Combined pharmaceutical preparation of tafamidis or pharmaceutically acceptable salt thereof and proline hydroxylase inhibitor

Abstract

A combined pharmaceutical preparation of tafamidis or a pharmaceutically acceptable salt thereof and a proline hydroxylase inhibitor. The combined drug use of tafamidis and the proline hydroxylase inhibitor can activate the expression of an HIF-2α downstream target gene, thereby displaying a synergistic effect. In a cisplatin-induced renal anemia model, tafamidis can enhance the effect of the proline hydroxylase inhibitor in treating renal anemia.

Description

Pharmaceutical combination of sulzol and a prolyl hydroxylase inhibitor TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a pharmaceutical combination of sulzol and a prolyl hydroxylase inhibitor. BACKGROUND

[0002] HIF has a wide range of target genes, which can affect the body's hematopoietic function, angiogenesis, iron ion transport, glucose utilization, resistance to oxidative stress, cell differentiation, cell survival and apoptosis, extracellular matrix homeostasis, and tumor occurrence. HIF is a heterodimer composed of α and β subunits, the α subunit is a functional subunit, which is very sensitive to changes in intracellular oxygen concentration and is highly regulated, and has a role in regulating HIF activity; the β subunit is a structural subunit, also known as aryl hydrocarbon receptor nuclear transporter (ARNT), which is stably expressed in cells, and the mRNA transcription and protein expression level is not affected by changes in oxygen concentration. Both α and β subunits of HIF belong to the basic helix-loop-helix transcription factor superfamily. There are three subtypes of HIF-1α, HIF-2α and HIF-3α in humans. Among them, HIF-2α is distributed locally, and plays an important role in the process of EPO (erythropoietin) gene expression and synthesis in kidney tissue. In addition, it also increases the absorption of iron in the intestine by up-regulating the expression of cytochrome and divalent metal transporter-1 in the duodenum, and reduces the expression of hepatic bactericidal peptide, and plays a leading role in iron metabolism. Therefore, HIF-2α plays a certain role in the process of hypoxic response.

[0003] The HIF-2α subunit belongs to the Per-ARNT-Sim (PAS) subfamily of the basic helix-loop-helix (bHLH) family, mainly including the N-terminal bHLH (DNA Bonding Domain, DBD, DNA binding region), and two adjacent PASA and PASB domains (Ligand Bonding Domain, LBD, ligand binding region); the C-terminal binds to transcriptional co-factors to regulate the transcription of downstream genes. Studies have found that there is a cavity of about 30 A in the PASB domain of the HIF-2α subunit, which can affect the formation of heterodimerization of the HIF-2α subunit and the ARNT subunit after binding with the regulator, and then block or activate the binding of DNA and the transcription of target genes. The downstream target genes of HIF-2α, such as vascular endothelial cell growth factor (VEGF), erythropoietin (EPO), cyclin (Cyclin1), and glucose transporter (GLUT1), etc., are related to kidney disease, renal anemia, cardiovascular disease, infection, cancer, etc.

[0004] ​Impaired renal tissue in patients with kidney disease leads to EPO deficiency and iron homeostasis deficiency, which in turn causes renal anemia. Renal anemia not only severely reduces the quality of life of patients, but also is an important factor for the occurrence of cardiovascular disease and increased mortality. Recombinant human erythropoietin (rHuEPO) or erythropoiesis stimulating agents (ESAs) can treat renal anemia by increasing hemoglobin levels. However, higher hemoglobin targets in clinical trials are positively correlated with the risk of cardiovascular side effects. Currently, an emerging therapy for renal anemia is to stabilize HIF-2 protein by pharmacologically inhibiting prolyl hydroxylase PHD to stimulate the production of endogenous EPO in renal or non-renal tissues. However, the over-upregulated HIF-1α by PHD inhibitors promotes inflammatory pathways, accelerates heart and kidney injury, and in turn triggers increased risk of pulmonary arterial hypertension and inflammation, while HIF-2α activation has a protective effect. Therefore, HIF-2α selective agonists may have more therapeutic advantages.

