Genome-processed strain for efficient synthesis of non-natural amino acid-introduced protein and method for producing cell lysate
A genome-engineered strain with a genetic construct for protein purification addresses inefficiencies in cell-free protein synthesis by removing natural enzymes and using a tRNA-unnatural amino acid complex, enabling efficient production of proteins with non-natural amino acids for industrial applications.
Patent Information
- Application Number
- PCT/KR2025/004955
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-04-11
- Filing Date
- 2025-04-11
- Publication Date
- 2025-10-16
AI Technical Summary
Conventional cell-free protein synthesis technologies face challenges in efficiently introducing non-natural amino acids due to competition with natural amino acids, difficulty in selectively removing specific enzymes, complexity in reconstituting systems, lack of energy source regeneration, and limitations in synthesizing proteins with multiple non-natural amino acids.
A genome-engineered strain with a genetic construct inserted for protein purification is developed, allowing for the removal of natural enzyme proteins and the use of a cell lysate to create a cell-free protein synthesis system that includes a tRNA-unnatural amino acid complex, enabling efficient introduction of non-natural amino acids without affecting cell growth and simplifying the purification process.
The system effectively blocks competition between natural and non-natural amino acids, facilitating high-efficiency production of proteins with non-natural amino acids, suitable for mass production and applications in industries requiring customized proteins.
Smart Images

Figure KR2025004955_16102025_PF_FP_ABST
Abstract
Description
Method for producing a genome-engineered strain and cell lysate for efficient synthesis of proteins containing non-natural amino acids
[0001] The present invention relates to a cell lysate from which a natural enzyme protein having a tag inserted for protein purification has been removed, and a cell-free protein synthesis technique using the same.
[0002] Recent advances in genetic engineering and molecular biology have led to active efforts to custom-produce specific proteins for use in various industries, research, and disease treatment. These target proteins are typically produced by introducing a vector expressing the protein into a host cell and then expressing it. In some cases, systems utilizing eukaryotic cells, prokaryotic cells, transgenic plants, or transgenic animals are utilized.
[0003] Recently, cell-free protein synthesis systems (CFPS systems), which extract only the cellular protein synthesis machinery and artificially synthesize proteins in vitro without directly utilizing cells, have been attracting attention. Cell-free protein synthesis systems are simple and efficient, capable of synthesizing proteins in a short period of time using only transcription and translation machinery, without the need for complex processes such as cell culture, transformation, or cell manipulation. These systems can overcome various limitations of cell-based systems, such as protein toxicity, aggregation, misfolding, and post-translational modification. Furthermore, they offer advantages such as ease of purification, process simplification, and reduced production time, making them highly promising for industrial applications.
[0004] However, conventional cell-free protein synthesis technologies are known to have the following limitations.
[0005] First, when attempting to introduce non-natural amino acids, the efficiency of their introduction is significantly reduced due to competition with existing natural amino acids. To address this, attempts have been made to eliminate specific acylating enzymes (aminoacyl-tRNA synthetases). However, these enzymes are essential for cell survival and growth, making complete elimination at the genome level impractical.
[0006] Second, cell-free systems based on cell lysate contain a mixture of various enzymes and proteins, making it very difficult to selectively remove specific enzymes.
[0007] Third, while reconstituted cell-free systems (CFPS) offer the advantage of freely configuring components by individually purifying and mixing them, the process is complex, labor-intensive, and uneconomical. Furthermore, the lack of a regeneration system for energy sources like ATP results in low synthesis yields, making them unsuitable for mass production.
[0008] Fourth, most existing technologies are limited to simple methods of introducing only one type of non-natural amino acid by utilizing a stop codon, and it is virtually impossible to synthesize high-difficulty proteins by simultaneously introducing multiple non-natural amino acids (multi-site incorporation).
[0009] Therefore, there is a need for a cell-free protein synthesis technology that can efficiently introduce non-natural amino acids without affecting cell growth and selectively remove only specific enzymes.
[0010] Accordingly, the present inventors have secured a strain whose genome has been precisely improved to maximize the efficient introduction of non-canonical amino acids (ncAAs) by selectively removing specific enzymes in cell lysate, and developed a cell-free protein synthesis system and method using the strain, thereby completing the present invention.
[0011] One object of the present invention is to provide a gene construct comprising a natural enzyme gene into which a tag for protein purification has been inserted.
[0012] Another object of the present invention is to provide a cell into which the genetic construct has been introduced.
[0013] Another object of the present invention is to provide a cell lysate from which a natural enzyme protein is removed and into which a tag for protein purification is inserted.
[0014] Another object of the present invention is to provide a method for producing the cell lysate.
[0015] Another object of the present invention is to provide a cell-free protein synthesis system.
[0016] Another object of the present invention is to provide a method for cell-free protein synthesis.
[0017] The terminology used herein is for the purpose of description only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. It should be understood that terms such as "comprise" or "have" in the present invention are intended to specify the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but do not preclude the possibility of the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.
[0018] Additionally, unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments pertain. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.
[0019] Furthermore, to avoid confusion due to overlapping content, the description of overlapping content will be omitted. In other words, the invention is not limited to the content described below, and the invention should be interpreted based on the overall scope of the invention.
[0020] Hereinafter, the present invention will be described in detail.
[0021] The present invention provides a genetic construct designed to insert a tag for protein purification into a specific site of a native enzyme gene.
[0022] In the present invention, the term "gene construct" is used in the same sense as a construct generally referred to as a "single or double stranded DNA cassette", and refers to a linear nucleic acid molecule comprising a base sequence homologous to a natural enzyme gene, a tag for protein purification, an FRT sequence, and a positive selection marker surrounded by the FRT sequence.
[0023] In the present invention, "protein" is used interchangeably with "polypeptide" or "peptide" to refer to a polymer of amino acids. Typically, "protein" is defined as a longer polymer of amino acids, typically greater than 50, 60, 70, 80, 90, or 100 amino acids in length.
[0024] In the present invention, the term "protein purification tag" refers to an amino acid sequence that allows purification of a specific protein. The protein purification tag may be any one selected from the group consisting of Strep-Tag II, one chitin binding domain (CBD1), three chitin binding domains (CBD3), His-Tag, and FLAG-Tag, each of which has a base sequence shown in SEQ ID NOs: 1 to 5. The protein purification tag may preferably be Strep-Tag II or CBD3. If necessary, each protein purification tag may additionally include a GS linker, and sequences of Strep-Tag II, CBD1, and CBD3 that additionally include a GS linker are shown in SEQ ID NOs: 6 to 8.
[0025] Additionally, the protein purification tag may be inserted into the terminal region of the native enzyme gene. Specifically, it may be inserted into the N-terminal region or the C-terminal region of the amino acid sequence of the native enzyme gene, and preferably, it may be inserted into the C-terminal region of the native enzyme gene.
[0026] According to one embodiment, the protein purification tag of the present invention may be inserted so as to be located upstream of the stop codon in the base sequence of the native enzyme gene. Embodiments including the protein purification tag at the terminal region of the native enzyme gene are shown in SEQ ID NOs: 31 to 36 and SEQ ID NO: 43. These sequences are illustrative and are not limiting.
[0027] In the present invention, the term "natural enzyme gene" refers to a gene that naturally exists in the genome of an organism (e.g., Escherichia coli) and encodes an enzyme protein involved in translation or protein biosynthesis processes. The natural enzyme gene may be any one selected from the group consisting of LysRS, GluRS, SerRS, LeuRS, AlaRS, ArgRS, AsnRS, AspRS, CysRS, GlnRS, GlyRS, HisRS, IleRS, MetRS, PheRS, ProRS, ThrRS, TrpRS, TyrRS, ValRS, and release factor 1 (RF1). Preferably, it may be release factor 1 (RF1). As an example, the base sequences of LysRS, GluRS, SerRS, and RF1 are shown in SEQ ID NOs: 9 to 12.
[0028] In the present invention, “base sequence homologous to a cellular genome” means a nucleic acid sequence having a sequence identical to or functionally equivalent to a target region of a cellular genome added to both ends to induce a gene construct to be inserted into a specific location during a cellular genome editing process.
[0029] According to one embodiment, the genetic construct of the present invention can maximize insertion efficiency by inserting a 50 bp long base sequence homologous to the Escherichia coli genome at both ends of the native enzyme gene. This homologous sequence can be adjusted to an appropriate length, such as, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 bp.
[0030] The genetic construct of the present invention may additionally comprise a positive selection marker and a negative selection marker.
[0031] In the present invention, a "positive selection marker" is a marker that enables positive selection by allowing only cells expressing the selection marker to survive in an environment treated with a selective agent, and includes a kanamycin resistance gene (KanR), an ampicillin resistance gene (AmpR), a chloramphenicol resistance gene (CmR), and a tetracycline resistance gene (TetR), and preferably a kanamycin resistance gene (KanR). The base sequences of KanR, AmpR, and CmR are shown in SEQ ID NOs: 13 to 15.
