonic mutations provided in Appendix 3 of US63 / 575,749. In some embodiments, the mutation is predicted to modulate splicing by at least a predetermined threshold. Appendix 3 provides filtered mutations from TCGA database that have between 6 and 99 affected patients. The mutations are filtered based on having large Oncosplice scores (functional divergence), having predicted penetrant missplicng, and affecting at least one transcript that has expression higher than 90% of all transcripts in one tissue (i.e., is highly expressed in at least one tissue). Terms used in the appendix are as follows: mut_id: the mutation ID described by the gene name, the chromosome, the position of the mutation, the reference allele, and the tumor allele. Genome positions are with respect to Hgl9. Mis-splicing: the highest penetrance that the mutation causes on mis-spliced sites, calculated with SpliceAI. Oncosplice score: a value describing the functional divergence ofa mutation as described in the oncosplice paper (Zhang et al., “OncoSplicing: an updated database for clinically relevant alternative splicing in 33 human cancers”, Nucleic Acids Res. 2022 Jan 7; 50(Dl): D1340-D1347, the contents of which are hereby incorporated herein by reference). Cases affected: the total number of patients affected by this mutation in the TCGA cohort.

[0095] In some embodiments, the mutation is in PIK3CA. In some embodiments, the mutation causes a glutamic acid at position 545 to be mutated to lysine. In some embodiments, the mutation encodes the E545K mutation. In some embodiments, the mutation is a 1633G>A mutation in PIK3CA. In some embodiments, the mutation causes a methionine at position 489 to be mutated to isoleucine. In some embodiments, the mutation encodes the M489I mutation. In some embodiments, the mutation is a 1467G>A mutation in PIK3CA. In some embodiments, the trigger comprises SEQ ID NO: 580. In some embodiments, the trigger consists of SEQ ID NO: 580. In some embodiments, the toehold comprises SEQ ID NO: 581. In some embodiments, the toehold consists of SEQ ID NO: 581. In some embodiments, the toehold for trigger SEQ ID NO: 580 comprises or consists of SEQ ID NO: 581.

[0096] In some embodiments, the mutation is oncogenic. In some embodiments, the mutation is a driver mutation. In some embodiments, the mutation in the first sequence is reverse complementary to a base in the first 5’ unhybridized region. In some embodiments, the mutation in the first trigger is reverse complementary to a base in the first 5’ unhybridized region. In some embodiments, the mutation in the second sequence is reverse complementary to a base in the second 5’ unhybridized region. In some embodiments, the mutation in the second trigger is reverse complementary to a base in the second 5’ unhybridized region.

[0097] In some embodiments, the RNA of the invention comprises a ribosome binding site (RBS). In some embodiments, the RBS is in the second toehold. In some embodiments, the second toehold is in the second stem-loop structure. In some embodiments, the second toehold is the 3’ toehold. In some embodiments, the second toehold is the toehold closer to the obtained coding sequence. In some embodiments, closer to is adjacent to. In some embodiments, the RBS is located in the second 3’ hybridized region. In some embodiments, the RBS is located in the second 3’ hybridized region of the reverse complement to the selected region. In some embodiments, the RBS is located in the second loop region. In some embodiments, the RBS is located in the second region reverse complementary to the hybridized region. In some embodiments, the RBS is located in the second region reversecomplementary to the 3’ hybridized region. In some embodiments, the RBS is located 3’ to the first toehold structure. In some embodiments, the RBS is located 3’ to the second toehold structure. In some embodiments, the RBS is located 3’ to the first stem-loop structure. In some embodiments, the RBS is located 3’ to the second stem-loop structure. In some embodiments, the RBS is located 3’ to the first region reverse complementary to the 3’ hybridized region. In some embodiments, the RBS is located 3’ to the second region reverse complementary to the 3’ hybridized region. In some embodiments, the RBS is located 3’ to the first 3’ unhybridized region. In some embodiments, the RBS is located 3’ to the second 3 ’ unhybridized region. In some embodiments, the RBS is located between the region reverse complementary to the second 3’ hybridized region and the coding sequence encoding a protein of interest. In some embodiments, the RBS is located between the coding sequence encoding a protein of interest and the reverse complement to the selected region. In some embodiments, the RBS is located between the coding sequence encoding a protein of interest and the second 3’ unhybridized region.

[0098] In some embodiments, the RBS is a Kozak sequence. In some embodiments, the Kozak sequence comprises the start codon. In some embodiments, the Kozak sequence is ACC. In some embodiments, the Kozak sequence is or comprises AGAAACCAAA. In some embodiments, the Kozak sequence is or comprises AAACCAAA. In some embodiments, the Kozak sequence is or comprises ACCAAA. In some embodiments, the RBS is 5’ to the start codon. In some embodiments, the start codon is 3’ to the RBS. In some embodiments, the Kozak is ACCAAAATG. In some embodiments, the start codon is 3’ to the RBS. In some embodiments, the Kozak comprises ACCAAAATG. Improved AUG context in eukaryotes was calculated based on models described in Zur and Tuller, 2013, “New Universal Rules of Eukaryotic Translation Initiation Fidelity”, PLoS Comput. Biol. 2013;9(7):el003136, herein incorporated by reference in its entirety. The improved AUG context produced a superior Kozak to the canonical sequence of ACCATG.

[0099] In some embodiments, the method further comprises confirming formation of a stem loop structure. In some embodiments, the stem comprises the 3’ hybridized region hybridized to the region reverse complementary to the 3’ hybridized region. In some embodiments, the stem comprises the 5’ hybridized region hybridized to the region reverse complementary to the 5’ hybridized region. In some embodiments, the stem comprises a region of the reverse complement to the selected region hybridized to the region reverse complementary to the 3’ hybridized region. In some embodiments, the stem comprises a region of the reverse complement to the selected region hybridized to the region reversecomplementary to the 5’ hybridized region. In some embodiments, the stem- loop structure comprises the 3’ hybridized region of the reverse complement to the selected region, the loop region and the region reverse complementary to the 3’ hybridized region. In some embodiments, the stem-loop structure comprises the 5’ hybridized region of the reverse complement to the selected region, the loop region and the region reverse complementary to the 5’ hybridized region.

[0100] In some embodiments, the confirming comprises performing a folding prediction algorithm. In some embodiments, folding prediction algorithm is an RNA folding prediction algorithm. In some embodiments, the folding prediction algorithm is a sliding window folding prediction algorithm. In some embodiments, the algorithm is performed across a full sequence of the RNA of the invention. In some embodiments, the algorithm is performed across a full sequence of the RNA of the invention excluding the coding region. In some embodiments, the algorithm is performed across a full sequence of the RNA of the invention excluding the coding region encoding the protein of interest. In some embodiments, the most probable secondary structure is selected. In some embodiments, the confirming further comprises selecting the most probable secondary structure.

[0101] In some embodiments, the method further comprises optimizing the stem size. In some embodiments, the method further comprises optimizing the loop size. In some embodiments, the method further comprises optimizing the folding energy in the absence of the first or second RNA. In some embodiments, the method further comprises optimizing the folding energy in the presence of the first and / or second RNA. In some embodiments, the method further comprises optimizing the hybridization energy of the first sequence to the reverse complement of the first sequence. In some embodiments, the method further comprises optimizing the hybridization energy of the second sequence to the reverse complement of the second sequence. In some embodiments, the optimization is by a sliding window RNA folding prediction algorithm. In some embodiments, the algorithm calculates optimization across the full sequence of the synthetic RNA. In some embodiments, the algorithm takes into account the full sequence of the synthetic RNA when optimizing any region. In some embodiments, the method further comprises selecting an optimized secondary structure. In some embodiments, the algorithm selects an optimized region. In some embodiments, the algorithm selects an optimized secondary structure.

