Use of tafamidis and pharmaceutically acceptable salt thereof in prevention, alleviation, or treatment of diseases associated with HIF-2α
By using clofentac and its salts to activate HIF-2α and regulate the expression of VEGF and EPO genes, the problem of insufficient selective activation of HIF-2α in the existing technology is solved, and effective treatment of HIF-2α-related diseases, especially improvement of renal anemia and kidney disease, is achieved.
Patent Information
- Application Number
- PCT/CN2025/089203
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-19
- Filing Date
- 2025-04-16
- Publication Date
- 2025-10-23
AI Technical Summary
When treating HIF-2α-related diseases, especially renal anemia and kidney disease, existing technologies have the risk of inflammation and heart damage caused by excessive activation of HIF-1α. The lack of drugs that selectively activate HIF-2α leads to poor treatment effects.
Clofentac and its pharmaceutically acceptable salts, such as clofentac meglumine, are used to activate HIF-2α and regulate the expression of downstream VEGF and EPO genes, thereby preventing and treating diseases related to HIF-2α activity. The drug can also be used in combination with prolyl hydroxylase inhibitors.
Clofentac significantly increases erythropoiesis, alleviates kidney damage, improves renal anemia, and reduces renal fibrosis, showing significant therapeutic potential for HIF-2α-related diseases and having good safety and efficacy when used in combination with existing drugs.
Smart Images

Figure CN2025089203_23102025_PF_FP_ABST
Abstract
Description
Use of clomazone and pharmaceutically acceptable salts thereof in preventing, alleviating or treating diseases related to HIF-2α TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to use of clomazone and pharmaceutically acceptable salts thereof in preventing, alleviating or treating diseases related to HIF-2α. BACKGROUND
[0002] In a low-oxygen environment, the body can spontaneously occur hypoxic response to maintain the body's oxygen acquisition ability. In 1992, Semenza et al. found that a protein can specifically bind to the hypoxic response element (HRE) of erythropoietin gene and affect the expression of certain genes, and the protein is called hypoxia-inducible factor (HIF) (Semenza GL et al., Mol. Cell Biol., 1992, 12, 5447-5454). The target genes of HIF are very extensive, which can affect the body's hematopoietic function, angiogenesis, iron ion transport, glucose utilization, resistance to oxidative stress, cell differentiation, cell survival and apoptosis, extracellular matrix homeostasis and tumor occurrence. HIF is a heterodimer composed of α and β subunits, the α subunit belongs to the functional subunit, which is very sensitive to the change of intracellular oxygen concentration and is highly regulated, and has the effect of regulating the activity of HIF; the β subunit is a structural subunit, also known as aryl hydrocarbon receptor nuclear transporter (ARNT), which is stably expressed in cells, and the mRNA transcription and protein expression level are not affected by the change of oxygen concentration. The α and β subunits of HIF belong to the members of the basic helix-loop-helix transcription factor superfamily. There are three subtypes of HIF-1α, HIF-2α and HIF-3α in humans. HIF-1α is widely distributed in the body and plays an important role in the process of angiogenesis triggered by local tissue ischemia or hypoxia, but has less effect on the process of iron metabolism; HIF-2α is distributed locally, which plays an important role in the process of EPO (erythropoietin) gene expression and synthesis in kidney tissue, in addition, it can improve the absorption of iron in the intestine by up-regulating the expression of cytochrome and divalent metal transporter-1 in the duodenum, and has the effect of reducing the expression of liver bactericidal peptide, and plays a leading role in the process of iron metabolism; the structure of HIF-3α is different from other subtypes, and it cannot affect the expression of genes. Studies have shown that HIF-3α may have a negative regulatory effect on the expression of HIF-mediated genes. Therefore, HIF-1α and HIF-2α play a certain role in the process of hypoxic response. In a HIF-1α and HIF-2α gene deletion mouse experiment, it is confirmed that HIF-1α and HIF-2α are necessary in the process of hypoxic response. In the development of compounds for treating chronic renal anemia, the change of HIF-2α is more important than that of HIF-1α.
[0003] Both HIF-2α subunits and ARNT subunits belong to the Per-ARNT-Sim (PAS) subfamily of the basic helix-loop-helix (bHLH) family. The two subunits have similar structures, mainly containing the N-terminal bHLH (DNA Bonding Domain, DBD, DNA binding region), and two adjacent PASA and PASB domains (Ligand Bonding Domain, LBD, ligand binding region); the C-terminus binds to transcriptional cofactors to regulate the transcription of downstream genes. Studies have found that there is an approximately The cavity in the HIF-2α subunit, upon binding to a regulator, can affect the heterodimerization of the HIF-2α subunit and the ARNT subunit, thereby blocking or activating DNA binding and target gene transcription. HIF-2α downstream target genes include vascular endothelial growth factor (VEGF), erythropoietin (EPO), cyclin 1, and glucose transporter 1 (GLUT1), which are associated with kidney disease, renal anemia, cardiovascular disease, infection, and cancer.
[0004] Renal damage in patients with kidney disease can lead to EPO deficiency and inadequate iron homeostasis, leading to renal anemia. Renal anemia not only severely impairs patients' quality of life but is also a significant contributor to the incidence of cardiovascular disease and mortality. Recombinant human erythropoietin (rHuEPO) or erythropoiesis-stimulating agents (ESAs) can treat renal anemia by increasing hemoglobin levels. However, higher hemoglobin targets in clinical trials have been positively correlated with the risk of cardiovascular side effects. An emerging therapy for renal anemia involves pharmacological inhibition of prolyl hydroxylases (PHDs) to stabilize HIF-2 protein, thereby stimulating endogenous EPO production in renal or non-renal tissues. However, excessive upregulation of HIF-1α by PHD inhibitors promotes inflammatory pathways, accelerating cardiac and renal damage, and leading to an increased risk of pulmonary hypertension and inflammation, whereas HIF-2α activation has a protective effect. Therefore, HIF-2α-selective agonists may offer therapeutic advantages.
