Compositions and methods treating FOXG1 and other syndromes

The AAV9 vector-based gene therapy for FOXG1 syndrome addresses brain abnormalities by driving FOXG1 expression in neurons, correcting neurological symptoms and reducing tumor risk.

WO2025217548A1PCT designated stage Publication Date: 2025-10-16THE RES FOUNDATION FOR THE STATE UNIV OF NEW YORK
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/024320
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-11
Filing Date
2025-04-11
Publication Date
2025-10-16

AI Technical Summary

Technical Problem

There are no approved treatments for FOXG1 syndrome, a rare neurodevelopmental disorder caused by pathogenic mutations, and current symptomatic treatments offer limited benefits with significant side effects, failing to address the underlying brain abnormalities and associated symptoms.

Method used

A gene therapy approach using AAV9 vectors with neuron-specific promoters and enhancer elements to drive FOXG1 expression in neurons while minimizing expression in non-neuronal cells, thereby correcting brain abnormalities and reducing the risk of brain tumors.

Benefits of technology

The gene therapy effectively rescues brain abnormalities, including cortical neuron thickness, oligodendrocyte lineage defects, and myelination deficiencies, improving neurological symptoms and reducing the risk of brain tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000022_0001
    Figure IMGF000022_0001
  • Figure IMGF000023_0001
    Figure IMGF000023_0001
  • Figure IMGF000023_0002
    Figure IMGF000023_0002
Patent Text Reader

Abstract

Provided are compositions and methods for treating neurological disorders such as FOXG1 syndrome. The polynucleotides may be provided as recombinant adeno associated virus vectors. The polynucleotides are configured to express a protein in a neuronal and brain-region restricted manner. Methods are provided and include administering the polynucleotides to an individual to treat the disorder.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS AND METHODS TREATING FOXG1 AND OTHER SYNDROMESCROSS- REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. provisional patent application no. 63 / 632,644, filed April 11, 2024, the entire disclosure of which is incorporated herein by reference.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created April 9, 2025. is named “011520 01942 ST26.xml”. and is 36,307 bytes in size.FIELD

[0003] The present disclosure relates generally to prophylaxis or therapy for FOXG1 syndrome.BACKGROUND OF THE DISCLOSURE

[0004] FOXG1 syndrome is a rare neurodevelopmental disorder resulting from pathogenic mutations in one of the two FOXG1 alleles. FOXG1 syndrome patients are characterized by brain structure abnormalities including smaller brain (microcephaly), agenesis of the corpus callosum, underdeveloped dentate gy rus and hypomyelination, with symptoms spanning autistic behavior, intellectual disability, absence of verbal and nonverbal communication, epilepsy, severe movement disorder, sleep disorder and GI problems. There are no approved treatments for FOXG1 syndrome, and symptomatic treatments offer limited or no benefit, with compounding side effects of the poly pharmacy associated with efforts to treat multiple symptoms. FOXG1 syndrome remains a significant unmet need, and the present disclosure of a gene therapy approach is addressing the root cause of this devastating condition.BRIEF DESCRIPTION OF THE FIGURES

[0005] Non-limiting aspects of this disclosure are illustrated by the accompanying figures. The disclosure includes each construct design as depicted on the figures, and each element of the construct designs alone and in combination.

[0006] Figure 1 : Representative Adeno-associated virus (AAV)-FOXGl constructs encompassed by this disclosure. The neuron-specific AAV9-FOXG1 set comprises vectors designed to predominantly drive human FOXG1 (hFOXGl) expression in neurons, while minimizing expression in neural stem cells (NSCs) and glial cells. This was achieved using repressive element 1 (RE1), which is an element that inhibits gene transcription in neuronal stem cells (NSCs) and glia yet permits expression in neurons.

[0007] Figure 2: The intracerebroventncular (icv) injection of pSYNl-FOXGl virus (A) into mouse brains at postnatal day 1 (Pl) resulted in the expression of human FOXG1 in the brains at P30, as assessed by in situ hybridization (ISH) with human FOXG1 -specific ISH probe (B. white signals indicate human FOXG1 mRNAs).

[0008] Figure 3: pSYNl-FOXGl virus rescued the reduction of layer 6 cortical projection neurons in brains of FOXG1 syndrome mouse model, W300X-heterozygous (W300X-Het) mice. (A) We performed immunohistochemistry (IHC) analysis with FOXP2 antibody to monitor the thickness of cortical neuronal layer 6. (B) Quantification. Treatment with pSYNl-FOXGl virus corrected the layer 6 thickness in W300X-Het mice to match the established wild-type (WT) control, normalized to 100%. WT (no virus, n=5), W300X-Het (no virus, n=5), and W300X-Het injected with pSYNl-FOXGl virus (n=5). Statistical analysis: **, p<0.01; ****, p<0.0001; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0009] Figure 4: pSYNl-FOXGl virus normalized aberrant increase of oligodendrocyte precursor cells (OPCs) in W300X-Het brains. (A) We performed IHC with OLIG2 antibody that detects OPCs. OPCs increased aberrantly in W300X-Het brains, indicating defects in the oligodendrocyte lineage. The treatment with the pSYNl-FOXGl virus effectively restored the number of OPCs in W300X-Het brains to levels comparable to those in WT control brains. These results suggest that the pSYNl-FOXGl virus can rescue impairments in oligodendrocyte lineage cells, which is required for the process of myelination within the brain. (B) Quantification. The Y-axis shows the number of OLIG2+ OPC in the defined cortical areas. WT (no virus, n=5), W300X-Het (no virus, n=5), and W300X-Het injected with pSYNl-FOXGl virus (n=5). Statistical analysis: ***, p<0.001; ****, p<0 0001; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0010] Figure 5: pSYNl-FOXGl virus ameliorated myelination deficiency in W300X-Het brains. (A) We performed IHC with myelination basic protein (MBP) antibody to monitor myelination status in the brain. W300X-Het brains showed myelination reduction.as monitored by MBP-expressing areas and the microstructure of MBP+processes. The pSYNl-FOXGl virus partially restored myelination levels in W300X-Het brains. These results indicate that the pSYNl-FOXGl virus can ameliorate myelination deficiency in W300X-Het brains. (B) Quantification. The Y-axis indicates the percentage of myelinated cortical area, as determined by MBP-positive areas in the defined total cortex areas. W300X- Het (no virus, n=5), and W300X-Het injected with pSYNl-FOXGl virus (n=5). Statistical analysis: **, p<0.01: ****, p<0.0001: ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0011] Figure 6: The icv injection of pSYNl-FOXGl virus led to an expression of human FOXG1 mRNA in the brains of FOXG1 syndrome mouse model, Q84Pfs- heterozygous (Q84Pfs-Het) mice. pSYNl-FOXGl virus was icv injected into Q84Pfs-Het brains at Pl. The brains were analyzed at P30, a month after the virus injection. We performed ISH with human NOXGf-specific ISH probe. Human FOXG1 was broadly expressed in the brain, including the cortex, hippocampus CAI -3, dentate gyrus, hypothalamus, and striatum.

[0012] Figure 7: pSYNl-FOXGl virus restored the overall FOXG1 protein levels_and the cortex thickness in Q84Pfs-Het mice. (A) We performed IHC with FOXG1 antibody that detects both mouse and human FOXG1 proteins. The pSYNl-FOXGl virus restored overall FOXG1 protein levels in Q84Pfs-Het mice, as monitored by FOXG1 IHC signal intensity (see images). Q84Pfs-Het mice display thinner cortex than WT control mice, recapitulating the microcephaly in human FOXG1 syndrome patients. The pSYNl -FOXGl virus restored the cortex thickness in Q84Pfs-Het mice, as measured by the cortex thickness (see the graph). Our data suggest that the pSYNl-FOXGl virus can rescue the microcephaly phenotype in the FOXG1 syndrome mouse model Q84Pfs-Het. (B) Quantification of the cortex thickness. The Y-axis shows the thickness of the cortex. WT (no virus, n=4), Q84Pfs-Het (no virus, n=4), and Q84-Het injected with pSYNl-FOXGl virus (n=4). Statistical analysis: *, p<0.05; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0013] Figure 8: pSYNl-FOXGl virus normalized aberrant increase of OPCs in Q84Pfs-Het brains. (A) We performed IHC with OLIG2 antibody that detects oligodendrocyte precursor cells (OPCs). OPCs increased aberrantly in Q84Pfs-Het brains, indicating defects in the oligodendrocyte lineage. The pSYNl-FOXGl virus effectively restored the number of OPCs in Q84Pfs-Het brains to levels comparable to those in WT control brains. These results suggest that the pSYNl-FOXGl virus is capable of correcting deficits in oligodendrocyte lineage cells, which are responsible for myelination in the brain.(B) Quantification. The Y -axis shows the number of OLIG2+ OPC in the defined cortical areas. WT (no virus, n=4), Q84Pfs-Het (no virus, n=4), and Q84-Het injected with pSYNl- FOXG1 virus (n=4). Statistical analysis: *, p<0.05; ***, p<0.001 ; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0014] Figure 9: pSYNl-FOXGl virus ameliorated myelination deficiency in Q84Pfs-Het brains. (A) We performed IHC with MBP antibody to monitor myelination status in the brain. Q84Pfs-Het brains showed marked myelination reduction, as monitored by the MBP-expressing areas and the microstructure of MBP+processes. The pSYNl-FOXGl virus partially restored myelination in Q84Pfs-Het brains. These results indicate that the pSYNl- FOXGl virus can ameliorate myelination deficiency in Q84Pfs-Het brains. (B) Quantification. The Y-axis indicates the percentage of myelinated cortical area, as determined by MBP-positive areas in the defined total cortex areas. WT (no virus, n=4), Q84Pfs-Het (no virus, n=4), and Q84-Het injected with pSYNl-FOXGl virus (n=4). Statistical analysis: **, p<0.01; ***, p<0.001; ****, pO.OOOl, in ANOVA test. The error bars represent the standard deviation of the means.

