Panel for detecting antibiotic resistance genes
The method uses Primer Pair Sets and PCR to detect multiple antibiotic resistance genes, addressing the inadequacies of current detection methods and enhancing treatment strategies by providing detailed resistance profiles.
Patent Information
- Application Number
- PCT/US2025/024261
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-12
- Filing Date
- 2025-04-11
- Publication Date
- 2025-10-16
AI Technical Summary
Current methods are inadequate for efficiently detecting and identifying various antibiotic resistance genes in bacteria, which poses a significant global health threat due to the rise in antibiotic-resistant infections.
A method utilizing Primer Pair Sets and PCR to amplify specific antibiotic resistance gene targets, allowing for the detection of multiple antibiotic resistance genes simultaneously or sequentially, with the use of probes for confirmation, and a composition comprising these sets for multiplex qPCR assays.
Enables accurate and efficient detection of multiple antibiotic resistance genes, providing a comprehensive understanding of bacterial resistance profiles, aiding in effective treatment strategies.
Smart Images

Figure US2025024261_16102025_PF_FP_ABST
Abstract
Description
[0001]PANEL FOR DETECTING ANTIBIOTIC RESISTANCE GENES CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No.63 / 633,341 filed on April 12, 2024, which is incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING This application was filed with a Sequence Listing XML in ST.26 XML format accordance with 37 C.F.R. § 1.831 and PCT Rule 13ter. The Sequence Listing XML file submitted in the USPTO Patent Center, “215686-0160-WO01_sequence_listing_xml_27-MAR-2025.xml,” was created on 27 MAR 2025, contains 781 sequences, has a file size of 688 kilobytes (704,512 bytes), and is incorporated by reference in its entirety into the specification. BACKGROUND Antibiotic resistance is an urgent global public health threat, killing at least 1.27 million people worldwide and associated with nearly 5 million deaths in 2019. In the U.S., more than 2.8 million antimicrobial-resistant infections occur each year. More than 35,000 people die as a result, according to the United States Center for Disease Control (CDC)’s 2019 Antibiotic Resistance Threats Report. Antibiotic resistance occurs when bacteria develop the ability to metabolize or develop resistance to antibiotic drugs designed to kill them. Resistant infections can be difficult, and sometimes impossible, to treat. Antibiotic resistance microbes have the potential to affect people at any stage of life, as well as the healthcare, veterinary, and agriculture industries. This makes it one of the world’s most urgent public health problems. Accordingly, there is a need to detect antibiotic resistance gene targets. The need is solved by the assays and methods described herein that detect the presence or absence of one or more of antibiotic resistance gene targets in individual or multiplex qPCR assays. SUMMARY One embodiment described herein is a method for individually, simultaneously, or sequentially determining the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β- lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample, the method comprising the steps of: (a) creating a reaction mixture containing the sample and one or more Primer Pair Sets, wherein the Primer Pair Sets comprise one or more of: at least one primer pair selected from Primer Pair Set 1 that specifically amplifies a portion of a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER; at least one primer pair selected from Primer Pair Set 2 that specifically amplifies an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M; at least one primer pair selected from Primer Pair Set 3 that specifically amplifies a portion of a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP; at least one primer pair selected from Primer Pair Set 4 that specifically amplifies a portion of a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY; at least one primer pair selected from Primer Pair Set 5 that specifically amplifies a portion of a β-lactamase resistance gene selected from: blaTEM; at least one primer pair selected from Primer Pair Set 6 that specifically amplifies a portion of a lincosamide, macrolide, streptogramin resistance gene selected from: cfr; at least one primer pair selected from Primer Pair Set 7 that specifically amplifies a portion of a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG; at least one primer pair selected from Primer Pair Set 8 that specifically amplifies a portion of a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A); at least one primer pair selected from Primer Pair Set 9 that specifically amplifies a portion of a methicillin resistance gene selected from: mecA or mecC; at least one primer pair selected from Primer Pair Set 10 that specifically amplifies a portion of a colistin resistance gene selected from: mcr-1, mcr- 2, or mcr-3; at least one primer pair selected from Primer Pair Set 11 that specifically amplifies a portion of a sulfonamide resistance gene selected from: sul1 or sul2; at least one primer pair selected from Primer Pair Set 12 that specifically amplifies a portion of a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S); at least one primer pair selected from Primer Pair Set 13 that specifically amplifies a portion of a vancomycin resistance gene selected from: vanA or vanB; at least one primer pair selected from Primer Pair Set 14 that specifically amplifies a portion of a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE; at least one primer pair selected from Primer Pair Set 15 that specifically amplifies a portion of a quinolone resistance gene selected from: qnrB, qnrA, or qnrS; and / or at least one primer pair selected from Primer Pair Set 16 that specifically amplifies a portion of a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating at least one amplicon when the targeted nucleic acids are present in the sample; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β- lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in the sample. In one aspect, the Primer Pair Sets comprise the following sequences: Primer Pair Set 1 comprises at least one forward and reverse primer pair specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the primer pairs selected from SEQ ID NO: 1–2; 4–5; 7–8; 10–11; 13–14; 16–17; 19–20; 22–23; or 25–26; Primer Pair Set 2 comprises at least one forward and reverse primer pair specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the primer pairs selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43– 44; 46–47; 49–50; or 52–53; Primer Pair Set 3 comprises at least one forward and reverse primer pair specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa- 2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the primer pairs selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79–80; 82–83; 85–86; 88– 89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149; Primer Pair Set 4 comprises at least one forward and reverse primer pair specific for a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the primer pairs selected from SEQ ID NO: 151– 152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208– 209; or 211–212; Primer Pair Set 5 comprises at least one forward and reverse primer pair specific for a β-lactamase resistance gene selected from: blaTEM, the primer pairs selected from SEQ ID NO: 214–215; 217–218; or 220–221; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the primer pairs selected from SEQ ID NO: 223–224; 226–227; or 229–230; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the primer pairs selected from SEQ ID NO: 232–233; 235–236; 238–239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259–260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280– 281; 283–284; 286–287; 289–290; 292–293; 295–296; 298–299; 301–302; 304–305; or 307–308; Primer Pair Set 8 comprises at least one forward and reverse primer pair specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the primer pairs selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325– 326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374; Primer Pair Set 9 comprises at least one forward and reverse primer pair specific for a methicillin resistance gene selected from: mecA or mecC, the primer pairs selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392; Primer Pair Set 10 comprises at least one forward and reverse primer pair specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the primer pairs selected from SEQ ID NO: 394–395; 397–398; 400–401; 403–404; 406–407; 409–410; 412–413; 415–416; or 418–419; Primer Pair Set 11 comprises at least one forward and reverse primer pair specific for a sulfonamide resistance gene selected from: sul1 or sul2, the primer pairs selected from SEQ ID NO: 421–422; 424–425; 427–428; 430–431; 433–434; or 436– 437; Primer Pair Set 12 comprises at least one forward and reverse primer pair specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the primer pairs selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473; Primer Pair Set 13 comprises at least one forward and reverse primer pair specific for a vancomycin resistance gene selected from: vanA or vanB, the primer pairs selected from SEQ ID NO: 475–476; 478–479; 481–482; 484–485; 487– 488; or 490–491; Primer Pair Set 14 comprises at least one forward and reverse primer pair specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the primer pairs selected from SEQ ID NO: 493–494; 496–497; 499–500; 502–503; 505–506; 508–509; 511– 512; 514–515; 517–518; 520–521; 523–524; or 526–527; Primer Pair Set 15 comprises at least one forward and reverse primer pair specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the primer pairs selected from SEQ ID NO: 529–530; 532–533; 535–536; 538– 539; 541–542; 544–545; 547–548; 550–551; 553–554; 556–557; 559–560; or 562–563; and / or Primer Pair Set 16 comprises at least one forward and reverse primer pair specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')- 30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the primer pairs selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595–596; 598– 599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; 652–653; 655– 656; 658–659; 661–662; 664–665; 667–668; or 670–671. In another aspect, the generating of the at least one amplicon comprises performing PCR. In another aspect, the at least one amplicon is one selected from: an amplicon specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER produced using at least one primer pair selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53, and a sequence comprising at least a portion of SEQ ID NO: 703, 704 or 705; an amplicon specific for an extended- spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M produced using at least one primer pair selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79–80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133– 134; 136–137; 139–140; 142–143; 145–146; or 148–149, and a sequence comprising at least a portion of SEQ ID NO: 706, 707, 708, 709 or 710; an amplicon specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP produced using at least one primer pair selected from SEQ ID NO: 151–152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178– 179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208–209; or 211–212, and a sequence comprising at least a portion of SEQ ID NO: 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721 or 722; an amplicon specific for an AmpC β- lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY produced using at least one primer pair selected from SEQ ID NO: 151–152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205– 206; 208–209; or 211–212, and a sequence comprising at least a portion of SEQ ID NO: 722, 723, 724, 725, 726, 727, 728 or 729; an amplicon specific for a β-lactamase resistance gene selected from: blaTEM produced using at least one primer pair selected from SEQ ID NO: 214– 215; 217–218; or 220–221, and a sequence comprising at least a portion of SEQ ID NO: 730; an amplicon specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr produced using at least one primer pair selected from SEQ ID NO: 223–224; 226–227; or 229– 230, and a sequence comprising at least a portion of SEQ ID NO: 731; an amplicon specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG produced using at least one primer pair selected from SEQ ID NO: 232–233; 235–236; 238– 239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259–260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280–281; 283–284; 286–287; 289–290; 292–293; 295– 296; 298–299; 301–302; 304–305; or 307–308, and a sequence comprising at least a portion of SEQ ID NO: 732, 733, 734, 735, 736, 737, 738 or 739; an amplicon specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A) produced using at least one primer pair selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325–326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346– 347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374, and a sequence comprising at least a portion of SEQ ID NO: 740, 741, 742, 743, 744, 745, 746 or 747; an amplicon specific for a methicillin resistance gene selected from: mecA or mecC produced using at least one primer pair selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392, and a sequence comprising at least a portion of SEQ ID NO: 748 or 749; an amplicon specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3 produced using at least one primer pair selected from SEQ ID NO: 394–395; 397–398; 400–401; 403–404; 406–407; 409–410; 412–413; 415–416; or 418–419, and a sequence comprising at least a portion of SEQ ID NO:750, 751 or 752; an amplicon specific for a sulfonamide resistance gene selected from: sul1 or sul2 produced using at least one primer pair selected from SEQ ID NO: 421–422; 424–425; 427–428; 430–431; 433–434; or 436–437, and a sequence comprising at least a portion of SEQ ID NO: 753 or 754; an amplicon specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S) produced using at least one primer pair selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473, and a sequence comprising at least a portion of SEQ ID NO: 755, 756, 757 or 758; an amplicon specific for a vancomycin resistance gene selected from: vanA or vanb produced using at least one primer pair selected from SEQ ID NO: 475–476; 478–479; 481–482; 484–485; 487–488; or 490–491, and a sequence comprising at least a portion of SEQ ID NO: 759 or 760; an amplicon specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE produced using at least one primer pair selected from SEQ ID NO: 493–494; 496–497; 499–500; 502–503; 505–506; 508–509; 511–512; 514– 515; 517–518; 520–521; 523–524; or 526–527, and a sequence comprising at least a portion of SEQ ID NO: 761, 762, 763 or 764; an amplicon specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS produced using at least one primer pair selected from SEQ ID NO: 529– 530; 532–533; 535–536; 538–539; 541–542; 544–545; 547–548; 550–551; 553–554; 556–557; 559–560; or 562–563, and a sequence comprising at least a portion of SEQ ID NO: 765, 766, 767, 768 or 769; and / or an amplicon specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)- Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22 produced using at least one primer pair selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580– 581; 583–584; 586–587; 589–590; 592–593; 595–596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637– 638; 640–641; 643–644; 646–647; 649–650; 652–653; 655–656; 658–659; 661–662; 664–665; 667–668; or 670–671, and a sequence comprising at least a portion of SEQ ID NO: 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780 or 781. In another aspect, the at least one amplicon is one selected from: an amplicon specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the amplicon comprising at least a portion of SEQ ID NO: 703, 704 or 705; an amplicon specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the amplicon comprising at least a portion of SEQ ID NO: 706, 707, 708, 709 or 710; an amplicon specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the amplicon comprising at least a portion of SEQ ID NO: 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721 or 722; an amplicon specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the amplicon comprising at least a portion of SEQ ID NO: 722, 723, 724, 725, 726, 727, 728 or 729; an amplicon specific for a β-lactamase resistance gene selected from: blaTEM, the amplicon comprising at least a portion of SEQ ID NO: 730; an amplicon specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the amplicon comprising at least a portion of SEQ ID NO: 731; an amplicon specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the amplicon comprising at least a portion of SEQ ID NO: 732, 733, 734, 735, 736, 737, 738 or 739; an amplicon specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the amplicon comprising at least a portion of SEQ ID NO: 740, 741, 742, 743, 744, 745, 746 or 747; an amplicon specific for methicillin resistance gene selected from: mecA or mecC, the amplicon comprising at least a portion of SEQ ID NO: 748 or 749; an amplicon specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the amplicon comprising at least a portion of SEQ ID NO: 750, 751 or 752; an amplicon specific for a sulfonamide resistance gene selected from: sul1 or sul2, the amplicon comprising at least a portion of SEQ ID NO: 753 or 754; an amplicon specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the amplicon comprising at least a portion of SEQ ID NO: 755, 756, 757 or 758; an amplicon specific for a vancomycin resistance gene selected from: vanA or vanb, the amplicon comprising at least a portion of SEQ ID NO: 759 or 760; an amplicon specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the amplicon comprising at least a portion of SEQ ID NO: 761, 762, 763 or 764; an amplicon specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the amplicon comprising at least a portion of SEQ ID NO: 765, 766, 767, 768 or 769; and / or an amplicon specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')- 30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the amplicon comprising at least a portion of SEQ ID NO: 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780 or 781. In another aspect, the reaction mixture further comprises probes specific for the at least one amplicon. In another aspect, the reaction mixture further comprises probes specific for the at least one amplicon and suitable for use with a Primer Pair Set, the probes comprising: a probe specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the probe selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, or 27; a probe specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the probe selected from SEQ ID NO: 30, 33, 36, 39, 42, 45, 48, 51, or 54; a probe specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the probe selected from SEQ ID NO: 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, or 150; a probe specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the probe selected from SEQ ID NO: 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, or 213; a probe specific for a β-lactamase resistance gene selected from: blaTEM, the probe selected from SEQ ID NO: 216, 219, or 222; a probe specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the probe selected from SEQ ID NO: 225, 228, or 231; a probe specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the probe selected from SEQ ID NO: 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, or 309; a probe specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the probe selected from SEQ ID NO: 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375; a probe specific for methicillin resistance gene selected from: mecA or mecC, the probe selected from SEQ ID NO: 378, 381, 384, 387, 390, or 393; a probe specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the probe selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, 414, 417, or 420; a probe specific for a sulfonamide resistance gene selected from: sul1 or sul2, the probe selected from SEQ ID NO: 423, 426, 429, 432, 435, or 438; a probe specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the probe selected from SEQ ID NO: 441, 444, 447, 450, 453, 456, 459, 462, 465, 468, 471, or 474; a probe specific for a vancomycin resistance gene selected from: vanA or vanb, the probe selected from SEQ ID NO: 477, 480, 483, 486, 489, or 492; a probe specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the probe selected from SEQ ID NO: 495, 498, 501, 504, 507, 510, 513, 516, 519, 522, 525, or 528; a probe specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the probe selected from SEQ ID NO: 531, 534, 537, 540, 543, 546, 549, 552, 555, 558, 561, or 564; and / or a probe specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')- 30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the probe selected from SEQ ID NO: 567, 570, 573, 576, 579, 582, 585, 588, 591, 594, 597, 600, 603, 606, 609, 612, 615, 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, 654, 657, 660, 663, 666, 669, or 672. In another aspect, the reaction mixture further contains a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. In another aspect, the control forward and reverse primer pairs are selected from SEQ ID NO: 673–674; 676–677; 679–680; 682–683; 685–686; 688–689; 691–692; 694–695; 697–698; or 700–701; and the control probe comprises a probe sequence selected from SEQ ID NO: 675; 678; 681; 684; 687; 690; 693; 696; 699; or 702. In another aspect, the probe comprises a fluorescent reporter. In another aspect, the probe comprises a quencher. In another aspect, the probe is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. In another aspect, the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Another embodiment described herein is a composition for individually, simultaneously, or sequentially determining the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β- lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside comprising a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise: at least one primer pair selected from Primer Pair Set 1 that specifically amplifies a portion of a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER; at least one primer pair selected from Primer Pair Set 2 that specifically amplifies an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M; at least one primer pair selected from Primer Pair Set 3 that specifically amplifies a portion of a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP; at least one primer pair selected from Primer Pair Set 4 that specifically amplifies a portion of a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY; at least one primer pair selected from Primer Pair Set 5 that specifically amplifies a portion of a β- lactamase resistance gene selected from: blaTEM; at least one primer pair selected from Primer Pair Set 6 that specifically amplifies a portion of a lincosamide, macrolide, streptogramin resistance gene selected from: cfr; at least one primer pair selected from Primer Pair Set 7 that specifically amplifies a portion of a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG; at least one primer pair selected from Primer Pair Set 8 that specifically amplifies a portion of a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A); at least one primer pair selected from Primer Pair Set 9 that specifically amplifies a portion of a methicillin resistance gene selected from: mecA or mecC; at least one primer pair selected from Primer Pair Set 10 that specifically amplifies a portion of a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3; at least one primer pair selected from Primer Pair Set 11 that specifically amplifies a portion of a sulfonamide resistance gene selected from: sul1 or sul2; at least one primer pair selected from Primer Pair Set 12 that specifically amplifies a portion of a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S); at least one primer pair selected from Primer Pair Set 13 that specifically amplifies a portion of a vancomycin resistance gene selected from: vanA or vanB; at least one primer pair selected from Primer Pair Set 14 that specifically amplifies a portion of a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE; at least one primer pair selected from Primer Pair Set 15 that specifically amplifies a portion of a quinolone resistance gene selected from: qnrB, qnrA, or qnrS; and / or at least one primer pair selected from Primer Pair Set 16 that specifically amplifies a portion of a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22. In one aspect, the Primer Pair Sets comprises the following sequences: Primer Pair Set 1 comprises at least one forward and reverse primer pair specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the primer pairs selected from SEQ ID NO: 1–2; 4–5; 7–8; 10–11; 13–14; 16–17; 19–20; 22–23; or 25–26; Primer Pair Set 2 comprises at least one forward and reverse primer pair specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the primer pairs selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43– 44; 46–47; 49–50; or 52–53; Primer Pair Set 3 comprises at least one forward and reverse primer pair specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa- 2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the primer pairs selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79–80; 82–83; 85–86; 88– 89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149; Primer Pair Set 4 comprises at least one forward and reverse primer pair specific for a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the primer pairs selected from SEQ ID NO: 151– 152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208– 209; or 211–212; Primer Pair Set 5 comprises at least one forward and reverse primer pair specific for a β-lactamase resistance gene selected from: blaTEM, the primer pairs selected from SEQ ID NO: 214–215; 217–218; or 220–221; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the primer pairs selected from SEQ ID NO: 223–224; 226–227; or 229–230; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the primer pairs selected from SEQ ID NO: 232–233; 235–236; 238–239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259–260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280– 281; 283–284; 286–287; 289–290; 292–293; 295–296; 298–299; 301–302; 304–305; or 307–308; Primer Pair Set 8 comprises at least one forward and reverse primer pair specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the primer pairs selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325– 326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374; Primer Pair Set 9 comprises at least one forward and reverse primer pair specific for a methicillin resistance gene selected from: mecA or mecC, the primer pairs selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392; Primer Pair Set 10 comprises at least one forward and reverse primer pair specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the primer pairs selected from