[0102] In some embodiments, the method further comprises optimizing the location of the RBS. In some embodiments, the optimizing is optimizing prevention of translation in the absence of the trigger RNA. It will be understood by a skilled artisan that the RBS regulatesthe binding of the ribosome. The position of the RBS thus has a strong effect on translation. Therefore, the RBS will be positioned such that there is no, or minimal leakage of translation in the second tissue or cell type. That is in the absence of the trigger RNA there is minimal or no ribosome binding and / or translation. In some embodiments, the optimal RBS position is within the loop region.

[0103] In some embodiments, the start codon is located 3’ to the RBS. In some embodiments, the start codon is AUG. In some embodiments, the AUG is located in the loop. In some embodiments, the start codon is 1-10 nucleotides downstream of the RBS. In some embodiments, the start codon is 6-8 nucleotides downstream of the RBS. In some embodiments, the start codon is 3 nucleotides downstream of the RBS. In some embodiments, the start codon is 4 nucleotides downstream of the RBS. In some embodiments, the RBS is a Kozak sequence and the Kozak sequence comprises the start codon. In some embodiments, the position of the start codon relative to the RBS is optimized. In some embodiments, the start codon is located in the 3’ hybridized region. In some embodiments, the start codon is located in the 3’ hybridized region of the reverse complement to the selected region. In some embodiments, the start codon is located in the loop region. In some embodiments, the start codon is located in the region reverse complementary to the hybridized region. In some embodiments, the start codon is located in the region reverse complementary to the 3’ hybridized region.

[0104] In some embodiments, the start codon is 3’ to region vi. In some embodiments, the start codon is adjacent to the 3’ end of region vi. In some embodiments, adjacent is within 100, 90, 80, 75, 70, 60, 50, 40, 30, 25, 20, 15, or 10 nucleotides of region vi. Each possibility represents a separate embodiment of the invention. In some embodiments, adjacent is adjacent to the 3’ end of region vi. In some embodiments, adjacent is within 50 nucleotides of region vi. In some embodiments, adjacent is within 26 nucleotides of region vi. In some embodiments, adjacent is within 20 nucleotides of region vi. In some embodiments, adjacent is within 10 nucleotides of region vi.

[0105] In some embodiments, the start codon is discontinuous with the rest of the coding region. In some embodiments, the start codon of the coding sequence is separated from the rest of the coding sequence. In some embodiments, a linker is inserted between the start codon and the rest of the coding region. In some embodiments, the start codon is separated from the rest of the coding sequence with a linker. In some embodiments, the linker is within the region reverse complementary to the second 3’ hybridized region. In some embodiments, the linker comprises the second 5’ hybridized region. In some embodiments, the linker iswithin the second 5’ hybridized region. In some embodiments, the linker comprises the region reverse complementary to the second 3’ hybridized region. In some embodiments, the linker is the second loop region 3’ to the start codon. In some embodiments, the linker comprises a part of the second loop region 3’ to the start codon. In some embodiments, the linker consists of the second loop region 3’ to the start codon and the region reverse complementary to the second 3’ hybridized region. In some embodiments, the linker consists of the region from the start codon to the rest of the coding sequence. In some embodiments, the start codon is in the loop (region v) and the linker is within region vi.

[0106] In some embodiments, the RNA sequence between the start codon and the obtained coding sequence is optimized. In some embodiments, the RNA sequence between the start codon and the rest of the coding sequence is optimized. In some embodiments, the linker is optimized. In some embodiments, optimized is codon optimized. In some embodiments, codon optimized is optimized to match the coding sequence. In some embodiments, the codon optimized is codon usage optimized. In some embodiments, codon optimized is CUB optimized. In some embodiments, codon optimized is TDR optimized. In some embodiments, optimized is length optimized. In some embodiments, optimal length is as short as possible. In some embodiments, optimized is while maintaining proper expression of the protein in the cancerous and noncancerous cells. In some embodiments, proper expression in the cancerous cell is expression. In some embodiments, proper expression in the noncancerous cell is low or no expression. In some embodiments, optimization is while maintaining inhibition of protein expression in the absence of the trigger RNAs. In some embodiments, optimization is while maintaining inhibition of protein expression in the noncancerous cell. In some embodiments, optimization is while maintaining expression of the protein in the presence of the trigger RNAs. In some embodiments, optimization is while maintaining expression of the protein in the cancerous cell.

[0107] In some embodiments, the RNA comprises an unhybridized region between a first and second part of the 3’ hybridized region. In some embodiments, the RNA comprises an unhybridized region between a first and second part of the 5’ hybridized region. In some embodiments, the unhybridized region is a bulge. In some embodiments, the RNA comprises an unhybridized region between a first and second part of the region reverse complementary to the 3’ hybridized region. In some embodiments, the RNA comprises an unhybridized region between a first and second part of the region reverse complementary to the 5’ hybridized region. In some embodiments, the RNA comprises an unhybridized region within both hybridized regions. In some embodiments, the unhybridized region is a bulge. In someembodiments, the unhybridized region comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, or 20 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the unhybridized region comprises at most 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, 25, 30, 35, 40, 45 or 50 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the unhybridized region comprises at most 4 nucleotides. In some embodiments, the unhybridized region comprises at most 7 nucleotides. In some embodiments, the start codon is located in the unhybridized region. In some embodiments, the start codon is located in the unhybridized region within the region reverse complementary to the 3’ hybridized region. In some embodiments, the start codon is located in the unhybridized region within the 5’ hybridized region. In some embodiments, the linker comprises the second part of the region reverse complementary. In some embodiments, the linker comprises the second part of the 5’ hybridized region. In some embodiments, the second part is the part 3’ to the start codon. In some embodiments, the linker comprises the 3’ unhybridized region.

[0108] In some embodiments, the RNA molecule comprises at least two unhybridized regions. In some embodiments, at least two is two. In some embodiments, each stem region has its own unhybridized region. In some embodiments, each stem region also has a corresponding unhybridized region. In some embodiments, the first stem has a first unhybridized region. In some embodiments, the second stem has a second unhybridized region. In some embodiments, has is comprises.

[0109] In some embodiments, the RNA molecule of the invention is depleted of immunogenic epitopes. In some embodiments, immunogenic epitopes are epitopes recognized by the immune system. In some embodiments, recognized by the immune system is recognized by T cells. In some embodiments, immunogenic is immunogenic to a mammal. In some embodiments, the mammal is a human. In some embodiments, an epitope algorithm is used to deplete the RNA molecule.