[0015] Figure 10: The icv injection of pREl-FOXGl virus (A) led to an expression of human FOXG1 in the brains of FOXG1 syndrome mouse model W300X-Het, as determined by ISH with human FOXG1 -specific ISH probe (B). Human FOXG1 is broadly expressed in the brain, including the cortex, hippocampus CAI-3, dentate gyrus, and striatum.

[0016] Figure 11: pREl-FOXGl virus rectified the abnormal increase of cortical deep layer neurons in W300X-Het brains. (A) We performed IHC with a BCL 11 B antibody that marks the cortical deep layer neurons. W300X-Het cortices showed an aberrant increase of BCL11B+deep layer neurons. The pREl-FOXGl virus treatment normalized the number of deep layer neurons in W300X-Het cortices. These results suggest that the pREl-FOXGl virus can restore cortical layer structures in W300X-Het brains. (B) Quantification. The Y- axis indicates the # of BCL11B+deep-layer neurons in the defined cortical area. WT (no virus, n=5), W300X-Het (no virus, n=5), and W300X-Het injected with pREl-FOXGl virus (n=5). Statistical analysis: *, p<0.05; ns. non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0017] Figure 12: pREl-FOXGl virus normalized abnormal increase of OPCs and restored myelination in W300X-Het brains. (A) We performed IHC with OLIG2 (OPC marker) and MBP (myelination marker) antibodies. The results shown are for MBP. W300X- Het brains showed aberrantly elevated OPCs and reduced myelination. The pREl-FOXGl virus normalized the number of OPCs and restored myelination in W300X-Het brains. Theseresults indicate that the pSYNl-FOXGl virus can ameliorate myelination deficiency in Q84Pfs-Het brains. Quantification is shown in panels (B) and (C) as follows. (B) The Y-axis indicates the percentage of myelinated cortical area, as determined by MBP-positive areas in the defined total cortex areas. (C) The Y-axis shows the number of OLIG2+ OPC in the defined cortical areas. WT (no virus, n=5), W300X-Het (no vims, n=5), and W300X-Het injected with pREl-FOXGl vims (n=5). Statistical analysis: *, p<0.05; ***, p<0.001; ****, p<0.0001; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0018] Figure 13: Efficacy testing of pSYNl and pREl viral treatments in W300X-Het mice (FOXG1 syndrome model) at P30. W300X-Het mice received intracistema magna (icm) injections of pSYNl or pREl viruses at P30 (adolescent stage), followed by rescue analysis at Pl 20 (adult stage). These experiments assess whether viral therapy remains effective beyond early postnatal stages. Both pSYNl and pREl viruses restored OPC populations and improved myelination. The results shown represent the pSYNl -FOXG1 treatment. # OLIG2+cells = number of OPC = MBP+area = myelinated area in the cortex

[0019] Figure 14: AAV-FOXG1 injection at P30 suppresses microglial hyperactivation in W300X-HET mice. W300X-Het mice received intracistema magna (icm) injections of pSYNl or pREl viruses at P30 (adolescent stage), followed by rescue analysis at P120 (adult stage). (A) IHC was performed with antibody against IBA1, which marks microglia. (B) Quantification of IB Al -positive cells in W300X-HET brains show increased microglia, which was normalized (rescued) by both pSYNl -FOXG1 and pREl -FOXGl viruses. The results shown are for the pSYNl -FOXG1 vims. The percentage of IBA1+ microglia w as normalized to WT control levels.

[0020] Figure 15: Schematic representation of AAV9-En-pl50-FOXGl constructs. The AAV9-FOXG1 construct was engineered by combining distal enhancer regions and a gene-proximal promoter from the human FOXG1 gene to drive its expression in specific brain regions. Enhancers and promoters were identified using a transcriptionally active chromatin database from neurons and glia in human and mouse brains. Enhancers were selected based on their region-specific transcriptional activity in the brain. We found that Enl50 is the promoter, hence named pl50.DESCRIPTION OF THE DISCLOSURE

[0021] Unless defined otherwise herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0022] Every numerical range given throughout this specification includes its upper and lower values, as well as every narrower numerical range that falls within it, as if such narrower numerical ranges were all expressly written herein.

[0023] The disclosure includes all polynucleotide and amino acid sequences described herein, and every' polynucleotide sequence referred to herein includes its complementary' DNA sequence, and also includes the RNA equivalents thereof to the extent an RNA sequence is not given. Every DNA and RNA sequence encoding polypeptides disclosed herein is encompassed by this disclosure, including but not limited to sequences encoding all recombinant proteins that comprise a segment of or a full protein, as described further below.

[0024] The present disclosure comprises compositions and method for prophylaxis and / or therapy FOXG1 syndrome, and related or other conditions.

[0025] In examples, approaches of this disclosure are related to reducing the known tumorigenic potential of FOXG1 protein. In this regard, the disclosure provides a bioinformatics analysis that led to identification of 17 genomic regions that are likely involved in driving the expression of FOXG1 to the described regions of the brain. One of these 17 elements (genomic DNA sequences) was the promoter of the FOXG1 gene, as described further below. The disclosure accordingly provides combinations of DNA elements to provide as proof of principle a new adeno-associated viral vector, namely a new AAV9 vector, that is expected to be suitable for use in humans. In examples, use of a described construct reduces risk of FOXG1 -induced tumoriogenesis due at least in part to neuron-restricted FOXG1 expression. In examples, the present disclosure differs from a previous approach, such as that described in WO 2021 / 183433, in at least the following ways: a) use of a described promoter and / or enhancer elements; b) use of RE1 and CBA in combination to provide a neuron-specific promoter by RE1 inhibiting the CBA activity in non-neuronal cells; c) use of a specific codon-optimized FOXG1 coding sequence; d) use of a AAV9 capsid instead of PHP.eB capsid; and c) use of a single-stranded AAV instead of self- complementary' AAV.

[0026] The disclosure demonstrates that FOXG1 expression in neurons is responsible for most symptoms of FOXG1 syndrome, and provides for avoiding expression of FOXG1 inthe area of the brain which does not normally express F0XG1, thereby reducing or eliminating the risk of brain tumor development. As such, the disclosure provides in certain examples AAV9 vectors, one with chicken beta-actin (CBA) promoter fused to two copies of the neuron-restrictive element RE1 (e.g,. repressive element 1), or a Synl promoter which itself contains RE1, or the described pl50 promoter used in combination with a described enhancer sequence for brain-region(s) specific protein expression.

[0027] Non-limiting examples of constructs encompassed by the disclosure include those depicted on the accompanying figures, including FIG. 1, and include: 1) ) AAV9-RE1- pCBA-FOXGl (pREl-FOXGl); 2) AAV9-pSYNl-FOXGl (pSYNl-FOXGl); and 3) AAV9-En-pl50-FOXGl. Thus, in examples, the disclosure provides a construct comprising or consisting of, optionally in a 5'-3’ direction: i) an AAV inverted terminal repeat which may be an mutated inverted terminal repeat (mITR); ii) a described transcription promotion element such as one or a repeated RE1 element, which may be only two RE1 element, and wherein an RE1 element may be comprised by a human Synapsinl promoter (pSYNl) promoter or the described pl 50 promoter; iii) an intron, including but not necessarily limited to an SV40 intron; iv) a human FOXG1 coding sequence including but not necessarily limited to a codon optimized human FOXG1 coding sequence (or an alternative coding sequence as described herein); v) a polyadenylation sequence and / or transcription termination site; and vi) a another AAV2 inverted terminal repeat. As discussed above, representative constructs of this disclosure are shown in FIG. 1. In FIG. 1, the “promoter’7segments are illustrated in the “Neuron -specific” labeled bracket. The depicted constructs are taken in connection with the diagram at the top of FIG. 1. The “promoters” are show n as REl-pCBA, pSYNl, and En-pl50. The Neuron-specific depictions show the name of each construct (beginning with “AAV9”) but are not meant to designate an orientation of the elements within the full-length construct, which is shown at the top of the figure with a generic “promoter” segment designated.