SEQ ID NO: 394–395; 397–398; 400–401; 403–404; 406–407; 409–410; 412–413; 415–416; or 418–419; Primer Pair Set 11 comprises at least one forward and reverse primer pair specific for a sulfonamide resistance gene selected from: sul1 or sul2, the primer pairs selected from SEQ ID NO: 421–422; 424–425; 427–428; 430–431; 433–434; or 436– 437; Primer Pair Set 12 comprises at least one forward and reverse primer pair specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the primer pairs selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473; Primer Pair Set 13 comprises at least one forward and reverse primer pair specific for a vancomycin resistance gene selected from: vanA or vanB, the primer pairs selected from SEQ ID NO: 475–476; 478–479; 481–482; 484–485; 487– 488; or 490–491; Primer Pair Set 14 comprises at least one forward and reverse primer pair specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the primer pairs selected from SEQ ID NO: 493–494; 496–497; 499–500; 502–503; 505–506; 508–509; 511– 512; 514–515; 517–518; 520–521; 523–524; or 526–527; Primer Pair Set 15 comprises at least one forward and reverse primer pair specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the primer pairs selected from SEQ ID NO: 529–530; 532–533; 535–536; 538– 539; 541–542; 544–545; 547–548; 550–551; 553–554; 556–557; 559–560; or 562–563; and / or Primer Pair Set 16 comprises at least one forward and reverse primer pair specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')- 30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the primer pairs selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595–596; 598– 599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; 652–653; 655– 656; 658–659; 661–662; 664–665; 667–668; or 670–671. In another aspect, the composition further comprising a probe specific for amplicons produced using the at least one primer pair selected from one or more of Primer Pair Sets 1–16. In another aspect, the probes suitable for use with a specific forward and reverse primer pair are selected from: a probe specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the probe selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, or 27; a probe specific for an extended-spectrum β- lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the probe selected from SEQ ID NO: 30, 33, 36, 39, 42, 45, 48, 51, or 54; a probe specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the probe selected from SEQ ID NO: 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, or 150; a probe specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the probe selected from SEQ ID NO: 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, or 213; a probe specific for a β-lactamase resistance gene selected from: blaTEM, the probe selected from SEQ ID NO: 216, 219, or 222; a probe specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the probe selected from SEQ ID NO: 225, 228, or 231; a probe specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the probe selected from SEQ ID NO: 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, or 309; a probe specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the probe selected from SEQ ID NO: 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375; a probe specific for methicillin resistance gene selected from: mecA or mecC, the probe selected from SEQ ID NO: 378, 381, 384, 387, 390, or 393; a probe specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the probe selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, 414, 417, or 420; a probe specific for a sulfonamide resistance gene selected from: sul1 or sul2, the probe selected from SEQ ID NO: 423, 426, 429, 432, 435, or 438; a probe specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the probe selected from SEQ ID NO: 441, 444, 447, 450, 453, 456, 459, 462, 465, 468, 471, or 474; a probe specific for a vancomycin resistance gene selected from: vanA or vanb, the probe selected from SEQ ID NO: 477, 480, 483, 486, 489, or 492; a probe specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the probe selected from SEQ ID NO: 495, 498, 501, 504, 507, 510, 513, 516, 519, 522, 525, or 528; a probe specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the probe selected from SEQ ID NO: 531, 534, 537, 540, 543, 546, 549, 552, 555, 558, 561, or 564; and / or a probe specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')- 30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the probe selected from SEQ ID NO: 567, 570, 573, 576, 579, 582, 585, 588, 591, 594, 597, 600, 603, 606, 609, 612, 615, 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, 654, 657, 660, 663, 666, 669, or 672. In another aspect, the composition further comprises a polymerase, a buffer, and deoxynucleotide triphosphates (dNTPs). In another aspect, the composition further comprises a sample. In another aspect, the composition further comprises at least one control forward and reverse primer and, optionally, a control probe, that specifically amplifies a target nucleic acid of a control sample. In another aspect, the control forward and reverse primer pairs are selected from SEQ ID NO: 673–674; 676–677; 679–680; 682–683; 685–686; 688–689; 691–692; 694– 695; 697–698; or 700–701; and the control probe comprises a probe sequence selected from SEQ ID NO: 675; 678; 681; 684; 687; 690; 693; 696; 699; or 702. In another aspect, the probe contains a fluorescent reporter. In another aspect, the probe contains a quencher. In another aspect, the probe is labeled at or near the 5′ end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. In another aspect, the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Another embodiment described herein is a kit for individually, simultaneously, or sequentially determining the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β- lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample, comprising any of the compositions described herein. In one aspect, the kit further comprises any of the compositions described herein. In another aspect the kit comprises Primer Pair Sets comprising the following sequences: Primer Pair Set 1 comprises at least one forward and reverse primer pair specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the primer pairs selected from SEQ ID NO: 1–2; 4–5; 7–8; 10–11; 13–14; 16–17; 19–20; 22–23; or 25–26; Primer Pair Set 2 comprises at least one forward and reverse primer pair specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the primer pairs selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53; Primer Pair Set 3 comprises at least one forward and reverse primer pair specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the primer pairs selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76– 77; 79–80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139– 140; 142–143; 145–146; or 148–149; Primer Pair Set 4 comprises at least one forward and reverse primer pair specific for a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the primer pairs selected from SEQ ID NO: 151–152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199– 200; 202–203; 205–206; 208–209; or 211–212; Primer Pair Set 5 comprises at least one forward and reverse primer pair specific for a β-lactamase resistance gene selected from: blaTEM, the primer pairs selected from SEQ ID NO: 214–215; 217–218; or 220–221; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the primer pairs selected from SEQ ID NO: 223– 224; 226–227; or 229–230; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the primer pairs selected from SEQ ID NO: 232–233; 235–236; 238– 239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259–260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280–281; 283–284; 286–287; 289–290; 292–293; 295– 296; 298–299; 301–302; 304–305; or 307–308; Primer Pair Set 8 comprises at least one forward and reverse primer pair specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the primer pairs selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325–326; 328–329; 331–332; 334–335; 337–338; 340– 341; 343–344; 346–347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374; Primer Pair Set 9 comprises at least one forward and reverse primer pair specific for a methicillin resistance gene selected from: mecA or mecC, the primer pairs selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392; Primer Pair Set 10 comprises at least one forward and reverse primer pair specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the primer pairs selected from SEQ ID NO: 394–395; 397– 398; 400–401; 403–404; 406–407; 409–410; 412–413; 415–416; or 418–419; Primer Pair Set 11 comprises at least one forward and reverse primer pair specific for a sulfonamide resistance gene selected from: sul1 or sul2, the primer pairs selected from SEQ ID NO: 421–422; 424–425; 427– 428; 430–431; 433–434; or 436–437; Primer Pair Set 12 comprises at least one forward and reverse primer pair specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the primer pairs selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473; Primer Pair Set 13 comprises at least one forward and reverse primer pair specific for a vancomycin resistance gene selected from: vanA or vanB, the primer pairs selected from SEQ ID NO: 475– 476; 478–479; 481–482; 484–485; 487–488; or 490–491; Primer Pair Set 14 comprises at least one forward and reverse primer pair specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the primer pairs selected from SEQ ID NO: 493–494; 496–497; 499– 500; 502–503; 505–506; 508–509; 511–512; 514–515; 517–518; 520–521; 523–524; or 526–527; Primer Pair Set 15 comprises at least one forward and reverse primer pair specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the primer pairs selected from SEQ ID NO: 529–530; 532–533; 535–536; 538–539; 541–542; 544–545; 547–548; 550–551; 553–554; 556– 557; 559–560; or 562–563; and / or Primer Pair Set 16 comprises at least one forward and reverse primer pair specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the primer pairs selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592– 593; 595–596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649– 650; 652–653; 655–656; 658–659; 661–662; 664–665; 667–668; or 670–671. In another aspect, the kit further comprises probes suitable for use with specific forward and reverse primer pairs, the probes comprising one or more of: a probe specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the probe selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, or 27; a probe specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the probe selected from SEQ ID NO: 30, 33, 36, 39, 42, 45, 48, 51, or 54; a probe specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa- 23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the probe selected from SEQ ID NO: 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, or 150; a probe specific for an AmpC β- lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the probe selected from SEQ ID NO: 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, or 213; a probe specific for a β-lactamase resistance gene selected from: blaTEM, the probe selected from SEQ ID NO: 216, 219, or 222; a probe specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the probe selected from SEQ ID NO: 225, 228, or 231; a probe specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the probe selected from SEQ ID NO: 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, or 309; a probe specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the probe selected from SEQ ID NO: 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375; a probe specific for methicillin resistance gene selected from: mecA or mecC, the probe selected from SEQ ID NO: 378, 381, 384, 387, 390, or 393; a probe specific for colistin resistance gene selected from: mcr- 1, mcr-2, or mcr-3, the probe selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, 414, 417, or 420; a probe specific for a sulfonamide resistance gene selected from: sul1 or sul2, the probe selected from SEQ ID NO: 423, 426, 429, 432, 435, or 438; a probe specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the probe selected from SEQ ID NO: 441, 444, 447, 450, 453, 456, 459, 462, 465, 468, 471, or 474; a probe specific for a vancomycin resistance gene selected from: vanA or vanb, the probe selected from SEQ ID NO: 477, 480, 483, 486, 489, or 492; a probe specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the probe selected from SEQ ID NO: 495, 498, 501, 504, 507, 510, 513, 516, 519, 522, 525, or 528; a probe specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the probe selected from SEQ ID NO: 531, 534, 537, 540, 543, 546, 549, 552, 555, 558, 561, or 564; and / or a probe specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the probe selected from SEQ ID NO: 567, 570, 573, 576, 579, 582, 585, 588, 591, 594, 597, 600, 603, 606, 609, 612, 615, 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, 654, 657, 660, 663, 666, 669, or 672. In another aspect, the kit further comprises a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. In another aspect, the control forward and reverse primer pairs are selected from SEQ ID NO: 673–674; 676–677; 679–680; 682–683; 685–686; 688–689; 691–692; 694–695; 697–698; or 700–701; and the control probe comprises a probe sequence selected from SEQ ID NO: 675; 678; 681; 684; 687; 690; 693; 696; 699; or 702. In another aspect, the kit further comprises a control plasmid comprising one or more target sequences selected from one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended- spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside. In another aspect, the control plasmid comprises one or more portions of nucleic acid sequences of SEQ ID NO: 703–781. DESCRIPTION OF THE DRAWINGS The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. FIG.1 shows limits of detections for antibiotic resistance gene panel qPCR assays using Open Array (OA) or TaqMan™ Array Card (TAC) platforms. DETAILED DESCRIPTION Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of biochemistry, molecular biology, immunology, microbiology, genetics, cell and tissue culture, and protein and nucleic acid chemistry described herein are well known and commonly used in the art. In case of conflict, the present disclosure, including definitions, will control. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the embodiments and aspects described herein. As used herein, the terms “amino acid,” “nucleotide,” “polynucleotide,” “vector,” “polypeptide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Standard single letter nucleotides (A, C, G, T, U) and standard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein. As used herein, the terms such as “include,” “including,” “contain,” “containing,” “having,” and the like mean “comprising.” The present disclosure also contemplates other embodiments “comprising,” “consisting essentially of,” and “consisting of” the embodiments or elements presented herein, whether explicitly set forth or not. As used herein, the term “a,” “an,” “the” and similar terms used in the context of the disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. In addition, “a,” “an,” or “the” means “one or more” unless otherwise specified. As used herein, the term “or” can be conjunctive or disjunctive. As used herein, the term “and / or” refers to both the conjunctive and disjunctive. As used herein, the term “substantially” means to a great or significant extent, but not completely. As used herein, the term “about” or “approximately” as applied to one or more values of interest, refers to a value that is similar to a stated reference value, or within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measurement system. In one aspect, the term “about” refers to any values, including both integers and fractional components that are within a variation of up to ± 10% of the value modified by the term “about.” Alternatively, “about” can mean within 3 or more standard deviations, per the practice in the art. Alternatively, such as with respect to biological systems or processes, the term “about” can mean within an order of magnitude, in some embodiments within 5-fold, and in some embodiments within 2-fold, of a value. As used herein, the symbol “~” means “about” or “approximately.” All ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range. For example, a range of 0.1–2.0 includes 0.1, 0.2, 0.3, 0.4 . . . 2.0. If the end points are modified by the term “about,” the range specified is expanded by a variation of up to ±10% of any value within the range or within 3 or more standard deviations, including the end points. As used herein, the terms “control,” or “reference” are used herein interchangeably. A “reference” or “control” level may be a predetermined value or range, which is employed as a baseline or benchmark against which to assess a measured result. “Control” also refers to control experiments. As used herein, the term “subject” refers to an animal. Typically, the subject is a mammal. A subject also refers to primates (e.g., humans, male or female; infant, adolescent, or adult), non- human primates, rats, mice, rabbits, pigs, cows, sheep, goats, horses, dogs, cats, fish, birds, and the like. In one embodiment, the subject is a primate. In one embodiment, the subject is a human. As used herein, a subject is “in need of treatment” if such subject would benefit biologically, medically, or in quality of life from such treatment. A subject in need of treatment does not necessarily present symptoms, particular in the case of preventative or prophylaxis treatments. As used herein, the terms “inhibit,” “inhibition,” or “inhibiting” refer to the reduction or suppression of a given biological process, condition, symptom, disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process. As used herein, “treatment” or “treating” refers to prophylaxis of, preventing, suppressing, repressing, reversing, alleviating, ameliorating, or inhibiting the progress of biological process including a disorder or disease, or completely eliminating a disease. A treatment may be either performed in an acute or chronic way. The term “treatment” also refers to reducing the severity of a disease or symptoms associated with such disease prior to affliction with the disease. “Repressing” or “ameliorating” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject after clinical appearance of such disease, disorder, or its symptoms. “Prophylaxis of” or “preventing” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject prior to onset of the disease, disorder, or the symptoms thereof. “Suppressing” a disease or disorder involves administering a cell, composition, or compound described herein to a subject after induction of the disease or disorder thereof but before its clinical appearance or symptoms thereof have manifest. As used herein, “antibiotic resistance gene targets” refer to microbial genes that confer resistance to one or more antibiotics. In one aspect, the antibiotic resistance genes confer resistance to one or more antibiotics or enzymes comprise aminoglycosides, ampicillin, β- lactamase, carbapenemase, colistin, extended-spectrum β-lactamases (ESBLs), lincosamide, macrolides, streptogramin, trimethoprim, macrolides, molecularly characterized extended- spectrum β-lactamases (MESBLs), methicillin, nitroimidazole, quinolone, sulfonamide, tetracycline, or vancomycin. In another aspect, the antibiotic resistance genes comprise molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER; extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M; carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP; AmpC β- lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY; β-lactamase resistance gene selected from: blaTEM; lincosamide, macrolide, streptogramin resistance gene selected from: cfr; trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG; macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A); methicillin resistance gene selected from: mecA or mecC; colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3; sulfonamide resistance gene selected from: sul1 or sul2; tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S); vancomycin resistance gene selected from: vanA or vanb; nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE; quinolone resistance gene selected from: qnrB, qnrA, or qnrS; or aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22. The primers, probes, and polynucleotides described herein may include variants that have substitutions, deletions, and / or additions that can involve one or more nucleotides. Some embodiments described herein include nucleic acid molecules comprising polynucleotides having nucleotide sequences about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, and more preferably at least about 95–99% or 100% identical to (a) nucleotide sequences of SEQ ID NO: 1–781 and capable of being used as primers or probes as described herein; or (b) nucleotide sequences capable of hybridizing to the complement of any of the nucleotide sequences of SEQ ID NO: 1–781 and capable of being used as primers or probes as described herein. As used herein, a nucleotide having a nucleotide sequence at least 90–99% “identical” to a reference nucleotide sequence indicates that the nucleotide sequence is identical to the reference sequence except that the nucleotide sequence can include up to about 10-to-1 point mutations, additions, or deletions per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a nucleotide having a nucleotide sequence at least 90–99% identical to a reference nucleotide sequence, up to 10% of the nucleotides in the reference sequence can be deleted, added, or substituted with another nucleotide, or a number of nucleotides up to 10% of the total nucleotides in the reference sequence can be inserted into the reference sequence. These mutations of the reference sequence can occur at the 5′- or 3′-terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. These may include standard nucleotides, modified nucleotides, fluorescent dyes, linkers, or other modifications. As described above, two or more polynucleotide sequences can be compared by determining their percent identity. The percent identity of two sequence is generally described as the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100. Alignment for nucleic acid sequences can be performed using by the global alignment method of Needleman and Wunsch, J. Mol. Biol.48 (3): 443-453 (1970) or the local homology algorithm of Smith and Waterman, Adv. Appl. Math.2: 482-489 (1981). Described herein are primers, primer sets, and probes designed for target sequences and compatible for use in an individual or multiplex qPCR determining the presence of multiple antibiotic resistance gene targets. Multiplex PCR presents a challenge for quantitation of the pathogen DNA: the different amplicons compete for the same PCR reaction components (such as e.g., DNA polymerase and MgCl2) and this can compromise the quantitative comparison between samples. It is known in the art that there is bias in the amplification efficiencies between different template amounts or lengths so that e.g., short amplicons are favored in the expense of longer ones. At the same time, undesired cross-reactions of multiplex set oligo combinations must be avoided. Finding suitable primer and probe sequences for the detection of a diverse group of pathogenic microbes is far from trivial especially when designing multiplex set ups. Described herein are primer sets and probes for detecting the presence or absence of one or more antibiotic resistance gene targets comprising molecularly characterized extended- spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside. In one aspect, the one or more antibiotic resistance gene targets comprise: molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER; extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M; carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP; AmpC β- lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY; β-lactamase resistance gene selected from: blaTEM; lincosamide, macrolide, streptogramin resistance gene selected from: cfr; trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG; macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A); methicillin resistance gene selected from: mecA or mecC; colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3; sulfonamide resistance gene selected from: sul1 or sul2; tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S); vancomycin resistance gene selected from: vanA or vanb; nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE; quinolone resistance gene selected from: qnrB, qnrA, or qnrS; or aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22. The disclosed detection method and assay may contain internal process control, such as Bacillus atrophaeus (BA) or a universal RNA Spike In / Reverse Transcription Control (Xeno). In addition, the assay may have a real time PCR positive control. The probes that target genomic regions of different pathogens utilize three distinct fluorophores, while a fourth fluorophore is designated for the process control detection. Therefore, individual or multiplex qPCR assays are described herein, wherein the detection takes place in a single-well reaction, to meet the speed and high- throughput needs for rapid clinical antibiotic resistance gene testing. When an exemplary “embodiment” or a particular “assay” is described herein, it will be understood that the features of that embodiment may be applicable to a composition (e.g., the particular physical components of an assay such as primers and / or probes), a kit (e.g., primers and / or probes and additional buffers, reagents, etc.), or a method (e.g., a process for detecting target nucleic acids) as appropriate. For simplicity, embodiments are presented by describing “assays,” but it will be understood that the associated methods for the assays, and the compositions for carrying out the assays (primers, probes, and primer sets), are also intended to be part of this disclosure. One embodiment described herein are primer pair sets, comprising one or more forward primers, reverse primers, and probes for detecting the presence or absence of one or more antibiotic resistance genes. Various primer pair sets for detecting specific antibiotic resistance genes are shown in Table 1. Table 1. Primer Pair Sets for Detecting Antibiotic Resistance Genes Primer Pair Set Antibiotic Antibiotic Resistance Genes Molecularly characterized 1 extended-spectrum β- blaGES, blaVEB, blaPER lactamases (MESBLs) 2 Extended-spectrum β- lactamases (ESBLs) blaSHV, blaCTX-M Carbapenemase blaOXA-51, blaOXA-23, blaOXA-2, blaOXA-1, 48, blaKPC, blaVIM, blaNDM, blalMP 4 AmpC β-lactamase blaACC, blaFOX, blaACT, blaACT / blaMIR, blaDHA, blaCMY / blaLAT, blaMOX / blaCMY 5 β-lactamase blaTEM 6 Lincosamide, Macrolide, Streptogramin cfr 7 Trimethoprim dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, dfrG 8 Macrolides mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), msr(A) 9 Methicillin mecA, mecC 10 Colistin mcr-1, mcr-2, mcr-3 11 Sulfonamide sul1, sul2 12 Tetracycline tet(M), tet(A), tet(B) tet (S) 13 Vancomycin vanA, vanB 14 Nitroimidazole nimB, nimD, nimJ, nimE 15 Quinolone qnrB, qnrA, qnrS aac(3)-Ia, aac(3)-Ib / aac(6′)-Ib″, aac(6′)-30 / aac(6′)-Ib′, 16 Aminoglycoside aac(6′)-Ib, aac(6′)-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6′)- Iid, aac(6′)-Ib-cr, aadA1, aadA12, aadA15, aadA22 In one embodiment, Primer Pair Set 1 comprises one or more the primer pairs shown in Table 2, in a combination with a corresponding probe sequence: Table 2. Molecularly Characterized Extended-Spectrum β-lactamases (MESBL) Primers and Probes (5′→3′) Primer SEQ SEQ SEQ PairGeneForward PrimerID Reverse Primer ID Probe ID Set 1 NO NO NO CGGGACACATGAC AGCAGGTCCGCCA CAGCTTGCGCTG 1 blaGESGGTTCTC1ATTTC2CCTC3GAAACTATCGGCC CGTGCTCAGGATG CAGAGGCAACTA 2 blaGES4 5 69121518212427 In another embodiment, Primer Pair Set 2 comprises one or more the primer pairs shown in Table 3, in a combination with a corresponding probe sequence: Table 3. Extended-Spectrum β-lactamases (ESBL) Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 2 NO NO NO CGCCTGTGTATTA AGCTGGCTTTCGC CTGGCGGTACAC 1 blaSHVTCTCCCTGTTAG28TTAGTTTAATTTG29GCC30GCTGCTGCAGTGG CCCGCTCGCCAGC ACGGTCCGGCGA 2 blaSHVATGGT31T32CCCG33 In another embodiment, Primer Pair Set 3 comprises one or more the primer pairs shown in Table 4, in a combination with a corresponding probe sequence: Table 4. Carbapenemase Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 3 NO NO NO blaOXA TGCTTCGACCGAG CTCAAGGCCGATC TCGACCTTCAAA 1 - 51TATGTACCT55AAAGCATTAA56ATGC57blaOX TGCTTCGACCGAG CTCAAGGCCGATC TCGACCTTCAAA 2 A- 51TATGTACCT58AAAGCATTAA59ATGC60bla CCACCAGCCAAAA ACTCATGTCTAAG TCTGCATTGCCA 3 OXA- 51ATTATCGACTTG61GAAGTGAAGCG62TAACCA63bla GAACTTGCGCGAC CCAGAAATTATCA CCAATACGTTTT 4 OXA- 23GTATCG64ACCTGCTGTCCAA65ACTTCTTTTTG66bl TGCCCTGATCGGA TTCCCAAGCGGTA CCAGAAAGCGGA 5 aOXA- 23TTGGAGA67AATGACCTT68TATTAA69ACTAAATGGAAGC blaOXA- AGCAGGTTGATAA TG CAAGAGGTAGAG 6 23TTTCTGGTTGGT70TGTATGTGCTA 7172ATTTGTTTCCbl GAACGTTCTGACT TTCGTCTGCCACA TTTGGCTTGAAA 7 aOXA- 2GGAGGAAGT73ACTATCGT74TTCG75blaO TGCCCTTTCGGGT TTGCGACCGGCTT CATGAGATCCTT 8 XA- 2AGAACATC76CCA77GACCAAGC78AGAACATCAGCGC CCGTCTTTGCACG ACCGGCTTCCAC 9 blaOXA- 2TTGGTCAA79CAGT80AATC81blaOXA- ATGCATCCACAAA CCATAAGTGATAA AAGCAAAGTGTG 10 TGCGATCTTGAAA 1CGCTGAAATT828384GTTCAACGCATGATGCGGAAATA blaOXA- ATA GGTTATTTCTTGC TTGCATCCACGT 11 GATCAGAAAA 1 85GAAACCCAAACA86CTTTGGTG87 bla AGGCTCCGGGTTC AACATCGTTGCT 12 OXA- 188GC89GCTCCATb GGGCGAACCAAGC GCGATCAAGCTAT CCCGCATCTACC 13 laOXA- 48 TGGGAATTT 92TTTblaO GTAGATGCGGGTA CTGGAATGAGAAT TTCGCCCGTTTA 14 XA- 48AAAATGCTTGG94AAGCAGCAAGGA95AGATT96blaO ACACGCATAACGT GATGCGCTTCCAC CCCTGATGATTT 15 XA- 48CCCCTTG97CCTAATTTG98ACAAATAA99CGCTACACCTAGC AGCGGCCATGAGA ACGGCGATACAG 16 blaKPCTCCACCT100GACAAG101TGACATC102TGGGTCAGTTTTC CGGACGGCCTCAG CCTCGGTGCTAT 17 blaKPCAGTTGGTGT103GAA104CTTC105CGCTGGCTGGCTT CGCCAAAGTCCTG TCGTCGCGGAAC 18 blaKPCTTCTG106TTCGAGTTTA107CATT108CGGTCTACCCGTC CGCTGTATCAATC CCATCACGGACA 19 blaVIMCAATGG109AAAAGCAACTCA110ATGAG111ATGGTCTCATTGT GTCATGAAAGTGC ATGAGTTGCTTT 20 blaVIMCCGTGATGG112GTGGAGACT113TGATTGATAC114CCGTGATGGTGAT GCCGCTGTGTTTT CCACGCTGTATC 21 blaVIMGAGTTGCT115TCGCA116AATCAAA117CGCGTGCAGTCTC CGACGGTGATGCG ACGCGGTCGTCA 22 blaVIMCAC118TACGTT119TGAAA120CCACGCACTTTCA CGACGGTGATGCG CAACGCCGCCGA 23 blaVIMTGACGAC121TACGTT122CGCG123GTCGGCATCACCG TGCCTGATCAAGG CGAGCGACTTGG 24 blaNDMAGATTG124ACAGCAA125C126 CCGGCCACACCAG ACTTGGCCTTGCT TTGGGATCGACG 25 blaNDMTGAC127GTCCTT128GCACCG129CCGCCCAGATCCT GCGCGCCCATACC CAAGCAGGAGAT 26 blaNDMCAACTG130G131CAAC132TCAATCTATTCCC ACTAGCCAATAGC CTTGCACCTTAC 27 blalMPACGTATGCATCTG133TAACTCCGCTAA134CGTCTTT135GAGCGCGGCTATA GATGCATACGTGG CATTTCCATAGC 28 blalMPAAATCAAAGG136GAATAGATTGAGA137GACAGCAC138GGCGTTTATGTTC ACAAACCAAGTGA TCCATTTACGGC 29 blalMPATACTTCGTTTGA139CTAACTTTTCAGT140TAAAGAT141GCAAATTTAGAAG TTCACTGTGACTT TTTTGCCTTACC 30 blalMPCTTGGCCAAAGT142GGAACAACCA143ATATTTGG144AGCCAATAACTAA TCCCACGTATGCA ACGGTAAGGTGC 31 blalMPTCTGAATTAACAA145CTCCGCTAAATGA 146147GAAGCTAAGTGGTTCTTGTAA ATACTGA CGCGCTCCACAAA TCCATTTACTGC 32 blalMP CGCCTA 148CCAAT149 150TTAAAGATAC in Table 5, in a combination with a corresponding probe sequence: Table 5. AmpC β-lactamase Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 4 NO NO NO ATGCGTAAAAAAA TGCATCAGCGGCT CAGACAGGTAAT 1 blaACCTGCAGAACAC151GGAT152CACGGATAAC153TCACTGCGACCGA GAGCAAAATTAAA CCGCTGATGCAG 2CATACC154GACACCGTTGATG 155156AAAGAAGACAGGTAATCAC GCGGATTGGCGTG CCACATATATCC 3 blaACCGGATAACAGCTT157CAA158GATTAAAAG159CGAGGCTTACGGG GCGGCATCTCCCT ACTTCAGCAGAT 4 blaFOXATCAAGA160GATACC161CCGCC162CAATCCGGTTACG GCACGAACGCCAC CAGTCGAGCCCG 5 blaFOXCGCTTTG163ATAGG164TCTTG165CACCTGGCCGCAA CAGCAGGGTCTGG CCAGCCATTTGA 6 blaFOXATAGTCT166CTCATC167GCAACT168CTGGACCATACCT CGCTTTACCGTCA ATGCGCCTCTTC 7 blaACTGGATTAACGT169CGATAGC CGCTTT171CCTCCCTGCTGCG CTGGCGTTGGCGT CCGCAGTGGAAG 8 blaACTCTTTTAT172AAAGAC173CCT174CGGTCAAACCTTC CGGAACGTTAATC ACGACGCGGGTC 9 blaACTTGGCATG175CAGGTATGGT176CTTAA177b CTGGCTGAGGTGG ACCGCCATACCCG CCGTTACGCCGC 10 laACT / blaMIRTGGAA178GAATG179TGATG180bl CGGATGAGGTCAC GGTGCCCGGCTTC CTGCTGCGCTTT 11 aACT / blaMIRGGATAACG181CA182TATC183bla CGGACAAACAGCT TCAGTTTTACGCA ACGTCACCCATT 12 ACT / blaMIRGGCAATTA184TGCCGCTA185CCGC186CCACCGCACCGAC GAGGCGTTTGACC CTGGCAGTTCCG 13 blaDHATTTCA187GGATTG188TGAGCG189 GCTCTGCTGGCGT CTGTGCCATCAGC CCGCCGCGACAT 14 blaDHATTTCC190GGTTTAATG191TA192CAGCCTGCGGCAA ATTGCGGATACTC CCGCTCACGGAA 15 blaDHAATGT193TGGAGTGTTTT194CTG195b CGCGAAGGGAAGC CCATATCAATAAC CCGGGACAACTT 16 laCMY / blaLATCTGTA196GCTGGATTTCACG197GATGC198CCCAGTCACGCAG CGCCGCGGGCGAT CAACACG 7 b CCGTT 1 laCMY / blaLATCAAAC199A200AAAC201bl TCCGGGCGCTAAG CAGGACGCGTCTG CCAATGCTGGAG 18 aCMY / blaLATAGACT202GTCATT203TTAGC204bla TGGTCAAGGGAGC CCCCATGGTGATG TCGCCTTGTCAT 19 MOX / blaCMYGATGC205CTGTCA206CCAGC207bla AGCGAGCAGACCC CTCCCTTGACCAC CCTGACTGCGAC 20 MOX / blaCMYTGTTC208CGCATA209CCTG210blaMO CGTGGTGGATGCC GGGCCTTGCCATC CTGTGCTCCTTG 21 X / blaCMYAGCAT211CTTGA212AGCAGCGGC213 one or more the primer pairs shown in Table 6, in a combination with a corresponding probe sequence: Table 6. β-lactamase Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 5 NO NO NO CTTCTGACAACGA AGCTCCGGTTCCC CCGCTTTTTTGC 1 blaTEMTCGGAGGAC214AACAATC215ACAACAT216CAACAACGTTGCG AACTTTATCCGCC CCGGGAAGCTAG 2 blaTEMCAAACTATTAAC217TCCATCCAG218AGTAAG219TGCAGTGCTGCCA GGTTAGCTCCTTC ATCGTTGTCAGA 3 blaTEMTAACCAT220GGTCCTC221AGTAAGTTG222In another embodiment, Primer Pair Set 6 comprises one or more the primer pairs shown in Table 7, in a combination with a corresponding probe sequence: Table 7. Lincosamide, Macrolide, Streptogramin Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 6 NO NO NO GGGCAGGTAGAAG GCAGCGTCAATAT CCATGTCACAAT 1 cfrCCTTTTACAAA223CAATCCCAAATT224TAGAAGTC225CTCGTAGACTTTC TATAT GCTGCGTTCCTCA ACCTAGTATCAA 2 cfr CAACGATT 226CTATAAGG228GGTT AAAAATAACCG CCAAATTGACTT CCTGAGATGTAT C CAGCAGACTTCA 3 cfrGAGAAGCAAACG229TAATTGTGACATG 230A231GAAACT In another embodiment, Primer Pair Set 7 comprises one or more the primer pairs shown in Table 8, in a combination with a corresponding probe sequence: Table 8. Trimethoprim Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 7 NO NO NO GGCGTTAGGCGTC CTTGGTCGGATAG CTGCTCAGGGAT 1 dfrA1ATATGAAGA232GTGCACAT233CACC234CGGATTCGCAAAC AGGGATCACCGAA AACGCCTGGCAC 2 dfrA1CTGTCAC235ATCTTCATATGAC236AGCG237CCAACCTAAAGAA AAT CTTCCGGCTCGAT CCACCACCTGAA 3 dfrA1 AACGGATCAT 238GTCTA239 240GTCTTGTAG ACAAACTGAGGGAAAAG AGTTAGCTTGGCG CCGAACCGTCAC 4 dfrA12TCGTTGTCATG241TGAGATTACC242ACATT243GTCAACGGGACGC TGCTAACGTTGGA CTGCGCATTTTG 5 dfrA12CAAAA244CGTAACGA245GTTCC246TCCGAACTCGGCA TCACCCTCGAAGG CTCTGGCACTAC 6 dfrA12ATGAACTC247TTTGATGTAC248CTCACG249ATCTATGGGAGCA CTCTTCGATCGAC CCGTCCAGGCTG 7 dfrA5CTCCCTAATAGG250GGGAATACT251AGCG252CATGTACGGGCTG CCCCGCCACCAGA CTCACCGATCAC 8 dfrA5GCTGAA253CA254GTTATAG255GCCTGGACGGCCG CCCCGCCACCAGA TCGAAGAGGCCA 9 dfrA5ATAA256CA257TGTACG258GTGGTCAGTAAAA AGAACGCCCATAG CTTCCGACAAGG 10 dfrA17GGTGAGCAAC259AGTCAAATGTTT260AGCCAT261AATGGCTCCTTGT ACTAGGACGTTTT CAGTAGTGTCAA 11 dfrA17CGGAAGAAA262CATTTGAGCTTGA263AGAACG264AAAAAGGCTAACA TTGCGCAGCAAAA CCAGTCGCTTCG 12 dfrA17ATGCGTTGCA265CCACAA266CTCC267ACCAAGAGCGCAC CGCGGACCACGGT ACGGCGTGATTG 13 dfrA14CGTTA268ATGTC269GTTG270CCGCTCAGGTTGG CTCCGCCACCAGA CTTCGATTGACT 14 dfrA14ACATCAAA271CACT272GAAATACA273GCATTGACCTACA ACGACCGCGTATT TCGCAAGACGTT 15 dfrA14ATCAGTGTCTTCT274TCCTATTGG275TGAATC276GGAACGAAGTAGC GCGATCTCCCATA ACAAAATTGCCA 16 dfrB1AATGAAGTCAGT277CCAAACGT278GCAACTG279TCAGTAATCCAGT TCTTGCGCACGCG CATCGAACGCCA 17 dfrB1TGCTGGCAAT280ATCT281CGTTTG282AGATTGTCGGGTG TTCAAGCGCCGCA CAGGCTCAGTAC 18 dfrB1GTACTGC283ACAG284AGATTT285GGCAGAAGTGAAG GCACGCGATCTCC AAGGGAACGCAA 19 dfrB5TCAGTAATCCA286CATTC287ACTGGCC288TCCACTCAACGGC TCAGTGGGCGGCG CCCACGGCCCAA 20 dfrB5CATACC289AAG290CTT291GTCGAGTCTGAGG CGTTGAGTGGAGC CAGTGCCGCAAC 21 dfrB5CTCACC292ACTTCAATCTT293AGGAT294GTTTCTTTGATTG GGAATCCTCCAAG TTGCCAATCACT 22 dfrGCTGCGATGGA295GAATGTCATTCT296CTATTCTTA297CCTTGAATCAATC GGTAAACCCCTTA CCTGACAGAAGA 23GGAAGAGCCTTA298TCTCTCGTCAGA299AATATT300GGCAAAGAGAATG CCTACCTAATATT CAGTCCTTGGGA 24 dfrGACATTCCTTGGA301ATCGGATGTCCCT 302303TTGTATCC GGGACATCCGATA GGTAAACCCCTTA AAGGCTCTTCCG 25 dfrG ATATTAGGTAGGA 304TCTCTCGTCAGA305AT306AGATGATTGGAGGATTCCCAA GCTCTTCCGATTG ACAAAGGGACAT 26 dfrGGGACTGG307ATTCAAGGTTCT308CCGATAAT309In another embodiment, Primer Set 8 comprises one or more the primer in Table 9, in a combination with a corresponding probe sequence: Table 9. Macrolides Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 8 NO NO NO TGCTAGTGGATCG CACCAGCTGCTGC TCGGCACCAATC 1 mef(A)TCATGATAGGAA310GATAATTAAA311ATTATC312CACTAGTGCCATC GGTCCCAAAATCG CAAGACCATCGC 2 mef(A)CTGCAAATG313CATAGGGTAAAA314AGATCC315GGTAGCAATTGTA GAACCGCAACTCC AAGTTTAGAACC 3 mef(A) CGTATACCTAAGC 316TTCTTTCATC317AAATTTCA318 TCATTTGGTTCCT ACTCGAAAACCA 4 ere(B)319GCAGTTGGA320TATTTTG321AATGCGAGAGCGG GCGACCGCCGCCT AAGGGCGTTTGA 5 ere(B)GCTAA322A323ACTTC324ATTTCAGGAGGCG GGTTTTTTAAATG ATGGGTGCAAAA 6 ere(B)GAATGCA325CCACAGCACAGAA 326327TGACAGGCCAACGCCGAG ACGAACCAGGCTG CATGCTCGAAGA 7 mph (A) 328GATGAC329CTCG330CCGCCGCCGTGGA TGGAGGCGCTTGT CCTGCGTCGGTG 8 mph (A)T331CGTT332TACG333CCGCTGACTGTCA CCACCGACGTCCA ACGATCCTATAG 9 mph (A)ATGAGCTT334TCGT335TCGAGCCC336AGCGGTAAACCCC GCAATCTTTTCGC TTGGGAAGGAAA 10 erm(A)TCTGAGAATATA337AAATCCCTTCT338ATTTTAG339AGAAATTGGGTCA TCGTGGCATGACA CTCATTTCCACA 11 erm(A)GGAAAAGGACATT340TAAACCTTCA341AGTTCCTT342GTTTGCTGTTAAT TCTACATTAGGCT TGGCACTTTTTT 12 erm(A) GGTGGAAATGGAT 343 TAGGGTGAAAATA 344AAGAATTTTT345A TGC GTAGGGAATATTA CCACGAAAAAAGC CCAAATATTTTAT 13 erm(A)AGTTGAACCTT346AGTCTGTATTTTT 347AAAATATCC348AGGA CATTCCGCTGGCA CTTGGATATTCAC TTGCACACTCAA 14 erm(B)GCTTAA349CGAACACTAGGG350GTCTC351CAACCCTAGTGTT TTTTGAAAGCCGT AAGGTACGCTTG 15 erm(B)CGGTGAATATCC352GCGTCTG353TAGAATC354CCCATTTTGAAAC GGGTTGCTCTTGC ACTTACCCGCCA 16 erm(B)ACACTCA355AAAGTACGTATAT 356TACCA357AGCATGAACGAGAAAA AAGATTAAATGA ATATAAAACACAG CCTTTTCCTGAGC 17 erm(C) 358359ACATGATAATAT C CTGACGCTTAAAT TAGAGCACACGGT AAGTCTAACACA 18 erm(C)GCACTAATGCC361TTAACGACTTAA362CTAGACTTATTT363CCGTGTGCTCTAC CTGCAATCTGATG TGTAAAAAAAGA 19 erm(C)GACCAAAA364CGATTATTGAATA 365 AACTAGATAAAT 366 AAAGA CT AAGTTGTCTTACC AACTGCTAACACA ACGAGCGCTATA 20 msr(A)TACACCATTTGCA367AGTACGATTCCAA368TTTT369CGCTTTCGTTGAA TGAAGCACTTGAG 21 msr(A)CGTTCTTGTA370AATAATACTGCTA372ACG GCAATAATGAAAC GGGAATTGATTGT AAGCAAGTTGAC 22 msr(A)GTCACGCATGTC373TCTCCTAAAGTGC GATAGTATG375 In another embodiment, Set 9 comprises more the primer pairs shown in Table 10, in a combination with a corresponding probe sequence: Table 10. Methicillin Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 9 NO NO NO CCCACTTTTGATC AGATAGGCATCGT TCCAAAGAATGTCATTTGTTGTTT AAGCAATCGCTA 1 mecA376G 377378AAAGAACTCATTGATCGCAAC TGGTCTTTCTGCA TGGAAGTTAGAT 2 mecAGTTCAATTT379TTCCTGGA380TGGGATCATAGC 381 G AGGAATGCAGAAA TGCCTATCTCATA CCGAAACAATGT 3 mecAGACCAAAGCA382TGCTGTTCCTGTA383GGAATTGGCCA384AAAGCCGTGTTTA TCGTCAGAATTAA AAGCAACAGTAC 4 mecCTCCATTGAACG385TTGGACCCACAT386ACCTTTT387TTGGAAATTAGAT TGCCTCGCTCTGA TTGAAAAATGGA 5 mecCTGGAGACCAGACG388TTTTAATGTTTCT389CAGAAAAT390AGCTAAAACTGGA CTTTTGTATCAAT AATACATATGA CACCCAAAGAAA 6 mecC AA 391 TTGTAAGTCACGA 392 GT GCAAAA393TCGTATGIn another embodiment, Primer Pair Set 10 comprises one or more the primer pairs shown in Table 11, in a combination with a corresponding probe sequence: Table 11. Colistin Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 10 NO NO NO CTATCCCATCGCG AGGCTTTAGCACA TCGCTGTCGTGC 1 mcr-1GACAATCTC394TAGCGATACG395TCTT396CTATCCCATCGCG GCGTGGTGATCAG TTGTGCTGACGA 2 mcr-1GACAATCTC397TAGCATCG398TCGCT399GCTGTTATCATCG TCACCGCGCCCAT CCTGTGTTGATT 3 mcr-1TATCGCTATGTG400GATTAATA401TTGC402 TGTTGGTCGCAGT TCATCGCACGCTG CCCATGTTGGAT 4 mcr-2TGCCA403AATCAGA404AATTG405CCACCAAGCCGAG CTCACGGCCATAG CACGCCTAGTGG 5 mcr-2CGA406CCATTGA407TGTTC408GCGTATTCTGTGC AGCGTATCTAGCA ACTATGATGTCG 6 mcr-2CGTGTATGT409CATTTTCTTGGT410ATACCGCC411TGATCTCCTTTAA ATCATCAAACTCC TGAT CTGCAACCGCTG 7 mcr-3 GTTCGTTCG 412 TTTCTCCCCATAT 413TA414T TGTCCGTTGTCCTTCAAG CATCAGGGTAGCG AAGCCAACCAGC 8 mcr-3ACCTCGATAGTG415CTTGTAGT416TTATC417TGTCCACGCAGTG TCTCCAATCACGA CCAACACCTATG 9 mcr-3ATATTGAAAACT418AATCGGTGTAG419ACAACAC420In another embodiment, Primer Pair Set 11 comprises one or more the primer pairs shown in Table 12, in a combination with a corresponding probe sequence: Table 12. Sulfonamide Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 11 NO NO NO CGAGGACTCCTTC CCGACTCGCAGCA CCGGCGCTGTCA 1 sul1TTCGATGAGA421TTTCGA422CCG423GAGGACTCCTTCT CGACATCCACGAC CCGACTCGCAGC 2 sul1TCGATGAGAG424GTCTGA425ATTT426GTATCGCCGGCCG GCATAGCGCTGGG AAGAGCGGCGCA 3 sul1ATGA427TTTCC428ATAC429GCTGACTTCATCC GCGCCGCCAATAC CCTTGCGCGACG 4 sul2GCACACA430CG431GGCT432CCAAACTCGTCGT CCGCAATGTGATC TCGGCGCGAGGC 5 sul2TATGCATTCG433CATGATGTC434ACC435TCGACCCGAGCAT TTATGTTGACGAT AAGCCCCCATGA 6 sul2CCGTA436GCCGAAAATGATG437ATAAA438In another embodiment, Primer Pair Set 12 comprises one or more the primer pairs shown in Table 13, in a combination with a corresponding probe sequence: Table 13. Tetracycline Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 12 NO NO NO GTTGGAATGTGAC GGAGCAAGCATCC TAGCCCTGTTAG 1 tet(M)GGACTGTAAAAT439GAAAATCTG440TACCCC441GCCGCCAAATCCT CAAGAGAAACCGA AAGCGGTGATAC 2 tet(M) GCTCTCATACTG443AGATAAACGTTGGGAAGTGGA AACCATAGCGTAT CTCTTGGATACT 3 tet(M)ATGCAGTATGA445CCCTTCCATAAC446TAAATCAATCAT447GCAGGTGGATGAG CGCATAGATCGCC CAGGCTGGTGAG 4 tet(A)GAACGT448GTGAAGAG449CGCC450 CCTTGAACGGCCT GAAGCGAGCGGGT TCGCCTTTGTGC 5 tet(A)CAATTTCC451TGAGA452GACTCC453GATGGATGGCGTT CTGCCTGGACAAC CACCCGAAGCAA 6 tet(A)CCCGAT454ATTGCTT455GCAG456CGTTTATATCTGA GGATAGACATCAC ACCAGCCAATAA 7 tet(B) AGGTTGGTTAGTT 4574CCTCCCTGT58 459TTAATGC AATTAAGTTTGGATAGACA CTGAAGGTTGGTT CCCACCACCAGC 8 tet(B)AGTTTTCCCTGT460TCACTCCCTGTAA 461462TCAATCGCAATCGAATTC GCACCCACACCGT TAGGCCAAATTC 9 tet(B)GGTATACATCAC463TGC464CC465CGAAGTACCTCCA GAGAAACCAGGCT CCACTACCCAAA 10 tet (S)AATCCTTTCTGG466CTCATACTGAAT467GGAAG468GTAACGAGGTCAT TGCGTCCATTTGT CCAGCCCGTTGT 11 tet (S)TCTCATTGGTGAA469AAAGAAAGTTAAA 470471CTGATTCTGGTCTATATTAC CCACTCTTTCTAA AAGCATTCGGAA 12 tet (S)AGCCCTGTCAGT472AAGCCTGCTCTA473ATCT474In another embodiment, Primer Pair Set 13 comprises one or more the primer pairs shown in Table 14, in a combination with a corresponding probe sequence: Table 14. Vancomycin Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 13 NO NO NO ACGACTGTATGAC GTTTTTACAAGAT CTGAACGAAGTC 1 vanAGTGAAACCG475AACGGCCGCATT476AATACTC477CGTTGACATACAT GCCACCGGCCTAT CTACTCCCGCCT 2 vanACGTTGCGAAAA CATCTTTATTAA TTTGG480TTTTCGCAACGAT AAGGTCTGTTTGA CCATACAAATTG 3 vanAGTATGTCAACG481ATTGTCCGGTAT482CTGAGCTTT483TTCGTCCTTTGGC CCGAAATCGCTTG ACGCTGCGATAG 4 vanBGTAACCA484CTCAATTAAGAT AAGC486CGCCATGCGTGGA GGATGGCGGCATC ACGAGGTCAATA 5 vanBTAGC GTTCTA488CCC489GCCGCCATGCGTG GGGCTTGCTCGTG AACGAGGTCAAT 6 vanBGATA490TTGATC491ACCC492 In another embodiment, Primer Pair Set 14 comprises one or more the primer pairs shown in Table 15, in a combination with a corresponding probe sequence: Table 15. Nitroimidazole Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 14 NO NO NO GACCGTCTGAGTT GCCAATAAACCCA TTGGCAAAGCCC 1 nimBTACCACTTACTT493AAGCAACACG494ACATATT495 GTGCCATGAAAGG GACGGTCTGATGT CTACCACGCAGA 2 nimBTCATAAAGTGG496CATCCTGTT497ATGA498CCGTATGCCGTTC ATGGCATCCACTT ATGCTGATGGCA 3 nimBCCATCA499TATGACCTTTCA500AAATA501GCGTAGTGGAGCA ACGCTCCGAAAAT TCGGCCGGCTTG 4 nimDGGATGA502AGGTGGTAAAC503ACC504CAACAGAAGAAAG GGCATACGGATAG CCATGAAGAGCC 5 nimDCGTTGCCATT505CCGTCAT506AACGTC507GCGTAAGCGGCAA GTCCCGTTTGTCA ATGGCAACGCTT 6 nimDTTGTTG508TCCGTTC509TCTTCTG510CCCGGATGCTTGT AGGCCATTCTCCA CAACCAAGAGGA 7 nimJGAACAGATATAA511ACTCTTTCTG512AGCCTT513GCCGGCACTTTAG CCGCTCAGTGCAC CCGTCCCCATCA 8 nimJCATTACTTG514TATGGAAATAT515GCTAT516CATACGAAAGTGT CGATGACACTCCG AAGTGCATCCAG 9 nimJGACAAGGCTTC517AAAGAAAGTG518AGAAAT519CGTTTTGCGTTGT GCCTTTCCAAAGA AAGTAGGTCGTG 10 nimEGGAACAAGA520CTATCACACTTC521AATTCG522CGCCAAGATAGGG GTTCCACAACGCA ACGCTATTATGC 11 nimECATAAGGT523AAACGATACTTT524AAAACAA525AATTCGGCAGGTT GCGCCAAGATAGG CAACGCAAAACG 12 nimEGCATAAGG526TAATATTGTCTTG 527528TTCATACTTTIn another embodiment, Primer Pair Set 15 comprises one or more the primer pairs shown in Table 16, in a combination with a corresponding probe sequence: Table 16. Quinolone Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 15 NO NO NO GAGATGCCATTTT CTTGCACCGCGGA TTGGGCATTGAA 1 qnrBCAAAAGCTGTGA529AATCTG530ATTC531GTCAGATCGCAAT GACGTTCAGTGGT CCGGCGGCGAGT 2 qnrBGTGTGAAGTTTG TCAGATCTCT533TT534ACCTGGTTTTGTA CAGCTCGCACTTT AAGCTACGCCAA 3 qnrBGCGCTTATATCA TCCAGTAC CTTTT537GAGATGCCATTTT CGGCAGTGGCGAA ATGCGCTGACGT 4 qnrBCAAAAGCTGTGA TTTCAATG539TGCG540GCGGTGCAAGCTT ACGACTTTCGAAA CAGCGCATATAT 5 qnrBTATGAATATGAT541AATTGGCGTAG542CACTAATAC543ACGCCAGGATTTG TGGCTGAAGTCAC CAGCGGCGAAAA 6 qnrAAGTGACA544ACTGATAGAAG545CG546GTTTCGAGGATTG GCAGATCGGCATA CACCCTTCAACG 7 qnrACAGTTTCATTGA547GCTGAAGT548 GCGCC549GCTGCCGCTTCTA GCGCCGCTTTCAA AAGGGATGCCAG 8 qnrATCAGTGT550TGAAAC551TTTCG552GGCCAATGCCTGG TGCCGCGGCTGAG CCCATCAAGGAA 9 qnrAAAAAGTG553G554GCACC555CCGTAGCAATTGG ATCGAAGGCTGCC CCATCGCAAGTT 10 qnrSCATTACTGAAG556ACTTTGA GGCATT558CCCAGACATCTTC GAGTTGTTTGAAA TAGCGGGTGCAT 11 qnrSGGAAAAAACAC559ATCGCTGGATAGG CACTGA561 CACATTCATTCGC GCCTTCGATATCA TCGACGTGCTAA 12 qnrSAGCGACTT562CCCTGTTCAAT563CTTGC564In another embodiment, Primer Pair Set 16 comprises one or more the primer pairs shown in Table 17, in a combination with a corresponding probe sequence: Table 17. Aminoglycoside Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Gene Forward Primer ID Reverse Primer ID Probe ID Set 16 NO NO NO aac ATGCACTTTGATA CCGATCTCGGCTT ACCGCCACCTAA 1 (3)- IaTCGACCCAAGT565GAACGA566CAAT567aac(3) CGCTCATCAATCT CGGGATCGTCACC CACGTAGATCAC 2 - IaCCTCAAGCAT GTAATCTG ATAAGCAC aa GCAGTCGCCCTAA AGAGCAGCCCGCA CATGTGCGAATG 3 c(3)- IaAACAAAGTTA571TGG572ATGC573aac(3)- TGGAAGCGGGGAC TGGCGTGTTTGAA CACCCCAgATGG 4 Ib / aac(6′GGAT574 575 576)-Ib″CCATGTACA TCaac(3)- ACCACTCGACGA 5578TATGAG579 - GATGGTCCAGCCG GATGGAAGGGTTA CCTGGCGTGTTT 6 Ib / aac(6′TGT581 582)-Ib″ACAT GGCAACACT GAACaac(6′)- TGGAAGCGGGGAC TGGCGTGTTTGAA CACCCCAgATGG 7 30 / aac(GGAT583CCATG584 5856′)-Ib′TACA TCaac(6′)- GACCTTGCGATGC GCTTGGCAAGTAC ACCACTCGACGA 8 30 / aac(TCTATGAGT586TGTTCCTGT587 5886′)-Ib′A TATGAGaac(6′)- GATGGTCCAGCCG GATGGAAGGGTTA CCTGGCGTGTTT 9 30 / aac(TGTACAT589GGCAACACT590GAAC591TGGAAGCGGGGAC TGGCGTGTTTGAA CACCCCAgATGG 10 - GGAT592CCATGTACA593TC594a GACCTTGCGATGC GCTTGGCAAGTAC ACCACTCGACGA 11 ac(6′)- IbTCTATGAGT595TGTTCCTGTA596TATGAG597aac(6 GATGGTCCAGCCG GATGGAAGGGTTA CCTGGCGTGTTT 12 ′)- IbTGTACAT598GGCAACACT599GAAC600GATGGTCCAGCCG GATGGAAGGGTTA CCTGGCGTGTTT 13 aac(6′)- Ib′TGTACAT601GGCAACACT602GAAC603GACCTTGCGATGC GCTTGGCAAGTAC ACCACTCGACGA 14 aac(6′)- Ib′TCTATGAGT604TGTTCCTGTA605TATGAG606aac TGGAAGCGGGGAC TGGCGTGTTTGAA CACCCCAgATGG 15 (6′)- Ib′GGAT607CCATGTACA608TC609aa GACCTTGCGATGC GCTTGGCAAGTAC ACCACTCGACGA 16 c(6′)- Ib11TCTATGAGT610TGTTCCTGTA611TATGAG612aac( TGGAAGCGGGGAC TGGCGTGTTTGAA CACCCCAgATGG 17 6′)- Ib11GGAT613CCATGTACA614TC615aa GATGGTCCAGCCG GATGGAAGGGTTA CCTGGCGTGTTT 18 c(6′)- Ib11TGTACAT616GGCAACACT617GAAC618 ant(3″)- TGGAAGCGGGGAC TGGCGTGTTTGAA CACCCCAgATGG 19 Ih / aac(6′GGAT619CCATGTACA620TC621)-IId ant(3″)- GACCTTGCGATGC GCTTGGCAAGTAC ACCACTCGACGA 20 Ih / aac(6′TCTATGAGT622TGT623 624)-IIdTCCTGTA TATGAGant(3″)- GATGGTCCAGCCG GATGGAAGGGTTA CCTGGCGTGTTT 21 Ih / aac(6′TGTACAT625GGCAA626 627)-IIdCACT GAACaac( TGGAAGCGGGGAC TGGCGTGTTTGAA CCACCCCAtATG 22 6′)- Ib-crGGAC628CCATGTACA629GTC630aac(6′)- CAGCCGTGTACAT GGCGCCAGCCCTT ATGGAAGGGTTA 23 Ib-crGGTTCAAAC631G632GGCATCAC633aac( TGCTGAATGGAGA CTTCTTCCCACCG CCCGCTTCCAAG 24 6′)- Ib-crGCCGATTG634TCCGT635AGCA636CTCATCGCCAGCC CGGTTCCTGAACA ACGCTATGGAAC 25 aadA1CAGT637GGATCTATTTGA638TCGCC639GAATGGCAGCGCA GCAAGATAGCCAG CTTGCAGGTATC 26 aadA1ATGACA640ATCAATGTCGAT641TTCG642ATCACCGCTTCCC GGCAAGCTATCGC CAGCCGACCGAA 27 aadA1TCATGATG643CCAACA644ACC645GAATGGCAGCGCA GCAAGATAGCCAG CTTGCAGGTATC 28 aadA12ATGACA646ATCAATGTCGAT647TTCG648CTCATCGCCAGCC CGGTTCCTGAACA ACGCTATGGAAC 29 aadA12CAGT649GGATCTATTTGA650TCGCC651ATCACCGCTTCCC GGCAAGCTATCGC CAGCCGACCGAA 30 aadA12TCATGATG652CCAACA653ACC654ATCACCGCTTCCC GGCAAGCTATCGC CAGCCGACCGAA 31 aadA15TCATGATG655CCAACA656ACC657CTCATCGCCAGCC CGGTTCCTGAACA ACGCTATGGAAC 32 aadA15CAGT658GGATCTATTTGA659TCGCC660GAATGGCAGCGCA GCAAGATAGCCAG CTTGCAGGTATC 33 aadA15ATGACA661ATCAATGTCGAT662TTCG663GAATGGCAGCGCA GCAAGATAGCCAG CTTGCAGGTATC 34 aadA22ATGACA664ATCAATGTCGAT665TTCG666CTCATCGCCAGCC CGGTTCCTGAACA ACGCTATGGAAC 35 aadA22CAGT667GGATCTATTTGA668TCGCC669ATCACCGCTTCCC GGCAAGCTATCGC CAGCCGACCGAA 36 aadA22TCATGATG670CCAACA671ACC672In some embodiments, the method or assay includes one or more control primers and probes. In one aspect, the control is Primer Pair Set 17 that comprises one or more the primer pairs shown in Table 18, in a combination with a corresponding probe sequence for the detection of control sample: Table 18. Xeno Control Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID 17 NO NO NO GGCGTTTCCCGCGTT CGGCCGCAGCCTAAA ACAACAAAGGGTACT 2TC676GATT677CGTCTAT678CTGCGGAAGGCCCAA CCATCCGTAGATCGT TTGACAGGCTCATAC 3TTTC679CGACCT680ATATAA681AGATCTAAGCGTGGA ACCCTTGCTAGTAGG ACGTACCAGAGGATC 4AGTGGCTATA682TGT683 684 AGATTCTC ACCGGTTACGCGGCCAGA CTTGCGTCCAATACG ACTATGGCGTACAAA 5TGA685ATTAGTATC686 687 CA TAAIn some embodiments, method or assay includes one or more control primers and probes. In one aspect, the control is Primer Pair Set 18 that comprises one or more the primer pairs shown in Table 19, in a combination with a corresponding probe sequence for the detection of control sample: Table 19. Bacillus subtilis atrophaeus Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID 18 NO NO NO GTTTGCGGCATTCAG CCCGCGCCTTTCTTG TCGCATGCAGCTGTT 1ACTGA688G689CA690AGCTCATTAGTGAAA CTCATCCGTAATGCC ACACAAAGAGAAATG 2ACGACTGGTT691CGTGAA692CC693CCGGACATGCTGGAT CAGCAGCATGCCTGA ACGGCTCTCGAATCC 3GAATGT694GC695G696CATCGGTGAAGAAAG CGGGTGACTTCAAAG ACGGTCCCCAGGCAT 4CGGAAAAA697AACAGGT698C699GTCGTGACGCCAAAT GGCTGTCAGACGATT ATGCCGCCTTTTCCT 5CTTCTC700ATGCATTGA701CTT702 the method or assay includes one or more control plasmids that contains target sequences for one or more of the target genes. In one aspect, the control plasmid comprises one or more the sequences shown in Table 22. Specifically, the control plasmid for each target gene can include the entire corresponding amplicon sequence in Table 22 or a portion of the amplicon sequence in Table 22. The portion (i.e., number of base pairs) of the amplicon sequence can vary by target gene. The control plasmid can be used with the primers and probes of Tables 2–17 as a positive control. In one embodiment, the method and / or assay comprises a panel comprising one or more primer pairs and one or more probes for the individual, simultaneous, or sequential detection of the presence or absence of one or more of antibiotic resistance genes conferring resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β- lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample. In one aspect, the method has one or more primer pairs and one or more probes for the detection of a universal RNA Spike In / Reverse Transcription (Xeno) Control. In another aspect, the method has one or more primer pairs and one or more probes for the detection of a control sample of Bacillus atrophaeus. One embodiment described herein is an individual or multiplex panel for the individual, simultaneous, or sequential detection of the presence or absence of one or more of one or more of one or more of antibiotic resistance genes conferring resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample. In one aspect, the individual or multiplex panels comprise at least one forward primer, at least one reverse primer, and at least one probe for each antibiotic resistance gene as shown in Table 1. All primer pairs (forward primers and reverse primers), and the requisite probes are consecutively numbered in multiples of three, e.g., 1, 2, 3; . . . ; 670, 671, 672, as forward primer; reverse primer; and probe, respectively. As an exemplary aspect, for detecting antibiotic resistance genes conferring resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs), a primer pair and probe set could include: a forward primer such as SEQ ID NO: 1, a reverse primer such as SEQ ID NO:2, and a probe such as SEQ ID NO: 3. Optionally, the individual or multiplex panel comprises controls, comprising at least one forward primer, at least one reverse primer, and a probe for the Universal RNA Spike In / Reverse Transcription Control (Xeno) as shown in Table 18 or the control organism Bacillus atrophaeus, as shown in Table 19. An additional positive control is a multisequence plasmid comprising one or more of the sequences (or portions of the sequences) shown in Table 22. This plasmid can be used with the primers and probes of Tables 2–17 as an amplification positive control. One embodiment described herein is an individual or multiplex panel for the individual, simultaneous, or sequential detection of the presence or absence of one or more of one or more of one or more of antibiotic resistance genes conferring resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample. In one aspect, the individual or multiplex panel comprises at least one forward primer, at least one reverse primer, and at least one probe for each gene as shown in Table 20. Optionally, the individual or multiplex panel comprises controls, comprising at least one forward primer, at least one reverse primer, and a probe for the Universal RNA Spike In / Reverse Transcription Control (Xeno) as shown in Table 18 or the control organism Bacillus atrophaeus, as shown in Table 19. An additional positive control is a multisequence plasmid comprising one or more of the sequences (or portions of the sequences) shown in Table 22. This plasmid can be used with the primers and probes of Tables 2–17 as an amplification positive control. Table 20. Individual or Multiplex Panel I Open Array – Primers and Probes (70 Genes) Gene Forward Primer Reverse Primer Probe SEQ ID NO SEQ ID NO SEQ ID NO blaGES 1, 4, 7 2, 5, 8 3, 6, 9 10, 13, 16 11, 14, 17 12, 15, 18 blaPER 19, 22, 25 20, 23, 26 21, 24, 27 blaSHV 28, 31, 34 29, 32, 35 30, 33, 36 blaCTX-M 37, 40, 43, 46, 49, 38, 41, 44, 47, 50, 39, 42, 45, 48, 51, 52 53 54 blaOXA-51 55, 58, 61 56, 59, 62 57, 60, 63 blaOXA-23 64, 67, 70 65, 68, 71 66, 69, 72 blaOXA-2 73, 76, 79 74, 77, 80 75, 78, 81 blaOXA-1 64, 67, 70 83, 86, 89 84, 87, 90 blaOXA-48 91, 94, 97 92, 95, 98 93, 96, 99 blaKPC 100, 