[0005] The typical pathological change of kidney disease is kidney fibrosis. Kyoung HK et al. found that long-term activation of HIF-2α helps to inhibit kidney fibrosis and improve kidney function. Yu et al. found that in the early stage of giving PHD inhibitor L-mimosine, the selective activation of HIF-1α leads to increased expression of fibrosis factors CTGF and phosphorylated Smad, aggravating macrophage infiltration and fibrosis in kidney tissue; while in the middle and late stages, mainly activating HIF-2α, up-regulating EPO and VEGF expression, reducing kidney damage. Qu et al. confirmed that HIF-2α knockout leads to more severe kidney damage. In summary, in acute and chronic kidney injury, the over-activation of HIF-1α may exacerbate kidney damage, while HIF-2α plays a protective role.

[0006] Tafamidis (2-(3,5-dichlorophenyl)-1,3-benzoxazole-6-carboxylic acid) is a transthyretin stabilizer, which was first developed by Pfizer in the United States. Vyndamax and Vyndaqel are both capsules for oral administration and contain tafamidis as the active moiety. The U.S. Food and Drug Administration (FDA) has approved Vyndaqel and Tafamidis for the treatment of adult wild-type or genetic transthyretin-mediated amyloidosis cardiomyopathy to reduce cardiovascular mortality and cardiovascular-related hospitalization. EMA has approved Vyndaqel for the treatment of transthyretin amyloidosis in adult patients with stage I symptomatic polyneuropathy to delay peripheral nerve damage.

[0007] In 2001, it was found that proline hydroxylase (PHD) can use O2 and 2-OG as substrates to specifically hydroxylate HIFα proline residues, thereby regulating the biological activity of HIF. 2+ It starts when it is concentrated with 2-OG at the PHD active site. Then PHD binds to the HIFα proline residue and replaces the water molecule with O2 to complete the hydroxylation. 2+ When cells are in a hypoxic environment, PHD activity is inhibited due to the scarcity of O2. Undegraded HIF-1α and HIF-2α enter the cell nucleus and bind to HIF-β, acting on HRE and promoting the expression of related genes.

[0008] There are currently no studies investigating the combined use of tafamidis and proline hydroxylase inhibitors. Summary of the Invention

[0009] Based on the discovery of the present invention, tafamidis, as a HIF-2α agonist, promotes the formation of HIF-2α / HIF-β dimers, stabilizes the binding of HIF-2α and HIF-β, and exhibits increased HIF-2α transcriptional activity in cells, thereby promoting the expression of target genes such as EPO and VEGF, thereby achieving the effect of treating diseases related to HIF-2α activity. The present invention proposes a drug combination of tafamidis and its analogs or salts with a proline hydroxylase (PHD) inhibitor. Through the combined use of the present invention, it is found that the combination of the two (HIF-PHD) has a synergistic effect, can inhibit the degradation of HIF protein, and is used to treat HIF-2α-mediated diseases.

[0010] In one aspect, the present invention provides a pharmaceutical combination preparation comprising tamifluan or a pharmaceutically acceptable salt thereof and a proline hydroxylase inhibitor.

[0011] In some embodiments, the pharmaceutically acceptable salt of clofazodone is an acid addition salt or a base addition salt.

[0012] In some embodiments, the pharmaceutically acceptable salt of clofazoline is selected from at least one of the following structures:

[0013] In some embodiments, the proline hydroxylase inhibitors include one or more of roxadustat, dapoxetine, valdustat, enastat, and molistastat.

[0014] In some embodiments, the pharmaceutical combination preparation further comprises a pharmaceutically acceptable excipient.

[0015] In some embodiments, the pharmaceutical combination formulation has a dose ratio of 1-20:10, preferably 2:1, of oxazalamine to prolyl hydroxylase inhibitor. In some embodiments, the pharmaceutical combination formulation has a dose ratio of 1:10, 2:10, 3:10, 4:10, 5:10, 6:10, 7:10, 8:10, 9:10, 10:10, 11:10, 12:10, 13:10, 14:10, 15:10, 16:10, 17:10, 18:10, 19:10 or 20:10 of oxazalamine to prolyl hydroxylase inhibitor.

[0016] In some embodiments, the pharmaceutical combination formulation further comprises cisplatin.

[0017] In another aspect, the present application provides use of the pharmaceutical combination formulation in the preparation of a medicament for preventing, alleviating or treating a disease associated with HIF-2a activity.