[0110] In some embodiments, the RNA of the invention comprises or consists from 5’ to 3’ of the reverse complement to the first sequence; the first loop region; the region reverse complementary to the first 3’ hybridized region; the reverse complement to the second sequence; the second loop region; the region reverse complementary to the second 3’ hybridized region; and the obtained coding sequence. In some embodiment, the RNA of the invention further comprises a spacer region 5’ to the reverse complement to the first sequence. In some embodiment, the RNA of the invention further comprises an additional region 3’ to the coding sequence. In some embodiments, the additional region comprises 3’untranslated region (UTR). In some embodiments, the 3’ UTR is the endogenous 3’ UTR of the coding sequence. In some embodiments, the additional region comprises a spacer region.

[0111] In some embodiments, the RNA of the invention further comprises a spacer between the first toehold and the second toehold. In some embodiments, the spacer is between region (iii) and region (iv). In some embodiments, the spacer is at least 1 nucleotide. In some embodiments, at least 1 nucleotide is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the spacer is at least 10 nucleotide. In some embodiments, spacer is a linear spacer. In some embodiments, the RNA structure of the spacer is linear. In some embodiments, the spacer does not comprise RNA secondary structure. In some embodiments, the first stem-loop and second stem-loop are separate structure and not part of a single structure. In some embodiments, the first stem-loop and second stem-loop are separated by the spacer which is devoid of secondary structure. In some embodiments, the spacer is at most 100 nucleotides. In some embodiments, at most 100 nucleotides is at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 75, 80, 90 or 100 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the spacer is at most 100 nucleotides. In some embodiments, the spacer is at most 50 nucleotides. In some embodiments, the spacer is at most 20 nucleotides. In some embodiments, the spacer is at most 10 nucleotides.

[0112] In some embodiments, the method further comprises confirming the RNA molecule of the invention produces the protein in the cancerous cell. In some embodiments, the method further comprises confirming the RNA molecule of the invention lowly produces the protein in the noncancerous cell. In some embodiments, lowly produces is does not produce. In some embodiments, the confirming comprises applying a trained regressor algorithm to predict protein production. In some embodiments, the algorithm is trained on sequences and known protein expression.

[0113] In some embodiments, the RNA molecule of the invention is a vector RNA molecule. A vector nucleic acid sequence generally contains at least an origin of replication for propagation in a cell and optionally additional elements, such as a heterologous polynucleotide sequence, expression control element (e.g., repressor, enhancer), selectable marker (e.g., antibiotic resistance), and / or poly-Adenine sequence.

[0114] By another aspect, there is provided an RNA molecule produced by a method of the invention.

[0115] By another aspect, there is provided an RNA molecule produced by a computer program product of the invention.

[0116] By another aspect, there is provided an RNA molecule comprising a toehold sequence selected from SEQ ID NO: 289-576 and 581.

[0117] In some embodiments, the RNA molecule is a synthetic RNA. In some embodiments, the RNA is a messenger RNA (mRNA). In some embodiments, the RNA comprises a 5’ cap. In some embodiments, the RNA comprises a polyA tail. In some embodiments, the RNA is polyadenylated. In some embodiments, the RNA is a 5’ capped RNA. In some embodiments, the RNA comprises a 5’ methyl -guanine base connected to the RNA by a 5’ to 5’ triphosphate linkage. In some embodiments, the RNA comprises a coding region. In some embodiments, the coding region encodes a protein. In some embodiments, the protein is a protein of interest. In some embodiments, the coding region is an open reading frame. In some embodiments, the RNA comprises a 5’ untranslated region (UTR). In some embodiments, the RNA comprises a 3’ UTR.

[0118] In some embodiments, the 5’ UTR comprises the toehold sequence. In some embodiments, the 5’ UTR comprises a sequence selected from SEQ ID NO: 289-576 and 581. In some embodiments, the 5’ UTR comprises SEQ ID NO: 581. In some embodiments, the RNA comprises SEQ ID NO: 581. In some embodiments, the toehold sequence is 5’ to a start codon of the coding sequence. In some embodiments, a trinucleotide of a loop of the toehold is replaced by the start codon. In some embodiments, the start codon is in the loop of the toehold and the coding sequence is devoid of the start codon. In some embodiments, the coding sequence is 3’ to the toehold sequence. In some embodiments, the toehold sequence is adjacent to the coding sequence. In some embodiments, the toehold sequence is adjacent to the 5’ end of the coding sequence. In some embodiments, the toehold sequence is adjacent to the start codon of the coding sequence. In some embodiments, adjacent is not more than 5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 75, 80, 90 or 100 bases apart. Each possibility represents a separate embodiment of the invention. In some embodiments, the toehold is not more than 20 bases 5’ to the coding sequence. In some embodiments, the toehold is not more than 20 bases 5’ to the start codon of the coding sequence.

[0119] By another aspect, there is provided a DNA molecule encoding an RNA of the invention.

[0120] In some embodiments, the DNA is a vector. In some embodiments, the vector is an expression vector. In some embodiments, the vector is a plasmid. In some embodiments, the vector comprises a promoter that drives expression of the RNA of the invention. In some embodiments, expression is transcription. A vector nucleic acid sequence generally contains at least an origin of replication for propagation in a cell and optionally additional elements, such as a heterologous polynucleotide sequence, expression control element (e.g., a promoter, enhancer), selectable marker (e.g., antibiotic resistance), poly-Adenine sequence.

[0121] The vector may be a DNA plasmid delivered via non-viral methods or via viral methods. The viral vector may be a retroviral vector, a herpesviral vector, an adenoviral vector, an adeno-associated viral vector or a poxviral vector. The promoters may be active in mammalian cells. The promoters may be a viral promoter.

[0122] In some embodiments, a transcribable region that encodes the RNA of the invention is operably linked to a promoter. The term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element or elements in a manner that allows for transcription of the nucleotide sequence (the transcribable sequence) (e.g. in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).

[0123] In some embodiments, the vector is introduced into the cell by standard methods including electroporation (e.g., as described in From et al., Proc. Natl. Acad. Sci. USA 82, 5824 (1985)), Heat shock, infection by viral vectors, high velocity ballistic penetration by small particles with the nucleic acid either within the matrix of small beads or particles, or on the surface (Klein et al., Nature 327. 70-73 (1987)), and / or the like.

[0124] The term "promoter" as used herein refers to a group of transcriptional control modules that are clustered around the initiation site for an RNA polymerase i.e., RNA polymerase II. Promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.

[0125] In some embodiments, nucleic acid sequences are transcribed by RNA polymerase II (RNAP II and Pol II). RNAP II is an enzyme found in eukaryotic cells. It catalyzes the transcription of DNA to synthesize precursors of mRNA and most snRNA and microRNA.

[0126] In some embodiments, mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (±), pGL3, pZeoSV2(±), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK- RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.

[0127] In some embodiments, expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses are used by the present invention. SV40 vectors include pSVT7 and pMT2. In some embodiments, vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo- 5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallo thionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.

[0128] In some embodiments, recombinant viral vectors, which offer advantages such as lateral infection and targeting specificity, are used for in vivo expression. In one embodiment, lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. In one embodiment, the result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. In one embodiment, viral vectors are produced that are unable to spread laterally. In one embodiment, this characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.

[0129] Various methods can be used to introduce the expression vector of the present invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. Inaddition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.

[0130] By another aspect, there is provided a cell comprising an RNA molecule of the invention.

[0131] By another aspect, there is provided a cell comprising a DNA molecule of the invention.

[0132] By another aspect, there is provided a composition comprising an RNA molecule of the invention.