[0032] In the present invention, the "negative selection marker" refers to a marker that enables negative selection to select and eliminate cells in which random insertion has occurred, and may be any one selected from the group consisting of the ccdB gene, rpsL, and sacB, and preferably the ccdB gene. The base sequence of the ccdB gene is shown in SEQ ID NO: 16.
[0033] According to one embodiment, the genetic construct of the present invention may include base sequences homologous to the cellular genome at both ends of the genes of the positive selection marker and the negative selection marker, wherein the base sequences are 50 bp or longer and serve to induce accurate insertion during genome editing.
[0034] The genetic construct of the present invention can be integrated into a specific target region of a cell genome by genome editing, and the genome editing can be performed by the FLP-FRT recombination system or the Lambda red recombination system.
[0035] Specifically, the "FLP-FRT recombination system" is used synonymously with the "Flippase system" and refers to a genome recombination technology that selectively deletes or replaces a nucleic acid sequence located between two FRT (Flippase Recognition Target) sequences using a yeast-derived Flippase (FLP) recombinase. The FLP enzyme recognizes the FRT sequence and can accurately cleave and remove the gene inserted between them. The base sequences of the FLP enzyme and FRT used here are shown in SEQ ID NOs: 17 and 18.
[0036] According to one embodiment, a gene construct including a positive selection marker surrounded by an FRT sequence is inserted into the genome of a target cell using a Lambda red recombination system, and then an FLP recombinase that recognizes the FRT sequence is introduced, thereby selectively removing the positive selection marker.
[0037] In addition, the "Lambda red recombination system" refers to a genome recombination technology that includes genetic recombination enzymes (Exo, Beta, Gam) derived from bacteriophage lambda (or λ phage) and induces the insertion of a foreign nucleic acid into a homologous sequence in the cellular genome by homologous recombination. Exo processes the end of donor DNA to produce a single-stranded DNA, Beta aligns the single-stranded DNA to a homologous region of the genome, and Gam prevents digestion by the host's RecBCD or SbcCD nuclease, thereby improving the recombination efficiency. The base sequences of Exo, Gamma, and Beta used here are shown in SEQ ID NOs: 19 to 21.
[0038] According to one embodiment, a genetic construct additionally including a positive selection marker and a negative selection marker can be inserted into the genome of a target cell by performing first genome editing and second genome editing using a Lambda red recombination system. In the first genome editing, a genetic construct including positive and negative selection markers is inserted to secure cells selected by the positive selection marker, and in the second genome editing, a genetic construct including only a protein purification tag from which the positive selection marker has been removed is reinserted to secure cells selected by the negative selection marker.
[0039] The present invention provides a cell into which the above genetic construct has been introduced.
[0040] In the present invention, “introduction” means an act of delivering external genetic material (e.g., a genetic construct) into a cell, and may include transfection or transduction.
[0041] The above cell may be any one selected from the group consisting of prokaryotic cells (bacteria such as Bacillus subtilis, Vibrio natriegens, etc., including E. coli) and eukaryotic cells (mammalian cells, insect cells, yeast cells, and plant cells including wheat germ), but is not limited thereto. Preferably, it may be E. coli.
[0042] The present invention provides a cell lysate prepared by disrupting cells into which the above genetic construct has been introduced.
[0043] In the present invention, "cell disruption" means a process of destroying a cell membrane or cell wall, such as a process of stirring cells with beads, to release cell contents, and "cell lysate" means a mixture of intracellular and extracellular substances obtained by disrupting cells.
[0044] The above cell disruption may be performed by, but is not limited to, cell disruption using a sonicator, high pressure disruption, pulsed electric field disruption, enzyme disruption, osmotic pressure disruption, electron beam disruption, or organic solvent disruption. Preferably, cell disruption may be performed using a sonicator.
[0045] According to one embodiment, a cell disruption solution can be prepared through cell disruption using a supersonic disperser (sonicator), and it was confirmed that the activity of the cell disruption solution was highest when cell disruption was performed by setting the sonication power of the supersonic disperser to 62.5 watts.
[0046] The present invention provides a cell lysate from which a natural enzyme protein having a tag inserted for protein purification has been removed.
[0047] The cell lysate may be selected from the group consisting of eukaryotic cells, Escherichia coli cells, yeast cells, and Kluyveromyces cells. The cell lysate may be used to synthesize a cell extract, wherein bacterial cells having altered nuclease or phosphatase activity (e.g., at least one mutated phosphatase or nuclease gene, or a combination thereof) are used to increase the synthesis efficiency. Preferably, a cell lysate of Escherichia coli (E. coli) may be used. For example, an E. coli strain deficient in RNase E or RNase A (e.g., by mutation) may be used to prepare an S30 extract for CFPS.
[0048] The cell lysate from which the natural enzyme protein having the protein purification tag inserted according to the present invention has been removed can be usefully used for the production of a protein having an unnatural amino acid inserted by removing the natural enzyme protein having the desired protein purification tag inserted.
[0049] Meanwhile, cell lysates do not contain complete cells, but rather contain, for example, ribosomes for protein translation, transfer RNA, aminoacyl-tRNA synthetase, initiation factors, elongation factors, and termination factors required for protein synthesis. Furthermore, the extract may also contain other proteins derived from the cell cytoplasm, particularly soluble proteins.
[0050] The present invention provides a method for producing a cell lysate from which a natural enzyme protein having a tag inserted for protein purification has been removed.
[0051] The above manufacturing method may include a step of purifying a cell lysate produced by disrupting cells into which a genetic construct has been introduced using a purification resin to remove a natural enzyme protein into which a tag for protein purification has been inserted.
[0052] Additionally, the purification may be accomplished through column purification or batch purification.
[0053] In the present invention, "column purification" means a method of separating a substance by utilizing the principle that a stationary phase, an adsorbent, is fixed to a column and a mobile phase, an eluent, is forced to flow through the column under pressure, thereby separating the substance according to the degree of affinity between the adsorbent and the substance to be separated. The column is not limited thereto, but includes various types of high-performance liquid chromatography (HPLC) columns and gas chromatography (GC) columns.
[0054] According to one embodiment, a column or tube is filled with a purification resin that acts as a stationary phase, and a cell lysate is brought into contact with the resin to adsorb the protein (a natural enzyme protein to which a protein purification tag is attached) by utilizing selective binding between the resin and the protein to be purified, thereby obtaining a purified cell lysate. In addition, it was confirmed that at least 200 μL of resin is required to efficiently remove RF1 to which a protein purification tag is attached from 500 μL of the cell lysate.
[0055] In the present invention, "batch purification" refers to a method in which the purification target and the stationary phase are mixed in a single container, reacted together for a certain period of time to induce selective binding, and then the target substance is isolated using the eluate. This batch purification differs from column purification in that the stationary phase is not packed in a column, but rather mixed with the sample to induce selective binding.
[0056] According to one embodiment, a certain amount of purification resin, which acts as a stationary phase, is added to the cell lysate, and then mixed and reacted within a tube to remove the protein to be purified (a natural enzyme protein with a protein purification tag attached). Furthermore, it was confirmed that at least 200 μL of resin is required to efficiently remove RF1 with a protein purification tag attached from 500 μL of cell lysate.
[0057] The present invention provides a cell-free protein synthesis system.
[0058] Specifically, a cell-free protein synthesis system is provided, comprising: (i) a cell lysate from which a native enzyme protein having a tag for protein purification has been removed; and (ii) a tRNA-unnatural amino acid complex that specifically recognizes a codon from which the introduction of an unnatural amino acid is possible by removing the native enzyme.
[0059] In addition, a composition for cell-free protein synthesis is provided, comprising (i) a cell lysate from which a natural enzyme protein having a tag for protein purification has been removed; and (ii) a tRNA-unnatural amino acid complex that specifically recognizes a codon from which the introduction of an unnatural amino acid is possible by removing the natural enzyme.
[0060] In addition, a kit for cell-free protein synthesis is provided, comprising (i) a cell lysate from which a natural enzyme protein having a tag for protein purification has been removed; and (ii) a tRNA-unnatural amino acid complex specifically introduced into a codon where the introduction of an unnatural amino acid is enabled by the removal of the natural enzyme.
[0061] In addition, the present invention provides a cell-free protein synthesis method using the above system.
[0062] The above cell-free protein synthesis method may comprise the following steps:
[0063] (i) a step of reacting a cell lysate from which a natural enzyme protein having a protein purification tag inserted therein has been removed; and a tRNA-unnatural amino acid complex that specifically recognizes a codon from which the introduction of an unnatural amino acid is possible by removing the natural enzyme; with a polynucleotide template; and
[0064] (ii) A step of synthesizing a protein into which a non-natural amino acid has been introduced through the above reaction.