[0018] In some embodiments, the disease associated with HIF-2a activity includes hematopoietic disorder, anemia, ischemic conditions associated with surgery and its sequelae after surgery, wound healing of surgery, chronic kidney disease, cardiovascular disease, infection, inflammatory disease, cancer and impairment of health status occurring during cancer therapy, acute and prolonged cerebral ischemic conditions and their sequelae.

[0019] In some embodiments, the disease associated with HIF-2a activity includes renal anemia, primary anemia, anemia associated with neoplastic disease, chemotherapy-induced anemia, anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, aplastic anemia and hypoplastic anemia, hemolytic anemia, anemia due to iron utilization disorder (iron deficiency anemia) or due to other endocrine disorders (e.g., hypothyroidism), ischemic conditions and their sequelae caused by cardiac intervention using a heart-lung machine (e.g., shunt surgery, heart valve implantation), carotid intervention, aortic intervention and intervention using instruments opening or penetrating the skull, primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial disorders (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, genetic nephropathy (polycystic kidney, hereditary nephritis), heart failure, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension and peripheral arterial occlusive disease, HIV infection, rheumatoid arthritis, diseases in the rheumatic spectrum and other forms of disease considered to be autoimmune diseases, impairment of health status occurring during drug therapy of such diseases (e.g., stroke, birth asphyxia).

[0020] In some embodiments, the disease associated with HIF-2a activity comprises anemia, ischemia, vascular disease, angina, myocardial infarction, metabolic disorder, or cancer.

[0021] In some embodiments, the disease associated with HIF-2a activity comprises renal anemia.

[0022] In some embodiments, the taloxamide or a pharmaceutically acceptable salt thereof, or the pharmaceutical combination preparation, prevents, alleviates, or treats the disease associated with HIF-2a activity by having an up-regulating effect on a downstream gene regulated by HIF-2a.

[0023] In some embodiments, the downstream gene regulated by HIF-2a comprises vascular endothelial growth factor, erythropoietin, cyclin, and / or glucose transporter.

[0024] In some embodiments, the prolyl hydroxylase inhibitor is roxadustat. Advantages:

[0025] Compared with the prior art, at least one of the following advantages is achieved by some embodiments of the present application:

[0026] The present application researches and finds that, in an in vitro experiment, taloxamide can effectively activate the transcription of HIF-2, the EC 50 is 1.11 μM, and the maximum excitation efficiency is 225%.

[0027] In Hep3B, roxadustat can increase the expression of the erythropoietin (EPO) gene, and when used in combination with the HIF-2a agonist taloxamide, taloxamide can significantly increase the expression of the EPO gene as the concentration increases.

[0028] The present application finds, through a luciferase reporter gene experiment, that taloxamide and a pharmaceutically acceptable salt thereof, as a HIF-2a agonist, promotes the formation of a HIF-2a / HIF-β dimer, enhances the binding of HIF-2a and HIF-β, and has a significant effect of enhancing the transcriptional activity of HIF-2a. This activation effect can have potential therapeutic value for treating ischemic diseases or anemia and the like.

[0029] It is determined through RT-qPCR that taloxamide has an up-regulating effect on a downstream EPO gene regulated by HIF-2a, and when used in combination with roxadustat, a synergistic effect is shown. This indicates that taloxamide and a prolyl hydroxylase drug can be used in combination to activate the expression of a downstream target gene of HIF-2a. This activation effect can have potential therapeutic value for treating ischemic diseases or anemia and the like.

[0030] The present application induces the rats to produce kidney anemia symptoms by using Cisplatin drug, 5mg / kg / day Roxadustat does not significantly increase the number of hemoglobin concentration (HGB) and red blood cell count (RBC) compared with the Cisplatin group when administered for four weeks, and when 10mg / kg / day of Chlorthiamphenicol is administered at the same time, HGB, RBC and HCT (hematocrit) are significantly increased. It shows that Chlorthiamphenicol further improves the symptoms of kidney anemia when used in combination with Roxadustat. In the Cisplatin-induced kidney anemia model, Chlorthiamphenicol can enhance the effect of proline hydroxylase inhibitor in treating kidney anemia, and has an unexpected synergistic effect.