[0133] By another aspect, there is provided a composition comprising a cell of the invention.

[0134] By another aspect, there is provided a composition comprising a DNA molecule of the invention.

[0135] By another aspect, there is provided a method of producing a cell of the invention, the method comprising producing an RNA molecule by a method of the invention and contacting a cell with the produced RNA molecule, thereby producing a cell of the invention.

[0136] By another aspect, there is provided a method of producing a composition of the invention, the method comprising producing a cell of the invention and combining the cell with a pharmaceutically acceptable carrier, excipient or adjuvant.

[0137] In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition comprises a pharmaceutically acceptable carrier, excipient or adjuvant. As used herein, the term “carrier,” “excipient,” or “adjuvant” refers to any component of a pharmaceutical composition that is not the active agent. As used herein, the term “pharmaceutically acceptable carrier” refers to non-toxic, inert solid, semi-solid liquid filler, diluent, encapsulating material, formulation auxiliary of any type, or simply a sterile aqueous medium, such as saline. Some examples of the materials that can serve as pharmaceutically acceptable carriers are sugars, such as lactose, glucose and sucrose, starches such as corn starch and potato starch, cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt, gelatin, talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol, polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate, agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline, Ringer's solution;ethyl alcohol and phosphate buffer solutions, as well as other non-toxic compatible substances used in pharmaceutical formulations. Some non-limiting examples of substances which can serve as a carrier herein include sugar, starch, cellulose and its derivatives, powered tragacanth, malt, gelatin, talc, stearic acid, magnesium stearate, calcium sulfate, vegetable oils, polyols, alginic acid, pyrogen-free water, isotonic saline, phosphate buffer solutions, cocoa butter (suppository base), emulsifier as well as other non-toxic pharmaceutically compatible substances used in other pharmaceutical formulations. Wetting agents and lubricants such as sodium lauryl sulfate, as well as coloring agents, flavoring agents, excipients, stabilizers, antioxidants, and preservatives may also be present. Any non-toxic, inert, and effective carrier may be used to formulate the compositions contemplated herein. Suitable pharmaceutically acceptable carriers, excipients, and diluents in this regard are well known to those of skill in the art, such as those described in The Merck Index, Thirteenth Edition, Budavari et al., Eds., Merck & Co., Inc., Rahway, N.J. (2001); the CTFA (Cosmetic, Toiletry, and Fragrance Association) International Cosmetic Ingredient Dictionary and Handbook, Tenth Edition (2004); and the “Inactive Ingredient Guide,” U.S. Food and Drug Administration (FDA) Center for Drug Evaluation and Research (CDER) Office of Management, the contents of all of which are hereby incorporated by reference in their entirety. Examples of pharmaceutically acceptable excipients, carriers and diluents useful in the present compositions include distilled water, physiological saline, Ringer's solution, dextrose solution, Hank's solution, and DMSO. These additional inactive components, as well as effective formulations and administration procedures, are well known in the art and are described in standard textbooks, such as Goodman and Gillman’s: The Pharmacological Bases of Therapeutics, 8th Ed., Gilman et al. Eds. Pergamon Press (1990); Remington’s Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Pa. (1990); and Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott Williams & Wilkins, Philadelphia, Pa., (2005), each of which is incorporated by reference herein in its entirety. The presently described composition may also be contained in artificially created structures such as liposomes, ISCOMS, slow-releasing particles, and other vehicles which increase the half-life of the peptides or polypeptides in serum. Liposomes include emulsions, foams, micelies, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. Liposomes for use with the presently described peptides are formed from standard vesicle-forming lipids which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally determined by considerations such as liposome size and stability in the blood. A variety of methods are available for preparing liposomes as reviewed, for example,by Coligan, J. E. et al, Current Protocols in Protein Science, 1999, John Wiley & Sons, Inc., New York, and see also U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369.

[0138] The carrier may comprise, in total, from about 0.1% to about 99.99999% by weight of the pharmaceutical compositions presented herein.

[0139] In some embodiments, cancerous cells comprising the synthetic RNA express the protein of interest at higher levels than noncancerous cells comprising the synthetic RNA. In some embodiments, a higher level is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 times higher. Each possibility represents a separate embodiment of the invention. In some embodiments, a higher level is at least 3 times higher. In some embodiments, a higher level is at least 5 times higher. In some embodiments, a higher level is at least 6 times higher. In some embodiments, a higher level is at least 9 times higher. In some embodiments, a higher level is at least 10 times higher. In some embodiments, a higher level is at least 13 times higher.

[0140] In some embodiments, the composition is a therapeutic composition. In some embodiments, the composition is a diagnostic composition. In some embodiments, the composition comprises a therapeutically effective carrier, excipient or adjuvant. In some embodiments, the composition is formulated for systemic administration. In some embodiments, the composition is formulated for administration to a eukaryote. In some embodiments, the carrier, excipient or adjuvant is formulated for administration to a eukaryote. In some embodiments, the eukaryote is a mammal. In some embodiments, the mammal is a human. In some embodiments, contact comprises expressing the synthetic RNA in the cell.

[0141] By another aspect, there is provided a computer program product comprising a non- transitory computer-readable storage medium having program code embodied thereon, the program code executable by at least one hardware processor to perform a method of the invention.

[0142] The present invention may be a system, a method, and / or a computer program product. The computer program product may include a computer readable storage medium (or media) having computer readable program instructions thereon for causing a processor to carry out aspects of the present invention.

[0143] The computer readable storage medium can be a tangible device that can retain and store instructions for use by an instruction execution device. The computer readable storage medium may be, for example, but is not limited to, an electronic storage device, a magneticstorage device, an optical storage device, an electromagnetic storage device, a semiconductor storage device, or any suitable combination of the foregoing. A non- exhaustive list of more specific examples of the computer readable storage medium includes the following: a portable computer diskette, a hard disk, a random access memory (RAM), a read-only memory (ROM), an erasable programmable read-only memory (EPROM or Flash memory), a static random access memory (SRAM), a portable compact disc read-only memory (CD-ROM), a digital versatile disk (DVD), a memory stick, a floppy disk, a mechanically encoded device having instructions recorded thereon, and any suitable combination of the foregoing. A computer readable storage medium, as used herein, is not to be construed as being transitory signals per se, such as radio waves or other freely propagating electromagnetic waves, electromagnetic waves propagating through a waveguide or other transmission media (e.g., light pulses passing through a fiber-optic cable), or electrical signals transmitted through a wire. Rather, the computer readable storage medium is a non-transient (i.e., not-volatile) medium.

[0144] Computer readable program instructions described herein can be downloaded to respective computing / processing devices from a computer readable storage medium or to an external computer or external storage device via a network, for example, the Internet, a local area network, a wide area network and / or a wireless network. The network may comprise copper transmission cables, optical transmission fibers, wireless transmission, routers, firewalls, switches, gateway computers and / or edge servers. A network adapter card or network interface in each computing / processing device receives computer readable program instructions from the network and forwards the computer readable program instructions for storage in a computer readable storage medium within the respective computing / processing device.