[0005] The typical pathological change of kidney disease is kidney fibrosis. Kyoung HK et al. found that long-term activation of HIF-2α helps to inhibit kidney fibrosis and improve kidney function. Yu et al. found that in the early stage of giving PHD inhibitor L-mimosine, selective activation of HIF-1α leads to increased expression of fibrosis factors CTGF and phosphorylated Smad, aggravates macrophage infiltration and fibrosis of kidney tissue; while in the middle and late stages, mainly activating HIF-2α, up-regulating the expression of EPO and VEGF, reducing kidney damage. Qu et al. confirmed that HIF-2α knockout leads to more severe kidney damage. In summary, in acute and chronic kidney injury, over-activation of HIF-1α may exacerbate kidney damage, while HIF-2α plays a protective role.
[0006] Tafamidis (2-(3,5-dichlorophenyl)-1,3-benzoxazole-6-carboxylic acid) and Tafamidis Meglumine (2-(3,5-dichlorophenyl)-1,3-benzoxazole-6-carboxylic acid 1-deoxy-1-(methylamino)-D-glucitol salt, also known as: Tafamidis Glutamate) is a transthyretin stabilizer, which was first developed by Pfizer in the United States. Vyndamax and Vyndaqel are both capsules for oral administration and contain tafamidis as the active moiety. The U.S. Food and Drug Administration (FDA) has approved Vyndaqel and Vyndamax for the treatment of adult patients with wild-type or genetic transthyretin-mediated amyloidosis cardiomyopathy to reduce cardiovascular mortality and cardiovascular-related hospitalization. EMA has approved Vyndaqel for the treatment of transthyretin amyloidosis in adult patients with stage I symptomatic polyneuropathy to delay peripheral nerve damage.
[0007] Tafamidis has been used in clinical practice for many years, and its safety has been verified, so developing other indications for it can further benefit mankind. SUMMARY
[0008] The present application aims to provide the use of tafamidis and its analogues and salts thereof in preventing, alleviating or treating diseases related to HIF-2a, achieving "new use of old drugs", saving drug development and treatment costs, and having obvious economic benefits and clinical application value.
[0009] In one aspect, the present application provides the use of tafamidis or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising tafamidis or a pharmaceutically acceptable salt thereof, in the preparation of a medicament for preventing, alleviating or treating diseases related to the activity of HIF-2α.
[0010] In some embodiments, the pharmaceutically acceptable salt of taloxamide is an acid addition salt or a base addition salt.
[0011] In some embodiments, the pharmaceutically acceptable salt of taloxamide is selected from at least one of the following structures:
[0012] In some embodiments, the pharmaceutically acceptable salt of taloxamide is meglumine taloxamate.
[0013] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.
[0014] In some embodiments, the disease associated with HIF-2a activity includes hematopoietic disorders, anemia, ischemic conditions associated with surgery and its sequelae following surgical procedures, wound healing from surgical procedures, chronic kidney disease, cardiovascular disease, infection, inflammatory disease, cancer and damage to health status occurring during cancer therapy, or acute and prolonged cerebral ischemic conditions and their sequelae.
[0015] In some embodiments, the disease associated with HIF-2a activity includes anemia, ischemia, vascular disease, angina, myocardial infarction, metabolic disorders or cancer.
[0016] In some embodiments, the disease associated with HIF-2a activity includes anemia, ischemia, vascular disease, angina, myocardial infarction, metabolic disorders or cancer.
[0017] In some embodiments, the disease associated with HIF-2a activity comprises renal anemia and / or kidney disease.
[0018] In some embodiments, the chloroxuron or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising chloroxuron or a pharmaceutically acceptable salt thereof, prevents, alleviates or treats the disease associated with HIF-2a activity by up-regulating the downstream VEGF gene regulated by HIF-2a.
[0019] In some embodiments, the chloroxuron or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising chloroxuron or a pharmaceutically acceptable salt thereof, prevents, alleviates or treats the disease associated with HIF-2a activity by up-regulating the downstream EPO gene regulated by HIF-2a.
[0020] In another aspect, the present application provides a combination of chloroxuron or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising chloroxuron or a pharmaceutically acceptable salt thereof, and a prolyl hydroxylase inhibitor for use in the preparation of a medicament for preventing, alleviating or treating a disease associated with HIF-2a activity. Advantages:
[0021] Compared with the prior art, at least one of the following advantages is achieved in some embodiments of the present application:
[0022] (1) The present application determines that chloroxuron up-regulates the downstream VEGF and EPO genes regulated by HIF-2a by RT-qPCR. It shows that chloroxuron can effectively activate the expression of downstream target genes of HIF-2a, and this activation may have potential therapeutic value for treating ischemic diseases or anemia and other diseases.
[0023] (2) In the aristolochic acid-induced chronic kidney disease model of zebrafish, it is confirmed that chloroxuron has the effects of increasing erythropoiesis and relieving kidney damage. It shows that chloroxuron has a protective effect on the kidney and also has a significant effect on improving renal anemia.
[0024] (3) In the 5 / 6 nephrectomy rat model, chloroxuron increases the number of red blood cells in chronic kidney disease rats, showing potential value in treating renal anemia. At the same time, by comparing with roxadustat, it shows that chloroxuron achieves a good balance between the effects of promoting erythropoiesis and the safety of the kidney.