[0065] The term "cell-free protein synthesis" of the present invention refers to a technology for mass producing a target protein in a short period of time by extracting only the intracellular protein synthesis machinery and its factors related to protein production in a cell and artificially repeating only the protein synthesis process outside the cell while excluding the physiological control mechanism of the cell. The required protein biosynthesis machinery, i.e., ribosome, initiation factor, elongation factor, termination factor, aminoacyl tRNA synthetase, etc., can be used as contained in the cell lysate or can be used separately.
[0066] The above cell-free protein synthesis may be performed in a vessel, such as a single vessel. The term "vessel" as used herein refers to any container suitable for containing reactants. Examples of vessels include, but are not limited to, microtiter plates, test tubes, centrifuge tubes, beakers, flasks, multi-well plates, cuvettes, flow systems, microfibers, microscope slides, and the like.
[0067] The polynucleotide template according to the present invention may be, for example, a DNA template or an RNA template.
[0068] For example, in the present invention, "DNA template" refers to a DNA sequence capable of transcribing a linear RNA polypeptide. For example, the DNA template may include, but is not limited to, a DNA vector, a PCR product, or a plasmid.
[0069] The polynucleotide template of the present invention has a protein purification tag inserted into it, and the position of the non-natural amino acid that can be inserted varies depending on the type of natural enzyme protein from which it was removed. More specifically, the codon sequence corresponding to the position where the non-natural amino acid is inserted for each natural enzyme is shown in Table 1 below.
[0070] Codons that enable the introduction of unnatural amino acids by removing natural enzymesLysRSAAA, AAGGluRSGAA, GAGSerRSUCU, UCC, UCA, UCG, AGU, AGCLeuRSUUA, UUG, CUU, CUC, CUA, CUGAlaRSGCU, GCC, GCA, GCGArgRSCGU, CGC, CGA, CGGAsnRSAAU, AACAspRSGAU, GACCysRSUGU, UGCGlnRSCAA, CAGGlyRSGGU, GGC, GGA, GGGHisRSCAU, CACIleRSAUU, AUC, AUAMetRSAUGPheRSUUU, UUCProRSCCU, CCC, CCA, CCGThrRSACU, ACC, ACA, ACGTrpRSUGGTyrRSUAU, UACValRSGUU, GUC, GUA, GUGRelease factor 1(RF1)UAGRelease factor 2(RF2)UGA
[0071] According to a temporary embodiment of the present invention, if the removed natural enzyme protein is Release factor 1 (RF1), the UAG codon may be used. The UAG codon typically functions as a stop codon for protein translation, but in the present invention, it is utilized as a position where a non-natural amino acid can be selectively introduced.
[0072] Specifically, by providing a tRNA-unnatural amino acid complex that specifically recognizes the UAG codon to the reaction system, the UAG codon acts to signal the insertion of the unnatural amino acid, thereby effectively inserting the unnatural amino acid into a specific target region.
[0073] In the present invention, "non-canonical amino acids (ncAAs)" refers to amino acids other than the 20 amino acids that exist in nature. Non-canonical amino acids are very useful as intermediate products of pharmaceuticals, and there are over 700 types of non-natural amino acids known to date. These non-natural amino acids include L-alpha, D-alpha, N-alkyl, beta, gamma, delta, eta, and zeta-amino acids, and in the case of alpha amino acids, there are forms in which various functional moieties are attached to the side chain, or carboxylic acids containing aromatic moieties.
[0074] These unnatural amino acids may vary depending on the desired natural enzyme.
[0075] 예를 들어, 상기 비천연 아미노산은 곁가지에 형광 표지(3,5-dinitrobenzyl (R)-2-amino-3-(7-methoxy-2-oxo-2H-chromene-3-carboxamido)propanoate)가 부착된 L-α- (1-(3,5-dinitrophenoxy)-2-methyl-1-oxopropan-2-aminium 등), β- (3,5-dinitrobenzyl 3-aminobutanoate 등), γ- (5-(3,5-dinitrobenzyl) 1-methyl L-glutamate 등), δ-, ε-, ζ-, D-아미노산 (3,5-dinitrobenzyl D-methioninate, 3,5-dinitrobenzyl D-valinate, cyanomethyl (R)-3-(2H-1l4-indol-3-yl)-2-aminopropanoate, 3,5-dinitrobenzyl D-asparaginate, 3,5-dinitrobenzyl D-lysinate, 3,5-dinitrobenzyl D-serinate, 3,5-dinitrobenzyl D-leucinate, 3,5-dinitrobenzyl D-allothreoninate, (R)-4-amino-7-(3,5-dinitrophenyl)-5-oxoheptanamide, 3,5-dinitrobenzyl D-argininate, 3,5-dinitrobenzyl D-alaninate, 3,5-dinitrobenzyl D-alloisoleucinate, 3,5-dinitrobenzyl D-cysteinate, (R)-3-amino-4-((3,5-dinitrobenzyl)oxy)-4-oxobutanoic acid, 3,5-dinitrobenzyl D-histidinate, cyanomethyl D-phenylalaninate, 3,5-dinitrobenzyl D-prolinate, cyanomethyl D-tyrosinate, (R)-4-amino-5-((3,It may be any one selected from the group consisting of, but is not limited to, carboxylic acids without amino groups (e.g., 5-dinitrobenzyl)oxy)-5-oxopentanoic acid, etc.), and carboxylic acids without amino groups (cyanomethyl 3-(azidomethyl)benzoate, 2-(4-(((3-hydroxybutanoyl)thio)methyl)benzamido)ethan-1-aminium).
[0076] The specific molecular structure of the above 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate is as shown in Chemical Formula 1 below.
[0077] [Chemical Formula 1]
[0078]
[0079] The specific molecular structure of the above 3,5-dinitrobenzyl (R)-2-amino-3-(7-methoxy-2-oxo-2H-chromene-3-carboxamido)propanoate is as shown in Chemical Formula 2 below.
[0080] [Chemical Formula 2]
[0081]
[0082] The specific molecular structure of the above 1-(3,5-dinitrophenoxy)-2-methyl-1-oxopropan-2-aminium is as shown in Chemical Formula 3 below.
[0083] [Chemical Formula 3]
[0084]
[0085] The specific molecular structure of the above 3,5-dinitrobenzyl 3-aminobutanoate is as shown in Chemical Formula 4 below.
[0086] [Chemical Formula 4]
[0087]
[0088] The specific molecular structure of the above 3,5-dinitrobenzyl D-methioninate is as shown in Chemical Formula 5 below.
[0089] [Chemical Formula 5]
[0090]
[0091] The specific molecular structure of the above 3,5-dinitrobenzyl D-valinate is as shown in Chemical Formula 6 below.
[0092] [Chemical Formula 6]
[0093]
[0094] The specific molecular structure of the above cyanomethyl (R)-3-(2H-1l4-indol-3-yl)-2-aminopropanoate is as shown in Chemical Formula 7 below.
[0095] [Chemical Formula 7]
[0096]
[0097] The specific molecular structure of the above 3,5-dinitrobenzyl D-asparaginate is as shown in Chemical Formula 8 below.
[0098] [Chemical Formula 8]
[0099]
[0100] The specific molecular structure of the above 3,5-dinitrobenzyl D-lysinate is as shown in Chemical Formula 9 below.
[0101] [Chemical Formula 9]
[0102]
[0103] The specific molecular structure of the above 3,5-dinitrobenzyl D-serinate is as shown in Chemical Formula 10 below.
[0104] [Chemical Formula 10]
[0105]
[0106] The specific molecular structure of the above 3,5-dinitrobenzyl D-leucinate is as shown in Chemical Formula 11 below.
[0107] [Chemical Formula 11]
[0108]
[0109] The specific molecular structure of the above 3,5-dinitrobenzyl D-allothreoninate is as shown in Chemical Formula 12 below.
[0110] [Chemical Formula 12]
[0111]
[0112] The specific molecular structure of the above 3,5-dinitrobenzyl D-glutaminate is as shown in Chemical Formula 13 below.
[0113] [Chemical Formula 13]
[0114]
[0115] The specific molecular structure of the above 3,5-dinitrobenzyl D-argininate is as shown in Chemical Formula 14 below.
[0116] [Chemical Formula 14]
[0117]
[0118] The specific molecular structure of the above 3,5-dinitrobenzyl D-alaninate is as shown in Chemical Formula 15 below.
[0119] [Chemical Formula 15]
[0120]
[0121] The specific molecular structure of the above 3,5-dinitrobenzyl D-alloisoleucinate is as shown in Chemical Formula 16 below.
[0122] [Chemical Formula 16]
[0123]
[0124] The specific molecular structure of the above 3,5-dinitrobenzyl D-cysteinate is as shown in Chemical Formula 17 below.