[0145] Computer readable program instructions for carrying out operations of the present invention may be assembler instructions, instruction-set-architecture (ISA) instructions, machine instructions, machine dependent instructions, microcode, firmware instructions, state-setting data, or either source code or object code written in any combination of one or more programming languages, including an object oriented programming language such as Java, Smalltalk, C++ or the like, and conventional procedural programming languages, such as the “C” programming language or similar programming languages. The computer readable program instructions may execute entirely on the user's computer, partly on the user's computer, as a stand-alone software package, partly on the user's computer and partly on a remote computer or entirely on the remote computer or server. In the latter scenario, theremote computer may be connected to the user's computer through any type of network, including a local area network (LAN) or a wide area network (WAN), or the connection may be made to an external computer (for example, through the Internet using an Internet Service Provider). In some embodiments, electronic circuitry including, for example, programmable logic circuitry, field-programmable gate arrays (FPGA), or programmable logic arrays (PLA) may execute the computer readable program instructions by utilizing state information of the computer readable program instructions to personalize the electronic circuitry, in order to perform aspects of the present invention.

[0146] These computer readable program instructions may be provided to a processor of a general-purpose computer, special purpose computer, or other programmable data processing apparatus to produce a machine, such that the instructions, which execute via the processor of the computer or other programmable data processing apparatus, create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks. These computer readable program instructions may also be stored in a computer readable storage medium that can direct a computer, a programmable data processing apparatus, and / or other devices to function in a particular manner, such that the computer readable storage medium having instructions stored therein comprises an article of manufacture including instructions which implement aspects of the function / act specified in the flowchart and / or block diagram block or blocks.

[0147] The computer readable program instructions may also be loaded onto a computer, other programmable data processing apparatus, or other device to cause a series of operational steps to be performed on the computer, other programmable apparatus or other device to produce a computer implemented process, such that the instructions which execute on the computer, other programmable apparatus, or other device implement the functions / acts specified in the flowchart and / or block diagram block or blocks.

[0148] By another aspect, there is provided a method of producing expression of a protein of interest in a cancerous cell, the method comprising introducing a synthetic RNA molecule of the invention into the cancerous cell, thereby producing the protein of interest.

[0149] By another aspect, there is provided a method of producing expression of a protein of interest in a cancerous cell, the method comprising introducing a DNA molecule of the invention into the cancerous cell, thereby producing the protein of interest.

[0150] By another aspect, there is provided a method of producing expression of a sequence of interest in a cancerous cell and not in a noncancerous cell, the method comprisingintroducing a synthetic RNA molecule of the invention into the cancerous cell and the noncancerous cell, thereby producing expression of a sequence of interest in a cancerous cell and not in a noncancerous cell.

[0151] By another aspect, there is provided a method of producing expression of a sequence of interest in a cancerous cell and not in a noncancerous cell, the method comprising introducing a DNA molecule of the invention into the cancerous cell and the noncancerous cell, thereby producing expression of a sequence of interest in a cancerous cell and not in a noncancerous cell.

[0152] By another aspect, there is provided a method of treating cancer in a subject in need thereof, the method comprising administering to the subject a synthetic RNA molecule of the invention, thereby treating cancer.

[0153] By another aspect, there is provided a method of treating cancer in a subject in need thereof, the method comprising administering to the subject a DNA molecule of the invention, thereby treating cancer.

[0154] In some embodiments, the introducing further comprises introducing the synthetic RNA molecule of the invention into a noncancerous cell. In some embodiments, the method further comprises introducing the synthetic RNA molecule of the invention into a noncancerous cell. In some embodiments, the introducing into the noncancerous cell does not produce expression of the protein of interest in the noncancerous cell. In some embodiments, the introducing into the noncancerous cell produces low expression of the protein of interest in the noncancerous cell. In some embodiments, the noncancerous cell is of the same cell type or tissue as the cancerous cell.

[0155] In some embodiments, the method is a method of treating cancer in a subject in need thereof, wherein the introducing comprises administering the synthetic RNA molecule of the invention to the subject. In some embodiments, the method is a method of treating cancer in a subject in need thereof, wherein the introducing comprises administering the DNA molecule of the invention to the subject. In some embodiments, the contacting is with a composition of the invention. In some embodiments, the administering is administering a composition of the invention.

[0156] As used herein, the terms “administering,” “administration,” and like terms refer to any method which, in sound medical practice, delivers a composition containing an active agent to a subject in such a manner as to provide a therapeutic effect. One aspect of the present subject matter provides for intravenous administration of a therapeutically effectiveamount of a composition of the present subject matter to a patient in need thereof. Other suitable routes of administration can include parenteral, subcutaneous, oral, intramuscular, intratumor or intraperitoneal. In some embodiments, administering is systemically administering.

[0157] The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.

[0158] In some embodiments, the cancer comprises a mutation in PIK3CA the synthetic RNA molecule comprises SEQ ID NO: 581. In some embodiments, the mutation is the M489I mutation. In some embodiments, the cancer and its corresponding toehold sequence selected from SEQ ID NO: 289-576 are selected from the sequences and cancers provided in Appendix 2 of US63 / 575,749.

[0159] As used herein, the term "about" when combined with a value refers to plus and minus 10% of the reference value. For example, a length of about 1000 nanometers (nm) refers to a length of 1000 nm+- 100 nm.

[0160] It is noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the polypeptide" includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements or use of a "negative" limitation.

[0161] In those instances where a convention analogous to "at least one of A, B, and C, etc." is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., "a system having at least one of A, B, and C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B."

[0162] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

[0163] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

[0164] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.EXAMPLES

[0165] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I- III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology"Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference. Other general references are provided throughout this document.Example 1: Toehold switch overview

[0166] Figures 1A and IB depict the concept of a double toehold switch in its most basic forms. The untranslated region folds into two hairpin structures and translation initiation is repressed. If two cancer-specific RNA molecules are present (the trigger mRNAs), each binds the exposed 5’ area just before the beginning of each stem (trigger binding site) and then hybridizes to the strand region that is part of the stem. This hybridization opens the structure and removes the secondary structure. In Figure 1A a double toehold switch is depicted in which each trigger RNA is different and Figure IB depicts a double toehold in which the same RNA acts as trigger for both toeholds.

[0167] In prokaryotes the ribosome binds to the ribosome binding site (RBS, e.g., the Shine - Dalgamo sequence) that is upstream of the translational start site (TSS, e.g., AUG). Thus, toe-holds must include the RBS within the stem-loop structure in order to inhibit translation in absence of the trigger RNA. Double toeholds in configurations like those shown in Figures 1A-1B therefore do not work in prokaryotes as opening of the stem-loop containing the RBS would facilitate ribosome binding and translation initiation / elongation. However, ribosome dynamics are different in eukaryotes. The small ribosome subunit scans down from the 5’ cap of the mRNA looking for the TSS. Secondary structure 5’ to the TSS impedes the small subunits scanning and the subunit becomes displaced when strong RNA folding is present. A stem-loop is sufficiently strong RNA folding such as to displace the small subunit and therefore if either of the two toeholds is closed (no trigger present) the small ribosome subunit cannot scan and will not find the TSS. Thus, in eukaryotes the inclusion in sequential fashion (one after the other) of two toeholds greatly decreases translational leakage and increases target cell specificity.

[0168] Figure 2 depicts what occurs when only one of the two trigger mRNAs are present. Binding of the one trigger opens the corresponding structure, but the remaining stem-loop still acts to inhibit ribosome scanning and blocks translation initiation. Though for the sake of simplicity two adjacent stem-loops with a linear linker between them are depicted, it willbe understood that any complex construct with two toeholds, including a core stem from which two stem-loops emerge are also envisioned.