[0028] In examples, the disclosure uses the FOXG1 coding sequence as a proof-of- principal to demonstrate targeted, brain-region specific expression of the described FOXG1 codon-optimized sequence by including at least one described enhancer element in a described construct. Representative results using the FOXG1 protein as an example of brainregion specific expression facilitated by an ensemble of enhancer elements is demonstrated in FIG. 15 and summarized in Table 4. As such, the disclosure includes using one or a combination of the described enhancer elements to promote expression of any gene and / or coding sequence that is used in place of the FOXG1 gene to promote brain-region specificexpression of an alternative gene / coding region. Such approaches can be used for treatment or prophylaxis of a variety of conditions by changing the particular gene / coding sequence in the construct and combining it with one or more of the described enhancer sequences. In particular, individual enhancers recapitulate the endogenous expression pattern of F0XG1 either fully or only partially, and some enhancers also drive the expression to the areas of the brain that do not express F0XG1. When these enhancers are combined with each other, they can demonstrate expression patterns that are different from that of individual enhancers. These properties of the enhancers are expected to be useful for other disorders by using one or a combination of enhancers with a gene that is used in place of the FOXG1 gene in a described construct. Such disorders include but are not necessarily limited to autism spectrum disorders, STXBP1 disorders, FOXP2 syndrome, TBR1 disorders, SATB2 disorders, ZBTB18 disorder, MEIS2 syndrome, MEF2C syndrome, Snijders Blok-Fisher syndrome (POU3F3 syndrome), Lamb-Shaffer syndrome, and Coffin Siris syndrome. In an example, STXBP1 disorders require expression of STXBP1 in a wide area of the brain. In this example, the sequence described as Enl63 is expected to be an effective enhancer for a wider expression of STXBP1 in most neurons. Another example is FOXP2, which requires an enriched expression in the striatum. In this example, the sequences described herein as Enl53, Enl55, Enl57 and Enl60 are expected to be effective for striatum-enriched expression of FOXP2.

[0029] In examples, a single enhancer element is used to promote expression in specific brain region(s). In examples, a combination of described enhancer elements is used. In examples, a combination of described enhancer elements may be present in a single construct, including but not necessarily limited to a single modified AAV delivery vector. Enhancer elements of this disclosure are designated using the prefix "ErT and ’Enh.” The present disclosure reveals that one of these elements, designated “Enhl50” in the text and referred to as “pl 50” in the figures, such as in FIG. 1, functions as a promoter. As is known in the art, eukaryotic promoters are typically positioned near the location on a chromosome where transcription is initiated. Nevertheless, the described enhancer elements may be provided in a described construct in locations that are distal to transcription initiation sites, provided the enhancer element is functional to promote gene expression when in an appropriate tissue context. Accordingly, in examples, the disclosure provides constructs comprising one or more of the elements referred to herein as Enhl49; Enhl50 (also referred to as “pl50” due to the identified promoter function); Enhl51; Enhl52; Enhl53; Enhl54; Enhl55; Enhl56; Enhl57; Enhl58; Enhl59; Enhl60; Enhl61; Enhl62; Enhl63; Enhl64;and Enhl65. In examples, the disclosure provides one or a combination of Enl54, Enl55, Enl57. Enl59. Enl64. or Enl65. Thus, the described enhancer sequences can be used to selectively promote expression of a desired gene in the cortex, including but not necessarily limited to the cortex upper layer, the cortex deep layer, and / or the retrosplenial region. Likewise, the described enhancer sequences can be used to selectively promote expression in the hippocampus, including but not necessarily limited to the hippocampal subfields (e.g., CAI. CA2. CA3, and CA4) and the dentate gyrus. Similarly, the described enhancer sequences can be used to selectively promote expression of a desired gene in the striatum, hypothallus, or thalamus.

[0030] In examples, a described promoter and / or an enhancer sequence is operably linked to a DNA sequence that is transcribed. By “operably linked” it is meant that the promoter, the enhancer, or a combination thereof, is present in the same polynucleotide as the sequence encoding a protein (and is thus provided in cis), and expression of the protein is dependent on the presence of the described promoter and / or enhancer to promote transcription in a manner that is restricted to specific cells, as described herein.

[0031] As discussed above, in examples, the FOXG1 gene is replaced with a gene encoding a therapeutic protein. Further, the described FOXG1 gene can be replaced with a sequence encoding an RNA polynucleotide that does not necessarily encode a protein, such as a microRNA, snRNA. shRNA, and the like, and used in combination with one or more of the described enhancer sequences.

[0032] The DNA coding sequence and amino acid sequences of mouse and human FOXG1 are known in the art. The nucleotide sequences of RE1 and SYN1 are also known. In non-limiting examples, the disclosure includes an AAV vector that comprises a combination of the following sequences, which in an example includes a codon-optimized FOXG1 coding sequence.

[0033] A representative codon-optimized FOXG1 sequence is: ATGCTGGACATGGGCGACCGCAAAGAAGTGAAGATGATCCCCAAGAGCAGCTTC AGCATCAACAGCCTGGTGCCTGAGGCCGTGCAGAACGATAATCACCACGCCTCT CACGGCCACCACAACAGCCATCATCCTCAGCACCACCATCATCACCACCATCACC ATCATCATCCTCCACCTCCAGCTCCTCAGCCTCCTCCACCACCTCAGCAACAACA ACCGCCACCACCGCCTCCACCAGCTCCACAACCACCTCAAACAAGAGGCGCCCC TGCCGCCGATGATGATAAGGGACCTCAACAGCTGCTGCTGCCACCTCCACCACCA CCACCTCCAGCCGCTGCACTTGATGGCGCTAAAGCCGATGGACTCGGAGGAAAA GGCGAACCTGGCGGAGGACCTGGCGAACTTGCTCCTGTTGGCCCCGACGAGAAAGAAAAAGGTGCTGGCGCTGGCGGCGAGGAAAAGAAAGGCGCAGGCGAAGGTGGCAAGGATGGCGAAGGCGGAAAAGAGGGCGAGAAGAAGAACGGCAAATACGAGAAGCCTCCGTTCAGCTACAACGCCCTGATCATGATGGCCATTCGGCAGAGCCCCGAGAAGAGACTGACCCTGAATGGCATCTACGAGTTTATCATGAAGAACTTCCCGTACTACCGCGAGAACAAGCAAGGCTGGCAGAACAGCATCCGGCACAACCTGAGCCTGAACAAGTGCTTCGTGAAGGTGCCCCGGCACTACGACGATCCTGGCAAGGGCAATTACTGGATGCTGGACCCCAGCAGCGACGACGTGTTCATCGGAGGAACAACCGGCAAGCTGCGGAGAAGAAGCACCACAAGCAGAGCCAAGCTGGCCTTCAAGAGAGGCGCCAGACTGACAAGCACCGGCCTGACCTTTATGGACAGAGCCGGCAGCCTGTACTGGCCTATGAGCCCATTTCTGAGCCTGCATCACCCCAGAGCCAGCAGCACCCTGAGCTACAATGGCACCACCAGCGCCTATCCTTCTCACCCCATGCCTTACAGCAGCGTGCTGACCCAGAATAGCCTGGGCAACAACCACAGCTTCTCCACCGCCAATGGCCTGAGCGTGGACAGACTGGTCAATGGCGAGATCCCCTACGCCACACACCACCTGACAGCTGCAGCACTGGCTGCCTCTGTTCCTTGTGGACTG (SEQ ID NO: 1)

[0034] As described herein, some constructs include an RE1 element. In examples, the RE1 element comprises or consists of the sequence ttcagcaccgcggacagtgcc (SEQ IDNO:2).

[0035] The RE1 sequence may be duplicated in any described construct. In examples, the RE1 sequence is repeated contiguously at least two times, meaning the sequence is repeated without intervening nucleotides between each repeated sequence. In examples, the RE1 sequence is repeated at least two times, but with intervening nucleotides between each repeated RE1 sequence.