103, 106 101, 104, 107 102, 105, 108 blaVIM 109, 112, 115, 118, 110, 113, 116, 119, 111, 114, 117, 120, 121 122 123 blaNDM 124, 127, 130 125, 128, 131 126, 129, 132 blaIMP 133, 136, 139, 142, 134, 137, 140, 143, 135, 138, 141, 144, 145, 148 146, 149 147, 150 151, 154, 157 152, 155, 158 153, 156, 159 160, 163, 166 161, 164, 167 162, 165, 168 blaACT 169, 172, 175 170, 173, 176 171, 174, 177 blaACT / blaMIR 178, 181, 184 179, 182, 185 180, 183, 186 blaDHA 187, 190, 193 188, 191, 194 189, 192, 195 blaCMY / blaLAT 196, 199, 202 197, 200, 203 198, 201, 204 blaMOX / blaCMY 205, 208, 211 206, 209, 212 207, 210, 213 blaTEM 214, 217, 220 215, 218, 221 216, 219, 222 cfr 223, 226, 229 224, 227, 230 225, 228, 231 dfrA1 232, 235, 238 233, 236, 239 234, 237, 240 dfrA12 241, 244, 247 242, 245, 248 243, 246, 249 dfrA5 250, 253, 256 251, 254, 257 252, 255, 258 dfrA17 259, 262, 265 260, 263, 266 261, 264, 267 dfrA14 268, 271, 274 269, 272, 275 270, 273, 276 dfrB1 277, 280, 283 278, 281, 284 279, 282, 285 dfrB5 286, 289, 292 287, 290, 293 288, 291, 294 dfrG 295, 298, 301, 304, 296, 299, 302, 305, 297, 300, 303, 306, 307 308 309 (A) 310, 313, 316 311, 314, 317 312, 315, 318 ere(B) 319, 322, 325 320, 323, 326 321, 324, 327 mph (A) 328, 331, 334 329, 332, 335 330, 333, 336 erm(A) 337, 340, 343, 346 338, 341, 344, 347 339, 342, 345, 348 erm(B) 349, 352, 355 350, 353, 356 351, 354, 357 erm(C) 358, 361, 364 359, 362, 365 360, 363, 366 msr (A) 367, 370, 373 368, 371, 374 369, 372, 375 mecA 376, 379, 382 377, 380, 383 378, 381, 384 mecC 385, 388, 391 386, 389, 392 387, 390, 393 mcr-1 394, 397, 400 395, 398, 401 396, 399, 402 mcr-2 403, 406, 409 404, 407, 410 405, 408, 411 mcr-3 412, 415, 418 413, 416, 419 414, 417, 420 sul1 421, 424, 427 422, 425, 428 423, 426, 429 sul2 430, 433, 436 431, 434, 437 432, 435, 438 tet(M) 439, 442, 445 440, 443, 446 441, 444, 447 tet(A) 448, 451, 454 449, 452, 455 450, 453, 456 tet(B) 457, 460, 463 458, 461, 464 459, 462, 465 tet (S) 466, 469, 472 467, 470, 473 468, 471, 474 vanA 475, 478, 481 476, 479, 482 477, 480, 483 vanB 484, 487, 490 485, 488, 491 486, 489, 492 nimB 493, 496, 499 494, 497, 500 495, 498, 501 nimD 502, 505, 508 503, 506, 509 504, 507, 510 nimJ 511, 514, 517 512, 515, 518 513, 516, 519 nimE 520, 523, 526 521, 524, 527 522, 525, 528 qnrB 529, 532, 535, 538, 530, 533, 536, 539, 531, 534, 537, 540, 541 542 543 qnrA 544, 547, 550, 553 545, 548, 551, 554 546, 549, 552, 555 qnrS 556, 559, 562 557, 560, 563 558, 561, 564 aac(3)-Ia 565, 568, 571 566, 569, 572 567, 570, 573 aac(3)-Ib / aac(6′)-Ib″ 574, 577, 580 575, 578, 581 576, 579, 582 aac(6′)-30 / aac(6′)-Ib′ 583, 586, 589 584, 587, 590 585, 588, 591 aac(6′)-Ib 592, 595, 598 593, 596, 599 594, 597, 600 aac(6′)-Ib′ 601, 604, 607 602, 605, 608 603, 606, 609 aac(6′)-Ib11 610, 613, 616 611, 614, 617 612, 615, 618 ant(3″)-Ih / aac(6′)-IId 619, 622, 625 620, 623, 626 621, 624, 627 aac(6′)-Ib-cr 628, 631, 634 629, 632, 635 630, 633, 636 aadA1 637, 640, 643 638, 641, 644 639, 642, 645 aadA12 646, 649, 652 647, 650, 653 648, 651, 654 aadA15 655, 658, 661 656, 659, 662 657, 660, 663 aadA22 664, 667, 670 665, 668, 671 666, 669, 672 Optional control: Xeno 673, 676, 679, 682, 674, 677, 680, 683, 675, 678, 681, 684, 685 686 687 Optional control: Bacillus 688, 691, 694, 697, 689, 692, 695, 698, 690, 693, 696, 699, atrophaeus 700 701 702 Another embodiment described herein is an individual or multiplex panel for the individual, simultaneous, or sequential detection of the presence or absence of one or more of one or more of one or more of antibiotic resistance genes conferring resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample. In one aspect, the individual or multiplex panel comprises at least one forward primer, at least one reverse primer, and at least one probe for each gene as shown in Table 21. Optionally, the individual or multiplex panel comprises controls, comprising at least one forward primer, at least one reverse primer, and a probe for the Universal RNA Spike In / Reverse Transcription Control (Xeno) as shown in Table 18 or the control organism Bacillus atrophaeus, as shown in Table 19. An additional positive control is a multisequence plasmid comprising one or more of the sequences (or portions of the sequences) shown in Table 22. This plasmid can be used with the primers and probes of Tables 2–17 as an amplification positive control. Table 21. Individual or Multiplex Panel II TaqMan Array – Primers and Probes (54 Genes) Gene Forward Primer Reverse Primer Probe SEQ ID NO SEQ ID NO SEQ ID NO blaGES 1, 4, 7 2, 5, 8 3, 6, 9 blaVEB 10, 13, 16 11, 14, 17 12, 15, 18 blaPER 19, 22, 25 20, 23, 26 21, 24, 27 blaSHV 28, 31, 34 29, 32, 35 30, 33, 36 blaCTX-M 37, 40, 43, 46, 49, 38, 41, 44, 47, 50, 39, 42, 45, 48, 51, 52 53 54 blaOXA-51 55, 58, 61 56, 59, 62 57, 60, 63 blaOXA-23 64, 67, 70 65, 68, 71 66, 69, 72 blaOXA-2 73, 76, 79 74, 77, 80 75, 78, 81 blaOXA-1 64, 67, 70 83, 86, 89 84, 87, 90 blaOXA-48 91, 94, 97 92, 95, 98 93, 96, 99 blaKPC 100, 103, 106 101, 104, 107 102, 105, 108 blaVIM 109, 112, 115, 118, 110, 113, 116, 119, 111, 114, 117, 120, 121 122 123 blaNDM 124, 127, 130 125, 128, 131 126, 129, 132 blaIMP 133, 136, 139, 142, 134, 137, 140, 143, 135, 138, 141, 144, 145, 148 146, 149 147, 150 blaACC 151, 154, 157 152, 155, 158 153, 156, 159 blaFOX 160, 163, 166 161, 164, 167 162, 165, 168 blaACT 169, 172, 175 170, 173, 176 171, 174, 177 blaACT / blaMIR 178, 181, 184 179, 182, 185 180, 183, 186 blaDHA 187, 190, 193 188, 191, 194 189, 192, 195 blaCMY / blaLAT 196, 199, 202 197, 200, 203 198, 201, 204 blaMOX / blaCMY 205, 208, 211 206, 209, 212 207, 210, 213 blaTEM 214, 217, 220 215, 218, 221 216, 219, 222 cfr 223, 226, 229 224, 227, 230 225, 228, 231 dfrA1 232, 235, 238 233, 236, 239 234, 237, 240 dfrA12 241, 244, 247 242, 245, 248 243, 246, 249 dfrA5 250, 253, 256 251, 254, 257 252, 255, 258 dfrA17 259, 262, 265 260, 263, 266 261, 264, 267 mef(A) 310, 313, 316 311, 314, 317 312, 315, 318 ere(B) 319, 322, 325 320, 323, 326 321, 324, 327 mph (A) 328, 331, 334 329, 332, 335 330, 333, 336 erm(A) 337, 340, 343, 346 338, 341, 344, 347 339, 342, 345, 348 erm(B) 349, 352, 355 350, 353, 356 351, 354, 357 erm(C) 358, 361, 364 359, 362, 365 360, 363, 366 msr (A) 367, 370, 373 368, 371, 374 369, 372, 375 mecA 376, 379, 382 377, 380, 383 378, 381, 384 mecC 385, 388, 391 386, 389, 392 387, 390, 393 mcr-1 394, 397, 400 395, 398, 401 396, 399, 402 mcr-2 403, 406, 409 404, 407, 410 405, 408, 411 mcr-3 412, 415, 418 413, 416, 419 414, 417, 420 sul1 421, 424, 427 422, 425, 428 423, 426, 429 sul2 430, 433, 436 431, 434, 437 432, 435, 438 tet(M) 439, 442, 445 440, 443, 446 441, 444, 447 tet(A) 448, 451, 454 449, 452, 455 450, 453, 456 tet(B) 457, 460, 463 458, 461, 464 459, 462, 465 tet (S) 466, 469, 472 467, 470, 473 468, 471, 474 vanA 475, 478, 481 476, 479, 482 477, 480, 483 vanB 484, 487, 490 485, 488, 491 486, 489, 492 nimB 493, 496, 499 494, 497, 500 495, 498, 501 nimD 502, 505, 508 503, 506, 509 504, 507, 510 nimJ 511, 514, 517 512, 515, 518 513, 516, 519 nimE 520, 523, 526 521, 524, 527 522, 525, 528 qnrB 529, 532, 535, 538, 530, 533, 536, 539, 531, 534, 537, 540, 541 542 543 qnrA 544, 547, 550, 553 545, 548, 551, 554 546, 549, 552, 555 qnrS 556, 559, 562 557, 560, 563 558, 561, 564 Optional control: Xeno 673, 676, 679, 682, 674, 677, 680, 683, 675, 678, 681, 684, 685 686 687 Optional control: Bacillus 688, 691, 694, 697, 689, 692, 695, 698, 690, 693, 696, 699, atrophaeus 700 701 702 In one embodiment, the primers pairs and probes shown in Tables 2–17 can be used to produce an amplicon. In one embodiment, the amplicons are shown in Table 22. Specifically, the amplicon for each antibiotic target (i.e., antibiotic resistance gene) can include the entire corresponding amplicon sequence in Table 22 or a portion of the amplicon sequence in Table 22. The portion (i.e., number of base pairs) of the amplicon sequence can vary by target gene. Table 22. Amplicons Gene Amplicon Sequences (5′→3′) SEQ ID CTGTAGCGGTGTATACAACGGCCCCGAAACTATCGGCCGTAGAACGTGACGAATT blaGES AGTTGCCTCTGTCGGTCAAGTTATTACACAACTCATCCTGAGCACGGACAAATAG 703 TTGACGCCCGTCTAAC TCTAAAAAAAGTTATGATTTTATTTGGAAAATTATGAGAGAAACAACAACAGGAA blaVEB GTAACCGATTAAAAGGACAATTACCAAAGAATACAATTGTTGCTCATAAAACAGG 704 GACTTCCGGAATAAATAATGGAATTGCAGCAGC GCCCCCACACTGCAACGCCTACAGTGGCTTTTTTTCCAATGACTATGGATTCAAT blaPER TTGCTCTTTTAACAGTGGGGATTGCGCTGAGGTTTCGAATGAACTAAAAGATACC 705 ATCAGTAGCGTCGAGGCAGTAACTACAGCT AGCGGCCGCACGCTGACCGCCTGGCGCGCCGATGAACGCTTTCCCATGATGAGCA blaSHVCCTTTAAAGTAGTGCTCTGCGGCGCAGTGCTGGCGCGGGTGGATGCCGG706GCAGTACCAGTAAAGTTATGGCGGCCGCGGCGGTGCTTAAGCAGAGTGAAACGCA blaCTX-M AAAGCAGCTGCTTAATCAGCCTGTCGAGATCAAGCCTGCCGATCTGGTTAACTAC 707 AATCCGATTGCCGAAAA ATGATGACTCAGAGCATTCGCCGCTCAATGTTAACGGTGATGGCGACGCTACCCC blaCTX-M TGCTATTTAGCAGCGCAACGCTGCATGCGCAGGCGAACAGCGTGCAACAGCAGCT 708 GGAAGCCCTGGAGAAAAGTTCGGGAGGTCGGCTTG TGACCTGGTTAACTATAATCCGATTGCGGAAAAGCACGTCAATGGGACGATGTCA blaCTX-MCTGGCTGAGCTTAGCGCGGCCGCGCTACAGTACAGCGATAACGTGGC709CCGGCAGCGGTGACTATGGCACCACCAACGATATCGCGGTGATTTGGCCAAAAGA blaCTX-M TCGTGCGCCGCTGATTCTGGTCACTTACTTCACCCAGCCTCAACCTAAGGCAGAA 710 AGCCGTCGCGAT CTTCTGTGGTGGTTGCCTTATGGTGCTCAAGGCCGATCAAAGCATTAAGCATTTT blaOXA-51 GAAGGTCGAAGCAGGTACATACTCGGTCGAAGCACGAGCAAGATCATTACCATAG 711 CTTT GGTTTCGGTAATGCTGAAATTGGACAGCAGGTTGATAATTTCTGGTTGGTAGGAC blaOXA-23 CATTAAAGGTTACGCCTATTCAAGAGGTAGAGTTTGTTTCCCAATTAGCACATAC 712 ACAGCTTCCATTTAGTGAAAAAGTGCAGGCTAATGTAAAAA CGCGCATGCGCAAGAAGGCACGCTAGAACGTTCTGACTGGAGGAAGTTTTTCAGC blaOXA-2 GAATTTCAAGCCAAAGGCACGATAGTTGTGGCAGACGAACGCCAAGCGGATCGTG 713 CCATGTTGG AGATCGCATTATCACTTATGGCATTTGATGCGGAAATAATAGATCAGAAAACCAT ATTCAAATGGGATAAAACCCCCAAAGGAATGGAGATCTGGAACAGCAATCATACA blaOXA-1 CCAAAGACGTGGATGCAATTTTCTGTTGTTTGGGTTTCGCAAGAAATAACCCAAA 714 AAATTGGATTAAATAAAATCA ATCCTTAACCACGCCCAAATCGAGGGCGATCAAGCTATTGGGAATTTTAAAGGTA GATGCGGGTAAAAATGCTTGGTTCGCCCGTTTAAGATTATTGGTAAATCCTTG715 GTTCTGCTGTCTTGTCTCTCATGGCCGCTGGCTGGCTTTTCTGCCACCGCGCTGA CCAACCTCGTCGCGGAACCATTCGCTAAACTCGAACAGGACTTTGGCGGCTCCAT CGGTGTGTACGCGATGGA GGACTTCCCGTAACGCGTGCAGTCTCCACGCACTTTCATGACGACCGCGTCGGCG blaVIM GCGTTGATGTCCTTCGGAAGGCTGGAGTGGCAACGTACGCATCACCGTCGACACG 717 CCGGCTAGCCGAGGCAGAGG CGGCACCGACATCGCTTTTGGTGGCTGCCTGATCAAGGACAGCAAGGCCAAGTCG blaNDMCTCGGCAATCTCGGTGATGCCGACACTGAGCACTACGCCGCGTCAGCGC718TAGAGTGGCTTAATTCTCAATCTATTCCCACGTATGCATCTGAATTAACAAATGA blalMP ACTTCTTAAAAAAGACGGTAAGGTGCAAGCTAAAAACTCATTTAGCGGAGTTAGT 719 TATTGGCTAGTTAAAAATAAAATTGAAGTTTTT TGAAAAGTTAGTCAATTGGTTTGTGGAGCGCGGCTATAAAATCAAAGGCAGTATT blalMP TCCTCACATTTCCATAGCGACAGCACGGGTGGAATAGAGTGGCTTAATTCTCAAT 720 CTATTCCCACGTATGCATCTGTATTAACAAATGAACTTCTCAAA TTTAAAAATTGAAAAGCTTGATGAAGGCGTTTATGTTCATACTTCGTTTGAAGAA GTTAACGGGTGGGGCGTTGTTCCTAAACATGGTTTGGTGGTTCTTGTAAATGCTG blalMP AGGCTTACCTAATTGACACTCCATTTACGGCTAAAGATACTGAAAAGTTAGTCAC 721 TTGGTTTGTGGAGCGTGGCTATAAAATAAAAGGC GTATGGTCTAGGTAATTTGGGTGACGCAAATTTAGAAGCTTGGCCAAAGTCTGCC blalMP AAATTATTAGTGTCCAAATATGGTAAGGCAAAACTGGTTGTTCCAAGTCACAGTG 722 AAGTTGGAGATGCATCACTCTTGAAAC CGACATACCGGGAATATTATTCTTCTGCATCAGCGGCTGGATCAGGTCATCAACG GTGTCTTTAATTTTGCTCTCATCGATATTAGCAGCCAGAGCACCTTGGACAGTTG blaACC CTGCCAGACAGGTAATCACGGATAACAGCTTCAATGTGTTCTGCATTTTTTTACG 723 CATGAATAAGTGACCTTTTAATCGGATA CAACCCCAGCATCGGCCTGTTTGGTCACCTGGCCGCAAATAGTCTGGGCCAGCCA blaFOXTTTGAGCAACTGATGAGCCAGACCCTGCTGCCCAAGCTGGGTTTGCACCACACCT724GACGCGGGTCCTTAAGCCGCTCAAGCTGGACCATACCTGGATTAACGTTCCGAAA blaACT GCGGAAGAGGCGCATTACGCCTGGGGCTATCGTGACGGTAAAGCGGTGCGCGTTT 725 CGCCGGGAATGCTGG GGCTGCCCCGATGTCAGAAAAACAGCTGGCTGAGGTGGTGGAACGTACCGTTACG blaACT / blaMI CCGCTGATGAAAGCGCAGGCCATTCCGGGTATGGCGGTGGCGGTGATTTATCAGG R 726 GTCAGCCG ATCGTTATCTGCAACACTGATTTCCGCTCTGCTGGCGTTTTCCGCCCCGGGGTTT blaDHA TCTGCCGCTGATAATGTCGCGGCGGTGGTGGACAGCACCATTAAACCGCTGATGG 727 CACAGCAGGATATTCCCGGGATGGCGGTTG GTAAAGCCGATATCGCCAATAACCACCCAGTCACGCAGCAAACGCTGTTTGAGCT blaCMY / blaLA AGGGTCGGTCAGTAAGACGTTTAACGGCGTGTTGGGCGGCGATGCTATCGCCCGC T 728 GGCGAAATTAAGCTCAGCGATCCGGTCAC CTTCACCGGTCGATCCCCTGCGCCCCGTGGTGGATGCCAGCATCCAGCCGCTGCT blaMOX / blaC CAAGGAGCACAGGATCCCGGGCATGGCGGTGGCCGTGCTCAAGGATGGCAAGGCC MY 729 CACTATTTCAATTACGGGGTGGCCAA GGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAAC blaTEM ACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTT 730 TTTTGCACAACATGGGGGATC TGAGATGTATGGAGAAGCAAACGAAGGGCAGGTAGAAGCCTTTTACAAAGTTTTG cfr AAGTCTGCTGGTATCCATGTCACAATTAGAAGTCAATTTGGGATTGATATTGACG 731 CTGCTTGTGGTCAATTATATGGTAATTAT TTTCCATCAATTAAAGATGCTTTAACCAACCTAAAGAAAATAACGGATCATGTCA TTGTTTCAGGTGGTGGGGAGATATACAAAAGCCTGATCGATCAAGTAGATACACT dfrA1 ACATATATCTACAATAGACATCGAGCCGGAAGGTGATGTTTACTTTCCTGAAATC 732 CC TGAGCAGAAGACTTTTCGCAGACTCACTGAGGGAAAAGTCGTTGTCATGGGGCGA dfrA12 AAGACCTTTGAGTCTATCGGTAAGCCTCTACCGAACCGTCACACATTGGTAATCT 733 CACGCCAAGCTAACTACCGCGCCACTGGCTGCGTAGTTGT TAGTATTCCCGTCGATCGAAGAGGCCATGTACGGGCTGGCTGAACTCACCGATCA dfrA5CGTTATAGTGTCTGGTGGCGGGGAGATTTACAGAGAAACATTGCCCAT734CTCTTTAAAGCGCTCACATATAATCAATGGCTCCTTGTCGGAAGAAAAACATTTG dfrA17 ACTCTATGGGCGTTCTTCCAAATCGCAAATATGCAGTAGTGTCAAAGAACGGAAT 735 TTCAAGCTCAAATGAAAACGTCCTAGTTTTTCCTTCAATAGAAAATGCTTTG GAAAGGGGAGCAGCTACTTTTTAAAGCATTGACCTACAATCAGTGTCTTCTGGTG dfrA14 GGTCGCAAGACGTTTGAATCTATGGGCGCACTCCCCAATAGGAAATACGCGGTCG 736 TTACCCGCTCAGGTTGGACATCAAAT AAGTTCACAAAGAAAGGTCGGAAATGGAACGAAGTAGCAATGAAGTCAGTAATCC dfrB1 AGTTGCTGGCAATTTTGTATTCCCATCGAACGCCACGTTTGGTATGGGAGATCGC 737 GTGCGCAAGAAATCCGGCGCCGCCT AAAAGAAGGGTCATAAATGGACCAAGGCAGAAGTGAAGTCAGTAATCCAGTTGCT dfrB5 GGCCAGTTTGCGTTCCCTTCAAACGCCGCGTTCGGAATGGGAGATCGCGTGCGCA 738 AGAAATCTGGCGCCGCTTGGCA GGGAATATGTTAAAAATACTACAAAGGGACATCCGATAATATTAGGTAGGAAGAA dfrG CCTTGAATCAATCGGAAGAGCCTTACCTGACAGAAGAAATATTATTCTGACGAGA 739 GATAAGGGGTTTACCTTTAATGGTTGTGAAATTGTTCATT GCGATTTTGGGACCTGCCATTGGTGTGCTAGTGGATCGTCATGATAGGAAGAAGA mef(A) TAATGATTGGTGCCGATTTAATTATCGCAGCAGCTGGTGCAGTGCTTGCTATTGT 740 TGCATTCTG TTACTTCTTATAGTGGGCATACTGCAGCCCTCTATCCGGAAGTTGATACAAAATA ere(B) TGGTTTTCGAGTTGATAACTTCCAACTGCAGGAACCAAATGAAGGTTCTGTCGAG 741 AAAGCTATTTCT CCGACATGGGCTCAAGCTCCATGGCCCGCTGACTGTCAATGAGCTTGGGCTCGAC mph (A) TATAGGATCGTGATCGCCACCGTCGACGATGGACGTCGGTGGGTGCTGCGCATCC 742 CGCGCCGAGCCG AAACCCAAAGCTCGTTGCAGATTTTGCAATCTTTTCGCAAATCCCTTCTCAACGA TAAGATAGCTATATTTAGCCTGACTTTCAAAGGTAATTCTTTTGACAATATCCGT erm(A) ACTGATGTTATAAGGAATATTACCATATATCTTATAGTTTATATGTTTTGGGAAG 743 GAAAATTTTAGAATATCCGTTTGAATCACTTTTATATTCTCAGAGGGGTTTACCG CTTCTTTAGTCACTTGACATAAGCCTC ATATCAATAAACAAGATAAAATAATAGAAATTGGGTCAGGAAAAGGACATTTTAC erm(A) CAAGGAACTTGTGGAAATGAGTCAACGGGTGAATGCTATAGAGATTGATGAAGGT 744 TTATGTCATGCCACGAAAAAAGCAGTTGAACCTTTTCAGAA AACAGTTGACGATATTCTCGATTGACCCATTTTGAAACAAAGTACGTATATAGCT TCCAATATTTATCTGGAACATCTGTGGTATGGCGGGTAAGTTTTATTAAGACACT erm(B) GTTTACTTTTGGTTTAGGATGAAAGCATTCCGCTGGCAGCTTAAGCAATTGCTGA 745 ATCGAGACTTGAGTGTGCAAGAGCAACCCTAGTGTTCGGTGAATATCCAAGGTA GGAGGAAAAAATAAAGAGGGTTATAATGAACGAGAAAAATATAAAACACAGTCAA AACTTTATTACTTCAAAACATAATATAGATAAAATAATGACAAATATAAGATTAA erm(C) ATGAACATGATAATATCTTTGAAATCGGCTCAGGAAAAGGGGATTTTACCCTTGA 746 ATTAGTACAG TTGGTTCATCCAAAATTAACATATTCGCTTTCGTTGAAAATAATACTGCTAACGA msr(A) TAATTTCGTTCTTTCCCCACCACTCAAAACATTACAAGAACGCTCAAGTGCTTCA 747 TTTAAACCCAAGTTATTTAAAATAG ATAAAATTAAAACAAACTACGGTAACATTGATCGCAACGTTCAATTTAATTTTGT mecA TAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTCCAGGA 748 ATGCAGAAAGACCAAAGCATACATATTGAAAAATTAAAA TACAATTTACAAATAAACACTATAAAAAGCCGTGTTTATCCATTGAACGAAGCAA mecC CAGTACACCTTTTAGGTTATGTGGGTCCAATTAATTCTGACGAGTTAAAAAGTAA 749 GCAATTTAGAAAC TTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAA mcr-1 GCCTGTGTTGATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGAC 750 ACTTATGG AGTGACATCGTGTGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCAGCTAT mcr-2 TTGGGTCAAGATGACTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTAG 751 ATACGCTTGACCGCTTGGGTGTGGGTATCTTG TGCTCATCGTCAGTTCACCCCTGACTGTCCACGCAGTGATATTGAAAACTGCACA mcr-3 GATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGA 752 TTGGAGAGATGATTGCCAAGTTGAAAACCTAC CGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCG sul1 GCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCA 753 GACGTCGTGGATGTCGGACCG TATCCGCAATTGGCGAAATCATCTGCCAAACTCGTCGTTATGCATTCGGTGCAAG sul2 ACGGGCAGGCAGATCGGCGCGAGGCACCCGCTGGCGACATCATGGATCACATTGC 754 GGCGTTCTTTGACGCGCGCATCGCGGC TATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGACTGTAAAATCTGTT tet(M) TTAAGTATGGCTTATACTATAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCT 755 TGCTCCTATTGTATTGGAACAAGTCTTAAAA CGGCGCTGCAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCT tet(A) GCAAGGCTCACTGGCGGCGCTCACCAGCCTGACCTCGATCGTCGGACCCCTCCTC 756 TTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGT ACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTAT tet(B) TTAAAACGATGCCCATTTTGTTGATTATTTATTTTTCAGCGCAATTGATAGGCCA 757 AATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGATG CAGACTGTAAGATCTGTTTTAAGTATGGTCTATATTACAGCCCTGTCAGTACGCC tet (S) AGCAGATTTCCGAATGCTTGCGCCTATTGTACTAGAGCAGGCTTTTAGAAAGAGT 758 GGTACAGAGTTATTAGAGCCATATCTT AAAAACAGGATAGGTAAACGTAGCTGCCACCGGCCTATCATCTTTATTAATAACC vanA CAAAAGGCGGGAGTAGCTATCCCAGCATTTTTCGCAACGATGTATGTCAACGATT 759 TGTCCATACAAATTGCTGAGCT ATGACCGCGCAGCCGACCTCACAGCCCGAAATCGCTTGCTCAATTAAGATTTTTC vanB CATCATATTGTCCTGCTGCTTCTATCGCAGCGTTTAGTTCTTCCGTACTGTTTAC 760 TTTGGTTACGCCAAAGGACGAACCTGACCGTGCCGGCTTCACAAAGA GGCTCTTCATGGGGACGATGGTTACCCGTATGCCGTTCCCATCAGTTATGTATAT nimB GCTGATGGCAAAATATATTTCCATAGTGCCATGAAAGGTCATAAAGTGGATGCCA 761 TTTTGCAGAATGACAAGGTATCATTC CTGCGGAATGACAAGGTCTCGTTCTGCGTAGTGGAGCAGGATGAGGTCAAGCCGG nimDCCGAGTTTACCACCTATTTTCGGAGCGTGATAGTCTTTGGCAAGGCCCGCATA762GATGAAACTGAGAAACTGGAAACAGCCCGGATGCTTGTGAACAGATATAATCCCA nimJ ACCAAGAGGAAGCCTTGCAGAAAGAGTTGGAGAATGGCCTGTCGCGGATGCTGAT 763 GATTCGTTTC CTGATGGCAAAATCTATTTTCATTGCGCCAAGATAGGGCATAAGGTGGACGCTAT nimE TATGCAAAACAATAAAGTATCGTTTTGCGTTGTGGAACAAGACAATATTAAACCT 764 GCCGAATT TGCAATTTTAGTCGCGCAATGCTGAGAGATGCCATTTTCAAAAGCTGTGATTTAT qnrB CAATGGCAGATTTCCGCAACGTCAGCGCATTGGGCATTGAAATTCGCCACTGCCG 765 CGCACAAGGCGCAGATTTCCGCGGT GGATGGGGACTCAGGTACTGGGTACGACGTTCAGTGGTTCAGATCTCTCCGGCGG qnrB CGAGTTTTCGACTTTCGACTGGCGAGCAGCAAACTTCACACATTGCGATCTGACC 766 AATTCGGAGTTAGGTGACTTAGAT CTTTATGAATATGATCACCACCCGCACCTGGTTTTGTAGCGCTTATATCACCAAT qnrB ACCAACTTAAGCTACGCCAACTTTTCTAAAGTCGTACTGGAAAAGTGCGAGCTGT 767 GGGAGAACCGCTGGATGGGTACTC AAGTTTTTCAACAAGAGGATTTCTCACGCCAGGATTTGAGTGACAGCCGTTTTCG qnrA CCGCTGCCGCTTCTATCAGTGTGACTTCAGCCACTGTCAGCTAAGGGATGCCAGT 768 TTC GAAGATCTGCGACATCAAAGTGGCAGCCTTCGATATCACCCTGTTCAATGAACTT qnrS GCAGTTGACGAATGTCGTATCACGCAAGTTAGCACGTCGAAAGTCGCTGCGAATG 769 AATGTGCAAGCGGTGAAGGTGAGATCACTTA CACCGGAGGCAGGGCATTGCCACCGCGCTCATCAATCTCCTCAAGCATGAGGCCA aac(3)-Ia ACGCGCTTGGTGCTTATGTGATCTACGTGCAAGCAGATTACGGTGACGATCCCGC 770 AGTGGCTCTCTATACAAAGTTGGG GGTATGCCCAGTCGTACGTTGCTCTTGGAAGCGGGGACGGATGGTGGGAAGAAGA AACCGATCCAGGAGTACGCGGAATAGACCAGTTACTGGCGAATGCATCACAACTG GGCAAAGGCTTGGGAACCAAGCTGGTTCGAGCTCTGGTTGAGTTGCTGTTCAATG aac(3)- ATCCCGAGGTCACCAAGATCCAAACGGACCCGTCGCCGAGCAACTTGCGAGCGAT Ib / aac(6′)-Ib″ 771 CCGATGCTACGAGAAAGCGGGGTTTGAGAGGCAAGGTACCGTAACCACCCCAGAT GGTCCAGCCGTGTACATGGTTCAAACACGCCAGGCATTCGAGCGAACACGCAGTG TT GGTATGCCCAGTCGTACGTTGCTCTTGGAAGCGGGGACGGATGGTGGGAAGAAGA aac(6′)- AACCGATCCAGGAGTACGCGGAATAGACCAGTTACTGGCGAATGCATCACAACTG 30 / aac(6′)-Ib′ 772 GGCAAAGGCTTGGGAACCAAGCTGGTTCGAGCTCTGGTTGAGTTGCTGTTCAATG ATCCCGAGGTCACCAAGATCCAAACGGACCCGTCGCCGAGCAACTTGCGAGCGAT CCGATGCTACGAGAAAGCGGGGTTTGAGAGGCAAGGTACCGTAACCACCCCAGAT GGTCCAGCCGTGTACATGGTTCAAACACGCCAGGCATTCGAGCGAACACGCAGTG TT GGTATGCCCAGTCGTACGTTGCTCTTGGAAGCGGGGACGGATGGTGGGAAGAAGA AACCGATCCAGGAGTACGCGGAATAGACCAGTTACTGGCGAATGCATCACAACTG GGCAAAGGCTTGGGAACCAAGCTGGTTCGAGCTCTGGTTGAGTTGCTGTTCAATG aac(6′)-Ib ATCCCGAGGTCACCAAGATCCAAACGGACCCGTCGCCGAGCAACTTGCGAGCGAT 773 CCGATGCTACGAGAAAGCGGGGTTTGAGAGGCAAGGTACCGTAACCACCCCAGAT GGTCCAGCCGTGTACATGGTTCAAACACGCCAGGCATTCGAGCGAACACGCAGTG TT GGTATGCCCAGTCGTACGTTGCTCTTGGAAGCGGGGACGGATGGTGGGAAGAAGA AACCGATCCAGGAGTACGCGGAATAGACCAGTTACTGGCGAATGCATCACAACTG aac(6′)-Ib′ ATCCCGAGGTCACCAAGATCCAAACGGACCCGTCGCCGAGCAACTTGCGAGCGAT 774 CCGATGCTACGAGAAAGCGGGGTTTGAGAGGCAAGGTACCGTAACCACCCCAGAT GGTCCAGCCGTGTACATGGTTCAAACACGCCAGGCATTCGAGCGAACACGCAGTG TT GGTATGCCCAGTCGTACGTTGCTCTTGGAAGCGGGGACGGATGGTGGGAAGAAGA AACCGATCCAGGAGTACGCGGAATAGACCAGTTACTGGCGAATGCATCACAACTG GGCAAAGGCTTGGGAACCAAGCTGGTTCGAGCTCTGGTTGAGTTGCTGTTCAATG aac(6′)-Ib11 ATCCCGAGGTCACCAAGATCCAAACGGACCCGTCGCCGAGCAACTTGCGAGCGAT 775 CCGATGCTACGAGAAAGCGGGGTTTGAGAGGCAAGGTACCGTAACCACCCCAGAT GGTCCAGCCGTGTACATGGTTCAAACACGCCAGGCATTCGAGCGAACACGCAGTG TT GGTATGCCCAGTCGTACGTTGCTCTTGGAAGCGGGGACGGATGGTGGGAAGAAGA AACCGATCCAGGAGTACGCGGAATAGACCAGTTACTGGCGAATGCATCACAACTG GGCAAAGGCTTGGGAACCAAGCTGGTTCGAGCTCTGGTTGAGTTGCTGTTCAATG ant(3″)- ATCCCGAGGTCACCAAGATCCAAACGGACCCGTCGCCGAGCAACTTGCGAGCGAT Ih / aac(6′)-IId 776 CCGATGCTACGAGAAAGCGGGGTTTGAGAGGCAAGGTACCGTAACCACCCCAGAT GGTCCAGCCGTGTACATGGTTCAAACACGCCAGGCATTCGAGCGAACACGCAGTG TT GGTATGCCCAGTCGTACGTTGCTCTTGGAAGCGGGGACGGACGGTGGGAAGAAGA AACCGATCCAGGAGTACGCGGAATAGACCAGTTACTGGCGAATGCATCACAACTG GGCAAAGGCTTGGGAACCAAGCTGGTTCGAGCTCTGGTTGAGTTGCTGTTCAATG aac(6′)-Ib-cr ATCCCGAGGTCACCAAGATCCAAACGGACCCGTCGCCGAGCAACTTGCGAGCGAT 777 CCGATGCTACGAGAAAGCGGGGTTTGAGAGGCAAGGTACCGTAACCACCCCATAT GGTCCAGCCGTGTACATGGTTCAAACACGCCAGGCATTCGAGCGAACACGCAGTG AT ACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATCGTGG aadA1 CTGGCTCGAAGATACCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAG 778 TTCGCGCTTAGCT ACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATCGTGG aadA12 CTGGCTCGAAGATACCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAG 779 TTCGCGCTTAGCT ACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATCGTGG aadA15 CTGGCTCGAAGATACCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAG 780 TTCGCGCTTAGCT ACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATCGTGG aadA22 CTGGCTCGAAGATACCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAG 781 TTCGCGCTTAGCT Sample or Specimen Described herein are compositions, kits, and method for the detection (i.e., the presence or absence) of antibiotic resistance genes including one or more of one or more of one or more of antibiotic resistance genes conferring resistance to molecularly characterized extended- spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a specimen or a sample. DNA or RNA is extracted from one or more specimen / sample, reverse transcribed if required, multiplied using real-time amplification (or RT- PCR if required), and detected using specific primers and a fluorescent reporter dye probe for one or more of one or more of one or more of one or more of antibiotic resistance genes conferring resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended- spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside. As will be appreciated by those in the art, the specimen / sample may comprise any number of things, including, but not limited to, include samples, swabs, or tissue samples (for example, taken during a biopsy) obtained from human patients; research samples; purified samples, such as purified genomic DNA, RNA, proteins, etc.; and raw samples (bacteria, virus, genomic DNA, etc.). As will be appreciated by those in the art, any experimental manipulation can have been performed on the sample before analysis. In some embodiments, the specimen / sample type for diagnosis of wound pathogens is one or more swabs of a subject’s body or of a wound. If required, nucleic acid from the sample / specimen is isolated using known techniques. For example, the sample / specimen may be treated to lyse the cells, using known lysis buffers, sonication, electroporation, etc., with purification occurring as needed, as will be appreciated by those in the art. In addition, the reactions outlined herein may be accomplished in a variety of ways, as will be appreciated by those in the art. Components of the reaction may be added individually, simultaneously, or sequentially, in any order, with preferred embodiments outlined below. In addition, the reaction may include a variety of other reagents that may be included in the assays. These include reagents like salts, buffers, neutral proteins, e.g., albumin, detergents, etc., which may be used to facilitate optimal hybridization and detection, and / or reduce non- specific or background interactions. Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may be used, depending on the sample / specimen preparation methods and purity of the target antibiotic resistance gene targets. In some embodiments, total nucleic acid extraction from a sample or a swab, such as a wound swab, is performed. The specimen / sample may be collected and transported in the Remel™ Cary-Blair Transport Medium by Thermo Fisher Scientific according to appropriate laboratory procedures. Remel™ Cary-Blair Transport Medium is a semisolid medium recommended for use in the collection, transportation, and preservation of sample / specimens, especially wound samples and swabs. Nucleic acids may be isolated and purified from the specimen / sample using a nucleic acid isolation, such as, e.g., the MagMAX™ Microbiome Ultra Nucleic Acid Isolation Kit with Bead Plate (Thermo Fisher Scientific). Nucleic acid extraction may be performed via an automated process using, e.g., the Kingfisher™ Flex Purification System. For RNA viruses, the RNA is reverse transcribed into cDNA. The cDNA and genomic DNA (from DNA viruses) are then subjected for amplification using the currently disclosed composition, method, or kit. Process Control, Control Organism, or Control Sample In addition, the disclosed kit and method of detection may further include a process control (“process control” is herein referred to, interchangeably, as “control organism” or “control sample”). This is an exogenous control that has the added advantage of being a bacterial lysis control in addition to being a nucleic acid extraction and recovery control. Controls are treated and tested in parallel with target pathogen and are used to generate a predetermined expected result. When the expected result is reported, one or more aspects of the diagnostic test are confirmed to be working as intended, enabling the user of to verify the diagnostic test as valid. The process control may be Bacillus atrophaeus, which is a gram- positive, endospore forming bacterium. Preferably, the process control can function as a positive control for lysis, purification and amplification within the cartridges described herein. One exemplified process control is lyophilized Bacillus atrophaeus, such as, e.g., the TaqMan™ Universal Extraction Control Organism by Thermo Fisher Scientific. The process control may be supplied lyophilized in a quantity of 1 × 109copies / vial, and reconstituted in 200 µL of 1× PBS, pH 7.4 to a final concentration 5 × 106copies / µL. During nucleic acid isolation, 10 µL of the process control is processed as a stand-alone sample in a background of universal transport media. The process control can be added to a negative extraction control. The process control may be added to one or more samples / specimens at the start of the extraction process. The process control is carried through the remainder of the workflow with the samples / specimens. It is recommended that at least one stand-alone control sample is run per extraction plate. Another exemplified process control is a bacterial spore, such as a spore of a Bacillus species. Suitable spores can be comprised of any species of Bacillus, including, e.g., Bacillus globigii, Bacillus atrophaeus, Bacillus subtilis, or Bacillus stearothermophilus. In one embodiment, the process control may be a Bacillus atrophaeus bacterial spore. In one embodiment, vicinal oxygen chelate (VOC) genes (accession number cll463) of Bacillus atrophaeus are detected as a process control. Another exemplified process control is the TaqMan® Universal RNA Spike In / Reverse Transcription (Xeno) Control is an exogenous process control for nucleic acid isolation, reverse transcription, and preamplification. The control can also be used as an internal positive control for real-time PCR. The control is used with the proprietary TaqMan® assay for Xeno™ sequences. Positive Control In addition, the disclosed method of detection may further include a positive control to determine the validity of the assay. The positive control is a mixture of plasmids of the antibiotic resistance genes. For instance, an exemplified positive control is a mixture of plasmids containing sequences for one or more of one or more of one or more of antibiotic resistance genes conferring resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended- spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside. I In one aspect, the control plasmid comprises one or more the sequences shown in Table 20. This plasmid can be used with the primers and probes of Tables 2–17 as positive control. Reaction Mixture The terms “reaction mixture,” “amplification mixture,” or “PCR mixture” as used herein refer to a mixture of components necessary to amplify at least one amplicon from nucleic acid templates. The mixture may comprise nucleotides (dNTPs, such as A, C, G, and T), a thermostable polymerase, primers, and a plurality of nucleic acid templates. The mixture may further comprise a buffer. As used herein, “buffer” refers a solution that can include multiple components such buffers that maintain a specific pH (e.g., Tris^HCl), mono and divalent salts (e.g., NaCl, KCl, (NH4)2SO4, MgCl2, MgSO4), cofactors, detergents (e.g., Polysorbate 20 (Tween™ 20), t-octylphenoxy polyethoxyethanol (Triton™ X-100), octylphenoxy polyethoxyethanol (Nonidet™ P-40)), and other additives (e.g., glycerol, polyethylene glycol, betaine, formamide, dimethyl sulfoxide, dithiothreitol, tetramethylammonium chloride, bovine serum albumin, gelatin, inter alia), The working concentration range of each component is known in the art and can be optimized as needed. An exemplary PCR reaction mixture comprises: 50 fg to 50 ng of target DNA; 0.1–1 μM of each primer and probe; 1–2 units of Taq DNA polymerase; 0.2 mM of each dNTP; 20 mM Tris^HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, and water to the requisite volume. Typically, the PCR mixture is dispensed into a PCR microtube, port or reservoir (e.g., of a TaqMan™ Array Card) or plate (e.g., wells of a TaqMan™ OpenArray sample plate),, the mixture is mixed by vortexing, and either capped, sealed, or overlayed with mineral oil or silicone oil to prevent evaporation. Amplification “Amplification” as used herein refers to the use of any amplification procedures to increase the concentration of a particular nucleic acid sequence within a mixture of nucleic acid sequences. In one embodiment and as describe more fully herein, a sequence from a sample is amplified to produce a secondary target (e.g., an amplicon) that is detected, as outlined herein. Amplification involves the amplification (replication) of the sequence to be detected, such that the number of copies of the sequence is increased. Suitable amplification techniques include, but are not limited to, the polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription mediated amplification (TMA) and nucleic acid sequence-based amplification (NASBA). In one embodiment, the amplification technique is PCR. The polymerase chain reaction (PCR) is well known and involves the use of primer extension combined with thermal cycling to amplify a target sequence. As used herein, “PCR”, unless specifically defined, refers to either single-plex (i.e., individual) or multiplex PCR assays, and can be real time or quantitative PCR (wherein detection occurs during amplification), end-point PCR (when detection occurs at the end amplification), or reverse transcription PCR, including but not limited to, “real-time PCR” or “quantitative PCR” or “qPCR”, “digital PCR” or “dPCR”, “reverse transcriptase PCR” or “RT-PCR”, “multiplex PCR”, “nested PCR”, “hot start PCR”, “long-range PCR”, “assembly PCR”, “asymmetric PCR”, “in situ PCR,” “single-cell PCR,” or “fast-cycling PCR,” among others. An exemplary PCR amplification typically consists of 25–35 cycles of: a denaturing step a 94 °C for 30–45 seconds; an annealing step at 55 °C for 20–60 seconds; and an extension step at 72 °C for 30–90 seconds. The amplification may be preceded by an initial denaturation step at 94 °C for 2–3 minutes. The amplification may be followed by a final extension step at 72 °C for 10 min, and then cooled to 4 °C and maintained at this temperature until the samples are removed from the thermocycler. Example embodiments of amplification are not limited to PCR. For instance, signal amplification, single base extension (SBE) or minisequencing, oligonucleotide ligation amplification (OLA) and / or rolling-circle amplification can be used for amplification. In an embodiment, amplification can include OLA followed by RCA. A skilled person would be well aware of the real-time PCR systems that can be used for an individual or multiplex detection using several dyes, or nucleic acid amplification assays as described herein. Exemplary systems include a real-time quantitative PCR (qPCR) instrument, including for example a QuantStudio™ Real-Time PCR system, such as the QuantStudio™5 Real-Time PCR System (QS5), QuantStudio™ 7 Real-Time PCR System (QS7), QuantStudio™ 12K Flex System (QS12K), QuantStudio™ DX Real-Time PCR System (QS Dx or QS5 Dx), or a 7500 Real-Time PCR system, such as the 7500 Fast Dx system, all from Applied Biosystems™ – a Thermo Fisher Scientific brand. Amplicon The terms “amplified product” or “amplicon” refer to a fragment of DNA amplified by a polymerase using a pair of primers in an amplification method such as PCR. Probe “Probe” as used herein, is a non-extendable oligonucleotide attached to a fluorescent reporter dye and a quencher moiety. Primer “Primer” as used herein can refer to more than one primer and refers to an oligonucleotide, whether occurring naturally or produced synthetically, which is capable of acting as an initiation- point for primer extension synthesis when placed under conditions that produce a primer extension product which is complementary to a nucleic acid strand, e.g., in the presence of nucleotides and an agent for polymerization such as DNA polymerase, at a suitable temperature for a sufficient amount of time and in the presence of a buffering agent. Such conditions can include, for example, the presence of at least four different deoxyribonucleoside triphosphates (such as A, C, G, and T) and a polymerization-inducing agent such as DNA polymerase or reverse transcriptase, in a suitable buffer, and at a suitable temperature. In some embodiments, the primer may be single-stranded for maximum efficiency in amplification. The primers herein are selected to be substantially complementary to the different strands of each specific sequence to be amplified. This means that the primers must be sufficiently complementary to hybridize with their respective strands. A non-complementary nucleotide fragment may be attached to the 5′-end of the primer, with the remainder of the primer sequence being complementary, or partially complementary, to the target region of the target nucleic acid. Commonly, the primers are complementary, except when non-complementary nucleotides may be present at a predetermined sequence location, such as a primer terminus as described. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5′-end of one sequence is paired with the 3′-end of the other, is in “antiparallel association.” Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Dyes, Detectable Labels, or Fluorescent Labels The primers and / or probes described herein may further comprise a dye, fluorescent label, or other detectable label. It should be appreciated that when using multiple fluorescent or detectable labels, particularly in an individual or multiplex format, each fluorescent or detectable label preferably differs in its spectral properties from the other detectable labels used therewith such that the labels may be distinguished from each other, or such that together the fluorescent or detectable labels emit a signal that is not emitted by either fluorescent or detectable label alone. Exemplary fluorescent or detectable labels include, for instance, a fluorescent dye or fluorophore (e.g., a chemical group that can be excited by light to emit fluorescence or phosphorescence), “acceptor dyes” capable of quenching a fluorescent signal from a fluorescent donor dye, and the like, as described above. Suitable fluorescent or detectable labels may include, for example, fluoresceins (e.g., 5-carboxy-2,7-dichlorofluorescein; 5-carboxyfluorescein (5-FAM); 5-hydroxy tryptamine (5-HAT); 6-JOE; 6-carboxyfluorescein (6-FAM); Mustang Purple, VIC, ABY, JUN; FITC; 6-carboxy-4′,5′-dichloro-2′,7′-dimethoxy-fluorescein (JOE)); 6-carboxy-1,4-dichloro-2′,7′- dichloro-fluorescein (TET); 6-carboxy-1,4-dichloro-2′,4′,5′,7′-tetra-chlorofluorescein (HEX); Alexa Fluor fluorophores (e.g., 350, 405, 430, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 635, 647, 660, 680, 700, 750); BODIPY fluorophores (e.g., 492 / 515, 493 / 503, 500 / 510, 505 / 515, 530 / 550, 542 / 563, 558 / 568, 564 / 570, 576 / 589, 581 / 591, 630 / 650-X, 650 / 665-X, 665 / 676, FL, FL ATP, FI-Ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, TR-X SE), Cascade Blue, Cascade Yellow; Cy™ dyes (e.g., 3, 3.18, 3.5, 5, 5.18, 5.5, 7), cyan GFP, cyclic AMP Fluorosensor (FiCRhR), fluorescent proteins (e.g., green fluorescent protein (e.g., GFP, EGFP), blue fluorescent protein (e.g., BFP, EBFP, EBFP2, Azurite, mKalamal), cyan fluorescent protein (e.g., ECFP, Cerulean, CyPet), yellow fluorescent protein (e.g., YFP, Citrine, Venus, YPet), FRET donor / acceptor pairs (e.g., fluorescein / fluorescein, fluorescein / tetramethylrhodamine, IAEDANS / fluorescein, EDANS / dabcyl, BODIPY FL / BODIPY FL, Fluorescein / QSY7 and QSY9), LysoTracker and LysoSensor (e.g., LysoTracker Blue DND- 22, LysoTracker Blue-White DPX, LysoTracker Yellow HCK-123, LysoTracker Green DND-26, LysoTracker Red DND-99, LysoSensor Blue DND-167, LysoSensor Green DND-189, LysoSensor Green DND-153, LysoSensor Yellow / Blue DND-160, LysoSensor Yellow / Blue 10,000 MW dextran), Oregon Green (e.g., 488, 488-X, 500, 514); rhodamines (e.g., 110, 123, B, B 200, BB, BG, B extra, 5-carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6- Carboxyrhodamine 6G, Lissamine, Lissamine Rhodamine B, Phallicidin, Phalloidine, Red, Rhod- 2, ROX (6-carboxy-X-rhodamine), 5-ROX (carboxy-X-rhodamine), Sulphorhodamine B can C, Sulphorhodamine G Extra, TAMRA (6-carboxytetramethyl-rhodamine), Tetramethylrhodamine (TRITC), Texas Red, Texas Red-X, among others as would be known to those of skill in the art. Exemplary fluorescent labels include but are not limited to FAM, VIC, ABY, JUN, AF647, or 6FAM. In one exemplary individual or multiplex dye scheme, the fluorescent labels include FAM, VIC, ABY, JUN, or AF647; or 6FAM, VIC, ABY, JUN, or FAM. In another exemplary individual or multiplex dye scheme, the fluorescent labels include FAM, HEX (JOE / VIC), Texas Red, and Cy5 dyes. In one embodiment the probes are labeled with FAM. Other detectable labels may be used in addition to or as an alternative to labelled probes. For example, primers can be labeled and used to both generate amplicons and to detect the presence (or concentration) of amplicons generated in the reaction, and such may be used in addition to or as an alternative to labeled probes described herein. As a further example, primers may be labeled and utilized as described in Nazarenko et al., Nucleic Acids Res. 30(9): e37 (2002), Hayashi et al., Nucleic Acids Res.17(9): 3605 (1989), and / or Neilan et al., Nucleic Acids Res.25(14): 2938-2939 (1997). Those of skill in the art are capable of utilizing the PCR processes (and associated probe and primer design techniques) described in Zhu et al., Biotechniques (4): 317-325 (2020). In some embodiments, the primers and / or probes may further comprise a quencher. Suitable quenchers include but are not limited to QSY (e.g., QSY7 and QSY21), BHQ (Black Hole Quencher) and DFQ (Dark Fluorescent Quencher). In an exemplary embodiment, the quencher is QSY7. Detector probes may also include two probes, wherein, for example, a fluorophore is associated with one probe and a quencher is associated with a complementary probe such that hybridization of the two probes on a target quenches the fluorescent signal or hybridization on the target alters the signal signature via a change in fluorescence. Detector probes may also include sulfonate derivatives of fluorescein dyes with SO3 instead of the carboxylate group, phosphoramidite forms of fluorescein, phosphoramidite forms of Cy5. Any of these systems and detectable labels, as well as many others, may be used to detect amplified target nucleic acids. In some embodiments, intercalating labels can be used such as ethidium bromide, SYBR Green I, SYBR GreenER, and PicoGreen (all products of Applied Biosystems – a brand of Thermo Fisher Scientific), thereby allowing visualization in real- time, or end point, of an amplification product in the absence of a detector probe. In some embodiments, real-time visualization may include both an intercalating detector probe and a sequence-based detector probe. In some embodiments, the detector probe is at least partially quenched when not hybridized to a complementary sequence in the amplification reaction and is at least partially unquenched when hybridized to a complementary sequence in the amplification reaction. In some embodiments, probes may further comprise various modifications such as a minor groove binder (MGB) to further provide desirable thermodynamic characteristics. In some embodiments, the amplicon is labeled by incorporation of, or hybridization to labeled primer. In some embodiments, the amplicon is labeled by hybridization to a labeled probe. In some embodiments, the amplicon is labeled by binding of a DNA-binding dye. In some embodiments, the dye may be a single-strand DNA binding dye. In other embodiments, the dye may be a double-stranded DNA binding dye. In other embodiments, the amplicon is labeled via polymerization or incorporation of labeled nucleotides in a template-dependent (or template- independent) polymerization reaction. This can be part of the amplifying step or alternatively the labeled nucleotide can be added after amplifying is completed. The labeled amplicon (or labeled derivative thereof) can be detected using any suitable method such as, for example, electrophoresis, hybridization-based detection (e.g., microarray, molecular beacons, and the like), chromatography, NMR, and the like. In one exemplary embodiment, the labeled amplicon is detected using qPCR. In some embodiments, a plurality of different amplicons is formed, and optionally labeled, within a single reaction volume via a single amplification reaction. For example, a multiplex reaction (e.g., 4- plex) carried out in a single tube or reaction vessel (e.g., “single-tube” or” I-tube” or “single-vessel” reaction) can produce a plurality of amplicons that are labeled. In some embodiments, the plurality of amplicons can be differentially labeled. In some embodiments, each of the plurality of amplicons produced during amplification is labeled with a different label. Assay Mixture The terms “assay mixture” or “assay mix” or “assay composition,” as used herein, include mixture containing the primer-probe pairs described above that are used in PCR. Another aspect provided herein is a method of detecting or quantifying a target nucleic acid molecule in a sample by polymerase chain reaction (PCR), such as by quantitative real-time polymerase chain reaction (qPCR). In one embodiment, the method includes: (i) contacting a sample comprising one or more target nucleic acid molecules with (a) at least one probe, such as those described herein, being sequence specific for the target nucleic acid molecule, where the at least one probe undergoes a detectable change in fluorescence upon amplification of the one or more target nucleic acid molecules; and with (b) at least one oligonucleotide primer pair; (ii) incubating the mixture of step (i) with a DNA polymerase under conditions sufficient to amplify one or more target nucleic acid molecules; and (iii) detecting the presence or absence or quantifying the amount of the amplified target nucleic acid molecules by measuring fluorescence of the probe. In some embodiments, the DNA polymerase comprises 5′-exonuclease activity. In some other embodiments, the DNA polymerase is a Thermus aquaticus (Taq) DNA polymerase. In some embodiments, the probe is a hydrolysis probe, such as a TaqMan™ probe. Another aspect provided herein is a kit for PCR, such as quantitative real-time polymerase chain reaction (qPCR) and reverse transcription polymerase chain reaction (RT-PCR). In an exemplary embodiment, the kit includes the assay mixture, the process control, and the positive control each described above, as well as an individual or multiplex master mix. In an embodiment, the individual or multiplex master mix is a RT-qPCR mix that provides for sensitive, reproducible detection of a plurality of different target antibiotic resistance genes in a single multiplex reaction. In another embodiment, the individual master mix provides for sensitive, reproducible detection of a sing antibiotic resistance gene. In an embodiment, the individual or multiplex master mix may include an enzyme (for instance, DNA polymerase), a thermostable enzyme, enzyme cofactors, deoxynucleotide triphosphates (dNTPs) including dUTP, an enzyme inhibitor (for instance, RNase inhibitor), a dye and / or a buffer agent. In an exemplary embodiment, the multiplex master mix can be, for instance, TaqPath™ 1-step Multiplex Master Mix by Applied Biosystems – a brand of Thermo Fisher Scientific. In an embodiment, the master mix may be concentrated. For instance, the master mix may be provided at a 4× concentration. In some embodiments, the master mix is prepared such that it requires less than a 3× dilution prior to use in PCR, e.g., 2× dilution, 1.5× dilution, 1.2× dilution, etc. In some embodiments, the kit also includes instructions for conducting the PCR, and one or more of the following: a buffering agent, deoxynucleotide triphosphates (dNTPs), an organic solvent, an enzyme, enzyme cofactors, and an enzyme inhibitor. In another embodiment, the kit for PCR comprises the described dye and / or quencher moiety, instructions for conjugating or labeling the dye and / or quencher moiety to a biomolecule, such as an oligonucleotide, instructions for conducting the PCR, and one or more of the following: a buffering agent, deoxynucleotide triphosphates (dNTPs), an organic solvent, an enzyme, enzyme cofactors, and an enzyme inhibitor. In some embodiments, the systems, compositions, methods, and devices used for nucleic acid amplification comprise a “point-of-service” (POS) system. In some embodiments, samples may be collected and / or analyzed at a “point-of-care” (POC) location. In some embodiments, analysis at a POC location typically does not require specialized equipment and has rapid and easy-to-read visual results. In some embodiments, analysis can be performed in the field, in a home setting, and / or by a lay person not having specialized skills. In certain embodiments, for example, the analysis of a small-volume clinical sample may be completed using a POS system in a short period of time (e.g., within hours or minutes). Optionally, a POS system is utilized at a location that is capable of providing a service (e.g., testing, monitoring, treatment, diagnosis, guidance, sample collection, verification of identity (ID verification), and other services) at or near the site or location of the subject. A service may be a medical service, or it may be a non-medical service. In some situations, a POS system provides a service at a predetermined location, such as a subject’s home, school, or work, or at a grocery store, a drug store, a community center, a clinic, a doctor’s office, a hospital, an outdoor triage tent, a makeshift hospital, a border check point, etc. A POS system can include one or more point of service devices, such as a portable antibiotic resistance gene detector. In some embodiments, a POS system is a point of care system. In some embodiments, the POS system is suitable for use by non-specialized workers or personnel, such as nurses, police officers, civilian volunteers, or the patient. In certain embodiments, a POC system is utilized at a location at which medical-related care (e.g., treatment, testing, monitoring, diagnosis, counseling, etc.) is provided. A POC may be, e.g., at a subject’s home, work, or school, or at a grocery store, a community center, a drug store, a doctor’s office, a clinic, a hospital, an outdoor triage tent, a makeshift hospital, a border check point, etc. A POC system is a system which may aid in, or may be used in, providing such medical-related care, and may be located at or near the site or location of the subject or the subject’s health care provider (e.g., subject’s home, work, or school, or at a grocery store, a community center, a drug store, a doctor’s office, a clinic, a hospital, etc.). In embodiments, a POS system is configured to accept a clinical sample obtained from a subject at the associated POS location. In embodiments, a POS system is further configured to analyze the clinical sample at the POS location. In embodiments, the clinical sample is a small volume clinical sample. In embodiments, the clinical sample is analyzed in a short period of time. In embodiments, the short period of time is determined with respect to the time at which sample analysis began. In embodiments, the short period of time is determined with respect to the time at which the sample was inserted into a device for the analysis of the sample. In embodiments, the short period of time is determined with respect to the time at which the sample was obtained from the subject. In some embodiments, a POS system or a POC system can include the amplification- based methods, compositions and kits disclosed herein, including any of the described assays and / or assay panels. Such assays are contemplated for use with both thermal cycling amplification workflows and protocols, such as in PCR, as well as isothermal amplification workflows and protocols, such as in LAMP. In some embodiments, a POS or a POC system comprises self-collection of a biological sample. In some embodiments, the self-collection may comprise the use of a self-collection kit and / or device, such as a swab or a tube. In some embodiments, the self-collection kit comprises instructions for use, including collection instructions, sample preparation or storage instructions, and / or shipping instructions. For example, the self-collection kit and / or device may be used by an individual, such as lay person, not having specialized skills or medical expertise. In some embodiments, self-collection may be performed by the patient themselves or by any other individual in proximity to the patient, such as but not limited to a parent, a care giver, a teacher, a friend, or other family member. Notably, in some embodiments, the nucleic acid amplification protocol can be configured for rapid processing (e.g., in less than about 45 minutes) and high throughput, allowing for a minimally invasive method to quickly screen large numbers of individuals in a scalable way. This can be particularly useful to perform asymptomatic testing (e.g., high frequency / widespread testing at schools, workplaces, conventions, sporting events, large social gatherings, etc.) or for epidemiological purposes. The disclosed embodiments can also beneficially provide a lower cost sample collection system and method that enables self-collection (reducing health care professional staffing needs) using a low-cost collection device. This eliminates the requirements for swabs, buffers, virus transmission media (or other specialized transport medium), and the like. The disclosed embodiments also allow for a reduction in Personal Protective Equipment (PPE) requirements and costs. There is also a beneficial reduced dependence on supply-constrained items, and the compatibility of these methods and kit components with existing equipment improves the flexibility and simplicity of their implementation to the masses. Overall, such embodiments allow for a less expensive assay that can be accomplished more quickly from sample collection through result generation. It will be apparent to one of ordinary skill in the relevant art that suitable modifications and adaptations to the compositions, formulations, methods, processes, and applications described herein can be made without departing from the scope of any embodiments or aspects thereof. The compositions and methods provided are exemplary and are not intended to limit the scope of any of the specified embodiments. All of the various embodiments, aspects, and options disclosed herein can be combined in any variations or iterations. The scope of the compositions, formulations, methods, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences herein described. The exemplary compositions and formulations described herein may omit any component, substitute any component disclosed herein, or include any component disclosed elsewhere herein. The ratios of the mass of any component of any of the compositions or formulations disclosed herein to the mass of any other component in the formulation or to the total mass of the other components in the formulation are hereby disclosed as if they were expressly disclosed. Should the meaning of any terms in any of the patents or publications incorporated by reference conflict with the meaning of the terms used in this disclosure, the meanings of the terms or phrases in this disclosure are controlling. Furthermore, the foregoing discussion discloses and describes merely exemplary embodiments. All patents and publications cited herein are incorporated by reference herein for the specific teachings thereof. Various embodiments and aspects of the inventions described herein are summarized by the following clauses: Clause 1. A method for individually, simultaneously, or sequentially determining the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β- lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample, the method comprising the steps of: (a) creating a reaction mixture containing the sample and one or more Primer Pair Sets, wherein the Primer Pair Sets comprise one or more of: at least one primer pair selected from Primer Pair Set 1 that specifically amplifies a portion of a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER; at least one primer pair selected from Primer Pair Set 2 that specifically amplifies an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M; at