[0125] [Chemical Formula 17]
[0126]
[0127] The specific molecular structure of the above (R)-3-amino-4-((3,5-dinitrobenzyl)oxy)-4-oxobutanoic acid is as shown in Chemical Formula 18 below.
[0128] [Chemical Formula 18]
[0129]
[0130] The specific molecular structure of the above 3,5-dinitrobenzyl D-histidinate is as shown in Chemical Formula 19 below.
[0131] [Chemical Formula 19]
[0132]
[0133] The specific molecular structure of the above cyanomethyl D-phenylalaninate is as shown in Chemical Formula 20 below.
[0134] [Chemical Formula 20]
[0135]
[0136] The specific molecular structure of the above 3,5-dinitrobenzyl D-prolinate is as shown in Chemical Formula 21 below.
[0137] [Chemical Formula 21]
[0138]
[0139] The specific molecular structure of the above cyanomethyl D-tyrosinate is as shown in Chemical Formula 22 below.
[0140] [Chemical Formula 22]
[0141]
[0142] The specific molecular structure of the above (R)-4-amino-5-((3,5-dinitrobenzyl)oxy)-5-oxopentanoic acid is as shown in Chemical Formula 23 below.
[0143] [Chemical Formula 23]
[0144]
[0145] The specific molecular structure of the above cyanomethyl 3-(azidomethyl)benzoate is as shown in Chemical Formula 24 below.
[0146] [Chemical Formula 24]
[0147]
[0148] The specific molecular structure for the above 2-(4-(((3-hydroxybutanoyl)thio)methyl)benzamido)ethan-1-aminium is as shown in Chemical Formula 25 below.
[0149] [Chemical Formula 25]
[0150]
[0151] For the unnatural amino acid of the present invention to be effectively incorporated into a ribosome-based translation system, the removal of specific translation-related enzymes that can compete with endogenous tRNAs and amino acids may be necessary. For example, when utilizing the UAG codon as a site for the introduction of an unnatural amino acid, release factor 1 (RF1), which recognizes the codon and terminates translation, is removed, allowing the unnatural amino acid-binding tRNA complex to bind to the codon and insert the amino acid. The enzyme may be at least one of RF1 and aaRS, and various combinations may be used depending on the type of unnatural amino acid and the method of introduction.
[0152] In the present invention, the term "tRNA-unnatural amino acid complex" refers to a form in which an unnatural amino acid is bound to a tRNA having an anticodon complementary to a specific codon (e.g., a UAG codon), and this complex serves to help the unnatural amino acid be selectively inserted into a specific target region within the cell-free protein synthesis system of the present invention.
[0153] The above tRNA-unnatural amino acid complex is formed through a tRNA aminoacylation reaction, and the formation of this complex can be synthesized using a ribozyme, preferably an artificial ribozyme, as an aminoacyl-tRNA synthetase. For example, a developed artificial RNA catalyst, flexizyme, may be involved. The flexizyme may include, but is not limited to, dinitrobenzyl flexizyme (dFx), enhanced flexizyme (eFx), etc. Flexizyme is also known as the original flexizyme (Fx) and modified forms such as dinitrobenzyl flexizyme (dFx), enhanced flexizyme (eFx), and aminoflexizyme (aFx). A desired amino acid or hydroxy acid can be linked to the tRNA generated by the flexizyme, so that a desired codon is translated in association with the desired amino acid or hydroxy acid. Special amino acids can also be used as desired amino acids.
[0154] The cell-free protein synthesis system, composition, and / or kit according to the present invention is applied to a polynucleotide template encoding a protein of interest. The template is an RNA molecule (e.g., mRNA) or a DNA template, and may be of any form (e.g., linear, circular, supercoiled, single-stranded, double-stranded, etc.). The polynucleotide template guides the production of the desired protein.
[0155] The lysate according to the present invention does not contain complete cells, but includes, for example, ribosomes for protein translation, transfer RNA, aminoacyl tRNA synthetase, initiation factors, elongation factors, and termination factors necessary for protein synthesis. In addition, the extract may further contain other proteins derived from the cell cytoplasm, particularly soluble proteins.
[0156] In the present invention, the system may further include at least one selected from an amino acid mixture, dNTP, and RNA polymerase.
[0157] In one embodiment, the amino acid mixture may include 20 natural amino acids and other non-natural amino acids, and may include D- or L-form amino acids. Representative amino acids include, but are not limited to, 20 natural amino acids such as glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine.
[0158] Additionally, the cell lysate may further contain RNA polymerase, if desired. The RNA polymerase may be selected from one or more RNA polymerases, including, but not limited to, T7 RNA polymerase.
[0159] In the present invention, the system may further include at least one selected from among a DNA polymerase, an energy supply system, polyethylene glycol, and an aqueous solvent.
[0160] Protein and polynucleotide synthesis generally requires an energy source. Energy is required for the initiation of transcription to produce mRNA (e.g., when a DNA template is used) and for the initiation of translation, for example, high-energy phosphates in the form of GTP are used. Each subsequent step of a codon (three nucleotides, one amino acid) by the ribosome requires additional GTP hydrolysis to GDP. ATP is also typically required. During protein synthesis, amino acids must first be activated before they can be polymerized. Therefore, a significant amount of energy from high-energy phosphate bonds is required for protein and / or polynucleotide synthesis to proceed.
[0161] In one embodiment, the energy supply system may be selected from one or a combination of glucose, maltose, trehalose, maltodextrin, starch dextrin, phosphocreatine, and phosphokinase.
[0162] In the above energy supply system, the energy source is a chemical substrate that can be processed by the cell to provide energy for achieving a desired chemical reaction. For example, the energy source may be a nucleoside triphosphate, such as one or more selected from adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate, and the concentration of each single nucleotide may be, but is not limited to, 0.5 to 5 mM, preferably 1.0 to 2.0 mM.
[0163] Additionally, the energy source is typically one that allows the release of energy for synthesis by cleavage of a high-energy phosphate bond, such as that found in ATP, for example. Any source that can be converted to a high-energy phosphate bond is particularly suitable. ATP, GTP, and other triphosphates can generally be considered equivalent energy sources that support protein synthesis. That is, to provide energy for the synthetic reaction, the system may include additional energy sources such as glucose, pyruvate, phosphoenolpyruvate (PEP), carbamoyl phosphate, acetyl phosphate, creatine phosphate, creatine kinase, phosphopyruvate, glyceraldehyde-3-phosphate, 3-phosphoglycerate, and glucose-6-phosphate, which can produce or regenerate high-energy triphosphate compounds such as ATP, GTP, and other NTPs.
[0164] If sufficient energy is not available initially in the cell-free protein synthesis system, an additional energy source may be added. This energy source may be added or supplemented during the in vitro synthesis reaction. Representative examples of PEGs include, but are not limited to, PEG3000, PEG8000, PEG6000, and PEG3350. Additionally, polyethylene glycols of various molecular weights (e.g., PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000) may be included.
[0165] As needed, NTP, E. coli tRNA, amino acids, Mg 2+ Acetate, Mg 2+ Glutamate, K + Acetate, K +It is performed using a system comprising any one or more combinations selected from the group consisting of glutamate, ammonium acetate, folinic acid, Tris pH 8.2, DTT, pyruvate kinase, T7 RNA polymerase, cAMP, disulfide isomerase, sodium pyruvate, L-5-formyl-5,6,7,8-tetrahydrofolic acid, PEG, NAD, CoA, Na+ oxalate, putrescine, spermidine creatine phosphate, creatine kinase, and S30 extract.
[0166] When cell-free protein synthesis is performed using the cell-free protein synthesis system of the present invention, the natural enzyme protein with the inserted protein purification tag is removed, thereby preventing competition between natural and non-natural amino acids, thereby enabling the effective production of a protein with the non-natural amino acid introduced. In other words, the desired protein can be produced by introducing the non-natural amino acid into the codon position where the removed natural enzyme acts.
[0167] Cell-free protein synthesis reactions can utilize large-scale reactors, small-scale reactors, or multiplexed to perform multiple simultaneous syntheses. Furthermore, the described protein synthesis reaction is a continuous reaction utilizing a feed mechanism to introduce a flow of reagents, and the final product can be isolated as part of the process. Furthermore, the described protein synthesis reaction is a batch reaction, and additional reagents can be introduced to extend the period of active synthesis. The reactor can be operated in any mode, including batch, extended batch, semi-batch, semi-continuous, fed-batch, and continuous, and the selection will depend on the application.
[0168] The present invention establishes a cell-free protein synthesis system using cell lysate from which natural enzyme proteins have been removed, with tags inserted for protein purification. This system effectively blocks competition between natural and non-natural amino acids, enabling the high-efficiency production of proteins containing non-natural amino acids. Accordingly, the system can also be applied to the manufacture of biokits for the customized production of proteins such as antibodies, peptide drugs, and enzymes, which require the introduction of non-natural amino acids.