[0169] The reliance on both triggers for the mechanism to transition to the ON state presents two significant advantages. Firstly, it serves as a safeguard against the mechanism's potential breakdown. As the mechanism is constructed from RNA molecules, which are not inherently stable, requiring the presence of both triggers adds robustness, preventing unintended activation and potential damage to non-targeted cells. Secondly, this dual-trigger requirement enhances specificity. Utilizing only one trigger might open the switch inadvertently, as a similar RNA molecule could bind due to thermodynamic considerations. Requiring both triggers reduces the likelihood of such occurrences, thereby increasing the specificity of the mechanism.

[0170] This project signifies a transformative step in cancer therapy by setting new standards in precise cancer treatment thereby vastly reducing the harmful effects on healthy tissues. Herein a computational model is disclosed to design these toehold switches, eliminating the need for time-consuming and costly in-vivo testing traditionally required for switch generation.Example 2: Algorithm

[0171] The objective is to advance cancer therapy, emphasizing the necessity for the toehold switch design to exhibit exceptional selectivity and specificity towards cancer cells. The aim is to maximize on-target expression while minimizing off-target expression, thereby amplifying the dynamic range of the toehold switches. Achieving this requires addressing various factors influencing On and Off expression levels. These include identifying ideal switches that effectively distinguish cancerous cells from healthy ones, optimizing switch efficiency by mitigating issues such as misfolding, ribosome affinity, locked switch, and off- state leakage. To systematically enhance these factors and achieve a high dynamic range, a model was developed that focuses on two primary levels:1. Finding the optimal trigger2. Toehold switch system design.Example 3: Finding the optimal trigger

[0172] The process of finding the optimal trigger for the toehold switch system involves several intricate steps aimed at enhancing its specificity and effectiveness in targeting cancerous cells while minimizing off-target effects.4Z

[0173] Initially, the algorithm harnesses extensive data sources to compile a list of potential RNA molecules, which are then prioritized based on their ability to distinguish cancer cells and their suitability as triggers. The trigger, a specific subsequence within the target mRNA found exclusively in cancerous cells, is crucial for the toehold switch's function. Identifying the optimal trigger necessitates a deep understanding of mutations driving cancer development. A mutation is defined suitable if it possesses several attributes, among them are 1) high gene expression levels, 2) being a somatic mutation and 3) causing a substantial difference in mRNA form.

[0174] To initiate this process, a mutation database is established through Next Generation Sequencing (NGS) of tumor and healthy cell samples. This data comparison enables identifying mutations with attributes essential to the objectives, such as high gene expression levels, somatic mutation status, and significant alterations in mRNA structure. Additionally, mutations can be selected from large and well-established databases, such as GDC (Genomic Data Commons) and SRA (Sequence Read Archive).

[0175] Subsequently, the algorithm filters out mutations with low gene expression levels and germline mutations, focusing solely on somatic mutations prevalent in cancer cells. The concentration of the target mRNA is crucial for the toehold switch success rate. The best candidates need to be expressed in the targeted cells at such a level that they activate the toehold switch but in relative low levels in the other non-targeted cells. That is why mutations with rare appearance in the cancer cells are filtered out.

[0176] As mentioned, the difference in the mRNA form that is caused by the mutation holds a great impact on the toehold switch dynamic range: the bigger the difference between the mutant and the wild type the lower the off-target ratio. That is why mutations that are robust are selected. There are two possible ways to achieve this. One is to find mutations that are big insertions / deletions. The inserted sequence can be used as a trigger or the junction between the wild-type sequence and the inserted sequence can act as the trigger. For deletions the newly created junction would be used as the trigger. The second option is to target splice mutations which can alter the mRNA form all together. With the prediction model “Oncosplice” one can predict whether a mutation is affecting splicing and what is the resultant mRNA sequence. The newly created splice junction can be used as a trigger. In other cases, a mutation that does not affect splicing can still cause a substantial difference in sequence and one can use transcriptome databases in order to predict the resulting mRNA.

[0177] Furthermore, statistical analysis guides the selection process, favoring mutations with higher frequency across patient populations to maximize the toehold switch's applicability.

[0178] This meticulous filtering process (Fig. 3) yields a refined list of candidate mutations for further analysis. Each candidate undergoes evaluation through the below described window search algorithm.

[0179] The window search algorithm is based on a folding matrix which contains the probability of each nucleotide connecting with another nucleotide in the sequence. Using this folding matrix, the complex secondary structure and ensemble options could be predicted. The optimal window will be a short sequence that in high probability is open and stable within the structure of the RNA molecule, to allow interaction with the toehold switch molecule. This algorithm considers both sequence probability and entropy traits to mitigate spatial disturbances.

[0180] Upon identifying potential triggers, scoring methodologies are employed to assess the predicted on / off ratio and compatibility with the toehold switch system. By analyzing complex connections, spatial structures, and thermodynamic properties, the method gages the trigger's efficacy in activating the toehold switch. In the same way, one can predict how well the wild type or other homolog sequences that resemble the target (and are present in healthy cells) will activate the toehold switch. This step is highly important the desire is for a high sensitivity system that will be activated solely in cancerous cells.

[0181] This process yielded an initial list of 288 trigger sequences (SEQ ID NO: 1-288) outlined in Table 1. Each unique trigger was identified in at least 870 cancer patients’ tumor samples.Example 4: Toehold switch system design

[0182] Poor dynamic range of toehold switches can arise from low specificity, locked off state, leaky off state and many more. The designed system enhances specificity and thus leads to higher dynamic range and better performance. This novel system comprises two concatenated toehold switches so it will be activated only when their corresponding triggers are present in the cancerous cell. By creating a more complex system as such, one can lower the possibility for leaky off state, which happens when the toehold secondary structure opens even without the trigger due to instability. Moreover, by increasing specificity a lower possibility of off target binding is achieved. Modeling such a complex system poses many computational challenges. The algorithm of the invention is focused on optimization of theprocess of switch design. It is based on optimizing structural and thermodynamic characteristics such as stem size, loop size, folding energies of the different states and hybridization energy of each trigger and its trigger binding domain.

[0183] Moreover, the Inventors encountered several challenges that led us to develop a few novel techniques (Fig. 4):1. Prediction of RNA secondary structure of the toehold switch (including the gene of interest) isn't reliable enough by using common tools, due to the long length of the sequence. Therefore, a new approach was developed. To increase the reliability of the prediction, the problem was converted into linear programming by using a sliding window algorithm. The algorithm weighs all predictions of fixed or different sized windows of the sequence to predict the most probable secondary structure. This approach also helps prevent unwanted pseudoknots.2. In most studies, access to the Kozak sequence is prevented by locating it within the hairpin. In this algorithm optimization of the Kozak sequence and its localization is optimized in order to ensure preventing access in the OFF state.3. Surprisingly, the toehold switch structure is affected by the sequence of the gene of interest. In the algorithm, adaptation of the toehold switch sequence was performed according to the gene of interest characteristics using codon usage bias (CUB), typical decoding rate (TDR) and more. Similar methods are also used to increases expression levels in the ON state.4. The linker, the sequence between the start codon and the gene of interest, has an effect on the expressed gene of interest. Therefore, the algorithm optimizes the length of the linker and its sequence to produce the shortest possible linker that does not affect the toehold switch activity, and / or the OFF and ON states.5. Preventing T cell epitope (immunogenic epitopes recognized by T cells) entrance in all algorithm stages is highly important.