[0036] Representative hSynl (pSynl) promoter sequence: agtgcaagtgggttttaggaccaggatgaggcggggtgggggtgcctacctgacgaccgaccccgacccactggacaagcaccca acccccattccccaaattgcgcatcccctatcagagagggggaggggaaacaggatgcggcgaggcgcgtgcgcactgccagctt cagcaccgcggacagtgccttcgcccccgcctggcggcgcgcgccaccgccgcctcagcactgaaggcgcgctgacgtcactcg ccggtcccccgcaaactccccttcccggccaccttggtcgcgtccgcgccgccgccggcccagccggaccgcaccacgcgaggc gcgagataggggggcacgggcgcgaccatctgcgctgcggcgccggcgactcagcgctgcctcagtctgcggtgggcagcgga ggagtcgtgtcgtgcctgagagcgcag (SEQ ID NO:3)

[0037] In an example, the disclosure provides a modified hSynl promoter comprising an RE1 sequence positioned at the 5’ end of the hSynl promoter. Accordingly, this construct can include two copies of the RE1 element, one at the 5’ end, and one in an internal location. A representative hSynl promoter with the described configuration comprises or consists of the sequence:ttcagcaccgcggacagtgccagtgcaagtgggttttaggaccaggatgaggcggggtgggggtgcctacctgacgaccgacccc gacccactggacaagcacccaacccccattccccaaattgcgcatcccctatcagagagggggaggggaaacaggatgcggcgag gcgcgtgcgcactgccagcttcagcaccgcggacagtgccttcgcccccgcctggcggcgcgcgccaccgccgcctcagcactga aggcgcgctgacgtcactcgccggtcccccgcaaactccccttcccggccaccttggtcgcgtccgcgccgccgccggcccagcc ggaccgcaccacgcgaggcgcgagataggggggcacgggcgcgaccatctgcgctgcggcgccggcgactcagcgctgcctca gtctgcggtgggcagcggaggagtcgtgtcgtgcctgagagcgcag (SEQ ID N0:4)In examples, a described construct is used with a chicken beta-actin (CBA) element. In an example, the CBA element comprises or consists of the sequenceCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGA (SEQ ID NO:5).

[0038] In an example, a promoter comprises an RE 1 -CBA element: (2 tandem and contiguous copies of the RE 1 element) The RE1 sequences are shown in and the bold nucleotides represent the CBA segment.Zfc'agc’accgcggacagZgcc'ZteagcaccgcggtzcagZgccTCTAGACGCGTTACATAACTTACGGT AAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAA TGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATC ATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTG GCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATC TACGTATTAGTCATCGCTATTAccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccc tccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggg gcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagttt ccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcg (SEQ ID NO:6.