[0169] Figure 1 is a schematic diagram showing the process of inserting a tag for protein purification into the C-terminal position of a natural enzyme gene.
[0170] Figure 2 shows the results of inserting strep tag II into LysRS. (A) and (B) are the results of gel electrophoresis after colony PCR, and (C) and (D) are the results of confirming whether the enzyme tag was inserted through base sequence analysis. The band size was confirmed to be 1679 bp for (A) and (C), and 286 bp for (B) and (D).
[0171] Figure 3 shows the results of inserting strep tag II into GluRS. (A) and (B) are the results of gel electrophoresis after colony PCR, and (C) and (D) are the results of base sequence analysis to confirm whether the enzyme tag was inserted. The band size was confirmed to be 1829 bp for (A) and (C), and 436 bp for (B) and (D).
[0172] Figure 4 is a diagram showing the result of inserting strep tag II into Release factor 1.
[0173] Figure 5 is a schematic diagram showing the process of inserting three repetitive CBDs (3ХCBD tags) into the C-terminal position of a natural enzyme gene.
[0174] Figure 6 is a diagram showing the result of inserting three CBD tags (3ХCBD tags) into the C-terminus of RF1.
[0175] Figure 7 is a schematic diagram showing the process of inserting a peptide / protein-degrading enzyme tag based on ssDNA donor.
[0176] Figure 8 is a diagram showing the result of inserting a strep tag into DegP protein decomposition enzyme.
[0177] Figure 9 is a diagram showing the results of comparing the growth rates of a wild E. coli cell line and an E. coli cell line in which a strep tag has been inserted into LysRS.
[0178] Figure 10 is a diagram showing the results of optimizing the cell disruption method using a strain in which a strep tag has been introduced into LysRS.
[0179] Figure 11 is a diagram showing the results of optimizing the centrifugation method for cell lysate produced using a strain in which a strep tag has been introduced into LysRS.
[0180] In Fig. 12, (A) is a schematic diagram showing the purification process of RF1, and (B) is a diagram showing the amount of resin used in the purification of RF1 measured by weight and placed in each tube.
[0181] Figure 13 is a diagram showing the change in fluorescence expression (measured after 1 / 4 dilution) before and after purification in cell lysates of wild-type E. coli strain (BL21(DE3)) and RF1_strep cell line.
[0182] Figure 14 is a diagram showing the results of fluorescence recovery measurement (measured after 1 / 4 dilution) before and after purification in cell lysate of a wild type E. coli strain (BL21(DE3)).
[0183] Figure 15 is a diagram showing the results of fluorescence recovery measurement before and after purification in the cell lysate of the RF1_strep cell line (measured after 1 / 4 dilution).
[0184] Figure 16 is a diagram showing the results of SDS-PAGE analysis on a resin to which RF1 is bound (M: Marker, Cn: number of purifications of cell lysate of wild-type strain, Rn: number of purifications of cell lysate of RF1_Strep tagged strain).
[0185] Figure 17 is a schematic diagram showing the manufacturing process of cell lysate through purification of natural enzyme protein using a column.
[0186] Figure 18 is a diagram showing the change in fluorescence expression (measured after 1 / 4 dilution) before and after purification using a column in the cell lysate of a wild-type E. coli strain (BL21(DE3)) and an RF1_strep cell line.
[0187] Figure 19 is a diagram showing the results of fluorescence recovery measurements before and after purification using a column in a cell lysate of a wild type E. coli strain (BL21(DE3)).
[0188] Figure 20 is a diagram showing the results of measuring fluorescence recovery before and after purification using a column in a cell lysate of the RF1_strep cell line.
[0189] Figure 21 is a diagram showing the results of SDS-PAGE analysis on a resin to which RF1 is bound (M: Marker, Cn: number of purifications of cell lysate of wild-type strain, Rn: number of purifications of cell lysate of RF1_Strep tagged strain).
[0190] Figure 22 is a diagram showing the molecular structure of 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate.
[0191] Figure 23 is a diagram showing the production results of the target protein with 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate introduced into the cell lysate from which RF1 was removed (EF-P: 21 kDa).
[0192] Hereinafter, preferred examples are presented to aid understanding of the present invention. However, the following examples are provided solely to facilitate understanding of the present invention and are not intended to limit the scope of the present invention.
[0193] Example 1. Genome engineering - insertion of specific enzyme tags based on the Flippase system
[0194] In this example, Strep tag II was used as a protein purification tag, and a donor DNA cassette was designed to efficiently remove positive selection markers from selected cell lines (Fig. 1). The donor DNA cassette sequences for native enzyme genes (LysRS, GluRS, and RF1) and the sequence information of the sequencing primers used to design them are shown in SEQ ID NOs: 22 to 30.
[0195] As shown in Fig. 1, the donor DNA cassette includes a tag for protein purification and a positive selection marker, with FRT (Flippase Recognition Target) sequences positioned on both sides of the positive selection marker. This configuration allows for the selective removal of the positive selection marker sequence using a flippase enzyme that selectively recognizes the FRT sequence after the donor DNA cassette is inserted into the genome.
[0196] As a result, we successfully inserted Strep tag II into the C-terminus of LysRS, GluRS, and release factor 1 (RF1), a protein translation terminator. In addition, we completed the production of a cell line in which purified tags were introduced into multiple enzymes (LysRS and RF1) within a single cell line (Figs. 2 to 4).
[0197] The base sequence of the natural enzyme gene into which Strep tag II has been inserted is shown in Table 2 below.
[0198] NameSequence (5'→3')RF1_Strep II TagTTGAACCGATTATCCAGGAACATCAGGCCGACCAACTGGCGGCGTTGTCCGAGCAGGAATGGAGCCATCCGCAGTTCGAAAAAGGTGGTGGTGGTTCTTAA (서열번호 31)LysRS_Strep II TagACATGGCGGATCTGGACAACTTCGACTCTGCAAAAGCGATTGCTGAATCTATCGGCATCCACGTTGAGAAGAGCTGGGGTCTGGGCCGTATCGTTACCGAGATCTTCGAAGAAGTGGCAGAAGCACATCTGATTCAGCCGACCTTCATTACTGAATATCCGGCAGAAGTTTCTCCGCTGGCGCGTCGTAACGACGTTAACCCGGAAATCACAGACCGCTTTGAGTTCTTCATTGGTGGTCGTGAAATCGGTAACGGCTTTAGCGAGCTGAATGACGCGGAAGATCAGGCGCAGCGCTTCCTGGATCAGGTTGCCGCGAAAGACGCAGGTGACGACGAAGCGATGTTCTACGACGAAGATTACGTCACCGCACTGGAACACGGCTTACCGCCGACAGCAGGTCTGGGAATTGGTATCGACCGTATGGTAATGCTGTTCACCAACAGCCATACCATCCGCGACGTTATTCTGTTCCCGGCGATGCGTCCAGTAAAATGGAGCCATCCGCAGTTCGAAAAAGGTGGTGGTGGTTCTTAA (서열번호 32)GluRS_Strep IITagCTGATCTGGTGAAACTGCTGGGCGAACGCTGCAAGACGCTGAAAGAGATGGCACAGAGCTGCCGTTATTTCTACGAAGATTTTGCTGAGTTCGATGCCGACGCCGCGAAAAAACATCTGCGTCCGGTAGCGCGTCAGCCGCTGGAAGTGGTTCGTGACAAACTGGCCGCGATTACTGACTGGACCGCTGAAAACGTTCATCACGCTATTCAGGCGACGGCGGATGAGCTGGAAGTGGGTATGGGTAAAGTTGGTATGCCGCTGCGTGTCGCCGTAACCGGTGCGGGGCAGTCTCCAGCACTGGATGTTACCGTTCACGCAATTGGTAAGACCCGCAGTATCGAGCGTATCAACAAAGCGCTGGATTTTATTGCTGAACGCGAAAATCAGCAGTGGAGCCATCCGCAGTTCGAAAAAGGTGGTGGTGGTTCTTAA (서열번호 33)SerRS_Strep II TagACGACCTGGAAGTATGGATCCCGGCACAGAACACCTACCGTGAGATCTCTTCCTGCTCCAACGTTTGGGATTTCCAGGCACGTCGTATGCAGGCACGTTGCCGCAGCAAGTCGGACAAGAAAACCCGTCTGGTTCATACCCTGAACGGTTCTGGTCTGGCTGTTGGTCGTACGCTGGTTGCAGTAATGGAAAACTATCAGCAGGCTGATGGTCGTATTGAAGTACCAGAAGTTCTGCGTCCGTATATGAACGGACTGGAATATATTGGCTGGAGCCATCCGCAGTTCGAAAAAGGTGGTGGTGGTTCTTAA (서열번호 34)LeuRS_Strep IITagAGCAAAAGGTGATGTTGCGGCACTGAACGTTGATGCGCTGACTGAAGATCAGAAAGCGCTGCGTCGCGATGTGCATAAAACTATCGCTAAAGTGACCGATGATATCGGCCGTCGTCAGACCTTCAACACCGCAATTGCGGCGATTATGGAGCTGATGAACAAACTGGCGAAAGCACCAACCGATGGCGAGCAGGATCGCGCTCTGATGCAGGAAGCGCTGCTGGCCGTTGTCCGTATGCTTAACCCGTTCACCCCGCACATCTGCTTCACGCTGTGGCAGGAACTGAAAGGCGAAGGCGATATCGACAACGCGCCGTGGCCGGTTGCTGACGAAAAAGCGATGGTGGAAGACTCCACGCTGGTCGTGGTGCAGGTTAACGGTAAAGTCCGTGCCAAAATCACCGTTCCGGTGGACGCAACGGAAGAACAGGTTCGCGAACGTGCTGGCCAGGAACATCTGGTAGCAAAATATCTTGATGGCGTTACTGTACGTAAAGTGATTTACGTACCAGGTAAACTCCTCAATCTGGTCGTTGGCTGGAGCCATCCGCAGTTCGAAAAAGGTGGTGGTGGTTCTTAA (서열번호 35)DegP_Strep IITagGTAAGCCAATCAGCAGCTTTGCCGCACTGCGTGCTCAGGTGGGGACTATGCCGGTGGGCAGCAAACTGACCCTGGGCTTGCTGCGCGACGGTAAGCAGGTCAACGTGAATCTGGAACTGCAGCAGAGCAGCCAGAATCAGGTTGATTCCAGCTCCATCTTCAACGGCATTGAAGGTGCTGAGATGAGCAACAAAGGCAAAGATCAGGGCGTGGTAGTGAA CAACGTGAAAACGGGCACTCCGGCTGCGCAGATCGGCCTGAAGAAAGGTGATGTGATTATTGGCGCGAACCAGCAGGCAGTGAAAAAACATCGCTGAACTGCGTAAAGTTCTCGACAGCAAACCGTCTGTGCTGGCACTGAACATTCAGCGCGGGCGACAGCACCATCTACCTGTTAATGCAGTGGAGCCATCCGCAGTTCGAAAAAAGGTGGTGGTGGTTCTTAA (SEQ ID NO: 36)
[0199] * The inserted protein purification tag is indicated in bold. In addition, the sequence information of the donor DNA cassette before and after the kanamycin resistance gene (KanR), a positive selection marker in FIGS. 2 to 4, was removed is shown in SEQ ID NOS: 37 to 42.