[0025] (4) In the cisplatin-induced kidney damage and renal anemia model, chloroxuron significantly increases the number of red blood cells, hemoglobin level and hematocrit of renal anemia rats, showing potential for treating renal anemia. Urine analysis and omics property analysis find that chloroxuron has the effects of repairing kidney damage and, importantly, relieving kidney fibrosis.
[0026] (5) On the model of kidney injury caused by unilateral ureteral obstruction, chloroxuron showed a strong effect of treating kidney injury and relieving ischemia.
[0027] (6) Through luciferase reporter gene experiments, it was found that chloroxuron and meglumine chloroxuron both had a significant effect of enhancing the transcriptional activity of HIF-2α. Therefore, chloroxuron and salts thereof can be used for preventing and / or treating diseases related to the activity of HIF-2α.
[0028] (7) The present application proves through in vitro experiments that chloroxuron enhances the transcriptional activity of HIF-2α, and further promotes the expression of downstream genes regulated by HIF-2α; and on the model of chronic kidney disease induced by aristolochic acid in zebrafish, the model of acute kidney injury caused by cisplatin and the model of renal anemia, and the model of unilateral ureteral obstruction, it is proved that chloroxuron has the effects of increasing erythropoiesis and relieving kidney injury. The present application verifies through a series of experiments that chloroxuron and salts thereof can be used for preventing and / or treating diseases related to the activity of HIF-2α, especially renal anemia or kidney disease.
[0029] Explanation of terms
[0030] Certain embodiments of the present application are now described in detail by way of examples with reference to the accompanying chemical formula. The present application intends to cover all alternatives, modifications and equivalents thereof falling within the scope of the present application as defined in the claims. Those skilled in the art will recognize that many methods and materials similar or equivalent to those described herein can be used in the practice of the present application. The present application in no way is limited to the methods and materials described herein. In the event of a discrepancy between one or more incorporated documents, patents and similar materials (including but not limited to defined terms, term application, described techniques, etc.) and the present application, the present application shall prevail.
[0031] It should be further recognized that certain of the features of the present application, described in detail herein in connection with individual embodiments, can be provided in combination with each other, while other features can be excluded from the combination. Conversely, various features of the present application, described in the context of a single embodiment, can also be provided separately or in any appropriate subcombination.
[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. All patents and publications referred to in this application are incorporated herein by reference in their entirety.
[0033] In the description of the specification, the description of the terms "one embodiment", "some embodiments", "an example", "a specific example", or "some examples" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, the person skilled in the art can combine and combine the different embodiments or examples described in the specification and the features of the different embodiments or examples without contradiction.
[0034] In the following, all the numbers disclosed herein are approximate, regardless of whether the word "about" or "approximately" or the like is used. The value of each number can differ by 1%, 2%, 5%, 7%, 8%, 10%, 15% or 20% or the like. Whenever a number having a value of N is disclosed, any number having a value of N + / - 1%, N + / - 2%, N + / - 3%, N + / - 5%, N + / - 7%, N + / - 8%, N + / - 10%, N + / - 15% or N + / - 20% is explicitly disclosed, wherein "+" or "-" means plus or minus. BRIEF DESCRIPTION OF DRAWINGS
[0035] Figure 1 is a luciferase reporter gene assay detection result graph of Example 1 of the present application. Figure A is the agonistic activity result graph of chlorzoxazone on HIF-2 protein, and Figure B is the agonistic activity of meglumine chlorzoxazone (B) on HIF-2 protein. In the figure, Luciferase assay: fluorescence detection. Efficacy: efficacy, concentration: concentration.
[0036] Figure 2 is a real-time fluorescent quantitative PCR detection result graph of Example 2 of the present application. The results show that in Example 2 of the present application, real-time fluorescent quantitative PCR detects the transcription of HIF-2 downstream target genes VEGF and EPO upregulated by chlorzoxazone. In the figure, relative mRNA level: relative mRNA level; Vehicle: vehicle.
[0037] Figure 3 is a detection result graph of Example 3 for improving the incidence of renal edema. In Example 3 of the present application, chlorzoxazone improves renal edema in a zebrafish model of aristolochic acid-induced kidney injury. In the figure, control: normal control group; model: model control group; aristolochic acid-induced model: aristolochic acid-induced model.
[0038] Figure 4 is a graph showing the results of detecting the reduction of glomerular filtration in Example 3. In Example 3 of the present application, on the aristolochic acid-induced kidney injury zebrafish model, the chloroxuron improved the glomerular filtration. In the figure, control: normal control group; model: model control group; aristolochic acid-induced model: aristolochic acid-induced model.
[0039] Figure 5 is a graph showing the results of detecting the improvement of renal anemia in Example 3. In Example 3 of the present application, on the aristolochic acid-induced kidney injury zebrafish model, the chloroxuron increased the heart red blood cell signal intensity. In the figure, control: normal control group; model: model control group; aristolochic acid-induced model: aristolochic acid-induced model.
[0040] Figure 6 is a graph showing the results of Example 4. In Example 4 of the present application, on the 5 / 6 nephrectomy rat model, the chloroxuron increased the number of red blood cells in rats with chronic kidney disease (A). Urine analysis showed that chloroxuron stabilized creatinine levels (B) and urine protein levels (C). In the figure, hematological analysis: blood analysis, urine analysis: urine analysis.