least one primer pair selected from Primer Pair Set 3 that specifically amplifies a portion of a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP; at least one primer pair selected from Primer Pair Set 4 that specifically amplifies a portion of a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY; at least one primer pair selected from Primer Pair Set 5 that specifically amplifies a portion of a β-lactamase resistance gene selected from: blaTEM; at least one primer pair selected from Primer Pair Set 6 that specifically amplifies a portion of a lincosamide, macrolide, streptogramin resistance gene selected from: cfr; at least one primer pair selected from Primer Pair Set 7 that specifically amplifies a portion of a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG; at least one primer pair selected from Primer Pair Set 8 that specifically amplifies a portion of a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A); at least one primer pair selected from Primer Pair Set 9 that specifically amplifies a portion of a methicillin resistance gene selected from: mecA or mecC; at least one primer pair selected from Primer Pair Set 10 that specifically amplifies a portion of a colistin resistance gene selected from: mcr-1, mcr-2, or mcr- 3; at least one primer pair selected from Primer Pair Set 11 that specifically amplifies a portion of a sulfonamide resistance gene selected from: sul1 or sul2; at least one primer pair selected from Primer Pair Set 12 that specifically amplifies a portion of a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S); at least one primer pair selected from Primer Pair Set 13 that specifically amplifies a portion of a vancomycin resistance gene selected from: vanA or vanB; at least one primer pair selected from Primer Pair Set 14 that specifically amplifies a portion of a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE; at least one primer pair selected from Primer Pair Set 15 that specifically amplifies a portion of a quinolone resistance gene selected from: qnrB, qnrA, or qnrS; and / or at least one primer pair selected from Primer Pair Set 16 that specifically amplifies a portion of a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)- Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating at least one amplicon when the targeted nucleic acids are present in the sample; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β- lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in the sample. Clause 2. The method of clause 1, wherein the Primer Pair Sets comprise the following sequences: Primer Pair Set 1 comprises at least one forward and reverse primer pair specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the primer pairs selected from SEQ ID NO: 1–2; 4–5; 7–8; 10–11; 13–14; 16–17; 19–20; 22–23; or 25–26; Primer Pair Set 2 comprises at least one forward and reverse primer pair specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the primer pairs selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53; Primer Pair Set 3 comprises at least one forward and reverse primer pair specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the primer pairs selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79– 80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149; Primer Pair Set 4 comprises at least one forward and reverse primer pair specific for a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the primer pairs selected from SEQ ID NO: 151–152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208–209; or 211–212; Primer Pair Set 5 comprises at least one forward and reverse primer pair specific for a β- lactamase resistance gene selected from: blaTEM, the primer pairs selected from SEQ ID NO: 214–215; 217–218; or 220–221; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the primer pairs selected from SEQ ID NO: 223–224; 226–227; or 229–230; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the primer pairs selected from SEQ ID NO: 232–233; 235– 236; 238–239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259– 260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280–281; 283– 284; 286–287; 289–290; 292–293; 295–296; 298–299; 301–302; 304–305; or 307–308; Primer Pair Set 8 comprises at least one forward and reverse primer pair specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the primer pairs selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325–326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374; Primer Pair Set 9 comprises at least one forward and reverse primer pair specific for a methicillin resistance gene selected from: mecA or mecC, the primer pairs selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392; Primer Pair Set 10 comprises at least one forward and reverse primer pair specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the primer pairs selected from SEQ ID NO: 394–395; 397–398; 400–401; 403–404; 406–407; 409– 410; 412–413; 415–416; or 418–419; Primer Pair Set 11 comprises at least one forward and reverse primer pair specific for a sulfonamide resistance gene selected from: sul1 or sul2, the primer pairs selected from SEQ ID NO: 421–422; 424–425; 427–428; 430–431; 433–434; or 436–437; Primer Pair Set 12 comprises at least one forward and reverse primer pair specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the primer pairs selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473; Primer Pair Set 13 comprises at least one forward and reverse primer pair specific for a vancomycin resistance gene selected from: vanA or vanB, the primer pairs selected from SEQ ID NO: 475–476; 478–479; 481–482; 484–485; 487–488; or 490–491; Primer Pair Set 14 comprises at least one forward and reverse primer pair specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the primer pairs selected from SEQ ID NO: 493–494; 496–497; 499–500; 502–503; 505–506; 508–509; 511–512; 514–515; 517–518; 520–521; 523–524; or 526–527; Primer Pair Set 15 comprises at least one forward and reverse primer pair specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the primer pairs selected from SEQ ID NO: 529–530; 532–533; 535–536; 538–539; 541–542; 544– 545; 547–548; 550–551; 553–554; 556–557; 559–560; or 562–563; and / or Primer Pair Set 16 comprises at least one forward and reverse primer pair specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the primer pairs selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595–596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; 652–653; 655–656; 658–659; 661–662; 664–665; 667–668; or 670–671. Clause 3. The method of clause 1 or 2, wherein the generating of the at least one amplicon comprises performing PCR. Clause 4. The method of any one of clauses 1–3, wherein the at least one amplicon is one selected from: an amplicon specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER produced using at least one primer pair selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53, and a sequence comprising at least a portion of SEQ ID NO: 703, 704 or 705; an amplicon specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M produced using at least one primer pair selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79–80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149, and a sequence comprising at least a portion of SEQ ID NO: 706, 707, 708, 709 or 710; an amplicon specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP produced using at least one primer pair selected from SEQ ID NO: 151–152; 154– 155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178– 179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202– 203; 205–206; 208–209; or 211–212, and a sequence comprising at least a portion of SEQ ID NO: 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721 or 722; an amplicon specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY produced using at least one primer pair selected from SEQ ID NO: 151–152; 154– 155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178– 179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202– 203; 205–206; 208–209; or 211–212, and a sequence comprising at least a portion of SEQ ID NO: 722, 723, 724, 725, 726, 727, 728 or 729; an amplicon specific for a β-lactamase resistance gene selected from: blaTEM produced using at least one primer pair selected from SEQ ID NO: 214–215; 217–218; or 220–221, and a sequence comprising at least a portion of SEQ ID NO: 730; an amplicon specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr produced using at least one primer pair selected from SEQ ID NO: 223– 224; 226–227; or 229–230, and a sequence comprising at least a portion of SEQ ID NO: 731; an amplicon specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG produced using at least one primer pair selected from SEQ ID NO: 232–233; 235–236; 238–239; 241–242; 244–245; 247– 248; 250–251; 253–254; 256–257; 259–260; 262–263; 265–266; 268–269; 271– 272; 274–275; 277–278; 280–281; 283–284; 286–287; 289–290; 292–293; 295– 296; 298–299; 301–302; 304–305; or 307–308, and a sequence comprising at least a portion of SEQ ID NO: 732, 733, 734, 735, 736, 737, 738 or 739; an amplicon specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A) produced using at least one primer pair selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325– 326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349– 350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374, and a sequence comprising at least a portion of SEQ ID NO: 740, 741, 742, 743, 744, 745, 746 or 747; an amplicon specific for a methicillin resistance gene selected from: mecA or mecC produced using at least one primer pair selected from SEQ ID NO: 376–377; 379– 380; 382–383; 385–386; 388–389; or 391–392, and a sequence comprising at least a portion of SEQ ID NO: 748 or 749; an amplicon specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3 produced using at least one primer pair selected from SEQ ID NO: 394–395; 397– 398; 400–401; 403–404; 406–407; 409–410; 412–413; 415–416; or 418–419, and a sequence comprising at least a portion of SEQ ID NO:750, 751 or 752; an amplicon specific for a sulfonamide resistance gene selected from: sul1 or sul2 produced using at least one primer pair selected from SEQ ID NO: 421–422; 424– 425; 427–428; 430–431; 433–434; or 436–437, and a sequence comprising at least a portion of SEQ ID NO: 753 or 754; an amplicon specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S) produced using at least one primer pair selected from SEQ ID NO: 439– 440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463– 464; 466–467; 469–470; or 472–473, and a sequence comprising at least a portion of SEQ ID NO: 755, 756, 757 or 758; an amplicon specific for a vancomycin resistance gene selected from: vanA or vanb produced using at least one primer pair selected from SEQ ID NO: 475–476; 478– 479; 481–482; 484–485; 487–488; or 490–491, and a sequence comprising at least a portion of SEQ ID NO: 759 or 760; an amplicon specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE produced using at least one primer pair selected from SEQ ID NO: 493– 494; 496–497; 499–500; 502–503; 505–506; 508–509; 511–512; 514–515; 517– 518; 520–521; 523–524; or 526–527, and a sequence comprising at least a portion of SEQ ID NO: 761, 762, 763 or 764; an amplicon specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS produced using at least one primer pair selected from SEQ ID NO: 529–530; 532– 533; 535–536; 538–539; 541–542; 544–545; 547–548; 550–551; 553–554; 556– 557; 559–560; or 562–563, and a sequence comprising at least a portion of SEQ ID NO: 765, 766, 767, 768 or 769; and / or an amplicon specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22 produced using at least one primer pair selected from SEQ ID NO: 565–566; 568–569; 571– 572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595– 596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619– 620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643– 644; 646–647; 649–650; 652–653; 655–656; 658–659; 661–662; 664–665; 667– 668; or 670–671, and a sequence comprising at least a portion of SEQ ID NO: 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780 or 781. Clause 5. The method of any one of clauses 1–5, wherein the at least one amplicon is one selected from: an amplicon specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the amplicon comprising at least a portion of SEQ ID NO: 703, 704 or 705; an amplicon specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the amplicon comprising at least a portion of SEQ ID NO: 706, 707, 708, 709 or 710; an amplicon specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the amplicon comprising at least a portion of SEQ ID NO: 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721 or 722; an amplicon specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the amplicon comprising at least a portion of SEQ ID NO: 722, 723, 724, 725, 726, 727, 728 or 729; an amplicon specific for a β-lactamase resistance gene selected from: blaTEM, the amplicon comprising at least a portion of SEQ ID NO: 730; an amplicon specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the amplicon comprising at least a portion of SEQ ID NO: 731; an amplicon specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the amplicon comprising at least a portion of SEQ ID NO: 732, 733, 734, 735, 736, 737, 738 or 739; an amplicon specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the amplicon comprising at least a portion of SEQ ID NO: 740, 741, 742, 743, 744, 745, 746 or 747; an amplicon specific for methicillin resistance gene selected from: mecA or mecC, the amplicon comprising at least a portion of SEQ ID NO: 748 or 749; an amplicon specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the amplicon comprising at least a portion of SEQ ID NO: 750, 751 or 752; an amplicon specific for a sulfonamide resistance gene selected from: sul1 or sul2, the amplicon comprising at least a portion of SEQ ID NO: 753 or 754; an amplicon specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the amplicon comprising at least a portion of SEQ ID NO: 755, 756, 757 or 758; an amplicon specific for a vancomycin resistance gene selected from: vanA or vanb, the amplicon comprising at least a portion of SEQ ID NO: 759 or 760; an amplicon specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the amplicon comprising at least a portion of SEQ ID NO: 761, 762, 763 or 764; an amplicon specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the amplicon comprising at least a portion of SEQ ID NO: 765, 766, 767, 768 or 769; and / or an amplicon specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the amplicon comprising at least a portion of SEQ ID NO: 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780 or 781. Clause 6. The method any one of clauses 1–5, wherein the reaction mixture further comprises probes specific for the at least one amplicon. Clause 7. The method of any one of clauses 1–6, wherein the reaction mixture further comprises probes specific for the at least one amplicon and suitable for use with a Primer Pair Set, the probes comprising: a probe specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the probe selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, or 27; a probe specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the probe selected from SEQ ID NO: 30, 33, 36, 39, 42, 45, 48, 51, or 54; a probe specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa- 23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the probe selected from SEQ ID NO: 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, or 150; a probe specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the probe selected from SEQ ID NO: 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, or 213; a probe specific for a β-lactamase resistance gene selected from: blaTEM, the probe selected from SEQ ID NO: 216, 219, or 222; a probe specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the probe selected from SEQ ID NO: 225, 228, or 231; a probe specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the probe selected from SEQ ID NO: 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, or 309; a probe specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the probe selected from SEQ ID NO: 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375; a probe specific for methicillin resistance gene selected from: mecA or mecC, the probe selected from SEQ ID NO: 378, 381, 384, 387, 390, or 393; a probe specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the probe selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, 414, 417, or 420; a probe specific for a sulfonamide resistance gene selected from: sul1 or sul2, the probe selected from SEQ ID NO: 423, 426, 429, 432, 435, or 438; a probe specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the probe selected from SEQ ID NO: 441, 444, 447, 450, 453, 456, 459, 462, 465, 468, 471, or 474; a probe specific for a vancomycin resistance gene selected from: vanA or vanb, the probe selected from SEQ ID NO: 477, 480, 483, 486, 489, or 492; a probe specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the probe selected from SEQ ID NO: 495, 498, 501, 504, 507, 510, 513, 516, 519, 522, 525, or 528; a probe specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the probe selected from SEQ ID NO: 531, 534, 537, 540, 543, 546, 549, 552, 555, 558, 561, or 564; and / or a probe specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)- Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the probe selected from SEQ ID NO: 567, 570, 573, 576, 579, 582, 585, 588, 591, 594, 597, 600, 603, 606, 609, 612, 615, 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, 654, 657, 660, 663, 666, 669, or 672. Clause 8. The method of any one of clauses 1–7, wherein the reaction mixture further contains a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. Clause 9. The method of clause 8, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 673–674; 676–677; 679–680; 682–683; 685–686; 688–689; 691–692; 694–695; 697–698; or 700–701; and the control probe comprises a probe sequence selected from SEQ ID NO: 675; 678; 681; 684; 687; 690; 693; 696; 699; or 702. Clause 10. The method of any one of clauses 1–9, wherein the probe comprises a fluorescent reporter. Clause 11. The method of clause 10, wherein the probe comprises a quencher. Clause 12. The method of clause 10 or 11, wherein the probe is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. Clause 13. The method of any one of clauses 10–12, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Clause 14. A composition for individually, simultaneously, or sequentially determining the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β- lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside comprising a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise: at least one primer pair selected from Primer Pair Set 1 that specifically amplifies a portion of a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER; at least one primer pair selected from Primer Pair Set 2 that specifically amplifies an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M; at least one primer pair selected from Primer Pair Set 3 that specifically amplifies a portion of a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa- 2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP; at least one primer pair selected from Primer Pair Set 4 that specifically amplifies a portion of a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY; at least one primer pair selected from Primer Pair Set 5 that specifically amplifies a portion of a β-lactamase resistance gene selected from: blaTEM; at least one primer pair selected from Primer Pair Set 6 that specifically amplifies a portion of a lincosamide, macrolide, streptogramin resistance gene selected from: cfr; at least one primer pair selected from Primer Pair Set 7 that specifically amplifies a portion of a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG; at least one primer pair selected from Primer Pair Set 8 that specifically amplifies a portion of a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A); at least one primer pair selected from Primer Pair Set 9 that specifically amplifies a portion of a methicillin resistance gene selected from: mecA or mecC; at least one primer pair selected from Primer Pair Set 10 that specifically amplifies a portion of a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3; at least one primer pair selected from Primer Pair Set 11 that specifically amplifies a portion of a sulfonamide resistance gene selected from: sul1 or sul2; at least one primer pair selected from Primer Pair Set 12 that specifically amplifies a portion of a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S); at least one primer pair selected from Primer Pair Set 13 that specifically amplifies a portion of a vancomycin resistance gene selected from: vanA or vanB; at least one primer pair selected from Primer Pair Set 14 that specifically amplifies a portion of a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE; at least one primer pair selected from Primer Pair Set 15 that specifically amplifies a portion of a quinolone resistance gene selected from: qnrB, qnrA, or qnrS; and / or at least one primer pair selected from Primer Pair Set 16 that specifically amplifies a portion of a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)- Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22. Clause 15. The composition of clause 14, wherein the Primer Pair Sets comprises the following sequences: Primer Pair Set 1 comprises at least one forward and reverse primer pair specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the primer pairs selected from SEQ ID NO: 1–2; 4–5; 7–8; 10–11; 13–14; 16–17; 19–20; 22–23; or 25–26; Primer Pair Set 2 comprises at least one forward and reverse primer pair specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the primer pairs selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53; Primer Pair Set 3 comprises at least one forward and reverse primer pair specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the primer pairs selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79– 80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149; Primer Pair Set 4 comprises at least one forward and reverse primer pair specific for a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the primer pairs selected from SEQ ID NO: 151–152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208–209; or 211–212; Primer Pair Set 5 comprises at least one forward and reverse primer pair specific for a β- lactamase resistance gene selected from: blaTEM, the primer pairs selected from SEQ ID NO: 214–215; 217–218; or 220–221; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the primer pairs selected from SEQ ID NO: 223–224; 226–227; or 229–230; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the primer pairs selected from SEQ ID NO: 232–233; 235– 236; 238–239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259– 260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280–281; 283– 284; 286–287; 289–290; 292–293; 295–296; 298–299; 301–302; 304–305; or 307–308; Primer Pair Set 8 comprises at least one forward and reverse primer pair specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the primer pairs selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325–326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374; Primer Pair Set 9 comprises at least one forward and reverse primer pair specific for a methicillin resistance gene selected from: mecA or mecC, the primer pairs selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392; Primer Pair Set 10 comprises at least one forward and reverse primer pair specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the primer pairs selected from SEQ ID NO: 394–395; 397–398; 400–401; 403–404; 406–407; 409– 410; 412–413; 415–416; or 418–419; Primer Pair Set 11 comprises at least one forward and reverse primer pair specific for a sulfonamide resistance gene selected from: sul1 or sul2, the primer pairs selected from SEQ ID NO: 421–422; 424–425; 427–428; 430–431; 433–434; or 436–437; Primer Pair Set 12 comprises at least one forward and reverse primer pair specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the primer pairs selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473; Primer Pair Set 13 comprises at least one forward and reverse primer pair specific for a vancomycin resistance gene selected from: vanA or vanB, the primer pairs selected from SEQ ID NO: 475–476; 478–479; 481–482; 484–485; 487–488; or 490–491; Primer Pair Set 14 comprises at least one forward and reverse primer pair specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the primer pairs selected from SEQ ID NO: 493–494; 496–497; 499–500; 502–503; 505–506; 508–509; 511–512; 514–515; 517–518; 520–521; 523–524; or 526–527; Primer Pair Set 15 comprises at least one forward and reverse primer pair specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the primer pairs selected from SEQ ID NO: 529–530; 532–533; 535–536; 538–539; 541–542; 544– 545; 547–548; 550–551; 553–554; 556–557; 559–560; or 562–563; and / or Primer Pair Set 16 comprises at least one forward and reverse primer pair specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the primer pairs selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595–596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; 652–653; 655–656; 658–659; 661–662; 664–665; 667–668; or 670–671. Clause 16. The composition of clause 14 or 15, further comprising a probe specific for amplicons produced using the at least one primer pair selected from one or more of Primer Pair Sets 1–16. Clause 17. The composition of any one of clauses 14–16, wherein the probe suitable for use with a specific forward and reverse primer pair are selected from: a probe specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the probe selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, or 27; a probe specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the probe selected from SEQ ID NO: 30, 33, 36, 39, 42, 45, 48, 51, or 54; a probe specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa- 23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the probe selected from SEQ ID NO: 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, or 150; a probe specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the probe selected from SEQ ID NO: 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, or 213; a probe specific for a β-lactamase resistance gene selected from: blaTEM, the probe selected from SEQ ID NO: 216, 219, or 222; a probe specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the probe selected from SEQ ID NO: 225, 228, or 231; a probe specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the probe selected from SEQ ID NO: 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, or 309; a probe specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the probe selected from SEQ ID NO: 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375; a probe specific for methicillin resistance gene selected from: mecA or mecC, the probe selected from SEQ ID NO: 378, 381, 384, 