[0184] Toehold sequences were designed for 288 trigger RNAs identified. These toehold sequences (SEQ ID NO: 289-576) are effective in shutting off translation in the absence of the trigger and initiating translation when it is present.

[0185] Table 1: Cancer specific trigger RNAs and their designed toehold sequencesExample 5: Cancer targeting via toehold specific to mutations in PIK3CA

[0186] As toeholds allow for specific expression of a gene of interest in a target tissue expressing the trigger or triggers and not in tissues without the trigger / s, they are particularly suited for treating cancer. To do this a cancer specific gene, or more likely cancer specific mutation is used as the trigger sequence and the gene of interest is a toxin or other death inducing gene.

[0187] Phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha (PIK3CA) is one of the most commonly mutated oncogenes in human cancers (see Samuels and Waldman, Curr Top Microbiol Immunol. 2010;347 :21 - 41 ). The E545K mutation caused by a point mutation conversion of G to A, has been reported to be prevalent in breast cancer, colon cancer, urinary cancer, cervical cancer and many others. A toehold is designed for this mutation with the mutation in the trigger binding to the region just 5’ to the stem in the toehold. The trigger binds just before the stem and thus disrupts the secondary structure allowing the small ribosome subunit to pass. The mutated nucleotide is reverse complementary to a base in the region just before the stem and not in the stem itself, as this region must be hybridized (thus creating specificity to the cancer cell) before the stem structure is disrupted. The presence of the mutation in the region that binds (outside the stem) provides specificity. Surprisingly, even a single mismatch at the mutation site provides increased expression only in the presence of the mutant RNA.

[0188] The HB2 breast epithelial cell line is wild-type for PIK3CA and comprises a glutamic acid residue at position 545. The breast cancer cell line MCF-7 comprises the G to A mutation that causes a lysine residue at position 545. Thus, MCF-7 cells express the trigger RNA and HB2 cells do not.

[0189] Klotho protein was selected as the gene of interest to be delivered to the cancer cells. Klotho is a tumor suppressor gene that has been shown to induce cell death in MCF7 cells (see Abboud et al., 2024, “Revealing the tumor suppressive sequence within KL1 domain of the hormone Klotho”, Oncogene, 43, 354-362, the contents of which are herebyincorporated by reference in their entirety). Though Klotho is 1012 amino acids long (SEQ ID NO: 577), amino acids 34 to 503 (the KL1 domain, SEQ ID NO: 578) and an even shorter truncation of just amino acids 34 to 340 (called KL340, SEQ ID NO: 579) were both shown to retain the cancer cell killing ability of the full protein. Thus, two toehold constructs are generated in a pcDNA3.1 plasmid backbone, one in which the PIK3CA E545K toehold is inserted in front of a coding sequence for the first 503 amino of Klotho and one in which the toehold is inserted in front of a coding sequence for just the first 340 amino acids.

[0190] The two plasmids are transfected into equal numbers of HB2 cells and MCF7 cells and klotho protein is measured by western blot after cell lysis. Low levels of both Klotho fragments are still present in HB2 cells attesting to the leakiness of single hairpin toeholds in eukaryotes. Nevertheless, Klotho expression is greatly increased in the cancerous MCF7 cells that express the trigger. Quantification of the western blot finds that Klotho levels were at least doubled in the cancer cells as compared to the PIK3CA WT cells. This difference is striking, as it is achieved using endogenous expression and occurs with just a single nucleotide change between the trigger and the mRNA found in the not targeted cells. That is, even a single base pair mismatch between the trigger and the toehold is able to halve transcription levels. The low levels of Klotho in the HB2 cells are not sufficient to induce substantial apoptosis, whereas high levels of cell death are observed in the MCF7 cells.

[0191] In order to improve the dynamic range of the toehold a double toehold is designed. In the first double toehold the already described PIK3CA E545K toehold is merely repeated twice in tandem. Even though the same sequence is used, since the mismatching RNA binds much less frequently, it will be unlikely that two mismatched RNAs will bind at the same time. A second double toehold is constructed to include a second toehold to a different mutation that is present in MCF7 cells but not healthy breast cells. Both double toehold constructs are transfected into HB2 and MF7 cells and Klotho protein is measured as before. The double toehold constructs show much lower leakage and thus Klotho expression in HB2 cells is very low or undetectable. In contrast expression is still high in MCF7 cells. Killing is again specific to MCF7 cells and is not observed in the HB2 cells. This demonstrates the unexpected added efficacy of double toeholds in eukaryotic cells.

[0192] A toehold against a second PIK3CA mutation was also generated. The M489I mutation has been reported in colon cancer and is caused by a G to A mutation. A toehold was designed for this mutation with the following sequence selected as the trigger: UAAAGUUCCCAGAUAUAUCAGUG (SEQ ID NO: 580). The designed toehold sequence wasCACUGAGAUAUUUGGGAAUUUUGACCAAACCCCCACAAAAUUCUCAAAUAA ACCAAAAUGCCCGCCAGCGCCCCGCCGCGCCGCCCGCGGCCGCCGCCGCCGUC GCUGUC (SEQ ID NO: 581, trigger binding region underlined, base pairs of the stem in bold, base reverse complementary to the point mutation in italics). The trigger binds just before the stem and within the stem and thus disrupts the secondary structure allowing the small ribosome subunit to pass. The mutated nucleotide is reverse complementary to a base in the region just before the stem and not in the stem itself, as this region must be hybridized (thus creating specificity to the cancer cell) before the stem structure is disrupted.

[0193] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

Claims

CLAIMS:

1. A method of designing a synthetic RNA molecule, the method comprising: a. obtaining a coding sequence encoding a protein of interest; b. obtaining a first RNA sequence expressed in a cancerous cell and not expressed or lowly expressed in a noncancerous cell; c. obtaining a second RNA sequence expressed in said cancerous cell and not expressed or lowly expression in said noncancerous cell; and d. producing a sequence of a synthetic RNA molecule comprising from 5’ to 3’: i. a reverse complement to said first sequence comprising a first 5’ unhybridized region and a first 3’ hybridized region; ii. a first loop region that does not hybridize to any of (i), (ii) and (iii); iii. a region reverse complementary to said first 3’ hybridized region of (i); iv. a reverse complement to said second sequence comprising a second 5’ unhybridized region and a second 3’ hybridized region; v. a second loop region that does not hybridize to any of (iv), (v) and (vi); vi. a region reverse complementary to said second 3’ hybridized region of (iv); and vii. said obtained coding sequence encoding a protein of interest; thereby designing a synthetic RNA molecule.

2. The method of claim 1, wherein said synthetic RNA molecule produces said protein of interest in said cancerous cell and does not produce or lowly produces said protein of interest in said noncancerous cell.

3. The method of claim 1 or 2, wherein said first RNA sequence expressed in a cancerous cell, said second RNA sequence expressed in a cancerous cell or both is not a microRNA (miRNA).