[0041] Figure 7 is a graph showing the results of blood analysis in Example 5. In Example 5 of the present application, on the cisplatin-induced kidney injury and renal anemia model, the chloroxuron significantly increased the number of red blood cells (A), hemoglobin levels (B), and hematocrit (C) in rats with renal anemia. Renal tissue images of cisplatin-induced rats showed (D) that chloroxuron significantly increased renal blood flow. In the figure, hematological analysis: blood analysis.
[0042] Figure 8 is a graph showing the results of urine analysis in Example 5. In Example 5 of the present application, on the cisplatin-induced kidney injury and renal anemia model, the results of urine analysis. Chloroxuron had less effect on UTP (A), significantly increased UCREA levels (B), and reduced the UTP / UCREA ratio (p<0.05) (Figure 8C), indicating that chloroxuron had a significant effect on improving kidney injury. In the figure, urine analysis: urine analysis.
[0043] Figure 9 is a graph showing kidney pathological changes in Example 5. In Example 5, the present application shows that clofenamic acid has a strong effect on treating kidney injury and alleviating renal anemia in a cisplatin-induced kidney injury and renal anemia model. Panel A, C, E represent kidney histological images, HE staining (A) (40x magnification), Masson's trichrome staining (C) (20x magnification), and PAS staining (E) (63x magnification), respectively. Panel B, D represent semi-quantitative analysis of tubular injury in HE-stained sections (B) and Masson's trichrome-stained sections (D). Panel F represents semi-quantitative analysis of glomerular sclerosis in PAS-stained sections. Panel G represents representative images of immunohistochemical staining of a-SMA protein expression (0.7x to 30x magnification). Panel H represents semi-quantitative analysis of a-SMA expression-positive areas. Panel I represents Western blot analysis of a-SMA protein and EPO protein expression. In the figure, semiquantification of tubular injury: semi-quantitative evaluation of tubular injury; semiquantification of glomerular scleosis: semi-quantitative evaluation of glomerular sclerosis; paller scores: Paller score; fibrosis area: fibrosis area; mesangial matrix area: mesangial matrix area.
[0044] Figure 10 is a graph showing the results of Example 6. In Example 6, the present application shows that clofenamic acid has a strong effect on treating kidney injury and alleviating ischemia in a unilateral ureteral obstruction-induced kidney injury model. Serum biochemical analysis shows the effect of clofenamic acid on CREA (A) and UREA (B). Panel C represents kidney tissue images showing (C) that clofenamic acid significantly improves kidney ischemia in a unilateral ureteral obstruction model. Panel D, F represent kidney histological images, HE staining (D) (40x magnification) and Masson's trichrome staining (F) (20x magnification), respectively. Panel E, G represent semi-quantitative analysis of tubular injury in HE-stained sections (E) and Masson's trichrome-stained sections (G). In the figure, semiquantification of tubular injury: semi-quantitative evaluation of tubular injury; paller scores: Paller score; serum CREA: serum creatinine; UREA: urea. DETAILED DESCRIPTION
[0045] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to examples. The specific examples described herein are only used to explain the present application and do not constitute any limitation on the present application. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present disclosure. Such structures and technologies are also described in many publications.
[0046] The reagents used in the present application can be purchased from the market or can be prepared by the methods described in the present application.
[0047] Example 1: Luciferase reporter gene experiment
[0048] Principle of experiment: 786-O is a renal cancer cell line, mainly expressing HIF-2a and lacking functional HIF-1a. This feature makes 786-O cells an ideal model for studying the transcriptional activity of HIF-2a and related signaling pathways. Luciferase reporter gene experiment obtains 786-O monoclonal cell lines stably expressing hypoxia response element (HRE) and luciferase (Luc) activity by puromycin screening. HIF-2a agonists promote the formation of HIF-2a / HIF-β dimers, activate the HRE promoter, and the activity of luciferase can be determined by detecting the intensity of fluorescence, thereby determining the ability of HIF-2a agonists to promote transcription.
[0049] Experimental method: 6000 stably transfected 786-O cells containing HRE and Luc sequences were seeded in a 96-well plate, and 100 μL of RPMI-1640 medium containing 10% fetal bovine serum was added to each well. After 24 h, the corresponding concentration of compound was added to each well. A blank group was set as a control, and only solvent DMSO was added to the wells of the blank group. In the initial screening of compounds, both cloxyquin and meglumine cloxyquin were tested at two concentrations of 2 μM and 20 μM. In the concentration gradient determination, each concentration was repeated three times. After 24 hours of incubation, the culture medium was discarded, 20 μL of firefly luciferase reporter gene cell lysis solution (RG126M, Beyotime) was added to each well, and the 96-well plate was placed on a microplate rapid shaker for 10 min. After shaking, 10 μL of lysis solution was transferred to a white non-transparent plate, then 10 μL of Steady-Lumi TM Firefly luciferase detection reagent (RG058S, Beyotime), and finally placed in an enzyme marker (Agilent Synergy Neo2) to detect the luminescence. 20 E represents the effect of 20 μM compound, calculated as 20= 20 μM well fluorescence value ÷ blank group fluorescence value x 100%. E2 represents the effect of 2 μM compound, calculated as E2 = 2 μM well fluorescence value ÷ blank group fluorescence value x 100%. EC 50 is the compound concentration that increases the relative blank group agonistic efficiency by 50%. The agonistic efficiency of the compound is determined by calculating the concentration (EC 50 ) required to achieve a 50% increase in fluorescence activity relative to the blank group fluorescence value and the maximum activation percentage (E max ). The maximum activation percentage (E max ) of an agonist refers to the ratio of the fluorescence value of the maximum effect (measured maximum response) induced by the agonist concentration reaching the saturation state of receptor binding to the fluorescence value of the receptor system without the addition of the agonist, expressed in percentage. In this experiment, meglumine chlorthalidone is directly replaced by Vyndaqel.