387, 390, or 393; a probe specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the probe selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, 414, 417, or 420; a probe specific for a sulfonamide resistance gene selected from: sul1 or sul2, the probe selected from SEQ ID NO: 423, 426, 429, 432, 435, or 438; a probe specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the probe selected from SEQ ID NO: 441, 444, 447, 450, 453, 456, 459, 462, 465, 468, 471, or 474; a probe specific for a vancomycin resistance gene selected from: vanA or vanb, the probe selected from SEQ ID NO: 477, 480, 483, 486, 489, or 492; a probe specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the probe selected from SEQ ID NO: 495, 498, 501, 504, 507, 510, 513, 516, 519, 522, 525, or 528; a probe specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the probe selected from SEQ ID NO: 531, 534, 537, 540, 543, 546, 549, 552, 555, 558, 561, or 564; and / or a probe specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)- Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the probe selected from SEQ ID NO: 567, 570, 573, 576, 579, 582, 585, 588, 591, 594, 597, 600, 603, 606, 609, 612, 615, 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, 654, 657, 660, 663, 666, 669, or 672. Clause 18. The composition of any one of clauses 14–17, further comprising a polymerase, a buffer, and deoxynucleotide triphosphates (dNTPs). Clause 19. The composition of any one of clauses 14–18, further comprising a sample. Clause 20. The composition of any one of clauses 14–19, further comprising at least one control forward and reverse primer and, optionally, a control probe, that specifically amplifies a target nucleic acid of a control sample. Clause 21. The composition of clause 21, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 673–674; 676–677; 679–680; 682–683; 685–686; 688– 689; 691–692; 694–695; 697–698; or 700–701; and the control probe comprises a probe sequence selected from SEQ ID NO: 675; 678; 681; 684; 687; 690; 693; 696; 699; or 702. Clause 22. The composition of any one of clauses 14–21, wherein the probe contains a fluorescent reporter. Clause 23. The composition of clause 22, wherein the probe contains a quencher. Clause 24. The composition of any one of clauses 22 or 23, wherein the probe is labeled at or near the 5′ end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. Clause 25. The composition of any one of clauses 22–24, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Clause 26. A kit for individually, simultaneously, or sequentially determining the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended- spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample, comprising the compositions of any one of clauses 14–18. Clause 27. The kit of clause 29, further comprising the compositions of any one of clauses 19–25. Clause 28. The kit of clause 26 or 27, wherein the kit comprises Primer Pair Sets comprising the following sequences: Primer Pair Set 1 comprises at least one forward and reverse primer pair specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the primer pairs selected from SEQ ID NO: 1–2; 4–5; 7–8; 10–11; 13–14; 16–17; 19–20; 22–23; or 25–26; Primer Pair Set 2 comprises at least one forward and reverse primer pair specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the primer pairs selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53; Primer Pair Set 3 comprises at least one forward and reverse primer pair specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the primer pairs selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79– 80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149; Primer Pair Set 4 comprises at least one forward and reverse primer pair specific for a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the primer pairs selected from SEQ ID NO: 151–152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208–209; or 211–212; Primer Pair Set 5 comprises at least one forward and reverse primer pair specific for a β- lactamase resistance gene selected from: blaTEM, the primer pairs selected from SEQ ID NO: 214–215; 217–218; or 220–221; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the primer pairs selected from SEQ ID NO: 223–224; 226–227; or 229–230; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the primer pairs selected from SEQ ID NO: 232–233; 235– 236; 238–239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259– 260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280–281; 283– 284; 286–287; 289–290; 292–293; 295–296; 298–299; 301–302; 304–305; or 307–308; Primer Pair Set 8 comprises at least one forward and reverse primer pair specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the primer pairs selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325–326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374; Primer Pair Set 9 comprises at least one forward and reverse primer pair specific for a methicillin resistance gene selected from: mecA or mecC, the primer pairs selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392; Primer Pair Set 10 comprises at least one forward and reverse primer pair specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the primer pairs selected from SEQ ID NO: 394–395; 397–398; 400–401; 403–404; 406–407; 409– 410; 412–413; 415–416; or 418–419; Primer Pair Set 11 comprises at least one forward and reverse primer pair specific for a sulfonamide resistance gene selected from: sul1 or sul2, the primer pairs selected from SEQ ID NO: 421–422; 424–425; 427–428; 430–431; 433–434; or 436–437; Primer Pair Set 12 comprises at least one forward and reverse primer pair specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the primer pairs selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473; Primer Pair Set 13 comprises at least one forward and reverse primer pair specific for a vancomycin resistance gene selected from: vanA or vanB, the primer pairs selected from SEQ ID NO: 475–476; 478–479; 481–482; 484–485; 487–488; or 490–491; Primer Pair Set 14 comprises at least one forward and reverse primer pair specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the primer pairs selected from SEQ ID NO: 493–494; 496–497; 499–500; 502–503; 505–506; 508–509; 511–512; 514–515; 517–518; 520–521; 523–524; or 526–527; Primer Pair Set 15 comprises at least one forward and reverse primer pair specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the primer pairs selected from SEQ ID NO: 529–530; 532–533; 535–536; 538–539; 541–542; 544– 545; 547–548; 550–551; 553–554; 556–557; 559–560; or 562–563; and / or Primer Pair Set 16 comprises at least one forward and reverse primer pair specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the primer pairs selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595–596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; 652–653; 655–656; 658–659; 661–662; 664–665; 667–668; or 670–671. Clause 29. The kit of clause 28, wherein the kit further comprises probes suitable for use with specific forward and reverse primer pairs, the probes comprising one or more of: a probe specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the probe selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, or 27; a probe specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the probe selected from SEQ ID NO: 30, 33, 36, 39, 42, 45, 48, 51, or 54; a probe specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa- 23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the probe selected from SEQ ID NO: 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, or 150; a probe specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the probe selected from SEQ ID NO: 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, or 213; a probe specific for a β-lactamase resistance gene selected from: blaTEM, the probe selected from SEQ ID NO: 216, 219, or 222; a probe specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the probe selected from SEQ ID NO: 225, 228, or 231; a probe specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the probe selected from SEQ ID NO: 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, or 309; a probe specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the probe selected from SEQ ID NO: 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375; a probe specific for methicillin resistance gene selected from: mecA or mecC, the probe selected from SEQ ID NO: 378, 381, 384, 387, 390, or 393; a probe specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the probe selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, 414, 417, or 420; a probe specific for a sulfonamide resistance gene selected from: sul1 or sul2, the probe selected from SEQ ID NO: 423, 426, 429, 432, 435, or 438; a probe specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the probe selected from SEQ ID NO: 441, 444, 447, 450, 453, 456, 459, 462, 465, 468, 471, or 474; a probe specific for a vancomycin resistance gene selected from: vanA or vanb, the probe selected from SEQ ID NO: 477, 480, 483, 486, 489, or 492; a probe specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the probe selected from SEQ ID NO: 495, 498, 501, 504, 507, 510, 513, 516, 519, 522, 525, or 528; a probe specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the probe selected from SEQ ID NO: 531, 534, 537, 540, 543, 546, 549, 552, 555, 558, 561, or 564; and / or a probe specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)- Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the probe selected from SEQ ID NO: 567, 570, 573, 576, 579, 582, 585, 588, 591, 594, 597, 600, 603, 606, 609, 612, 615, 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, 654, 657, 660, 663, 666, 669, or 672. Clause 30. The kit of clause 28, wherein the kit further comprises a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. Clause 31. The kit of clause 30, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 673–674; 676–677; 679–680; 682–683; 685–686; 688–689; 691–692; 694–695; 697–698; or 700–701; and the control probe comprises a probe sequence selected from SEQ ID NO: 675; 678; 681; 684; 687; 690; 693; 696; 699; or 702. Clause 32. The kit of clause 28, wherein the kit further comprises a control plasmid comprising one or more target sequences selected from one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β- lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside. Clause 33. The control plasmid of clause 32, wherein the plasmid comprises one or more portions of nucleic acid sequences of SEQ ID NO: 703–781. EXAMPLES Example 1 Sample Preparation A sample is obtained from a subject. The sample can be a swab or sample of a wound. For wound samples, approximately 100 mg of sample is used to isolate genomic DNA. Samples can be frozen in a storage solution at a sample to solution ratio of 1:2. Frozen samples are thawed on ice and approximately 100 mg of the sample are used to isolate nucleic acids. The frozen or samples are lysed, and genomic DNA is isolated from the lysis. For swabs, the stick of the swab is removed and the swab containing the biological material is placed in lysis genomic extraction conditions. To each swab, the B. Atrophaeus control can be added before lysis during nucleic acid nucleic acid extraction. Example 2 Control Sample Preparation The TaqMan™ Universal Extraction Control Organism (B. atrophaeus) (BA process control) was used to verify the efficacy of the sample preparation and the absence of inhibitors in the real-time PCR reaction. A 1× solution of the control was added to each sample and negative control before extraction. The BA process control was contained a lyophilized pellet at 1 × 109copies / vial. A 25× stock solution of the BA process control was prepared by adding 200 µL of 1× phosphate buffered saline (1× PBS: 137 mM NaCl, 2.7 mM KCl: 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4) to the vial containing the lyophilized pellet and vortexed until the pellet was resuspended. A working 1× stock solution was prepared by combining 24 µL of a 25× stock solution with 576 µL 1× PBS, pH 7.4 to achieve a total volume of 600 µL. The prepared BA process control was added to the genomic DNA extraction reaction, to each sample and to the negative extraction control immediately before lysis during nucleic acid extraction. Real-time PCR Reaction Preparation Genomic DNA samples were thawed or placed on ice. All reagents were gently vortexed, briefly centrifuged to collect the liquid at the bottom of the container and kept on ice until use. The amplification control was prepared by combining 495.0 µL of 1× TE buffer (1× TE: 10 mM Tris^HCl, 1 mM EDTA^Na2, pH 8.0) into a microcentrifuge tube, and adding 5.0 µL of the amplification control. The sample was mixed well and briefly centrifuged. A 5.0 µL aliquot of the diluted sample was combined with 170 µL of 1× TE buffer, mixed, and centrifuged briefly. For each 96-well plate, the following components were combined in sufficient amounts for the number of samples plus the amplification control and negative control. Table 23. PCR Individual or Multiplex Master Mix and Primer / Probes Volume per sample or Volume for n samples plus Component control 2 controls Master Mix 6.25 µL 6.25 × (1.2 × n) µL 1.25 µL 1.25 × (1.2 × n) µL Total Volume 7.50 µL — The Master Mix contained components for the PCR reaction (buffer, MgCl2, dNTPs, and DNA polymerase, inter alia) and the individual or multiplex Primer / Probe Panel contained the primer pairs and probes specific for the target organisms and controls. The reaction plate was set up by dispensing 7.5 µL of the reaction mix prepared as shown in Table 46 to each well of a MicroAmp™ Optical 96-Well Reaction Plate, 0.2 mL. 17.5 µL of either the extracted materials (target DNA), the diluted amplification control, or nuclease- free water was added to the designated wells. The plate was sealed thoroughly with MicroAmp™ Optical Adhesive Film, ensuring that pressure was applied across the entire plate and that there was a tight seal across every individual well. The plate was vortexed at the highest setting speed for 30–60 seconds as follows: 5–10 seconds in the center of the plate, 5–10 seconds in each plate corner, and 5–10 seconds, again in the center. The reaction plate was centrifuged for 1–2 minutes at ≥ 650 × g to remove bubbles and to collect the liquid at the bottom. The real-time PCR reaction plate is maintained at 2–8 °C and protected from light until it was loaded into the real-time PCR instrument. The real-time PCR reaction was run within an hour after preparation of the plate. The real-time PCR reaction was performed, and the results were analyzed using the software accompanying the instrument. Example 3 Real-Time TaqMan™ PCR with Open Array The nucleic acid samples were diluted 1:10. An OpenArray™ plate was allowed to equilibrate to room temperature. Before preparing the samples, the TaqMan™ OpenArray™ Real-time PCR Master Mix was mixed but not inverted. The master mix and samples were added to the wells of the OpenArray™ Plate in a 1:1 ratio of master mix-to-pre-amplified nucleic acid. In separate wells, the TaqMan™ Amplification Control was used in place of the diluted pre-amplified nucleic acid sample. The resulting mixtures were further mixed with pipetting. After mixing, the plate was sealed with aluminum foil and centrifuged at 1,200 RPM (301 × g) for 1 minute. The OpenArray™ plate is transferred to an OpenArray™ AccuFill™ Instrument where a fraction of the samples were loaded onto a separate OpenArray™ plate. The new OpenArray™ plate was transferred to a QuantStudio™ 12K Flex OpenArray™ Plate Press where the plate was encased with a lid. OpenArray™ Immersion Fluid was slowly injected into the port of the encasement to minimize formation of air bubbles. After injection of the immersion fluid, the port was sealed. The encased OpenArray™ plate was transferred to a QuantStudio™ 12K Flex Instrument where the real-time PCR reaction is performed, imaged, and analyzed. Table 24. Open Array Platform Assay Efficiency Antibiotic Target Name R2Slope Efficiency (%) aac(3)-Ia aac(3)-Ib / aac(6)- Aminoglycoside Ib aac(6)-30 / a 0.99 −3.35 99 BA B.atrophaeus 0.99 −3.41 96 Amp C blaACC_blaACT blaFOX 0.99 −3.34 99 Amp C blaACT_blaDHA blaFOX_blaMIR 0.99 −3.37 98 ESBLs blaCTX-M_5 0.99 101 Carbapenemase blaKPC_blaNDM 0.99 108 blaKPC_blaNDM Carbapenemase blaOXA_2 1.00 −3.40 97 Amp C BlaMOX_BlaLAT_BlaDHA 0.99 −3.38 98 ESBLs BlaOKP_C_BlaSHV BlaOHIO_Ba04646134_s1 0.99 −3.30 101 MESBLs BlaVEB_BlaGES_BlaPER 0.99 −3.43 96 Ba00005007_po Carbapenemase Carbapanem_combo 0.99 −3.42 96 Linco, Macrolide, Cfr_Ba07319992_s1 0.99 −3.32 100 Trimethoprim dfrA_dfrA1_dfrA12 dfrA17_dfrA5 0.99 −3.37 98 Trimethoprim dfrA14_dfrB1_dfrB5_dfrG 0.99 −3.35 99 Macrolides ere(B)_mef(A)_mph(A)_1 0.99 −3.53 92 Macrolides erm(A)_erm(B)_erm(C)_1 0.99 −3.43 96 Colistin Escherichia_Moraxella mcr-1_mcr-2_mcr-3_1 0.99 −3.34 99 Methicillin mecA_mecC_1 0.99 −3.30 101 Macrolides Msr(A)_APMFW22 0.99 −3.30 101 Nitroimidazole nimB_nimD_nimE_nimJ 0.99 −3.41 96 Quinolone qnrA_qnrS_2 0.99 −3.39 97 Quinolone qnrB_5 0.99 −3.43 96 Sulfonamide Sul1_Sul2 Ba00005027_po 0.99 −3.38 97 Beta-Lactamase TEM_Ba04646128_s1 0.99 −3.37 98 Tetracycline tet(A)_tet(B)_tet(S) 0.99 −3.32 100 Tetracycline tetM_Ba04230915_s1 0.99 −3.34 99 Vancomycin VanA_VanB 0.99 −3.35 99 Ba00005023_po Xeno Xeno Pa00010014_a1 0.99 −3.42 96 Example 4 Real-Time TaqMan™ PCR with TaqMan Array Card The nucleic acid samples were diluted 1:10. A TaqMan™ Array Card was allowed to equilibrate to room temperature. The TaqMan™ Fast Advanced Master Mix containing no UNG was mixed before preparing the PCR samples. A master mix containing a 2:3:5 ratio of diluted pre-amplified nucleic acid, nuclease-free water, and of TaqMan™ Fast Advanced Master Mix was prepared such that 100 µL of sample was added to each port of the TaqMan™ Array Card. Optionally, positive amplification control samples were added to the TaqMan™ Array Card by preparing a sample containing 10 µL of TaqMan™ of Amplification Control, 40 µL of nuclease free water, and 50 µL of TaqMan™ Fast Advanced Master Mix for each designated control port. After the samples were added to TaqMan™ Array Card, the card was centrifuged twice at 1,200 RPM (301 × g) for 1 minute. The TaqMan™ Array Card was sealed and loaded into a real-time PCR instrument. Inside the instrument, the samples were activated by heating the sample to 95 °C for 10 minutes. Following activation, amplification was performed by holding the temperature at 95 °C for 3 seconds to allow for separation of the templates into single strands followed by reducing the temperature to 60 °C and holding the temperature for 30 second to allow for annealing and elongation. The cycling between the two temperatures is repeated 40 times. The results of the real-time TaqMan™ PCR reaction were analyzed using the software accompanying the instrument. Table 25. TAC Platform Assay Efficiency Antibiotic R2Slope Efficiency (%) AmpC 1 1.00 −3.35 99 AmpC 2 1.00 −3.36 99 AmpC 3 1.00 −3.38 98 BA Ba06596576_s1 1.00 −3.31 100 blaCTX-M 0.99 −3.38 98 blaIMP 1.00 −3.38 98 blashv Ba04646134_s1 1.00 −3.34 99 blaTEM Ba04646128_s1 1.00 −3.35 99 Carbapenemase 1 1.00 −3.09 110.8 Carbapenemase 2 1.00 −3.35 99 cfr Ba07319992_s1 1.00 −3.35 99 Colistin 1.00 −3.38 98 Macrolides 1 1.00 −3.46 95 Macrolides 2 1.00 −3.43 96 MESBLs 1.00 −3.42 96 Methicillin 1.00 −3.36 98 Nitroimidazole 1.00 −3.36 99 qnrB 1.00 −3.38 98 Quinolone 2 1.00 −3.36 98 Sul1_Sul2 Ba00005027_po 1.00 −3.43 96 Tetracycline 1.00 −3.39 97 Trimethoprim 1 0.99 −3.35 99 VanA_VanB 1.00 −3.41 96 Ba00005023_po Xeno Ac00010014_a1 1.00 −3.41 97 All assays showed good linearity ranging from 107to 102cps / uL and efficiencies ranging from 90–110% except Carbapenemase_1 on the TAC platform, which has an efficiency of 110.8. The assays showed good performances at LoD levels in the TAC and OA platforms.
Claims
CLAIMS What is claimed:
1. A method for individually, simultaneously, or sequentially determining the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended- spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample, the method comprising the steps of: (a) creating a reaction mixture containing the sample and one or more Primer Pair Sets, wherein the Primer Pair Sets comprise one or more of: at least one primer pair selected from Primer Pair Set 1 that specifically amplifies a portion of a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER; at least one primer pair selected from Primer Pair Set 2 that specifically amplifies an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M; at least one primer pair selected from Primer Pair Set 3 that specifically amplifies a portion of a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP; at least one primer pair selected from Primer Pair Set 4 that specifically amplifies a portion of a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY; at least one primer pair selected from Primer Pair Set 5 that specifically amplifies a portion of a β-lactamase resistance gene selected from: blaTEM; at least one primer pair selected from Primer Pair Set 6 that specifically amplifies a portion of a lincosamide, macrolide, streptogramin resistance gene selected from: cfr; at least one primer pair selected from Primer Pair Set 7 that specifically amplifies a portion of a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG;at least one primer pair selected from Primer Pair Set 8 that specifically amplifies a portion of a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A); at least one primer pair selected from Primer Pair Set 9 that specifically amplifies a portion of a methicillin resistance gene selected from: mecA or mecC; at least one primer pair selected from Primer Pair Set 10 that specifically amplifies a portion of a colistin resistance gene selected from: mcr-1, mcr-2, or mcr- 3; at least one primer pair selected from Primer Pair Set 11 that specifically amplifies a portion of a sulfonamide resistance gene selected from: sul1 or sul2; at least one primer pair selected from Primer Pair Set 12 that specifically amplifies a portion of a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S); at least one primer pair selected from Primer Pair Set 13 that specifically amplifies a portion of a vancomycin resistance gene selected from: vanA or vanB; at least one primer pair selected from Primer Pair Set 14 that specifically amplifies a portion of a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE; at least one primer pair selected from Primer Pair Set 15 that specifically amplifies a portion of a quinolone resistance gene selected from: qnrB, qnrA, or qnrS; and / or at least one primer pair selected from Primer Pair Set 16 that specifically amplifies a portion of a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)- Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating at least one amplicon when the targeted nucleic acids are present in the sample; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β- lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim;macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in the sample.
2. The method of claim 1, wherein the Primer Pair Sets comprise the following sequences: Primer Pair Set 1 comprises at least one forward and reverse primer pair specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the primer pairs selected from SEQ ID NO: 1–2; 4–5; 7–8; 10–11; 13–14; 16–17; 19–20; 22–23; or 25–26; Primer Pair Set 2 comprises at least one forward and reverse primer pair specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the primer pairs selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53; Primer Pair Set 3 comprises at least one forward and reverse primer pair specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the primer pairs selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79– 80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149; Primer Pair Set 4 comprises at least one forward and reverse primer pair specific for a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the primer pairs selected from SEQ ID NO: 151–152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208–209; or 211–212; Primer Pair Set 5 comprises at least one forward and reverse primer pair specific for a β- lactamase resistance gene selected from: blaTEM, the primer pairs selected from SEQ ID NO: 214–215; 217–218; or 220–221; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the primer pairs selected from SEQ ID NO: 223–224; 226–227; or 229–230; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the primer pairs selected from SEQ ID NO: 232–233; 235–236; 238–239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259– 260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280–281; 283– 284; 286–287; 289–290; 292–293; 295–296; 298–299; 301–302; 304–305; or 307–308; Primer Pair Set 8 comprises at least one forward and reverse primer pair specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the primer pairs selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325–326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374; Primer Pair Set 9 comprises at least one forward and reverse primer pair specific for a methicillin resistance gene selected from: mecA or mecC, the primer pairs selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392; Primer Pair Set 10 comprises at least one forward and reverse primer pair specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the primer pairs selected from SEQ ID NO: 394–395; 397–398; 400–401; 403–404; 406–407; 409– 410; 412–413; 415–416; or 418–419; Primer Pair Set 11 comprises at least one forward and reverse primer pair specific for a sulfonamide resistance gene selected from: sul1 or sul2, the primer pairs selected from SEQ ID NO: 421–422; 424–425; 427–428; 430–431; 433–434; or 436–437; Primer Pair Set 12 comprises at least one forward and reverse primer pair specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the primer pairs selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473; Primer Pair Set 13 comprises at least one forward and reverse primer pair specific for a vancomycin resistance gene selected from: vanA or vanB, the primer pairs selected from SEQ ID NO: 475–476; 478–479; 481–482; 484–485; 487–488; or 490–491; Primer Pair Set 14 comprises at least one forward and reverse primer pair specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the primer pairs selected from SEQ ID NO: 493–494; 496–497; 499–500; 502–503; 505–506; 508–509; 511–512; 514–515; 517–518; 520–521; 523–524; or 526–527; Primer Pair Set 15 comprises at least one forward and reverse primer pair specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the primer pairsselected from SEQ ID NO: 529–530; 532–533; 535–536; 538–539; 541–542; 544– 545; 547–548; 550–551; 553–554; 556–557; 559–560; or 562–563; and / or Primer Pair Set 16 comprises at least one forward and reverse primer pair specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the primer pairs selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595–596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; 652–653; 655–656; 658–659; 661–662; 664–665; 667–668; or 670–671.