[0031] The present application verifies through a series of experiments that the combination of Chlorthiamphenicol and Roxadustat can be used to synergistically prevent and / or treat diseases related to HIF-2α activity, especially kidney anemia.

[0032] Term Explanation

[0033] Certain embodiments of the present application are now described in detail by referring to the following illustrative figures. The present application is intended to cover all alternatives, modifications and equivalents thereof that are included within the scope of the present application as defined by the claims. One skilled in the art will readily recognize from the disclosure herein, that numerous other methods and materials similar or equivalent to those described herein can be used in the practice of the present application. The present application is in no way limited to the methods and materials described herein. In the event that one or more of the incorporated literature, patents, and similar materials differs from or contradicts with the present application, including but not limited to defined terms, term application, described techniques, etc., the present application controls.

[0034] It should be further recognized that certain of the described features of the present application can be interchanged, altered or substituted for one another, and / or combined in any suitable combination, in various embodiments of the present application. Conversely, various features of the present application, which are, for brevity, described in a single embodiment, can also be provided separately or in any suitable subcombination.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. All patents and publications identified are incorporated herein by reference in their entirety.

[0036] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0037] In the following disclosure, all numerical values ​​disclosed herein are approximate, regardless of whether the word "about" or "approximately" is used. The numerical value of each number may vary by 1%, 2%, 5%, 7%, 8%, 10%, 15%, or 20%. Whenever a number having a value of N is disclosed, any number having a value of N+ / -1%, N+ / -2%, N+ / -3%, N+ / -5%, N+ / -7%, N+ / -8%, N+ / -10%, N+ / -15%, or N+ / -20% is expressly disclosed, where "+ / -" means plus or minus.

[0038] Combination refers to a fixed combination in the form of a single dosage unit or a kit of parts for combined administration, wherein the compound disclosed herein and the combination partner can be administered independently at the same time or can be administered separately within a certain time interval, especially so that the combination partners show a cooperative, e.g., synergistic effect. As used herein, the terms "co-administration" or "combination administration" and the like are intended to encompass administration of the selected combination partners to a single individual (e.g., a patient) in need thereof, and are intended to include treatment regimens in which the substances are not necessarily administered by the same route of administration or at the same time.

[0039] As used herein, the term "pharmaceutical combination" refers to a product resulting from the mixing or combining of more than one active ingredient, and includes both fixed and non-fixed combinations of the active ingredients. The term "fixed combination" means that the active ingredient, such as a compound disclosed herein, and the combination partner are administered to a patient simultaneously as a single entity or dosage. The term "non-fixed combination" means that the active ingredient, such as a compound disclosed herein, and the combination partner are administered to a patient as separate entities simultaneously, concurrently, or sequentially without specific time limits, wherein the administration provides therapeutically effective levels of both compounds in the patient. The latter also applies to cocktail therapies, for example, administration of three or more active ingredients. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 is a graph showing the results of luciferase reporter gene assay in Example 1 of the present application. Figure A shows the agonistic activity of chlorozotocin on HIF-2 protein, and Figure B shows the agonistic activity of meglumine chlorozotocin (B) on HIF-2 protein. In the figure, Luciferase assay: luciferase assay; Efficacy: efficacy; concentration: concentration.

[0041] Figure 2 is a graph showing the results of real-time fluorescent quantitative PCR in Example 2 of the present application. The results show that in Example 2 of the present application, real-time fluorescent quantitative PCR was used to detect the upregulation of the transcription of HIF-2 downstream target gene EPO by chlorozotocin in combination with roxadustat. In the figure, relative mRNA level: relative mRNA level; Vehicle: vehicle.

[0042] Figure 3 is a graph showing the results of Example 3. Figure A is a statistical graph showing the effect of each group on the number of red blood cells in rats with renal anemia in a cisplatin-induced renal anemia model; Figure B is a statistical graph showing the effect of each group on the hemoglobin level in a cisplatin-induced renal anemia model; Figure C is a statistical graph showing the effect of each group on the hematocrit in a cisplatin-induced renal anemia model. In Figure D, the images of the kidney tissues of cisplatin-induced rats in each group show that, compared with the cisplatin group and the roxadustat single-drug use, the combination of chlorozotocin and roxadustat significantly increased renal blood flow. Days: days. DETAILED DESCRIPTION

[0043] To make the purpose, technical solutions and advantages of the present application clearer, further detailed description of the present application will be given below in combination with examples. The specific examples described herein are only used to explain the present application and do not constitute any limitation on the present application. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present disclosure. Such structures and technologies are also described in many publications.