[0050] The test results show that the agonistic efficiency of 20 μM chlorthalidone is 207%, and the agonistic efficiency at 2 μM is 142%, indicating that the agonistic efficiency of chlorthalidone increases with the increase of concentration, showing obvious dose dependence. The measured EC 50 of chlorthalidone is 1.11 μM, and E max is 225% (Figure 1A), indicating that chlorthalidone has strong agonistic activity and good efficacy.
[0051] The agonistic efficiency of 20 μM meglumine chlorthalidone is 223%, and the agonistic efficiency at 2 μM is 122%, indicating that the agonistic efficiency of meglumine chlorthalidone increases with the increase of concentration, showing obvious dose dependence. The measured EC 50 of meglumine chlorthalidone is 0.97 μM, and E max is 228% (Figure 1B), indicating that meglumine chlorthalidone also has strong agonistic activity and good efficacy.
[0052] It can be seen that chlorthalidone and its pharmaceutically acceptable salts as HIF-2α agonists promote the formation of HIF-2α / HIF-β dimers, enhance the binding of HIF-2α and HIF-β, and exert the protective effect of HIF-2α.
[0053] Example 2: Real-time fluorescence quantitative (qRT-PCR) experiment
[0054] Experimental method: Renal cancer cells 786-O were inoculated into a 12-well plate. After 24 h, different concentrations of chlorthalidone (1 μM, 10 μM and 20 μM, respectively) were added, and the cells were incubated with the compound for 24 h. The vehicle group was not operated. RNA extraction used TRIZOL reagent. cDNA transcription used All-in-one TM First-Strand cDNA Synthesis Kit kit (for detailed operation steps, see the instructions). Use SYBR reagent for signal calibration, and GAPDH as an internal reference. The qRT-PCR primers are as follows:
[0055] GAPDH_fwd, GCACCGTCAAGGCTGAGAAC;
[0056] GAPDH_rev, TGGTGAAGACGCCAGTGGA;
[0057] VEGF_fwd, AGGGCAGAATCATCACGAAGT;
[0058] VEGF_rev, AGGGTCTCGATTGGATGGCA;
[0059] EPO_fwd, AACAATCACTGCTGACACTT;
[0060] EPO_rev, AGAGTTGCTCTCTGGACAGT.
[0061] The detection results are shown in Figure 2: 10 μM of chloroxuron up-regulated epidermal growth factor (VEGF) gene by 0.5 times, and 20 μM of chloroxuron up-regulated VEGF gene by 1.4 times (Figure 2). 20 μM of chloroxuron up-regulated erythropoietin (EPO) gene by 0.9 times (Figure 2). Different concentrations of chloroxuron had up-regulating effects on VEGF gene and EPO gene expression, indicating that chloroxuron could effectively activate the expression of HIF-2α downstream target genes, and this activation effect might have potential therapeutic value for treating ischemic diseases or anemia and the like. Statistical analysis was performed using GraphPad Prism software (version 8.0), and a two-tailed test was used, *P < 0.05, **P < 0.01, ***P < 0.001.
[0062] Example 3: Aristolochic acid-induced chronic kidney disease experiment in zebrafish
[0063] 3.1. Improving the incidence of nephrotic edema
[0064] Randomly selected 2dpf wild type AB strain zebrafish in 6-hole plate, each hole (experimental group) were treated with 30 zebrafish. Except for the normal control group, the rest of the experimental groups were given aqueous Aristolochic acid to establish zebrafish renal anemia model. After 18h treatment at 28℃, the normal control group and the model control group were set up at the same time, and each experimental group (20μM, 10μM and 1μM for testing, each concentration has 3 repeats) was given aqueous chlorendic acid sample, and the normal control group and the model control group were given water respectively, and the volume of each hole was 3mL. After 30h continuous treatment at 28℃, each experimental group was placed under a dissecting microscope for observation, and the number of zebrafish renal edema was counted, and the incidence of renal edema in each experimental group was calculated (%).
[0065] 3.2. Reduce glomerular filtration
[0066] Randomly selected 2dpf wild type AB strain zebrafish in 6-hole plate, each hole (experimental group) were treated with 30 zebrafish. Except for the normal control group, the rest of the experimental groups were given aqueous Aristolochic acid to establish zebrafish renal anemia model. After 18h treatment at 28℃, the normal control group and the model control group were set up at the same time, and each experimental group was given aqueous chlorendic acid sample (concentration was 0.1μM and 1μM respectively), and the normal control group and the model control group were given water respectively, and the volume of each hole was 3mL. After 4h continuous treatment at 28℃, each experimental group was intravenously injected with fluorescent marker (Dextran tetramethylrhodamine), and after 1 day of continuous treatment at 28℃, 10 zebrafish were randomly selected from each experimental group and placed under a fluorescence microscope for photography. The NIS-Elements D 3.20 advanced image processing software was used to analyze and collect data, and the whole body fluorescence intensity of zebrafish was analyzed. The statistical analysis results of this index were used to evaluate the efficacy of the sample on the repair of kidney damage. The statistical processing results were expressed as mean±SE. Statistical analysis was performed using SPSS 26.0 software, and p<0.05 indicated that the difference was statistically significant.