[0039] In examples, the aforementioned enhancer elements include the following sequences:Enlil49:ATGGAACAGGTCCGCCCtcacactatcagggactcaagtccttcagcaaatcactcaccctctggagggcactggcaa agaacgcgaaacaagtaaaagggtagtggacattatgtttacaatgtttacaagagatgtacagagtattcgactgagaagtttttccag agactaaagtcccttggccctctggtggtatttcgtcatggatctttccacgcctggctctcccttggctaatgtcgggacaaagcttctcc catgcacattttgctgaagatcacgggacttttcttttggctgcgtacgtacttggcttcagagagcctggaacacctggcagcgtcacag agacttgcctggagagtcccaggggtctctgtcaaggccttctcctcatccttgtcctcttcctcctcctgctcctcttcttcgccttggactt tctcccttttaaagtggctccctagcttacacaagctaaacatttccactctcatagacgaggctctcccatagatttttttactcgaggttctc aagcaaaattgccggtgccacaatgttatgatggaaggATGCTGAAATGACAGGCCTAGTAg (SEQ ID NO: 7)Enlil50 (also referred to as “pI50”):Cgaaaatgacccagtacaatgaggaggaagccggaaatgtgagctattggccctaggaggggaatttcggtggagcggagccggc ggggtggagggggtggcgggggcgcagggaagggctgcggcaccgcgtgctcccgccggcgtatccctacgcggctccgcgc ggcctcggggtccgaggcccgcggagagggggaggcgagcgcccgagggggcggcagccggcgggcggggcgggggtgg gtgggcccggcccctccgattggtcgacggcgagagagacgctcccgcacgccgccagctctgattggcccagcggtaggaaag gttaaaccaaaaatttttttacagccctagtgtgcgcctgtagctcggaaaattaattgtggctatagccgcctcgatcgctgtctccccag cctcgccgcggccgctccgggacgcgcccgcccgccgcccggctctccccccctttgggctgctgctgctgctgctgtgactgctgc tgcgagaggaggaggaggaggaggaagcagcgggggggggagcggggggtggggggggagaccaagaagtacagttggga gcgagggagcttcacccccggggcggtggttgtttcttttttctttctttcttttttcttttcctttttttttttttttctaattcctgaggggtggttgc tgcttttgcta (SEQ ID NO: 8)Enhl50 in the AAV9 vector:Gggcggggcgggggtgggtgggcccggcccctccgattggtcgacggcgagagagacgctcccgcacgccgccagctctgatt ggcccagcggtaggaaaggttaaaccaaaaatttttttacagccctagtgtgcgcctgtagctcggaaaattaattgtggctatagccgc ctcgatcgctgtctccccagcctcgccgcggccgctccgggacgcgcccgcccgccgcccggctctccccccctttgggctgctgct gctgctgctgtgactgctgctgcgagaggaggaggagg (SEQ ID NO:9)Enhl51:Tggctgagagcacgcgccagacacaggttggctcggcccgaagcgaatttgggactctcgtcgcggtgtcctattaattagcttttcc cggcgcctcagggactccggggtgaagatggagaggtggcataatggcgggacttgaagtcgttgtggcagggacctggcagcgtt gttttctcgggttttgaaccggtgtggagaagtaacttcagctgctgagttggggccgccctggctgcgcggtggcggaggaggaga ggagaagcgctctcgggacattgcggcggcgatccccgcagagggtgaagccgggcgctgcgcagggagcagcaacatgaggg cgctcttgcccaggacaagcagagctgtacgtttgggtagctcatattggctgatgccaagaaaagtgacttcagaaccttggctggcg cgcttccctaccttttccctttcttcttaatcttctgtgtgccaccacctccccccaaccttttttcccctcccaaagttgtttccttttgtttaccc ggtgcggtttcagatctcagcacttctcagctagtagataaaattatttgctctgtaatggacatctcttctcctctccacttgttaccccactc gcccttcgctttctaccccattttgcttctctctgcccaagcctgtggtccaaggtgcagggatctcacaggaaa (SEQ IDNO: 10)Enhl52:GGAAGATACTTAACTTTAACGAGTTTAAGTATCATAcatatttacttttaaggtgttcatttctttaaaac aatgtgatgaaaatataacataataggaatgtatgtcctattttagaagtagggcaaagcaggctgtttaatacaaaattgtgagtgagata atttgaagctaagaaaacataaatacagtatgagcccacataccatgaaaaggtaacaaatagggaagggaaacagcggggaaaac cccagagcatttaatcttattttatggtggcattcatgtactgaaaagagtgaaagaacagcccccacacttccagaaatgagtcagtttc atgtctcaagctgattataaaccattcaagggcggcagcctcccacagctgactttaactgtgattagaatagaggatggtcgttagtttg ggcatgccatatgtgccctgaagtctcaaagcctgatcatcaggtaaacttgaagtttctctaggaccagcttacaaataacttcatatatg tatcctgaaaaagacagctcatcaacaggccggtcacatatgcttaaaccatactccaaaccatttggcatgcactagagcaattttaca agtttagaAACTCCATCTTAATTTTAAACCACTTCAGT (SEQ ID NO: 11)Enhl53:Aaaccagaagtgactcttctgctcatagtctagtgtctaaaacatgtcacatagtttcaacctaactgcaggggaagctaggaaatgtaa aggaatacatggagaaccaacagactctgtcaaaactggctagtgaaccttctggaatattctcatagatcgctccaacccagcaaaga caagacataattcgtatttcaatcttctttatttcaatactggctagagtcttagccatcacagaagcttctctgagcagaagaataaggtca atctttgtgccatatatatttttatattagctatattggttagtgaagcaacaacttgaacattcagactgttaacatttttaaggacacacataa aaatgctttggtgagttacataattatgggaagacagaaatttcattttaaaaatcttttgaatctattatggaaattagctttacaattataaaa tcctagacttaaaatatctaggcaaggatattttatgtgctggttgctttataaagatccacaatgtattagggcaaataggacatacaaaaa tcatcagcaaatatcCAAACAGAACATCAGTAAAGAGCATTAGA (SEQ ID NO: 12)Enhl54:TATAATGAACAATTTCAGTCCAATGGAAGAtttattttaaaaaatggcaccaatatacatttttgaacgctaa aataagttttatgaacattactcatttttttccttttcttgtactttgtcttttccaaccagaaaatcatttcaatgggaaaatatgttggcatgtttgttttattagctaatacattttctcatgtgatatcagctcacggcaaaagttaaggaataaaaaaagaaaagatctttcttctttccacctactga attctgcctgaacctctcccactcccatacacacaccaacacgcccactgttccacagcaatatactgcttggcattctggcagggaaca gaaagacaaagcatcatgggaagaaacggttagaaaaaaataactgaaagatgtggaaatttttatgctcagaggctcttggcagtcaa tgagaaataggagattggaatggaaactataaaggggtaactctaatttctttccattcctctttgtgtcttgcagtattctcttctagcagtg gaaggaggagacacgatcaaatcatttatagctttaggatcttccagttgtgcttccctttacctgatatccatagatacgttttcttgattcta aaaatgtataagcaagaagaaccccacttctaattgctactgagcATT GCCC AGAT CTTAGC ACCT (SEQ ID N0: 13)Enhl55:ATCTTGTTACTTTGCCAGGAATAGCacaggggtccctttagcgagtgagactaagggtactaaagtggttgga aatcactgaaaacagtagcaggtttatttgagcaaaatcggcagggtggtgtaatatacatttttaaaaatgcgttttcattaaaattaaaaa atagcttccaaacaaactctggaaagggctccaaatgcagccttacaaaccccaaatgaaatcaataaaaagaaaccagccaagcag caagttgagaaaacaccaattagagtttttaacaaacagagaagctcgctgtggggtacagtttttaaatcagacaagagaaatttgggc ttttttctctacctcggctctgctgtactgtgctcttgctggaactgaaatttatgggattcagaatgcaccccaggaagaaaacacaaaca agcgggtgctctgggcattgtatctgagcagatgaaagcaaatattattctgatagcttttcattttgccctccaaggagctctgcgttatta tccacgactagggattttaatagtcaaactaccacaaatttgtcaacactCAATTTCTGCCTGGTTACAGAGT (SEQ ID NO: 14)Enhl56:GCTCAGAAATAAACTGACAGGCActagtgcttcgttcatttccagcaaggaagcaccaatttgattcctaccataa caatttttgctgttgccagtgcatcagatttttttaacacagcttctcaagtgatagaaatcatcccgtcactttgtttcataaaattgacaccct ggggaaatgcaaaatatagtaagaacttgagcaaagcttctcctccaacccctgctaggtattcctgaaatcctttttttcctcttaaacga atgtcatcaatcccaattgcttgttgttcttttctccttgttctgctcatgtgctacaacatcccttggcttccctgagcacaagagttggtgtttt taaaagtgttactcatagataggattctactgctggctgattggaatgcagcgacaaataaaaaaaaagaaacttgatgaaattatttcac acacagagcaataaacatatggaataaattactacagaagacgattcaaagagtttaagaaacacctggatttgtttctggaggcagtcg attggagagtagcattagaaacaggagggtgaaataaaagcaacactcaagaagccaagagtcagggctctaacctcttgttgaaatg gcacctcctcttgcagttgctgcacaggagtctattagggaaagacttCTCGAATACACTGGGAACAAGTC (SEQ ID NO: 15)Enhl57:TTCTTTTCCTTGAAAGGAGGTGAAAAtctgacagctcaaaatgaagcaaaaacccaagattaaaacagacac cattttgtgcccactcagtcttctttccagggtcatacatgtgtaagtagctgtttgttatagtcgagaccttctgtgggtaaatctggcagg atatcaaagacatttagcatagatatttcattttcaatgcatgtgtctatttttttccctgttgatgaaccaaatataacacatgcagatgattttt aggaatttattttaaatcataagtgtttctttttctttttctgaatgttcacagtagctgggagacaagtatttgctaccactcccctcccaaca cggcattgaatggttgggtggaactgaacacaagattgcataatgtgcttcctctctttaatatctccatatttaatccactaattaatcatata tatatcaatctgtctattaaccatctataatctattcatctgttaatcatctataatttatcaatctgtacttcgtggcatagtatttaagaatatgg gctttggactcggttatatctgagtttaaaggcagggtccatttcttattagctaagtggctttaggcaaattaacctctctaagactaattgg c (SEQ ID NO: 16)Enlil58:Aacgaaggtcagaatgttgtaccaaaagaaggagaaaaggaagctaaccaaaagttaaaaagagatgttgagtataataatgctttga gatggtgagtacatttcccagggtacataagttgttacaggagatgcctacagacctagatctgacaattgttagtcaagtgcttgttccac tacaccattgtttcacttgattgaggagaaagtttatggttattttgtggaatatattgggatggttatttaagatttgtacagcattttcatacat gttgggtcacttgagaaggcagcaggatatgtatgctatctaggtttcccatctcgatttctttagctgttcttggcagccttcactttgttaaa ctgactatataaagccgagtagcactcaaaatcagagctactttctctcaagaaagaacatgtggttaagtcattatattatattcctaatgt ggtgcagcctgaatgtaaagtaaaattagactgagagattgaatcaaccaaaaaaacaataaagaagaacatgtgctttcagcagaata tatactgcagttttgttgataagtgttaaagcacaatttcctacagtatggatagtccagtctgagctaaccaaaggttactcctatatgcaa gataagttataccttcatactcccaatcaagatCCCTGACACTGAATTCCTCCA (SEQ ID NO: 17)Enhl59:TGGCCATTCACTTGGATGTGgaatgaagaaaggggaatattaaaatgactccttaattactgactcatgtggaagag ataagagggtagagatggagagataatgggtgttatctggtactggtttagttagaagtgggtttgaaatattgaagttgtgcaggccaa aaaaagaaatctgggagactttaagatttaagtggtcaataaagccatgtcatacaatgagattacccagaaaaagcatttcaaataaga aaggaaaagatgaaacactaaagacagctggcctgtgggaggtagctgcagaaaaaaatatatatatatttcttaagtgacagataata agaaccgggaaaacctagatcattacatgctgaagggagagagaagaagacagtgatcgccagtgctgaaagccttagaggagtaa gacagatgaggactaaaaattatccattgaatttagcaatctcaatctgatgaatctatttacaaagattacaaactcttgggtagtgaaga aagaaaatcaattgaaagagttgtggagcaaatctaatttagacgttaaagaaagaaagagtaaatggtttgaacacctagatagtaaag gaaaggagagaacaagatgtttacccttgtttgtgtgttacaagatagaaggcagtggTGAGGAGAAATTTATGATA CAGAAGTGTC (SEQ ID NO: 18)Enlil60:CCGTTACTTACTGCTACCTGACTtgtcagtatgaatgtggctcctattccctaaatcacactacctgtgaatagagct ccgctggccaattcaaggctctttaggcaactatgattgatgactcagtgactaggagaaaattgccttcaatgaattattcatcaagctat ctctttgctgttaaagtagctgacaggaaagttctgacactgcctaagcacaatccacttacaaatcagttacaaggaaatattaaaaata gctcggttacagcataccagcacagtatcaagttggggcttttttctgtctacattgagcatcacggagaacttgagcagctcttcccattt agccattgtgctaatggcagtaaaggcagtgattagatagaaagcaatgtgatttgtattggctttgaaacaatacactgtttttaataacac aaatctctaaatttaaggtagaCAGTTAATCAAGCAAATGGTAATATTTAAGCAT (SEQ ID NO: 19)Eiihl61:ATCCTAAATGGATCTACCACAGAGACaaacttaataattctactacctctacaacagttagataacattcaccgt gagacagctgagtatatgtcggcttctaaactatagcatgcaggcacgtaaaacagtatttgcattaacacactctttatgaaatgaatttg aaagacttttctgagttgtcctgaaaaaaaaaagcagcctcccacagctggctcctctatttttggcttctcctatccctgttttcatggcag ctgagaaatattaatgtgagaaaagtatcttttattttagtctttagaaaagaactcaacagaaaaccctgcaacttcagcagtagatgata agagttccaagatcacactgtggaagtacattattgaaacaacctgtaggaaagggaacataatataaaataatatgttccacttacatat gacatacccaaaacttatgctgtttacatataatgattaaattaacatattttgccaaaagttaataggtcccctaggaatgattatataaaat aggtttgtaatcaatctcatacagagaaaaggcacagtggaagaaaaaagatttatttgatccaccaccattcaacagaaacaagtgatg aatagatctatttgaagattggagaaacatttagctttatgagaaatTTTCCTCCTGATGTTTCCTATGATACA (SEQ ID NO: 20)Enhl 62:AAAATAGTTACTTTCCAGTAATTCATAGACAAGCagaacaagagcacagaaaaatcctgaatgtgcg tatgtccatagtaatgataaacaacttgttgattgggatcttacaattaaatgtgattttgaaaaacatattacaggtatagtttatcttgtatgg taaatttgatgtaagacaaaattagttaaaggactagtatcaaagttttaataacagattgttaaaatagatgcattattaaatgtataccaat gattctgcttgccaaaagaagcaattccacctcgttttatatactatatttttaatgattgcataataatcctcagctttgaggagctgatatat gtgagaacacccaacaactctgtagctgagttaaatataggacctgtgggttttatctgtgttaaagacacatggagcaagagatgcaca tttacataaaatgtatcttttaaaggccatacattttgtgcacacctgtttgtgttcctgatagttctgagactcttcagcaggtgcacttcatcg ttaatgagaaggaccggtttattttaatactaagaagaagagagtagaaacagtgaggagagggtaaaagaggaaatgggcttaattg cttatgaaaatgccatatttaagaaatcagtatctcctataagtagtgagaaagtggactgcttaattaacaaga (SEQ ID NO:21)Enhl63:ATAAAGTAAAAATAGAAGTGATATAAGGGTTGTATTTTTatagctgtatttgagtacatttcaaatg aatgtttgttaaacagggggaaaaatcagactggcattgtcgtgattctaagcgaattaggtgaggcaggaacaggaagaatctgagta gcttgcatttaattagcacttactggtacaaaataaattagacagatttgtcttgttttatgagcaagatcctgtttttctatttcattttctttgtgc ttttggtaaggacggatctggcgctttggatactaaataggcaactaattcaattggtgctttctccgagggtctccttgcaaaccggtgcc agactcactggtcctttgtgtactgcccgccctgcatgtgtctgggctcccctggccagtccgtttttttgtctctgatggttaataagctttg agcctagtagtcaaatgtggtgggaacggggacaagacgagggtccttagtgaaggtgtttgttgttaaatagaacaattcagctgtctc tttagaaaacttgacaaaaggaaatgctccctgctgaaaattttcttagcctgttgcacaaaagatgaagtttgtttaagaaattgctgctaa agaaagcgtcaacccattaaggtaattatatggaacctgtgccGTATAACAGCTTAATTGATGTTAATGTTT GTCTA (SEQ ID NO:22)Enhl64:GCTGAGTGACTGGGGTTCTccagtggacatactgggaaatttatagaggtactctatgttcagtggtattgcatcttttct cacctaagccatgtttacagtgagacccactcccatatttctgaaatgctttaagtagccccactgaaaggtcataaaataggcttaattat ccttttcctggcttttcaaatctttagatttcacaagctcttgccttgttatagctgtgagggttaattttatatatcaacataactgtactaaggg atgcccagacagctggtaaaacattatttctggatgtgtttgtgatggtgtttccagaagagattaacatttaaatcagcagactgagtaaa aaagatcctttctcaccagtgtgggtgggcatcatccagtccactgtggtctcaaatagaagaaaatgtggaggaaggatgaattttctct ctctgcttgagatgagacatccatcttctcctcccttcagatatcggtgttcctggctcctgggcttttggactcaggccaggacttatacca ttagcccctcagttctcagaccttcacacttagaatgaattacaccaccaactttgtagcttgcaaacagcagatcatggtaattcttggcct ctataactgtgtgagttaatttatgtgataaatctccatacataCATGcacgcacacagaca (SEQ ID NO:23)Enhl65:Cttccttaacctctgtgaatatggtacccaagtgtggcatgataaacaggagaatctgcaaagtgtcagcaggtataagggtgacatttc ccctgccctttaagggccagtgggaatacactggcaaagctgcctttgcagtagctgcttcttacatatggcccagcgcatgcttccggc accagtgtctttgggagaggtgtgaaaaagatttctctctgagtccaggagagtgggctgttcgaatcctcctggagacaaaagaaaga attggttccagtgcctttttcaatcctaacagctttcagatgacacattgggagtcatttatacagccttgaatatacccaaaagtgttcctcg ccaagtcttcccacagtctacatgagccaatgcagatcactttattttaaaaggttacatgttatataaaacccacacaagtagctgcctta aatttttctctatccctgttgaacttctgtggggtttcctctatattttccatatttaactatagactaactaatttattgtcacccataaagcaatgt ttattttagtaacccaccttccaaaggtagcagccattggaagtcctgctcagc (SEQ ID NO:24)