[0044] The reagents used in the present application can be purchased from the market or can be prepared by the methods described in the present application.

[0045] Example 1: Luciferase assay

[0046] Principle: 786-O is a renal carcinoma cell line that primarily expresses HIF-2α and lacks functional HIF-1α. This property makes 786-O cells an ideal model for studying HIF-2α transcriptional activity and related signaling pathways. A luciferase reporter gene assay was performed using puromycin selection to generate a 786-O monoclonal cell line stably expressing the hypoxia response element (HRE) and luciferase (Luc) activity. HIF-2α agonists promote HIF-2α / HIF-β dimerization, activating the HRE promoter. Luciferase activity is measured by fluorescence intensity, thereby assessing the ability of HIF-2α agonists to promote transcription.

[0047] Experimental method: 6000 stably transfected 786-O cells containing HRE and Luc sequences were seeded in a 96-well plate, and 100 μL of RPMI-1640 medium containing 10% fetal bovine serum was added to each well. After 24 hours, the corresponding concentration of compound was added to each well. A blank group was set as a control, and only the solvent DMSO was added to the wells of the blank group. In the initial screening of the compound, clofentac and clofentac meglumine were tested at two concentrations of 2 μM and 20 μM. When the concentration gradient was determined, 3 replicates were performed for each concentration. After incubation for 24 hours, the culture medium was discarded, and 20 μL of firefly luciferase reporter gene cell lysate (RG126M, Beyotime) was added to each well. The 96-well plate was placed on a microplate fast shaker and shaken for 10 minutes. After the shaking, 10 μL of lysate was transferred to a white opaque plate, and then 10 μL of Steady-Lumi TM Firefly luciferase detection reagent (RG058S, Beyotime) was added and the cells were placed in a microplate reader (Agilent Synergy Neo2) to detect luminescence. 20 The effect of 20 μM compound was calculated as E 20 = Fluorescence value of 20 μM wells ÷ fluorescence value of blank group × 100%. E2 represents the effect of 2 μM compound and is calculated as E2 = fluorescence value of 2 μM wells ÷ fluorescence value of blank group × 100%. EC 50 The agonist efficiency of the compound was calculated by calculating the concentration required to achieve a 50% increase in fluorescence activity relative to the blank group (EC 50 ) and the maximum activation percentage (E max ) is determined by the maximal activation percentage (Emax) of an agonist. The maximum activation percentage (Emax) of an agonist is the ratio of the fluorescence value of the maximum effect (measured maximum response) elicited by an agonist concentration reaching receptor binding saturation in a specific receptor system to the fluorescence value of the receptor system in the absence of agonist, expressed as a percentage. In this experiment, tafamidis meglumine was directly replaced by Vyndaqel.

[0048] The detection results show that the agonistic efficiency of 20 μM talazoparib is 207%, and the agonistic efficiency of 2 μM talazoparib is 142%, indicating that the agonistic efficiency of talazoparib increases with the increase of concentration, showing obvious dose dependence. The measured EC 50 of talazoparib is 1.11 μM, and E max is 225% (Figure 1A), indicating that talazoparib has strong agonistic activity and good drug efficacy.

[0049] The agonistic efficiency of 20 μM meglumine talazoparib is 223%, and the agonistic efficiency of 2 μM meglumine talazoparib is 122%, indicating that the agonistic efficiency of meglumine talazoparib increases with the increase of concentration, showing obvious dose dependence. The measured EC 50 of meglumine talazoparib is 0.97 μM, and E max is 228% (Figure 1B), indicating that meglumine talazoparib also has strong agonistic activity and good drug efficacy.

[0050] It can be seen that talazoparib and its pharmaceutically acceptable salts as HIF-2α agonists promote the formation of HIF-2α / HIF-β dimer, can enhance the binding of HIF-2α and HIF-β, and further promote the transcription of HIF-2α downstream genes.