[0067] 3.3. Efficacy evaluation of improving renal anemia (heart red blood cell staining intensity)
[0068] Randomly selected 2 dpf wild type AB strain zebrafish in 6-well plates, each hole (experimental group) was treated with 30 zebrafish. Except for the normal control group, the rest of the experimental groups were given aqueous aristolochic acid to establish a zebrafish renal anemia model. After 18h of treatment at 28℃, the normal control group and the model control group were set up at the same time, and the experimental groups were given aqueous chloro-oxazole acid samples (concentration of 0.1 μM and 1 μM) respectively, and the normal control group and the model control group were given water, and the volume of each hole was 3 mL. After continuing to treat at 28℃ for 30h, the zebrafish were stained with o-phenylamine, and 10 zebrafish were randomly selected from each experimental group and placed under a dissecting microscope for photography. The data were collected using NIS-Elements D 3.20 advanced image processing software, and the intensity of the heart red blood cell staining of zebrafish was analyzed. The statistical significance of the index was used to evaluate the efficacy of the sample in improving renal anemia. SPSS 26.0 software was used for statistical analysis, and p<0.05 indicated that the difference was statistically significant.
[0069] Results analysis:
[0070] (1) The incidence of renal edema in the aristolochic acid-induced zebrafish model group was 100%, and the incidence of renal edema in the 1 μM chloro-oxazole acid experimental group was 80% (Figure 3), indicating that chloro-oxazole acid had a protective effect on the kidney.
[0071] (2) The glomerular filtration rate of normal zebrafish was 100%, the glomerular filtration rate of the aristolochic acid-induced zebrafish model group was 239%, and the glomerular filtration rate of the 1 μM chloro-oxazole acid experimental group was 158%, indicating that chloro-oxazole acid had the function of improving glomerular filtration (Figure 4).
[0072] (3) The heart red blood cell count of normal zebrafish group was 100%, the heart red blood cell count of aristolochic acid-induced zebrafish model group was 46%, the heart red blood cell count of 0.1 μM chloro-oxazole acid experimental group was 60%, and the heart red blood cell count of 1 μM chloro-oxazole acid experimental group was 65%, indicating that chloro-oxazole acid had a significant effect on improving renal anemia (Figure 5).
[0073] On the aristolochic acid-induced zebrafish chronic kidney disease model, it was confirmed that chloro-oxazole acid had the effects of increasing red blood cell production and relieving kidney damage.
[0074] Example 4: 5 / 6 nephrectomy (5 / 6 Nx) rat model
[0075] Male Sprague-Dawley (SD) rats were used to establish a model of anemia induced by kidney injury through 5 / 6 nephrectomy surgery to study the erythropoietic effect of clomazone acid. After a one-week adaptation period, rats were anesthetized with isoflurane and the left kidney was exposed through a midline abdominal incision. Ligation threads were placed in the upper and lower thirds of the kidney and the corresponding kidney tissue outside the ligation threads was removed. After a one-week recovery period, the right kidney was removed. Eight of the rats were assigned to the nephrectomy group and another eight served as a non-surgical normal control group. At the fourth week, kidney dysfunction in the surgical rats was confirmed by evaluating serum urea and creatinine levels. Clomazone acid and Roxadustat were dissolved in a vehicle consisting of 10% dimethyl sulfoxide (DMSO), 30% polyethylene glycol 400 (PEG 400), 5% Tween-80, 1% hydrochloric acid (113.3 mM), 9% 0.1 N sodium hydroxide, and 45% saline. The nephrectomized rats were randomly divided into 5 / 6 Nx, clomazone acid treatment, and roxadustat treatment groups (8 rats each), ensuring comparable baseline body weights in each group. Starting at the sixth week, the clomazone acid treatment and roxadustat groups were orally administered 10 mg / kg (10 mg per 1 kg of rat body weight per day) of the respective compound daily for four weeks, while the sham and 5 / 6 nephrectomy model (5 / 6 Nx) rats were given the vehicle according to the same dosing regimen. Hematology analysis was performed weekly, and urine samples were collected the day after the last treatment for determination of urinary total protein (UTP) and urinary creatinine (UCREA). Hematology analysis (using a Sysmex Europe XN-2000 automated blood analyzer) and urine analysis (using a Cobas C501 automated blood analyzer) were performed according to the manufacturer's instructions using commercially available kits. After sample collection, the animals were euthanized. Statistical significance was determined by one-way ANOVA followed by Dunnett's test for comparison with the 5 / 6 Nx group (*P < 0.05, **P < 0.01, ***P < 0.001).
[0076] Results analysis:
[0077] (1) Hematology analysis showed that the 10 mg / kg clomazone acid treatment group had a significant increase in red blood cell (RBCs) count at week 4 compared to the 5 / 6 Nx group (7.7 ± 0.3 x 1012 cells / L vs. 8.2 ± 0.3 x 1012 cells / L, p < 0.05, Figure 6, panel A). Comparative analysis with the HIF-PHD inhibitor roxadustat showed a significant difference in the safety profile between the two. 10 mg / kg roxadustat showed a clear polycythemia at day 14, with RBCs levels exceeding the physiological range of the healthy control group, suggesting that excessive erythropoiesis can pose a risk of thromboembolism. 12 cells / L, p < 0.05, Figure 6, panel A). Comparative analysis with the HIF-PHD inhibitor roxadustat showed a significant difference in the safety profile between the two. 10 mg / kg roxadustat showed a clear polycythemia at day 14, with RBCs levels exceeding the physiological range of the healthy control group, suggesting that excessive erythropoiesis can pose a risk of thromboembolism.