4. The method of claim 3, wherein said first RNA sequence expressed in a cancerous cell, said second RNA sequence expressed in a cancerous cell or both is a sequence from a messenger RNA (mRNA).

5. The method of any one of claims 1 to 4, wherein said first sequence, said second sequence or both comprise an oncogenic mutation.

6. The method of claim 5, wherein said oncogenic mutation is highly expressed in said cancerous cell and is a somatic mutation.

7. The method of claim 6, wherein said oncogenic mutation in said first sequence is reverse complementary to a base in the first 5’ unhybridized region, said oncogenic mutation in said second sequence is reverse complementary to a base in the second 5’ unhybridized region or both.

8. The method of any one of claims 1 to 7, wherein said first RNA sequence and said second RNA sequence are from different mRNAs.

9. The method of any one of claims 1 to 8, wherein said first sequence, said second sequence or both is in an unfolded region of said RNA.

10. The method of claim 9, wherein an unfolded region is a region with a local folding energy above a predetermined threshold.

11. The method of claims 9 or 10, wherein said folding is determined for said first sequence, said second sequence or both.

12. The method of any one of claims 9 to 11, wherein selecting an unfolded region comprises performing a window search algorithm that produces a folding matrix indicating the probability of each nucleotide of said sequence of an RNA hybridizing to another nucleotide of said sequence of an RNA and selecting a window predicted to not hybridize.

13. The method of any one of claims 9 to 12, wherein selecting a region comprises evaluating the local folding energy of windows adjacent to said region and / or the folding of said region to windows adjacent to said region.

14. The method of any one of claims 1 to 13, wherein said first sequence, said second sequence or both is between 20 and 100 nucleotides, optionally wherein said first sequence, said second sequence or both is between 20-30 nucleotides.

15. The method of any one of claims 12 to 14, wherein said window is an outer window and wherein each outer window is subdivided into inner windows consisting of a portion that is less than 100% of said outer window and wherein said producing a folding matrix is producing a folding matrix for each inner window.

16. The method of claim 15, wherein said selecting an unfolded region further comprises summing the folding energies for each inner window across all outer windows to produce an inner window folding value, summing the inner window folding values of all inner windows in each outer window to produce an outer window folding value and selecting an outer window with a folding value beyond a predetermined threshold.

17. The method of any one of claims 1 to 16, wherein said sequence of a synthetic RNA comprises a spacer between region (iii) and region (iv) such that regions i-iii form a first stem-loop structure and regions iv-vi form a second stem-loop structure and said structures are separated by a linear stretch of sequence that is said spacer, optionally wherein said spacer comprises at least 10 linear nucleotides.

18. The method of any one of claims 1 to 17, further comprising confirming formation of a stem- loop structure comprising said first 3’ hybridized region, said first loop region and said first region reverse complementary to said 3’ hybridized region and a stemloop structure comprising said second 3’ hybridized region, said second loop region and said second region reverse complementary to said 3’ hybridized region.

19. The method of claim 18, wherein said confirming comprises performing a sliding window RNA folding prediction algorithm across the full sequence of the synthetic RNA and selecting the most probable secondary structure.

20. The method of claim 18 or 19, further comprising optimizing stem size, loop size, folding energy in the absence of said first and / or said second RNA, folding energy in the presence of said first and / or said second RNA, hybridization energy of said firstsequence to said reverse complement to said first sequence, hybridization energy of said second sequence to said reverse complement to said second sequence or a combination thereof by performing a sliding window RNA folding prediction algorithm across the full sequence of the synthetic RNA and selecting an optimized secondary structure.

21. The method of any one of claims 1 to 20, wherein a start codon of said coding sequence is located within 20 nucleotides of region vi.

22. The method of any one of claims 1 to 21, wherein synthetic RNA sequence between a start codon of said coding sequence and said obtained coding sequence is codon optimized to match a codon usage of said coding sequence encoding a protein of interest.

23. The method of claim 22, wherein said codon optimization comprises codon usage bias (CUB) optimization or typical decoding rate (TDR) optimization.

24. The method of any one of claims 21 to 23, wherein a start codon of said coding sequence encoding a protein of interest is separated from the rest of said coding sequence by a linker.

25. The method of claim 24, wherein said start codon is in said loop of region v and said linker is within said region vi reverse complementary to said second 3’ hybridized region.

26. The method of claims 24 or 25, comprising optimizing said linker to be as short as possible while expression of said protein of interest is still inhibited in the absence of said first and second RNAs.

27. The method of any one of claims 1 to 26, wherein the synthetic RNA comprises an unhybridized region between a first and second part of said first 3’ hybridized region, a first and second part of said second 3’ hybridized region, a first and second part of said first region reverse complementary to said 3’ hybridized region, a first and second part of said second region reverse complementary to said 3’ hybridized region or a combination thereof.

28. The method of claim 27, wherein said start codon is located in said unhybridized region between a first and second part of said second region reverse complementary to said 3’ hybridized region.

29. The method of claim 28, wherein said linker comprises said second part of said second region reverse complementary to said second 3’ hybridized region which is 3’ to said start codon.

30. The method of any one of claims 1 to 29, further comprising confirming said synthetic RNA molecule produces said protein of interest in said cancerous cell and does not produce or lowly produces said protein of interest in said noncancerous cell.

31. The method of claim 30, comprising applying a trained regressor algorithm to predict protein of interest production.

32. The method of any one of claims 1 to 31, wherein said protein of interest is a toxin or tumor suppressor.

33. The method of claim 32, wherein said protein of interest is a Klotho protein comprising or consisting of SEQ ID NO: 577 or a fragment thereof comprising SEQ ID NO: 578 or SEQ ID NO: 579.

34. The method of any one of claims 1 to 33, wherein said first RNA sequence, said second RNA sequence or both comprise or consist of a sequence selected from SEQ ID NO: 1-288 and 580 and said regions i-iii, said regions iv-vi or both comprise or consist of a sequence that can hybridize said first RNA sequence, said second RNA sequence or both selected from SEQ ID NO: 289-576 and 581.

35. The method of any one of claims 1 to 34, wherein said loop region is not a bulge region.

36. The method of any one of claims 1 to 35, wherein said noncancerous cell is of the same cell type or tissue as said cancerous cell.

37. A computer program product comprising a non-transitory computer-readable storage medium having program code embodied thereon, the program code executable by at least one hardware processor to perform a method of any one of claims 1 to 36.

38. A synthetic RNA molecule produced by a method of any one of claims 1 to 36.

39. A synthetic RNA comprising a 5’ cap and a coding sequence encoding a protein of interest, wherein a toehold sequence selected from SEQ ID NO: 289-576 and 581 is present 5’ to start codon of said coding sequence.

40. The synthetic RNA of claim 35, wherein said start codon is not more than 20 bases 3’ to said toehold sequence.

41. A method of producing expression of a sequence of interest in a cancerous cell and not in a noncancerous cell of the same cell type or tissue as said cancerous cell, the method comprising introducing the synthetic RNA molecule of claim any one of claims 38 to 40 into said cancerous cell and said noncancerous cell, thereby producing expression of a sequence of interest in a cancerous cell and not in a noncancerous cell.

42. The method of claim 41, being a method of treating cancer in a subject in need thereof, wherein said introducing comprises administering said synthetic RNA molecule or a DNA molecule that encodes said synthetic RNA molecule to said subject.

Images