[0051] Example 2: Real-time fluorescence quantitative (qRT-PCR) experiment

[0052] Experimental method: Hepatoma cells HepG2 were inoculated on a 12-well plate. After 24 h, 10 μM roxadustat, 1 μM talazoparib, 5 μM talazoparib, 10 μM talazoparib and 20 μM talazoparib, and 10 μM roxadustat+1 μM talazoparib, 10 μM roxadustat+5 μM talazoparib, 10 μM roxadustat+10 μM talazoparib, 10 μM roxadustat+20 μM talazoparib were added, respectively, and the cells were incubated with the compounds for 24 h. The vehicle group was not operated. RNA extraction used TRIZOL reagent. cDNA transcription used All-in-one TM First-Strand cDNA Synthesis Kit kit (for details, see the instruction). SYBR reagent was used for signal calibration, and GAPDH was used as an internal reference. The qRT-PCR primers were:

[0053] GAPDH_fwd, GCACCGTCAAGGCTGAGAAC;

[0054] GAPDH_rev, TGGTGAAGACGCCAGTGGA;

[0055] EPO_fwd, AACAATCACTGCTGACACTT;

[0056] EPO_rev, AGAGTTGCTCTCTGGACAGT.

[0057] The detection results are shown in Figure 2: based on the matrix, when a single drug is used, 10 μM Roxadustat up-regulates erythropoietin (EPO) gene by 1.5 times, and 20 μM chlorozotocin up-regulates EPO gene by 1 time; different concentrations of chlorozotocin have up-regulating effect on EPO gene expression, indicating that chlorozotocin can effectively activate the expression of HIF-2α downstream target genes. When different concentrations of chlorozotocin are combined with 10 μM Roxadustat, 10 μM Roxadustat + 20 μM chlorozotocin up-regulates EPO gene by 4.7 times, showing a synergistic effect. It is shown that chlorozotocin and proline hydroxylase drugs can be used in combination to activate the expression of HIF-2α downstream target genes, and this activation effect may have potential therapeutic value for the treatment of ischemic diseases or anemia and the like. Statistical analysis was performed using SPSS software, *P<0.05, **P<0.01, ***P<0.001 compared with the no drug group, and # P<0.05, ## P<0.01, ### P<0.001.

[0058] Example 3: Cisplatin-induced renal anemia rat model

[0059] Male SD rats, after a week of adaptation period, were given 6 mg / kg of cisplatin by tail vein injection, and a second injection was given after one week. Two weeks later, the success of the kidney disease model was confirmed by measuring the serum creatinine and urea levels. The successfully modeled rats were randomly divided into three groups: cisplatin group (n=6), 5 mg / kg Roxadustat group (n=6), and 5 mg / kg Roxadustat + 10 mg / kg chlorozotocin group (n=6), and continuous administration for 4 weeks. The normal control group (n=7) and the cisplatin group rats were given the same drug administration regimen. After administration, blood analysis (using Mindray automatic blood analyzer BC-5150) was performed once a week. After sample collection, the rats were euthanized. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test comparison with the cisplatin group (*P<0.05, **P<0.01, ***P<0.001).

[0060] The fourth week of hematological analysis is shown in Table 1 as follows,

[0061] Results Analysis: Table 1 and Figures 3A-3C show that the combination of roxadustat and sulfilimine further enhances the activity of roxadustat.

[0062] Gross observation of kidney tissue (Figure 3D) shows that the kidneys of the normal control group appear healthy red, while the kidneys of the cisplatin group appear significantly yellow discoloration. In contrast, 3 rats in the 5 mg / kg roxadustat group had red kidneys, and 5 rats in the 5 mg / kg roxadustat + 10 mg / kg sulfilimine group had red kidneys. This indicates that sulfilimine further improves the symptoms of renal anemia when used in combination with roxadustat.