[0078] (2) Renal function assessment further highlighted the therapeutic advantage of clofenamic acid: Urinalysis showed that UTP excretion levels remained at baseline in the clofenamic acid-treated group, while they significantly increased in the roxadustat-treated group (3.3-fold increase compared to the 5 / 6 Nx group, p < 0.01, Figure 6, panels B and C), suggesting that roxadustat can cause renal damage, while the clofenamic acid-treated group had no effect on UCREA and a non-significant increase in the mean value of UTP. These results suggest that clofenamic acid has significant activity in erythropoiesis, although it does not show significant renal repair activity, but shows better safety compared to roxadustat.
[0079] Example 5: Rat model of cisplatin-induced renal injury and anemia
[0080] 5.1 Animal model establishment, dosing and sampling
[0081] Male SD rats, after a week of adaptation, were administered a single tail vein injection of 6 mg / kg of cisplatin, and a second injection was given one week later. Two weeks later, the establishment of the model of renal disease was confirmed by measuring serum creatinine and urea levels. The established rat model was randomly divided into four groups: control group (n = 7), cisplatin group (n = 6), roxadustat group (n = 6) and clofenamic acid group (n = 6). The roxadustat and clofenamic acid groups were orally administered 10 mg / kg of the corresponding compound (roxadustat or clofenamic acid) daily for four consecutive weeks. The control and cisplatin groups of rat models were administered the solvent according to the same dosing regimen. Urine samples were collected the day after the last treatment to measure UTP and UCREA. Blood analysis (using Mindray automatic blood analyzer BC-5150) and urine analysis (using Mindray automatic biochemical analyzer BS-2000M) were measured according to the manufacturer's instructions using commercially available kits. After sample collection, the rats were euthanized. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test for comparison with the cisplatin group (*P < 0.05, **P < 0.01, ***P < 0.001).
[0082] 5.2 Renal pathology and immunohistochemistry studies
[0083] The left kidney samples obtained from cisplatin-induced rats were fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned. The tissue sections were 4 μιη thick and then subjected to histological staining with hematoxylin-eosin (H&E), periodic acid-Schiff (PAS) and Masson's trichrome. After staining, the sections were scanned using advanced three-dimensional histological imaging technology and high-resolution images were captured using the Pannoramic DESK / MIDI / 250 / 1000 system. To assess tubular damage, 10 fields per sample were randomly selected at xlOo magnification and the degree of tubular damage was assessed using a semi-quantitative scoring system (Pallar score): 0 (no damage), 1 (<25% damage), 2 (25-50% damage), 3 (50-75% damage) and 4 (>75% damage). In addition, the entire tissue section was evaluated at x0.7 magnification to determine the degree of collagen fiber deposition shown by Masson's trichrome staining. The area of collagen fibers was semi-quantitatively analyzed using Image-Pro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA). For glomerular evaluation, 20 glomeruli per rat were randomly selected and analyzed at xlOo magnification, using mesangial matrix expansion shown by PAS staining as an indicator. The mesangial matrix was also semi-quantitatively analyzed using Image-Pro Plus 6.0 software. Statistical significance was determined by one-way ANOVA followed by Dunnett's test for comparison with the cisplatin group (*P < 0.05, **P < 0.01, ***P < 0.001).
[0084] Immunofluorescence staining was performed on 4 pm-thick kidney tissue sections. Sections were deparaffinized, rehydrated with ethanol, and then subjected to microwave treatment in 0.01 mol / L sodium citrate buffer (pH 6.0) for antigen retrieval. Next, the sections were incubated with primary a-SMA (19245S, Cell Signaling Technology) antibody overnight at 4 °C. After incubation, the sections were incubated with HRP-labeled secondary antibody (PK10009, Proteintech Group) for 30 min at room temperature, and localization was performed using a DAB kit. After staining, the sections were scanned using advanced three-dimensional histology imaging technology, and high-resolution images were obtained by Pannoramic DESK / MIDI / 250 / 1000 system. The entire tissue section was evaluated at a magnification of x0.7 to determine the positive area of a-SMA expression. The area of a-SMA expression was semi-quantitatively analyzed using Image-Pro Plus 6.0 software. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test comparison with the cisplatin group (*P < 0.05, **P < 0.01, ***P < 0.001).
[0085] 5.3 Western blot analysis
[0086] Kidney tissues were lysed in RIPA buffer containing protease inhibitors. Protein extracts were electrophoresed in 10% SDS-PAGE gels and then transferred to PVDF membranes. The membranes were blocked in 5% skim milk for 1 h and then incubated with primary antibodies overnight at 4 °C. The primary antibodies included a-SMA (19245S, Cell Signaling Technology), EPO (ab226956, Abeam), and NADPH (5174S, Cell Signaling Technology). Next, the membranes were incubated with the corresponding secondary antibodies (ab6721, Abeam). After washing, images were detected using a GE AI600. Signal intensity was quantified and normalized to NADPH as an internal reference.
[0087] Results analysis: (1) Hematology analysis at the fourth week showed that chloroxolnic acid significantly improved erythropoiesis-related parameters compared with the cisplatin group, as shown in Table 1 below:
[0088] Gross observation of kidney tissues showed that the kidneys of the normal control group appeared healthy red, while the kidneys of the cisplatin group appeared significantly white discoloration and edema. In contrast, the kidneys of the Rox group appeared purplish red, while the kidneys of the CBA group appeared normal red, indicating improved kidney health (Figure 7, panel D). In summary, CBA showed a significant effect in treating renal anemia.
[0089] (2) Urinalysis showed that Rox increased UTP levels (p < 0.05) (Figure 8, panel A), indicating potential kidney toxicity; while CBA increased UCREA levels (p < 0.05) (Figure 8, panel B), while decreasing the UTP / UCREA ratio (p < 0.05) (Figure 8, panel C); indicating that CBA has a significant effect in treating kidney damage.