[0200] Example 2. Genome Engineering - Insertion of a Protein Purification Tag (CBD) Using Positive and Negative Selectable Markers
[0201] In this example, genome engineering was performed using the lambda red recombination system. Furthermore, the donor DNA cassette was designed to contain a kanamycin resistance gene (KanR) for positive selection and a ccdB gene for negative selection. 50 bp sequences homologous to the E. coli genome were inserted at both ends of the two marker genes (Fig. 5). Subsequently, a protein purification tag (3×CBD tag) was introduced into the C-terminal position of the RF1 gene in the E. coli genome (Fig. 6).
[0202] At this time, the base sequence of RF1 with the 3×CBD tag inserted is as follows.
[0203] RF1_CBD3 Tag (3×CBD tag is in bold):
[0204] 5'- TTGAACCGATTATCCAGGAACATCAGGCCGACCAACTGGCGGCGTTGTCCGAGCAGGAAGGAGGGGGCGGAAGTGGAGGCGGCGGTGCATGGCAAGTCAATACGGCTTACACTGCAGGTCAGCTGGTTACGTACAATGGCAAAACGTATAA ATGTTTACAGCCTCACACCAGTTTAGCCGGCTGGGAACCTAGTAATGTACCAGCGCTGTGGCAATTGCAAGGTGGTGGTGGATCTGGGGGAGGAGGATCCGGAGGGGGAGGAGCATGGCAAGTGAACACGGCCTATACAGCGGGGCAGTTG GTCACGTATAACGGTAAAACTTACAAGTGCTTGCAACCTCACACGTCATTAGCAGGATGGGAACCGTCGAACGTGCCTGCCTTGTGGCAATTACAAGGTGGCGGCGGTAGTGGGGGCGGGGGGTCTGGAGGAGGTGGCGCTTGGCAAGTAA ACACGGCGTATACGGCAGGCCAACTTGTGACTTATAATGGTAAGACATATAAATGTCTGCAACCACATACTAGCTTGGCCGGATGGGAGCCTTCCAATGTGCCTGCTTTGTGGCAATTGCAGGGAGGGGGCGGTTCCGGGGGTGGGGGTTAA -3' (SEQ ID NO: 43)
[0205] Additionally, the sequence information of the donor DNA cassette shown in Fig. 6 is shown in SEQ ID NOs: 44 and 45.
[0206] Since RF1 recognizes the UAG or UAA codon on mRNA and terminates protein translation, if RF1 is removed in the cell lysate, the UAG codon provides an opportunity to introduce unnatural amino acids rather than to terminate translation. This is due to the specificity of the UAG codon, which can only be recognized by RF1, unlike the UAA codon, which can also be recognized by RF2.
[0207] In the first genome engineering process, a positive selection marker (KanR) was used to select cell lines in which the donor DNA cassette was inserted into the genome. Subsequently, a second genome engineering process was performed, which involved removing the two selection markers and introducing a protein purification tag (3×CBD tag) at the C-terminus of the RF1 gene. During this process, 50 bp homologous sequences were positioned on both sides of the donor DNA to maximize insertion efficiency.
[0208] That is, cell lines in which a protein purification tag was correctly introduced at the end of the RF1 gene were selected using a negative selection marker (ccdB). Specifically, the ccdB protein expressed by the ccdB gene is toxic to E. coli, so cells in which the ccdB gene is not deleted from the genome die, and thus only cells in which the purification tag was correctly introduced survive, which was utilized for the final selection.
[0209] Example 3. Genome Engineering - ssDNA Donor-Based Peptide / Peptidase Tag Insertion
[0210] Cell-free protein synthesis systems based on cell lysates have a limitation in that peptide production efficiency is very low due to the high activity of peptide / protease enzymes. Therefore, the present invention aimed to improve protein production and enable the stable production of low-molecular-weight peptides by selectively removing or eliminating the activity of proteases present in cell lysates. To achieve this goal, a 90-nucleotide (nt) single-stranded DNA (ssDNA) was designed and used as a donor DNA in the lambda red recombination system. This enabled the precise insertion of a desired tag sequence into a specific region of the protease gene using a single synthesized oligonucleotide alone, without the need for plasmid-based vector construction. Compared to double-stranded DNA, ssDNA exhibits superior intracellular transduction efficiency and a lower likelihood of nonspecific insertion or unintended recombination, enabling more precise and efficient genome editing.
[0211] In this example, the lambda red recombination system was utilized, and genome engineering was performed by designing the donor DNA cassette as a 90 nt-long single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA) (Fig. 7). The sequence information of the 90 nt-long ssDNA is shown in SEQ ID NO: 46.
[0212] As a result, an E. coli cell line was successfully constructed in which strep tag II was inserted into the C-terminal position of DegP, one of the protein-degrading enzymes (Fig. 8).
[0213] Example 4. Confirmation of cell lysate activity using a strain in which strep tag II was introduced into LysRS.
[0214] Protein production experiments were conducted using a cell line in which the strep tag II was introduced into LysRS. Prior to producing cell lysate, we examined whether the growth rate of the cells differed from that of wild-type E. coli during culture.
[0215] As a result, it was confirmed that the growth rate of the cell line in which strep tag II was inserted into LysRS did not show a significant difference from the growth rate of the wild E. coli cell line (Fig. 9).
[0216] That is, we confirmed that genome engineering to insert strep tag II into LysRS did not negatively affect cell growth and survival.
[0217] Example 5. Optimization of a method for producing cell lysate using a strain in which strep tag II has been introduced into RF1.
[0218] To obtain a cell lysate with maximized activity, the cell disruption process was optimized by varying the sonication power of the supersonicator. As a result, the cell lysate with the highest activity was obtained when the sonication power was set to 62.5 watts (Fig. 10). Additionally, it was confirmed that whether or not the cells were stored at -80°C prior to cell disruption did not significantly affect the activity of the cell lysate when disrupted at 62.5 watts (Sample 5 in Fig. 10).
[0219] Based on the above results, the cell lysate produced under the conditions of sample 6 was used in the subsequent experiments.
[0220] Example 6. Optimization of the centrifugation method for cell lysate produced using a strain in which strep tag II was introduced into RF1.