[0063] In terms of mechanism of action, roxadustat stabilizes HIF-2a protein by inhibiting the activity of proline hydroxylase. HIF-2a exerts transcriptional activity on downstream genes by forming a stable dimer with HIF-β. Example 1 shows that sulfilimine, as an HIF-2a agonist, promotes the formation of HIF-2a / HIF-β dimers, enhances the binding of HIF-2a and HIF-β, and thus promotes the transcription of HIF-2a genes. The combination of sulfilimine and proline hydroxylase drugs in this Example 2 enhances the transcription of the HIF-2a downstream EPO gene. The combination of sulfilimine and the proline hydroxylase drug roxadustat in this Example 3 further enhances the pharmacodynamic activity of roxadustat. This research is of great significance to patients who are only suitable for roxadustat.

[0064] The method of the present application has been described by preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein to realize and apply the present technology within the content, spirit and scope of the present application. Those skilled in the art can refer to the content herein to appropriately improve process parameters. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art, and they are considered to be included in the present application.

Claims

1. A pharmaceutical combination preparation comprising a compound of chlorozotocin or a pharmaceutically acceptable salt thereof and a prolyl hydroxylase inhibitor.

2. The pharmaceutical combination preparation according to claim 1, characterized in that The pharmaceutically acceptable salt of the compound of chlorozotocin is an acid addition salt or a base addition salt.

3. The pharmaceutical combination preparation according to claim 1, characterized by The pharmaceutically acceptable salt of the said halofenic acid is selected from at least one of the structures:

4. The pharmaceutical combination preparation according to claim 1, characterized by The prolyl hydroxylase inhibitor includes one or more of Roxadustat, Daprodustat, Vadadustat, Fedradustat, Molidustat.

5. The pharmaceutical combination preparation according to claim 1, characterized by The pharmaceutical combination preparation further comprises a pharmaceutically acceptable excipient.

6. The pharmaceutical combination preparation according to claim 1, characterized in that, The dose ratio of the compound of chlorozotocin to the prolyl hydroxylase inhibitor in the pharmaceutical combination preparation is 1 to 20:

10.

7. Use of the pharmaceutical combination preparation according to any one of claims 1 to 6 for the manufacture of a medicament for preventing, alleviating or treating a disease associated with HIF-2α activity.

8. Use according to claim 7, characterized in that, The disease associated with HIF-2α activity includes hematopoietic disorder, anemia, ischemic conditions associated with surgery and its sequelae after surgery, wound healing of surgery, chronic kidney disease, cardiovascular disease, infection, inflammatory disease, cancer and damage to health status occurring during cancer treatment, or sequelae of acute and prolonged cerebral ischemic conditions; or, the disease associated with HIF-2α activity includes renal anemia, primary anemia, anemia associated with neoplastic disease, chemotherapy-induced anemia, anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, aplastic anemia and pancytopenia, hemolytic anemia, anemia due to iron utilization disorder (iron deficiency anemia) or due to other endocrine disorders (e.g., hypothyroidism), ischemic conditions and its sequelae caused by cardiac intervention using a heart-lung machine (e.g., shunt surgery, heart valve transplantation), carotid artery intervention, aortic intervention and intervention using an instrument opening or penetrating the skull, primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial disorders (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, genetic nephropathy (polycystic kidney, hereditary nephritis), heart failure, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension and peripheral arterial occlusive disease, HIV infection, rheumatoid arthritis, diseases in the rheumatic spectrum and other forms of disease considered to be autoimmune diseases, damage to health status occurring during drug treatment of such diseases (e.g., stroke, birth asphyxia); or, the disease associated with HIF-2α activity includes anemia, ischemia, vascular disease, angina pectoris, myocardial infarction, metabolic disorder or cancer; or, the disease associated with HIF-2α activity includes renal anemia and / or nephropathy.

9. The use according to claim 7, wherein the pharmaceutical combination preparation according to any one of claims 1 to 6 prevents, alleviates or treats a disease associated with HIF-2α activity by having an up-regulating effect on a downstream gene regulated by HIF-2α.

10. The use according to claim 9, wherein the pharmaceutical combination preparation according to any one of claims 1 to 6 prevents, alleviates or treats a disease associated with HIF-2α activity by having an up-regulating effect on a downstream gene regulated by HIF-2α. ​ The downstream genes modulated by HIF-2a include vascular endothelial cell growth factor, erythropoietin, cyclins, and / or glucose transporters. The downstream genes modulated by HIF-2a include vascular endothelial cell growth factor, erythropoietin, cyclins, and / or glucose transporters.

Images