[0040] Polynucleotides comprised by rAAVs of this disclosure can comprise additional elements that will be apparent to those skilled in the art, given the benefit of the present disclosure. The disclosure is demonstrated using rAAV9, but other serotypes may be adapted for use with the present disclosure. In examples, the rAAV9 serotype targets neuronal cells.

[0041] In examples, the disclosure includes neuronal cells that comprise a described polynucleotide, and / or a described rAAV. The cells may be present in a human individual.

[0042] Methods of making the described rAAVs are provided. In general, the method of making the rAAvs comprises culturing cells which comprise one or polynucleotides which may be present in one or more expression vectors encoding components of that rAAVs of this disclosure, allowing expression of the polynucleotides to produce the rAAVs, and separating the rAAVs from cells in the cell culture and / or from the cell culture media. The rAAVs can be purified to any desired degree of purity using conventional approaches.

[0043] rAAvs of the invention can be mixed with any pharmaceutically acceptable buffer, excipient, carrier and the like to form a pharmaceutical preparation. Suitable pharmaceutical compositions can be prepared by mixing rAAVs with a pharmaceutically- acceptable carrier, diluent or excipient, and suitable such components are well known in the art.

[0044] In general, a composition comprising a rAAV can be administered to any individual in need thereof. In embodiments, the individual has or is at risk for developing aneurological disorder including but not necessarily limited to F0XG1 syndrome, or any other disorder or condition as described herein wherein the F0XG1 gene is substituted with another coding sequence. In examples, the individual is a fetus who has been determined to be predisposed to developing F0XG1 syndrome, and thus a described composition may be administered in utero. In examples, the individual is a neonate, e.g., the individual receives a described composition immediately after birth or up to an age of approximately four weeks old. In examples, the individual is more than four weeks old but is less than 1 year old. In examples, the individual is 1-3 years old, or more than 3 years old but not more than 5 years old, or is more than 5 years old but is not more than 12 years old. In examples, the individual is more than 12 years old.

[0045] In examples, a described rAAV composition can be administered using any suitable approach, such as intracranial injection, central nervous system (CNS) injection, intravenous injection, and the like. In an example, the rAAV composition is administered by intracerebroventricular (icv) injection.

[0046] In examples, the disclosure includes administering a therapeutically effective amount of an rAAVs to an individual. “Therapeutically effective amount” as used herein means that amount of rAVV that is introduced into a sufficient number of neurons such FOXG1 is produced and reduces or eliminates one or more signs and / or symptoms of FOXG1 syndrome, which include but are not necessarily limited to otherwise unexplained irritability, seizures and / or spasms which may be considered epileptic seizures or spasms, developmental delays such as with motor skills, intellectual disabilities, cortical visual impairment, speech capability, microcephaly, corpus callosum agenesis, dentate gyrus development, autistic behavior, and any combination thereof.

[0047] In an example, the disclosure provides for DNA constructs that may be used to generate rAAVs or other suitable vectors, wherein the DNA constructs comprise one or more of the described enhancer and / or promoter elements, and restriction endonuclease cloning sites configured so that a therapeutic protein of interest can be introduced into the vector and expressed in desired brain region(s) by including desired coding sequence an alternative to the FOXG1 gene used in the examples of this disclosure.

[0048] The following Examples are intended to illustrate but not limit aspects of this disclosure.Example 1

[0049] Examples of this disclosure are provided on the accompanying figures, as follows.

[0050] FIG. 1 shows representative Adeno-associated virus (AAV)-FOXGl constructs encompassed by this disclosure. The neuron-specific AAV9-FOXG1 set comprises vectors designed to predominantly drive human FOXG1 (hFOXGl) expression in neurons, while minimizing expression in neural stem cells (NSCs) and glial cells. This was achieved using repressive element 1 (RE1), which is an element that inhibits gene transcription in neuronal stem cells (NSCs) and glia yet permits expression in neurons. The AAV9-pSYNl- FOXG1 vector, also referred to as pSYNl-FOXGl, utilizes the neuron-specific human Synapsinl promoter (pSYNl), which contains RE1. As shown in related figures, such as FIG. 15, the disclosure provides for directing the expression of human FOXG1 to FOXG1- positive areas of the brain. To achieve this, we identified the endogenous promoter of the human FOXG1 gene (referred to herein as discussed above as “pl 50”) as well as a series of enhancer elements of the FOXG1 gene (referred to herein with the prefix “En” or “Enh” as discussed above). We found that the combinatorial use of pl 50 and those endogenous enhancer elements (AAV9-En-pl50-FOXGl vector) recapitulates the endogenous expression pattern of FOXG1.