3. The method of claim 1 or 2, wherein the generating of the at least one amplicon comprises performing PCR.
4. The method of any one of claims 1–3, wherein the at least one amplicon is one selected from: an amplicon specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER produced using at least one primer pair selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53, and a sequence comprising at least a portion of SEQ ID NO: 703, 704 or 705; an amplicon specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M produced using at least one primer pair selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79–80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149, and a sequence comprising at least a portion of SEQ ID NO: 706, 707, 708, 709 or 710; an amplicon specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP produced using at least one primer pair selected from SEQ ID NO: 151–152; 154– 155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178– 179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208–209; or 211–212, and a sequence comprising at least a portion of SEQ ID NO: 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721 or 722; an amplicon specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY produced using at least one primer pair selected from SEQ ID NO: 151–152; 154– 155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178– 179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202– 203; 205–206; 208–209; or 211–212, and a sequence comprising at least a portion of SEQ ID NO: 722, 723, 724, 725, 726, 727, 728 or 729; an amplicon specific for a β-lactamase resistance gene selected from: blaTEM produced using at least one primer pair selected from SEQ ID NO: 214–215; 217–218; or 220–221, and a sequence comprising at least a portion of SEQ ID NO: 730; an amplicon specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr produced using at least one primer pair selected from SEQ ID NO: 223– 224; 226–227; or 229–230, and a sequence comprising at least a portion of SEQ ID NO: 731; an amplicon specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG produced using at least one primer pair selected from SEQ ID NO: 232–233; 235–236; 238–239; 241–242; 244–245; 247– 248; 250–251; 253–254; 256–257; 259–260; 262–263; 265–266; 268–269; 271– 272; 274–275; 277–278; 280–281; 283–284; 286–287; 289–290; 292–293; 295– 296; 298–299; 301–302; 304–305; or 307–308, and a sequence comprising at least a portion of SEQ ID NO: 732, 733, 734, 735, 736, 737, 738 or 739; an amplicon specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A) produced using at least one primer pair selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325– 326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349– 350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374, and a sequence comprising at least a portion of SEQ ID NO: 740, 741, 742, 743, 744, 745, 746 or 747; an amplicon specific for a methicillin resistance gene selected from: mecA or mecC produced using at least one primer pair selected from SEQ ID NO: 376–377; 379– 380; 382–383; 385–386; 388–389; or 391–392, and a sequence comprising at least a portion of SEQ ID NO: 748 or 749;an amplicon specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3 produced using at least one primer pair selected from SEQ ID NO: 394–395; 397– 398; 400–401; 403–404; 406–407; 409–410; 412–413; 415–416; or 418–419, and a sequence comprising at least a portion of SEQ ID NO:750, 751 or 752; an amplicon specific for a sulfonamide resistance gene selected from: sul1 or sul2 produced using at least one primer pair selected from SEQ ID NO: 421–422; 424– 425; 427–428; 430–431; 433–434; or 436–437, and a sequence comprising at least a portion of SEQ ID NO: 753 or 754; an amplicon specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S) produced using at least one primer pair selected from SEQ ID NO: 439– 440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463– 464; 466–467; 469–470; or 472–473, and a sequence comprising at least a portion of SEQ ID NO: 755, 756, 757 or 758; an amplicon specific for a vancomycin resistance gene selected from: vanA or vanb produced using at least one primer pair selected from SEQ ID NO: 475–476; 478– 479; 481–482; 484–485; 487–488; or 490–491, and a sequence comprising at least a portion of SEQ ID NO: 759 or 760; an amplicon specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE produced using at least one primer pair selected from SEQ ID NO: 493– 494; 496–497; 499–500; 502–503; 505–506; 508–509; 511–512; 514–515; 517– 518; 520–521; 523–524; or 526–527, and a sequence comprising at least a portion of SEQ ID NO: 761, 762, 763 or 764; an amplicon specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS produced using at least one primer pair selected from SEQ ID NO: 529–530; 532– 533; 535–536; 538–539; 541–542; 544–545; 547–548; 550–551; 553–554; 556– 557; 559–560; or 562–563, and a sequence comprising at least a portion of SEQ ID NO: 765, 766, 767, 768 or 769; and / or an amplicon specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22 produced using at least one primer pair selected from SEQ ID NO: 565–566; 568–569; 571– 572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595– 596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619– 620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; 652–653; 655–656; 658–659; 661–662; 664–665; 667– 668; or 670–671, and a sequence comprising at least a portion of SEQ ID NO: 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780 or 781.
5. The method of any one of claims 1–5, wherein the at least one amplicon is one selected from: an amplicon specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the amplicon comprising at least a portion of SEQ ID NO: 703, 704 or 705; an amplicon specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the amplicon comprising at least a portion of SEQ ID NO: 706, 707, 708, 709 or 710; an amplicon specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the amplicon comprising at least a portion of SEQ ID NO: 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721 or 722; an amplicon specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the amplicon comprising at least a portion of SEQ ID NO: 722, 723, 724, 725, 726, 727, 728 or 729; an amplicon specific for a β-lactamase resistance gene selected from: blaTEM, the amplicon comprising at least a portion of SEQ ID NO: 730; an amplicon specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the amplicon comprising at least a portion of SEQ ID NO: 731; an amplicon specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the amplicon comprising at least a portion of SEQ ID NO: 732, 733, 734, 735, 736, 737, 738 or 739; an amplicon specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the amplicon comprising at least a portion of SEQ ID NO: 740, 741, 742, 743, 744, 745, 746 or 747; an amplicon specific for methicillin resistance gene selected from: mecA or mecC, the amplicon comprising at least a portion of SEQ ID NO: 748 or 749; an amplicon specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the amplicon comprising at least a portion of SEQ ID NO: 750, 751 or 752;an amplicon specific for a sulfonamide resistance gene selected from: sul1 or sul2, the amplicon comprising at least a portion of SEQ ID NO: 753 or 754; an amplicon specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the amplicon comprising at least a portion of SEQ ID NO: 755, 756, 757 or 758; an amplicon specific for a vancomycin resistance gene selected from: vanA or vanb, the amplicon comprising at least a portion of SEQ ID NO: 759 or 760; an amplicon specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the amplicon comprising at least a portion of SEQ ID NO: 761, 762, 763 or 764; an amplicon specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the amplicon comprising at least a portion of SEQ ID NO: 765, 766, 767, 768 or 769; and / or an amplicon specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the amplicon comprising at least a portion of SEQ ID NO: 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780 or 781.
6. The method any one of claims 1–5, wherein the reaction mixture further comprises probes specific for the at least one amplicon.
7. The method of any one of claims 1–6, wherein the reaction mixture further comprises probes specific for the at least one amplicon and suitable for use with a Primer Pair Set, the probes comprising: a probe specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the probe selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, or 27; a probe specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the probe selected from SEQ ID NO: 30, 33, 36, 39, 42, 45, 48, 51, or 54; a probe specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa- 23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the probe selected from SEQ ID NO: 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96,99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, or 150; a probe specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the probe selected from SEQ ID NO: 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, or 213; a probe specific for a β-lactamase resistance gene selected from: blaTEM, the probe selected from SEQ ID NO: 216, 219, or 222; a probe specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the probe selected from SEQ ID NO: 225, 228, or 231; a probe specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the probe selected from SEQ ID NO: 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, or 309; a probe specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the probe selected from SEQ ID NO: 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375; a probe specific for methicillin resistance gene selected from: mecA or mecC, the probe selected from SEQ ID NO: 378, 381, 384, 387, 390, or 393; a probe specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the probe selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, 414, 417, or 420; a probe specific for a sulfonamide resistance gene selected from: sul1 or sul2, the probe selected from SEQ ID NO: 423, 426, 429, 432, 435, or 438; a probe specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the probe selected from SEQ ID NO: 441, 444, 447, 450, 453, 456, 459, 462, 465, 468, 471, or 474; a probe specific for a vancomycin resistance gene selected from: vanA or vanb, the probe selected from SEQ ID NO: 477, 480, 483, 486, 489, or 492; a probe specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the probe selected from SEQ ID NO: 495, 498, 501, 504, 507, 510, 513, 516, 519, 522, 525, or 528;a probe specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the probe selected from SEQ ID NO: 531, 534, 537, 540, 543, 546, 549, 552, 555, 558, 561, or 564; and / or a probe specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)- Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the probe selected from SEQ ID NO: 567, 570, 573, 576, 579, 582, 585, 588, 591, 594, 597, 600, 603, 606, 609, 612, 615, 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, 654, 657, 660, 663, 666, 669, or 672.
8. The method of any one of claims 1–7, wherein the reaction mixture further contains a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample.
9. The method of claim 8, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 673–674; 676–677; 679–680; 682–683; 685–686; 688–689; 691–692; 694–695; 697–698; or 700–701; and the control probe comprises a probe sequence selected from SEQ ID NO: 675; 678; 681; 684; 687; 690; 693; 696; 699; or 702.
10. The method of any one of claims 1–9, wherein the probe comprises a fluorescent reporter.
11. The method of claim 10, wherein the probe comprises a quencher.
12. The method of claim 10 or 11, wherein the probe is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM.
13. The method of any one of claims 10–12, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ.
14. A composition for individually, simultaneously, or sequentially determining the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended- spectrum β-lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin;sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside comprising a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise: at least one primer pair selected from Primer Pair Set 1 that specifically amplifies a portion of a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER; at least one primer pair selected from Primer Pair Set 2 that specifically amplifies an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M; at least one primer pair selected from Primer Pair Set 3 that specifically amplifies a portion of a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa- 2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP; at least one primer pair selected from Primer Pair Set 4 that specifically amplifies a portion of a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY; at least one primer pair selected from Primer Pair Set 5 that specifically amplifies a portion of a β-lactamase resistance gene selected from: blaTEM; at least one primer pair selected from Primer Pair Set 6 that specifically amplifies a portion of a lincosamide, macrolide, streptogramin resistance gene selected from: cfr; at least one primer pair selected from Primer Pair Set 7 that specifically amplifies a portion of a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG; at least one primer pair selected from Primer Pair Set 8 that specifically amplifies a portion of a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A); at least one primer pair selected from Primer Pair Set 9 that specifically amplifies a portion of a methicillin resistance gene selected from: mecA or mecC; at least one primer pair selected from Primer Pair Set 10 that specifically amplifies a portion of a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3; at least one primer pair selected from Primer Pair Set 11 that specifically amplifies a portion of a sulfonamide resistance gene selected from: sul1 or sul2; at least one primer pair selected from Primer Pair Set 12 that specifically amplifies a portion of a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S);at least one primer pair selected from Primer Pair Set 13 that specifically amplifies a portion of a vancomycin resistance gene selected from: vanA or vanB; at least one primer pair selected from Primer Pair Set 14 that specifically amplifies a portion of a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE; at least one primer pair selected from Primer Pair Set 15 that specifically amplifies a portion of a quinolone resistance gene selected from: qnrB, qnrA, or qnrS; and / or at least one primer pair selected from Primer Pair Set 16 that specifically amplifies a portion of a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)- Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22.
15. The composition of claim 14, wherein the Primer Pair Sets comprises the following sequences: Primer Pair Set 1 comprises at least one forward and reverse primer pair specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the primer pairs selected from SEQ ID NO: 1–2; 4–5; 7–8; 10–11; 13–14; 16–17; 19–20; 22–23; or 25–26; Primer Pair Set 2 comprises at least one forward and reverse primer pair specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the primer pairs selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53; Primer Pair Set 3 comprises at least one forward and reverse primer pair specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the primer pairs selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79– 80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149; Primer Pair Set 4 comprises at least one forward and reverse primer pair specific for a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the primer pairs selected from SEQ ID NO: 151–152; 154–155; 157–158; 160–161; 163–164;166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208–209; or 211–212; Primer Pair Set 5 comprises at least one forward and reverse primer pair specific for a β- lactamase resistance gene selected from: blaTEM, the primer pairs selected from SEQ ID NO: 214–215; 217–218; or 220–221; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the primer pairs selected from SEQ ID NO: 223–224; 226–227; or 229–230; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the primer pairs selected from SEQ ID NO: 232–233; 235– 236; 238–239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259– 260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280–281; 283– 284; 286–287; 289–290; 292–293; 295–296; 298–299; 301–302; 304–305; or 307–308; Primer Pair Set 8 comprises at least one forward and reverse primer pair specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the primer pairs selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325–326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374; Primer Pair Set 9 comprises at least one forward and reverse primer pair specific for a methicillin resistance gene selected from: mecA or mecC, the primer pairs selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392; Primer Pair Set 10 comprises at least one forward and reverse primer pair specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the primer pairs selected from SEQ ID NO: 394–395; 397–398; 400–401; 403–404; 406–407; 409– 410; 412–413; 415–416; or 418–419; Primer Pair Set 11 comprises at least one forward and reverse primer pair specific for a sulfonamide resistance gene selected from: sul1 or sul2, the primer pairs selected from SEQ ID NO: 421–422; 424–425; 427–428; 430–431; 433–434; or 436–437; Primer Pair Set 12 comprises at least one forward and reverse primer pair specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), theprimer pairs selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473; Primer Pair Set 13 comprises at least one forward and reverse primer pair specific for a vancomycin resistance gene selected from: vanA or vanB, the primer pairs selected from SEQ ID NO: 475–476; 478–479; 481–482; 484–485; 487–488; or 490–491; Primer Pair Set 14 comprises at least one forward and reverse primer pair specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the primer pairs selected from SEQ ID NO: 493–494; 496–497; 499–500; 502–503; 505–506; 508–509; 511–512; 514–515; 517–518; 520–521; 523–524; or 526–527; Primer Pair Set 15 comprises at least one forward and reverse primer pair specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the primer pairs selected from SEQ ID NO: 529–530; 532–533; 535–536; 538–539; 541–542; 544– 545; 547–548; 550–551; 553–554; 556–557; 559–560; or 562–563; and / or Primer Pair Set 16 comprises at least one forward and reverse primer pair specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the primer pairs selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595–596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; 652–653; 655–656; 658–659; 661–662; 664–665; 667–668; or 670–671.
16. The composition of claim 14 or 15, further comprising a probe specific for amplicons produced using the at least one primer pair selected from one or more of Primer Pair Sets 1–16.
17. The composition of any one of claims 14–16, wherein the probe suitable for use with a specific forward and reverse primer pair are selected from: a probe specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the probe selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, or 27;a probe specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the probe selected from SEQ ID NO: 30, 33, 36, 39, 42, 45, 48, 51, or 54; a probe specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa- 23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the probe selected from SEQ ID NO: 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, or 150; a probe specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the probe selected from SEQ ID NO: 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, or 213; a probe specific for a β-lactamase resistance gene selected from: blaTEM, the probe selected from SEQ ID NO: 216, 219, or 222; a probe specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the probe selected from SEQ ID NO: 225, 228, or 231; a probe specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the probe selected from SEQ ID NO: 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, or 309; a probe specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the probe selected from SEQ ID NO: 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375; a probe specific for methicillin resistance gene selected from: mecA or mecC, the probe selected from SEQ ID NO: 378, 381, 384, 387, 390, or 393; a probe specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the probe selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, 414, 417, or 420; a probe specific for a sulfonamide resistance gene selected from: sul1 or sul2, the probe selected from SEQ ID NO: 423, 426, 429, 432, 435, or 438; a probe specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the probe selected from SEQ ID NO: 441, 444, 447, 450, 453, 456, 459, 462, 465, 468, 471, or 474;a probe specific for a vancomycin resistance gene selected from: vanA or vanb, the probe selected from SEQ ID NO: 477, 480, 483, 486, 489, or 492; a probe specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the probe selected from SEQ ID NO: 495, 498, 501, 504, 507, 510, 513, 516, 519, 522, 525, or 528; a probe specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the probe selected from SEQ ID NO: 531, 534, 537, 540, 543, 546, 549, 552, 555, 558, 561, or 564; and / or a probe specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)- Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the probe selected from SEQ ID NO: 567, 570, 573, 576, 579, 582, 585, 588, 591, 594, 597, 600, 603, 606, 609, 612, 615, 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, 654, 657, 660, 663, 666, 669, or 672.
18. The composition of any one of claims 14–17, further comprising a polymerase, a buffer, and deoxynucleotide triphosphates (dNTPs).
19. The composition of any one of claims 14–18, further comprising a sample.
20. The composition of any one of claims 14–19, further comprising at least one control forward and reverse primer and, optionally, a control probe, that specifically amplifies a target nucleic acid of a control sample.
21. The composition of claim 21, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 673–674; 676–677; 679–680; 682–683; 685–686; 688–689; 691–692; 694–695; 697–698; or 700–701; and the control probe comprises a probe sequence selected from SEQ ID NO: 675; 678; 681; 684; 687; 690; 693; 696; 699; or 702.
22. The composition of any one of claims 14–21, wherein the probe contains a fluorescent reporter.
23. The composition of claim 22, wherein the probe contains a quencher.
24. The composition of any one of claims 22 or 23, wherein the probe is labeled at or near the 5′ end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM.
25. The composition of any one of claims 22–24, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ.
26. A kit for individually, simultaneously, or sequentially determining the presence or absence of one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β- lactamases (ESBLs); carbapenemase; AmpC β-lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside in a sample, comprising the compositions of any one of claims 14–18.
27. The kit of claim 29, further comprising the compositions of any one of claims 19–25.
28. The kit of claim 26 or 27, wherein the kit comprises Primer Pair Sets comprising the following sequences: Primer Pair Set 1 comprises at least one forward and reverse primer pair specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the primer pairs selected from SEQ ID NO: 1–2; 4–5; 7–8; 10–11; 13–14; 16–17; 19–20; 22–23; or 25–26; Primer Pair Set 2 comprises at least one forward and reverse primer pair specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the primer pairs selected from SEQ ID NO: 28–29; 31–32; 34–35; 37–38; 40–41; 43–44; 46–47; 49–50; or 52–53; Primer Pair Set 3 comprises at least one forward and reverse primer pair specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa-23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the primer pairs selected from SEQ ID NO: 55–56; 58–59; 61–62; 64–65; 67–68; 70–71; 73–74; 76–77; 79– 80; 82–83; 85–86; 88–89; 91–92; 94–95; 97–98; 100–101; 103–104; 106–107; 109–110; 112–113; 115–116; 118–119; 121–122; 124–125; 127–128; 130–131; 133–134; 136–137; 139–140; 142–143; 145–146; or 148–149;Primer Pair Set 4 comprises at least one forward and reverse primer pair specific for a AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the primer pairs selected from SEQ ID NO: 151–152; 154–155; 157–158; 160–161; 163–164; 166–167; 169–170; 172–173; 175–176; 178–179; 181–182; 184–185; 187–188; 190–191; 193–194; 196–197; 199–200; 202–203; 205–206; 208–209; or 211–212; Primer Pair Set 5 comprises at least one forward and reverse primer pair specific for a β- lactamase resistance gene selected from: blaTEM, the primer pairs selected from SEQ ID NO: 214–215; 217–218; or 220–221; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the primer pairs selected from SEQ ID NO: 223–224; 226–227; or 229–230; Primer Pair Set 6 comprises at least one forward and reverse primer pair specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the primer pairs selected from SEQ ID NO: 232–233; 235– 236; 238–239; 241–242; 244–245; 247–248; 250–251; 253–254; 256–257; 259– 260; 262–263; 265–266; 268–269; 271–272; 274–275; 277–278; 280–281; 283– 284; 286–287; 289–290; 292–293; 295–296; 298–299; 301–302; 304–305; or 307–308; Primer Pair Set 8 comprises at least one forward and reverse primer pair specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the primer pairs selected from SEQ ID NO: 310–311; 313–314; 316–317; 319–320; 322–323; 325–326; 328–329; 331–332; 334–335; 337–338; 340–341; 343–344; 346–347; 349–350; 352–353; 355–356; 358–359; 361–362; 364–365; 367–368; 370–371; or 373–374; Primer Pair Set 9 comprises at least one forward and reverse primer pair specific for a methicillin resistance gene selected from: mecA or mecC, the primer pairs selected from SEQ ID NO: 376–377; 379–380; 382–383; 385–386; 388–389; or 391–392; Primer Pair Set 10 comprises at least one forward and reverse primer pair specific for a colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the primer pairs selected from SEQ ID NO: 394–395; 397–398; 400–401; 403–404; 406–407; 409– 410; 412–413; 415–416; or 418–419;Primer Pair Set 11 comprises at least one forward and reverse primer pair specific for a sulfonamide resistance gene selected from: sul1 or sul2, the primer pairs selected from SEQ ID NO: 421–422; 424–425; 427–428; 430–431; 433–434; or 436–437; Primer Pair Set 12 comprises at least one forward and reverse primer pair specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the primer pairs selected from SEQ ID NO: 439–440; 442–443; 445–446; 448–449; 451–452; 454–455; 457–458; 460–461; 463–464; 466–467; 469–470; or 472–473; Primer Pair Set 13 comprises at least one forward and reverse primer pair specific for a vancomycin resistance gene selected from: vanA or vanB, the primer pairs selected from SEQ ID NO: 475–476; 478–479; 481–482; 484–485; 487–488; or 490–491; Primer Pair Set 14 comprises at least one forward and reverse primer pair specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the primer pairs selected from SEQ ID NO: 493–494; 496–497; 499–500; 502–503; 505–506; 508–509; 511–512; 514–515; 517–518; 520–521; 523–524; or 526–527; Primer Pair Set 15 comprises at least one forward and reverse primer pair specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the primer pairs selected from SEQ ID NO: 529–530; 532–533; 535–536; 538–539; 541–542; 544– 545; 547–548; 550–551; 553–554; 556–557; 559–560; or 562–563; and / or Primer Pair Set 16 comprises at least one forward and reverse primer pair specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)-Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)-Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the primer pairs selected from SEQ ID NO: 565–566; 568–569; 571–572; 574–575; 577–578; 580–581; 583–584; 586–587; 589–590; 592–593; 595–596; 598–599; 601–602; 604–605; 607–608; 610–611; 613–614; 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; 652–653; 655–656; 658–659; 661–662; 664–665; 667–668; or 670–671.
29. The kit of claim 28, wherein the kit further comprises probes suitable for use with specific forward and reverse primer pairs, the probes comprising one or more of: a probe specific for a molecularly characterized extended-spectrum β-lactamases (MESBLs) resistance gene selected from: blaGES, blaVEB, or blaPER, the probe selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, or 27;a probe specific for an extended-spectrum β-lactamases (ESBLs) resistance gene selected from: blaSHV or blaCTX-M, the probe selected from SEQ ID NO: 30, 33, 36, 39, 42, 45, 48, 51, or 54; a probe specific for a carbapenemase resistance gene selected from: blaoxa-51, blaoxa- 23, blaoxa-2, blaoxa-1, blaoxa-48, blakpc, blaVIM, blaNDM, or blalMP, the probe selected from SEQ ID NO: 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, or 150; a probe specific for an AmpC β-lactamase resistance gene selected from: blaACC, blaFOX, blaACT,blaACT / blaMIR, blaDHA, blaCMY / blaLAT, or blaMOX / blaCMY, the probe selected from SEQ ID NO: 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, or 213; a probe specific for a β-lactamase resistance gene selected from: blaTEM, the probe selected from SEQ ID NO: 216, 219, or 222; a probe specific for a lincosamide, macrolide, streptogramin resistance gene selected from: cfr, the probe selected from SEQ ID NO: 225, 228, or 231; a probe specific for a trimethoprim resistance gene selected from: dfrA1, dfrA12, dfrA5, dfrA17, dfrA14, dfrB1, dfrB5, or dfrG, the probe selected from SEQ ID NO: 234, 237, 240, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, or 309; a probe specific for a macrolide resistance gene selected from: mef(A), ere(B), mph (A), erm(A), erm(B), erm(C), or msr(A), the probe selected from SEQ ID NO: 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375; a probe specific for methicillin resistance gene selected from: mecA or mecC, the probe selected from SEQ ID NO: 378, 381, 384, 387, 390, or 393; a probe specific for colistin resistance gene selected from: mcr-1, mcr-2, or mcr-3, the probe selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, 414, 417, or 420; a probe specific for a sulfonamide resistance gene selected from: sul1 or sul2, the probe selected from SEQ ID NO: 423, 426, 429, 432, 435, or 438; a probe specific for a tetracycline resistance gene selected from: tet(M), tet(A), tet(B), or tet (S), the probe selected from SEQ ID NO: 441, 444, 447, 450, 453, 456, 459, 462, 465, 468, 471, or 474;a probe specific for a vancomycin resistance gene selected from: vanA or vanb, the probe selected from SEQ ID NO: 477, 480, 483, 486, 489, or 492; a probe specific for a nitroimidazole resistance gene selected from: nimB, nimD, nimJ, or nimE, the probe selected from SEQ ID NO: 495, 498, 501, 504, 507, 510, 513, 516, 519, 522, 525, or 528; a probe specific for a quinolone resistance gene selected from: qnrB, qnrA, or qnrS, the probe selected from SEQ ID NO: 531, 534, 537, 540, 543, 546, 549, 552, 555, 558, 561, or 564; and / or a probe specific for a aminoglycoside resistance gene selected from: aac(3)-Ia, aac(3)- Ib / aac(6')-Ib″, aac(6')-30 / aac(6')-Ib′, aac(6')-Ib, aac(6')-Ib′, aac(6′)-Ib11, ant(3″)- Ih / aac(6')-Iid, aac(6')-Ib-cr, aadA1, aadA12, aadA15, or aadA22, the probe selected from SEQ ID NO: 567, 570, 573, 576, 579, 582, 585, 588, 591, 594, 597, 600, 603, 606, 609, 612, 615, 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, 654, 657, 660, 663, 666, 669, or 672.
30. The kit of claim 28, wherein the kit further comprises a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample.
31. The kit of claim 30, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 673–674; 676–677; 679–680; 682–683; 685–686; 688–689; 691–692; 694– 695; 697–698; or 700–701; and the control probe comprises a probe sequence selected from SEQ ID NO: 675; 678; 681; 684; 687; 690; 693; 696; 699; or 702.
32. The kit of claim 28, wherein the kit further comprises a control plasmid comprising one or more target sequences selected from one or more antibiotic resistance gene targets comprising resistance to molecularly characterized extended-spectrum β-lactamases (MESBLs); extended-spectrum β-lactamases (ESBLs); carbapenemase; AmpC β- lactamase; β-lactamase; lincosamide, macrolide, streptogramin; trimethoprim; macrolides; methicillin; colistin; sulfonamide; tetracycline; vancomycin; nitroimidazole; quinolone; or aminoglycoside.
33. The control plasmid of claim 32, wherein the plasmid comprises one or more portions of nucleic acid sequences of SEQ ID NO: 703–781.
Citation Information
Patent Citations
Compositions and methods for identification of subspecies characteristics of mycobacterium tuberculosis
US20110105531A1
Compositions for use in identification of antibiotic-resistant bacteria
US20110190170A1
Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US20160180020A1
Electrochemical detection of bacterial and / or fungal infections
US20210246491A1
Methods for rapid identification of pathogens in humans and animals
US9725771B2