[0221] Cell lysates of the wild-type E. coli strain (BL21(DE3)) and the strain (RF1_strep) in which strep tag II was introduced into RF1 under the conditions optimized in Example 5 were centrifuged at 12,000×g and 30,000×g, respectively. Thereafter, the precipitate was removed, and only the supernatant was recovered, and the activity of the cell lysate was measured through a fluorescent protein expression experiment.
[0222] As a result, it was confirmed that the cell lysate centrifuged at 30,000×g showed higher activity than the cell lysate centrifuged at 12,000×g (Fig. 11).
[0223] Example 7. Optimization of the RF1 purification process using a batch purification method.
[0224] In order to confirm the RF1 removal efficiency and the change in the activity of the cell homogenate according to the number of purification cycles, 100 μL of resin was placed in a 1.5 mL tube, 500 μL of the cell homogenate was added, and the purification process was performed a total of 5 times, and the extent of RF1 present in the cell homogenate removed by the purification resin was confirmed. Specifically, the amount of resin used for purification of RF1 present in the cell homogenate was measured by weight and adjusted so that 0.04 g of resin existed in each tube, and the cell homogenate was secured through 5 consecutive purification processes (Fig. 12).
[0225] (1) Comparison of fluorescence expression of cell lysates
[0226] To confirm that the activity of the cell lysate was not reduced after purification, sfGFP (superfolder GFP), which clearly shows a fluorescent signal, was expressed in the cell lysate before and after purification, and the activity was compared.
[0227] As a result, when purification was performed 1 to 3 times in the lysate of both the wild-type E. coli strain (BL21(DE3)) and the RF1_strep cell line, there was little change in activity, but when purification was performed 4 times, a significant decrease in activity was observed (Fig. 13).
[0228] Since each purification process takes approximately one hour, it appears that the activity of the cell lysate decreased as the purification time increased excessively due to repeated purification. In other words, excessive purification reduces the activity of the cell lysate, and approximately three purifications are considered appropriate.
[0229] (2) Establishment of a system for comparing fluorescence recovery of cell lysates
[0230] The tyrosine (Tyr) residue at amino acid position 66 of the sfGFP protein is essential for fluorophore formation, and when this residue is missing, no fluorescence signal is generated. Based on this characteristic, when the Tyr codon at position 66 is replaced with a UAG codon, protein translation is terminated early when RF1 is present, and no fluorescence signal appears. On the other hand, when RF1 is sufficiently removed, an externally synthesized tRNA:L-Tyr complex binds to the UAG codon, allowing translation to continue, thereby restoring fluorescence.
[0231] In this example, a system was constructed to quantitatively evaluate the RF1 removal efficiency from cell lysate before and after purification based on the above principle.
[0232] 1) Plasmid production
[0233] An sfGFP expression plasmid was constructed in which the Tyr codon at position 66 was replaced with the UAG codon, and the plasmid was designed so that the generation of sfGFP fluorescence signal was clearly distinguished depending on the activity of RF1. The plasmid was introduced into cell lysates before and after purification, and the efficiency of RF1 removal was evaluated based on the degree of fluorescence recovery after the addition of an externally synthesized tRNA: L-Tyr complex.
[0234] 2) Production of tRNA: L-Tyr complex
[0235] First, Pro1E2 tRNA CUA and eFx (Flexizyme) were synthesized through an in vitro transcription reaction using T7 RNA polymerase. The resulting RNA transcripts were separated and purified using a 12% polyacrylamide (PAM) gel containing 6 M urea. The sequences of Pro1E2 tRNA CUA and eFx used in the above process are as follows.
[0236] eFx sequence (SEQ ID NO: 47):
[0237] GGCGTAATACGACTCACTATAGGATCGAAAGATTTCCGCGGCCCCGAAAGGGGATTAGCGTTAGGT
[0238] Pro1E2 tRNA (CUA) sequence (SEQ ID NO: 48):
[0239] GTAATACGACTCACTATAGGGTGATTGGCGCAGCCTGGTAGCGCACTTCGTTCTAAACGAAGGGGTCAGGGGTTCGAATCCCCTATCACCCGCCA
[0240] Next, for the synthesis of L-Tyr-CME, 0.83 mmol of N-boc-L-tyrosine-OH was dissolved in 1 mL of dimethyl formamide (DMF), and 0.3 mL of chloroacetonitrile and 0.26 mL of diisopropylethylamine (DIPEA) were added. The mixture was stirred at room temperature for 16 h, diluted with ethyl acetate (EtOAc), and washed twice with 1 M HCl, twice with saturated aqueous NaHCO3 solution, and five times with brine. The organic layer was then dried over MgSO4 and concentrated using a rotary evaporator.
[0241] Finally, the binding reaction of tRNA (microhelix) and L-Tyr was performed.
[0242] Specifically, for acylation of microhelix, 1 μL of 0.5 M HEPES (pH 7.5) or bicine (pH 8.8), 1 μL of 10 μM microhelix, and 3 μL of nuclease-free water were mixed in a PCR tube, and then 1 μL each of 10 μM eFx, dFx, and aFx was added. The mixture was heated at 95°C for 2 min and then slowly cooled to room temperature for 5 min. Then, 2 μL of 300 mM MgCl2 was added to the cooled mixture, reacted at room temperature for 5 min, and kept on ice for 2 min. After that, 2 μL of 50 mM Substrate (L-Tyr-CME) (dissolved in DMSO) was added. The reaction mixture was then reacted in a low-temperature environment on ice for 16 h.
[0243] microhelix RNA sequence (SEQ ID NO: 49):
[0244] rGrGrCrUrCrUrGrUrUrCrGrCrArGrArGrCrCrGrCrCrA
[0245] For acylation of tRNA, 2 μL of 0.5 M HEPES (pH 7.5), 2 μL of 250 μM tRNA, 2 μL of 250 μM Fx selected in the acylation experiment of the microhelix, and 6 μL of nuclease-free water were mixed in a PCR tube. The mixture was heated at 95°C for 2 min and then cooled to room temperature for 5 min. Then, 4 μL of 300 mM MgCl2 was added and the mixture was reacted at room temperature for 5 min, kept on ice for 2 min, and 4 μL of 50 mM Substrate (L-Tyr-CME) (dissolved in DMSO) was added. The reaction mixture was reacted in a low-temperature environment on ice as in the acylation experiment of the microhelix.
[0246] (3) Comparison of fluorescence recovery of cell lysates
[0247] 1) Wild type E. coli strain (BL21(DE3))
[0248] Since the wild-type E. coli cell line retained RF1 both before and after purification, there was no significant difference in fluorescence recovery. However, after the second purification, an increase in fluorescence recovery was observed compared to before purification. This is believed to be due to errors such as experimental error or fluctuations in the measurement process (Fig. 14).
[0249] 2) Strain with strep tag II introduced into RF1 (RF1_strep)
[0250] When the purification was performed twice, it was confirmed that the fluorescence recovery increased by approximately 3.5 times compared to the negative control, and accordingly, it was confirmed that the corresponding condition (2 times purification) was the optimal condition for removing RF1 (Fig. 15). Based on the above results, it was confirmed that the optimal amount of purification resin required to effectively remove RF1 from 500 μL of cell homogenate was 200 μL. In addition, considering that the binding capacity of the resin used in the experiment was 16 mg / mL, it could be estimated that approximately 3.2 mg of RF1 was present in 500 μL of cell homogenate.
[0251] To qualitatively evaluate the RF1 remaining in the resin after purification, analysis was performed using SDS-PAGE.
[0252] As a result, a thick band was observed above the molecular weight of RF1, 41.88 kDa (red arrow in Figure 16), and the thickness of the band was confirmed to have become significantly thinner after the second round of purification (Figure 16). Through this, it was qualitatively confirmed that at least 200 μL of resin was required to efficiently remove RF1 from 500 μL of cell lysate.
[0253] Example 8. Results of optimization of RF1 purification process using column
[0254] To compare the activity of the cell lysate before and after purification, RF1 was purified using a column (Fig. 17). The ratio of purification resin and cell lysate was set to 1:5, and purification was performed five times consecutively.
[0255] As a result, it was found that there was little change in the activity of the cell lysate when purified 1 to 3 times, but it was confirmed that the activity of the cell lysate decreased significantly from the 4th purification (Fig. 18). In other words, it was confirmed that excessive purification reduces the activity of the cell lysate, and that purification around 3 times is appropriate.
[0256] Next, the RF1 removal efficiency was quantitatively evaluated in the cell lysate before and after purification using the same method as in Example 7 above.
[0257] In the case of the wild type E. coli strain (BL21(DE3)), it was confirmed that RF1 remained in both the cell lysate before and after purification, so there was no significant difference in fluorescence recovery (Fig. 19).
[0258] In the case of the strain (RF1_strep) in which strep tag II was introduced into RF1, it was confirmed that the fluorescence recovery increased approximately 1.77 times compared to the negative control when purification was performed twice, and accordingly, it was confirmed that the corresponding condition (2 times purification) was the optimal condition for removing RF1 (Fig. 20).