[0051] FIG. 2 shows results obtained from intracerebroventricular (icv) injection of pSYNl-FOXGl virus (A) into mouse brains at postnatal day 1 (Pl). This resulted in the expression of human FOXG1 in the brains at P30, as assessed by in situ hybridization (ISH) with human FOXG1 -specific ISH probe (B, white signals indicate human FOXG1 mRNAs). The results show that human FOXG1 is broadly expressed in the brain areas, including the cortex, hippocampus CAI -3, dentate gyrus, and striatum.

[0052] FIG. 3 shows that pSYNl-FOXGl virus rescued the reduction of layer 6 cortical projection neurons in brains of FOXG1 syndrome mouse model, W300X- heterozygous (W300X-Het) mice. (A) We performed immunohistochemistry (IHC) analysis with FOXP2 antibody to monitor the thickness of cortical neuronal layer 6. (B) Quantification. Treatment with pSYNl-FOXGl virus corrected the layer 6 thickness in W300X-Het mice to match the established wild-type (WT) control, normalized to 100%. WT (no virus, n=5), W300X-Het (no virus, n=5), and W300X-Het injected with pSYNl-FOXGl virus (n=5). Statistical analysis: **, p<0.01; ****, p<0.0001; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0053] FIG. 4: shows that pSYNl-FOXGl vims normalized aberrant increase of oligodendrocyte precursor cells (OPCs) in W300X-Het brains. (A) We performed IHC with OLIG2 antibody that detects OPCs. OPCs increased aberrantly in W300X-Het brains, indicating defects in the oligodendrocyte lineage. The treatment with the pSYNl-FOXGlvirus effectively restored the number of OPCs in W300X-Het brains to levels comparable to those in WT control brains. These results suggest that the pSYNl-FOXGl virus can rescue impairments in oligodendrocyte lineage cells, which is required for the process of myelination within the brain. (B) Quantification. The Y-axis shows the number of 0LIG2+ OPC in the defined cortical areas. WT (no virus, n=5), W300X-Het (no virus, n=5), and W300X-Het injected with pSYNl-FOXGl virus (n=5). Statistical analysis: ***, p<0.001; ****, pO.OOOl; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0054] FIG. 4 shows that pSYNl-FOXGl virus ameliorated myelination deficiency in W300X-Het brains. (A) We performed IHC with myelination basic protein (MBP) antibody to monitor myelination status in the brain. W300X-Het brains showed myelination reduction, as monitored by MBP-expressing areas and the microstructure of MBP+processes. The pSYNl-FOXGl virus partially restored myelination levels in W300X-Het brains. These results indicate that the pSYNl-FOXGl vims can ameliorate myelination deficiency in W300X-Het brains. (B) Quantification. The Y-axis indicates the percentage of myelinated cortical area, as determined by MBP-positive areas in the defined total cortex areas. W300X- Het (no virus, n=5), and W300X-Het injected with pSYNl-FOXGl virus (n=5). Statistical analysis: **, p<0.01; ****, pO.OOOl; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0055] FIG. 6 shows that icv injection of pSYNl-FOXGl virus led to an expression of human FOXG1 mRNA in the brains of FOXG1 syndrome mouse model, Q84Pfs- heterozygous (Q84Pfs-Het) mice. pSYNl-FOXGl virus was icv injected into Q84Pfs-Het brains at Pl. The brains were analyzed at P30, a month after the vims injection. We performed ISH with human FOXG1 -specific ISH probe. Human FOXG1 was broadly expressed in the brain, including the cortex, hippocampus CAI -3, dentate gyms, hypothalamus, and striatum.

[0056] FIG. 7 shows that pSYNl-FOXGl vims restored the overall FOXG1 protein levels and the cortex thickness in Q84Pfs-Het mice. (7A) We performed IHC with FOXG1 antibody that detects both mouse and human FOXG1 proteins. The pSYNl-FOXGl vims restored overall FOXG1 protein levels in Q84Pfs-Het mice, as monitored by FOXG1 IHC signal intensity (see images). Q84Pfs-Het mice display thinner cortex than WT control mice, recapitulating the microcephaly in human FOXG1 syndrome patients. The pSYNl-FOXGl vims restored the cortex thickness in Q84Pfs-Het mice, as measured by the cortex thickness (see the graph). Our data suggest that the pSYNl-FOXGl vims can rescue the microcephalyphenotype in the F0XG1 syndrome mouse model Q84Pfs-Het. (7B) Quantification of the cortex thickness. The Y-axis shows the thickness of the cortex. WT (no virus, n=4), Q84Pfs- Het (no virus, n=4), and Q84-Het injected with pSYNl-FOXGl vims (n=4). Statistical analysis: *, p<0.05; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0057] FIG. 8 shows that pSYNl-FOXGl vims normalized aberrant increase of OPCs in Q84Pfs-Het brains. (8A) We performed IHC with OLIG2 antibody that detects oligodendrocyte precursor cells (OPCs). OPCs increased aberrantly in Q84Pfs-Het brains, indicating defects in the oligodendrocyte lineage. The pSYNl-FOXGl vims effectively restored the number of OPCs in Q84Pfs-Het brains to levels comparable to those in WT control brains. These results suggest that the pSYNl-FOXGl vims is capable of correcting deficits in oligodendrocyte lineage cells, which are responsible for myelination in the brain. (8B) Quantification. The Y-axis shows the number of OLIG2+ OPC in the defined cortical areas. WT (no vims, n=4), Q84Pfs-Het (no vims, n=4), and Q84-Het injected with pSYNl- FOXGl vims (n=4). Statistical analysis: *, p<0.05; ***, p<0.001; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0058] FIG. 9 shows that pSYNl-FOXGl vims ameliorated myelination deficiency in Q84Pfs-Het brains. (9A) We performed IHC with MBP antibody to monitor myelination status in the brain. Q84Pfs-Het brains showed marked myelination reduction, as monitored by the MBP-expressing areas and the microstmcture of MBP1processes. The pSYNl-FOXGl vims partially restored myelination in Q84Pfs-Het brains. These results indicate that the pSYNl-FOXGl vims can ameliorate myelination deficiency in Q84Pfs-Het brains. (9B) Quantification. The Y -axis indicates the percentage of myelinated cortical area, as determined by MBP-positive areas in the defined total cortex areas. WT (no vims, n=4), Q84Pfs-Het (no vims, n=4), and Q84-Het injected with pSYNl-FOXGl vims (n=4).Statistical analysis: **, p<0.01; ***, p<0.001; ****, pO.OOOl, in ANOVA test. The error bars represent the standard deviation of the means.

[0059] FIG. 10 shows that icv injection of pREl-FOXGl vims (10A) led to an expression of human FOXG1 in the brains of FOXG1 syndrome mouse model W300X-Het, as determined by ISH with human FOXG1 -specific ISH probe (10B). Human FOXG1 is broadly expressed in the brain, including the cortex, hippocampus CAI -3, dentate gyms, and striatum.

[0060] FIG. 11 shows that pREl-FOXGl vims rectified the abnormal increase of cortical deep layer neurons in W300X-Het brains. (11 A) We performed IHC with a BCL1 IBantibody that marks the cortical deep layer neurons. W300X-Het cortices showed an aberrant increase of BCL11B+deep layer neurons. The pREl-FOXGl virus treatment normalized the number of deep layer neurons in W300X-Het cortices. These results suggest that the pREl- F0XG1 virus can restore cortical layer structures in W300X-Het brains. (1 IB) Quantification. The Y-axis indicates the # of BCL11B+deep-layer neurons in the defined cortical area. WT (no virus, n=5), W300X-Het (no virus, n=5), and W300X-Het injected with pREl-FOXGl virus (n=5). Statistical analysis: *, p<0.05; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0061] FIG. 12 shows that pREl-FOXGl virus normalized abnormal increase of OPCs and restored myelination in W300X-Het brains. (12A) We performed IHC with OLIG2 (OPC marker) and MBP (myelination marker) antibodies. W300X-Het brains showed aberrantly elevated OPCs and reduced myelination. The pREl-FOXGl virus normalized the number of OPCs and restored myelination in W300X-Het brains. Quantification is shown in panels (12B) and ( 12C) as follows. (12B) The Y-axis indicates the percentage of myelinated cortical area, as determined by MBP-positive areas in the defined total cortex areas. ( 12C) The Y -axis shows the number of OLIG2+ OPC in the defined cortical areas. WT (no vims, n=5), W300X-Het (no vims, n=5), and W300X-Het injected with pREl-FOXGl vims (n=5). Statistical analysis: *, p<0.05; ***, p<0.001; ****, pO.OOOl; ns, non-specific, in ANOVA test. The error bars represent the standard deviation of the means.