[0259] Next, SDS-PAGE analysis was performed to qualitatively evaluate the RF1 remaining in the resin after purification.
[0260] As a result, a band that did not exist in the cell lysate of the wild-type E. coli strain was observed at a position slightly higher than the molecular weight of RF1, 41.88 kDa (red arrow in Figure 21), and it was confirmed that the thickness of the band became significantly thinner after the second round of purification (Figure 21). Through this, it was qualitatively confirmed that at least 200 μL of resin was required to efficiently remove RF1 from 500 μL of cell lysate.
[0261] Example 9. Protein synthesis after purification of RF1 from cell lysate of a strain in which three CBD tags are inserted (tagged) into RF1.
[0262] A cell-free protein synthesis reaction was performed using a DNA template in which a UAG codon was inserted into the middle position of the EF-P protein.
[0263] Specifically, to introduce 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate (Fig. 22) into the UAG codon in the EF-P protein, a plasmid with a single UAG codon inserted into the middle position of the EF-P protein gene was constructed through site-directed mutagenesis. The constructed plasmid was used to evaluate the efficiency of 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate introduction using a cell lysate from which RF1 was removed.
[0264] The 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate compound was synthesized by performing an esterification reaction using N-Boc-L-glutamic acid 4-methyl ester, 3,4-dinitrobenzyl alcohol, DMAP, EDC·HCl, and EtOAc. The resulting 3,4-dinitrobenzyl ester derivative was then synthesized by removing the Boc protecting group using a 4 M HCl / 1,4-dioxane solution at 0°C, and then washing with diethyl ether to remove the remaining 3,4-dinitrobenzyl alcohol.
[0265] Additionally, a tRNA: 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate complex was added to efficiently introduce 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate into the UAG codon. The above tRNA: 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate complex was formed by mixing 2 μL of 0.5 M HEPES (pH 7.5), 2 μL of 250 μM tRNA, 2 μL of 250 μM dFx, and distilled water without nuclease in a PCR tube, heating at 95°C for 2 minutes, slowly cooling to room temperature for 5 minutes, adding 24 μL of 300 mM MgCl to the cooled mixture, reacting at room temperature for 5 minutes, and then adding 4 μL of 25 mM 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate dissolved in DMSO.
[0266] After preparing the tRNA-unnatural amino acid complex as above, the CFPS reaction was performed. A total of 15 μL of cell-free protein synthesis (CFPS) reaction was prepared by mixing the following components in a 1.5 mL tube: 2.2 μL of Solution A, 2.1 μL of Solution B, 5 μL of △RF1 extract, 1 μL of substrate (tRNA: 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate, 500 pmol), 3.7 μL of nucleotide-free water, and 1 μL of DNA template (EF-P_UAG). The mixed reaction solution was reacted overnight at 30°C, and the full-length EF-P protein was purified using an affinity tag after the reaction.
[0267] The components of Solution A and Solution B are shown in Tables 3 and 4, respectively.
[0268] Solution A (2.2μL)MaterialAmount (10 -3 μL) 15
[0269] [Table 4]
[0270]
[0271] Considering that the completion of translation of EF-P protein varies depending on whether RF1 is removed, the molecular weight of the formed protein was analyzed by SDS-PAGE.
[0272] If RF1 is not deleted, the UAG codon is expected to act as a translation termination signal, resulting in the production of a short protein, whereas if RF1 is deleted, 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate can be successfully incorporated, resulting in the formation of a full-length protein.
[0273] As a result of the experiment, a normal-sized EF-P protein was confirmed (Fig. 23), indicating that RF1 was effectively removed and 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate was successfully introduced.
[0274] In summary, it was confirmed that a protein into which a non-natural amino acid has been introduced can be effectively produced using the cell-free protein synthesis system of the present invention.
Claims
1. A gene construct comprising a natural enzyme gene into which a tag for protein purification has been inserted; and a base sequence homologous to a cellular genome located at both ends of the gene.
2. A gene construct according to claim 1, wherein the protein purification tag is inserted into the terminal portion of a natural enzyme gene.
3. In the first paragraph, the natural enzyme gene is a gene construct selected from the group consisting of LysRS, GluRS, SerRS, LeuRS, AlaRS, ArgRS, AsnRS, AspRS, CysRS, GlnRS, GlyRS, HisRS, IleRS, MetRS, PheRS, ProRS, ThrRS, TrpRS, TyrRS, ValRS and release factor 1 (RF1).
4. In the first paragraph, the tag for protein purification is a gene construct selected from the group consisting of Strep-Tag II, CBD1, CBD3, His-Tag, and FLAG-Tag.
5. A genetic construct according to claim 1, characterized in that the genetic construct further comprises a positive selection marker and a negative selection marker.
6. In the fifth paragraph, the positive selection marker is any one selected from the group consisting of a kanamycin resistance gene (KanR), an ampicillin resistance gene (AmpR), a chloramphenicol resistance gene (CmR), and a tetracycline resistance gene (TetR), and the negative selection marker is any one selected from the group consisting of a ccdB gene, rpsL, and sacB, a gene construct.
7. A cell into which the genetic construct of any one of clauses 1 to 6 has been introduced.
8. Cell lysate prepared by crushing the cells of Article 7.
9. A cell lysate from which a natural enzyme protein having a protein purification tag inserted therein has been removed in accordance with paragraph 8.
10. A method for producing a cell lysate from which a natural enzyme protein having a protein purification tag inserted has been removed, comprising: a step of purifying the cell lysate of clause 8 with a purification resin to remove a natural enzyme protein having a protein purification tag inserted therein; 11. A manufacturing method according to claim 10, wherein the purification is performed through column chromatography or batch purification.
12. A cell-free protein synthesis system comprising: (i) a cell lysate from which a native enzyme protein having a protein purification tag inserted therein has been removed; and (ii) a tRNA-unnatural amino acid complex that specifically recognizes a codon from which the introduction of an unnatural amino acid is enabled by the removal of the native enzyme. 13.제12항에 있어서, 상기 비천연 아미노산은 3,5-dinitrobenzyl D-methioninate, 3,5-dinitrobenzyl D-valinate, cyanomethyl (R)-3-(2H-1l4-indol-3-yl)-2-aminopropanoate, 3,5-dinitrobenzyl D-asparaginate, 3,5-dinitrobenzyl D-lysinate, 3,5-dinitrobenzyl D-serinate, 3,5-dinitrobenzyl D-leucinate, 3,5-dinitrobenzyl D-allothreoninate, 3,5-dinitrobenzyl D-glutaminate, 3,5-dinitrobenzyl D-argininate, 3,5-dinitrobenzyl D-alaninate, 3,5-dinitrobenzyl D-alloisoleucinate, 3,5-dinitrobenzyl D-cysteinate, (R)-3-amino-4-((3,5-dinitrobenzyl)oxy)-4-oxobutanoic acid, 3,5-dinitrobenzyl D-histidinate, cyanomethyl D-phenylalaninate, 3,5-dinitrobenzyl D-prolinate, cyanomethyl D-tyrosinate, (R)-4-amino-5-((3,5-dinitrobenzyl)oxy)-5-oxopentanoic acid, 1-(3,5-dinitrophenoxy)-2-methyl-1-oxopropan-2-aminium, 3,5-dinitrobenzyl 3-aminobutanoate, cyanomethyl 3-(azidomethyl)benzoate, 2-(4-(((3-hydroxybutanoyl)thio)methyl)benzamido)ethan-1-aminium, 5-(3,5-dinitrobenzyl) 1-methyl L-glutamate, 및 3,A cell-free protein synthesis system, wherein the system comprises any one selected from the group consisting of 5-dinitrobenzyl (R)-2-amino-3-(7-methoxy-2-oxo-2H-chromene-3-carboxamido)propanoate.
14. A cell-free protein synthesis system according to claim 12, wherein the system further comprises at least one selected from an amino acid mixture, dNTP, and RNA polymerase. 15.(i) a step of reacting a cell lysate from which a natural enzyme protein having a tag for protein purification has been removed; and a tRNA-unnatural amino acid complex that specifically recognizes a codon from which the introduction of an unnatural amino acid is possible by removing the natural enzyme; and (ii) a step of synthesizing a protein into which a non-natural amino acid is introduced through the above reaction; a cell-free protein synthesis method comprising the step.
Citation Information
Patent Citations
Method for preparation of recombinant protein usingRNA binding protein as fusion partner
KR1020040016654A
Trade Used Vehicle parts Platform Application
KR1020230066678A
Ascent and descent device of the core drill
KR102681867B1
Method for the production of a lysate used for cell-free protein biosynthesis
WO2005017166A1
Cell-free synthetic incorporation of non-natural amino acids into proteins
WO2014194129A2