[0062] FIG. 13 testing of pREl and pSYNl viral treatments in W300X-Het mice (FOXG1 syndrome model) at P30. W300X-Het mice received intracisterna magna (icm) injections of pREl (A) or pSYN 1 (B) viruses at P30 (adolescent stage), followed by rescue analysis at P60 (adult stage). These experiments assess whether viral therapy remains effective beyond early postnatal stages. Both pREl and pSYNl viruses restored OPC populations and improved myelination. # OL1G2+ cells = number of OPC. MBP+ area = myelinated area in the cortex.

[0063] FIG. 14. The results show that AAV-FOXG1 injection at P30 suppresses microglial hyper-activation in W300X-HET mice (A,B) as well as hypo-activation in G216S- HET mice, another FOXG1 syndrome mouse model (C). W300X-Het (A,B) or G216S (C) mice received intracistema magna (icm) injections of pSYNl or pREl viruses at P30 (adolescent stage), followed by rescue analysis at P60 (adult stage).(A) IHC was performed with antibody against IBA1, which marks microglia. (B) Quantification of IB Al -positive cells in W300X-HET brains show increased microglia, which was normalized (rescued) by both pSYNl -FOXG1 and pREl-FOXGl viruses. The results shown are for the pSYNl - FOXG1 virus. The percentage of IBA1+ microglia was normalized to WT control levels. (C)Quantification of IB Al -positive cells in G216S-HET brains show reduced microglia, which was normalized (rescued) by both pSYNl-FOXGl and pREl-FOXGl viruses. The percentage of IBA1+ microglia was normalized to WT control levels. (C) Quantification of IBA1 -positive cells in G216S-HET brains show reduced microglia, which was normalized (rescued) by both pSYNl-FOXGl and pREl-FOXGl viruses. The percentage of IBA1+ microglia was normalized to WT control levels.

[0064] FIG. 15(A) shows a schematic representation of AAV9-En-pl50-FOXGI constructs. Results are shown in (B). The AAV9-FOXG1 construct was engineered by combining distal enhancer regions and a gene-proximal promoter from the human FOXG1 gene to drive its expression in specific brain regions. Enhancers and promoters were identified using a transcriptionally active chromatin database from neurons and glia in human and mouse brains. Enhancers were selected based on their region-specific transcriptional activity in the brain. We found that Enl50 is the promoter, hence named pl50. Each AAV9-En-pl50-FOXGl virus was delivered via intracerebroventricular (ICV) injection at Pl, and human FOXG1 expression was assessed using in situ hybridization (ISH) with a human FOXGI -specific probe. Representative images of nine AAV9-En-pl50-FOXGl constructs are shown in 15B, each directing FOXGI expression to distinct brain regions, as summarized in Table 4. These enhancer-promoter combinations provide critical tools for developing AAV9-based gene therapy vectors that achieve targeted gene expression in specific brain areas. The image for Enl53 is a sagittal section, while all other images depict half-coronal sections. The constructs used to produce the images are: En 1 3 = AAV9- Enl53-pl50-FOXGl; Enl54 = AAV9-EnI54-pI50-FOXGI; Enl55 = AAV9-Enl55-pl50- FOXG1; Enl57 = AAV9-Enl57-pl50-FOXGI; Enl59 = AAV9-Enl59-pl50-FOXGl;Enl60 = AAV9-Enl60-pl50-FOXGl; Enl63 = AAV9-Enl63-pl50-FOXGl; Enl64 = AAV9-EnI64-pI50-FOXGl; and Enl65 = AAV9-Enl65-pl50-FOXGl.Table 1: Summary of the phenotypic rescue by pSYNl and pREl viruses in P30 W300-Het mice following icv injection at Pl.# BCL11B+cells = number of cortical deep layer neuronsFOXP2+area = thickness of the cortical deep layer # OLIG2 cells = number of OPCMBP+area = myelinated area in the cortexTable 2: Summary of the phenotypic rescue by pSYNl and pREl viruses in P120 W300-Het mice, following injection at Pl. The injection of pSYNl-FOXGl and pREl-FOXGl at the perinatal stage led to an increased FOXG1 protein levels and a significant amelioration of FOXG1 syndrome-like phenotypes in W300X-Het mice, the FOXG1 syndrome mouse model.# BCL11B+cells = number of cortical deep layer neurons# OLIG2 cells = number of OPC MBP+area = myelinated area in the cortexFOXG1 full length exp (IHC) = expression level for full length FOXG1 protein in IHCTable 3: Summary of the results for P30 injection of the pSYNl-FOXGl and pREl-FOXGl virus, followed by rescue analysis in adult stages (P60). The injection of pSYNl-FOXGl and pREl-FOXGl at P30 led to an increased FOXG1 protein levels and a significant melioration of FOXG1 syndrome-like phenotypes in W300X-Het mice, the FOXG1 syndrome mouse model. # OLIG2+ cells = number of OPC. MBP+ area = myelinated area in the cortex. Activated microglia = number of IBA1+ activated microgliaTable 4: Summary of AAV9-En-pl50-FOXGl Injection Results: FOXG1 Endogenous Enhancer Activity Across Brain Regions.This summary details the specific brain regions where human FOXG1 is expressed following AAV9-En-pl50-FOXGl injection, with expression driven by distinct enhancers. Enhancer activity was assessed by detecting human FOXG1 expression in mouse brains using ISH.

[0065] While the disclosure has been particularly shown and described with reference to specific embodiments, it should be understood by those having skill in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present disclosure as disclosed herein.

Claims

What is claimed is:1 . A recombinant adeno-associated virus (rAAV) for use in prophylaxis or treatment for a disorder associated with a mutated FOXG1 gene, the rAAV comprising a polynucleotide encoding a human F0XG1 protein, and wherein the polynucleotide encoding the human F0XG1 protein is operably linked to a transcription promoting element, said transcription promoting element comprising: a) a Synapsinl (pSYNl) promoter; or b) a chicken beta-actin (CBA) promoter fused to two copies of a neuron-restrictive repressive element 1 (RE1); or c) an enhancer sequence and / or a pl 50 promoter.

2. The rAAV of claim 1, wherein the rAAV is a single stranded rAAV that is optionally rAAV9.

3. The rAAV of claim 1, comprising the pSYNl promoter.

4. The rAAV of claim 1 comprising the CBA promoter fused to the two copies of the RE I .5 The rAAV of claim 1, comprising the enhancer sequence and / or the pl 50 promoter, said pl 50 promoter comprising the sequence of SEQ ID NO: 8, and wherein said enhancer sequence is a sequence comprising the sequence of SEQ ID NO:7 or SEQ ID Nos: 9-24 or a combination thereof.

6. The rAAV of any one of claims 1-5, wherein the polynucleotide encoding the FOXG1 protein is a human codon optimized FOXG1 coding that comprises the sequence of SEQ ID NO: 1.

7. The rAAV of claim 6, wherein the polynucleotide encoding the human FOXG1 protein further comprises a combination of: i) a first AAV inverted terminal repeat which may be a mutated inverted terminal repeat (mITR); ii) an intron; iii) a polyadenylation sequence and / or transcription termination site; and iv) second AAV2 inverted terminal repeat.

8. A method for prophylaxis or treatment of a disorder associated with a mutated FOXG1 gene, the method comprising administering to an individual who has or is susceptible to developing the disorder a composition comprising rAAVs of claim 6.

9. The method of claim 8, wherein the mutated FOXG1 gene comprises a mutation that inactivates only a single copy of the FOXG1 gene in cells of the individual.

10. The method of claim 9, wherein the individual has or is susceptible to developing FOXG1 syndrome.1 1. The method of claim 10, wherein administration of the rAAVs promotes neuronspecific expression of the FOXG1 protein, and / or more expression of the FOXG1 protein in neurons, relative to expression of the FOXG1 protein in neural stem cells (NSCs), glial cells, or a combination thereof.

12. The method of claim 11, wherein administration of the rAAVs is performed postnatally.

13. The method of claim 12. wherein administration of the rAAVs results in normalizing development of the corpus callosum, dentate gyrus, or a combination thereof in the individual.

14. A polynucleotide comprising the sequence of SEQ ID NO: 1.

15. The polynucleotide of claim 14, wherein the polynucleotide is present in a recombinant adeno-associated virus.

16. A pharmaceutical formulation comprising isolated rAAVs of any one of claims 1-6.

17. An expression vector comprising the sequence of SEQ ID NO: 8.

18. The expression vector of claim 17, where the sequence of SEQ ID NO: 8 is operably linked to a nucleotide sequence encoding a protein.

19. A polynucleotide that is optionally an expression vector, said polynucleotide comprising SEQ ID NO:7 or SEQ ID Nos: 9-24 or a combination thereof.

Citation Information

Patent Citations

  • Gene replacement therapy for FOXG1 syndrome

    US20230151359A1

  • RNA encoding a therapeutic protein

    WO2017191274A2

  • Compositions and methods to treat neurological diseases

    WO2024031058A2