[0090] (3) Prolonged cisplatin induced severe kidney pathological changes, including glomerular mesangial expansion, interstitial fibrosis, and inflammatory cell infiltration, as confirmed by Periodic acid-Schiff (PAS), Masson's trichrome, and hematoxylin-eosin (H&E) staining (Figure 9, panels A, C, E). Semi-quantitative scoring confirmed that CBA significantly attenuated cisplatin-induced kidney injury (Figure 9, panels B, D, F). Compared to Rox, CBA treatment significantly reduced inflammatory infiltration, tubular vacuolar degeneration, and kidney fibrosis.
[0091] (4) Immunohistochemistry results showed (Figure 9, panels G, H) that CBA significantly reduced the level of a-smooth muscle actin (a-SMA) protein. Western blot analysis showed that CBA significantly reduced a-SMA protein expression, while increasing erythropoietin (EPO) protein levels (Figure 9, panel I).
[0092] These results confirmed that CBA demonstrated a potent effect in attenuating cisplatin-induced kidney injury and renal anemia in reducing kidney damage and alleviating renal anemia.
[0093] Example 6: Renal injury and anemia mouse model induced by unilateral ureteral obstruction (UUO)
[0094] 6.1 Establishment of animal model, dosing, and sampling
[0095] Animal model establishment Male Balb / c mice were anesthetized with isoflurane and fixed on the operating table with medical adhesive tape. The skin was prepared for incision in the middle of the abdomen, and the surgical site skin was disinfected with 75% alcohol-iodine-alcohol. Then, the incision was fixed with an open abdominal fixator along the mouse abdominal white line opening. The left ureter was isolated with a sterile cotton swab and a small curved forceps, and was ligated with a 3-0 line near the upper pole of the bladder. After dropping a drop of normal saline in the abdominal cavity, the abdomen was sutured, and after recovery on the heating pad, it was put back into the cage. Then, normal diet, drinking water were given and observed, and the model construction was completed. The sham operation group (Sham group) was the same as the model group except for not being ligated. The experimental groups of UUO model of male Balb / c mice, after one week of adaptation period, were given oral gavage for three consecutive days with clofazimic acid (clofazimic acid experimental group) or roxadustat (roxadustat experimental group). The first clofazimic acid experimental group was given at a dose of 5 mg / kg / day, the second clofazimic acid experimental group was given at a dose of 10 mg / kg / day, and the roxadustat experimental group was given at a dose of 10 mg / kg / day. The drug administration was continued for seven days after the unilateral ureteral obstruction surgery. The sham operation group and the UUO control group of mice were given solvent according to the same drug administration scheme. Serum analysis was performed after the last treatment. Serum analysis (automatic blood analyzer, Mindray, BS-2000M) was performed using a commercially available kit according to the manufacturer's instructions. After sample collection, the rats were euthanized. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test for comparison with the UUO control group (*P < 0.05, **P < 0.01, ***P < 0.001).
[0096] 6.2 Kidney pathological study
[0097] The left kidney samples of mice were fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned. The thickness of the tissue sections was 4 pm, followed by histochemical staining such as H&E and Masson's trichrome staining. After staining, the sections were scanned using advanced three-dimensional histological imaging technology, and high-resolution images were captured using the Pannoramic DESK / MIDI / 250 / 1000 system. By analyzing H&E staining, the tubular injury was evaluated, and 10 fields of view were randomly selected under x40 magnification for each sample for examination, and the degree of tubular injury was evaluated using a semi-quantitative scoring system (Pallar score): 0 (no injury), 1 (<25% injury), 2 (25-50% injury), 3 (50-75% injury), and 4 (>75% injury). In addition, the entire tissue section was evaluated under x0.7 magnification to determine the degree of collagen fiber deposition shown by Masson's trichrome staining. The semi-quantitative analysis of collagen fiber area was performed using Image-Pro Plus 6.0 software. Statistical significance was determined by one-way ANOVA, followed by Dunnett's test for comparison with the UUO control group (*P < 0.05, **P < 0.01, ***P < 0.001).
[0098] The relevant results are described in Table 2 below.
[0099] Results analysis: Serum biochemical analysis showed that the creatinine of the UUO group was significantly higher than that of the normal rats, while the creatinine level of the drug administration group did not change significantly compared with the UUO group. Comprehensive urea level analysis, compared with the urea (6.26 ± 0.14 mmol / L) level of the UUO control group, the urea levels of the 10 mg / kg Roxadustat experimental group (5.36 ± 0.10 mmol / L, P < 0.01) and the 10 mg / kg second chlorzoxazone experimental group (5.28 ± 0.29 mmol / L, P < 0.05) were significantly lower, indicating that Roxadustat and chlorzoxazone both have kidney protection effects (Fig. 10, A, B).
[0100] Gross observation showed that the first chlorzoxazone experimental group (5 mg / kg of chlorzoxazone) significantly improved the pallor of the obstructed kidney (Fig. 10, C), suggesting its potential in improving renal ischemia associated with ureteral obstruction.
[0101] Histopathological evaluation by H&E staining and Pallar scoring system (Fig. 10, panel D, E) showed that different doses of tarenflurbil significantly reduced tubular injury and decreased pathological scores in the first tarenflurbil experimental group (5 mg / kg of tarenflurbil) (2.85 ± 0.83, P < 0.05) and the second tarenflurbil experimental group (10 mg / kg of tarenflurbil) (2.93 ± 0.35, P < 0.05) compared to the UUO control group (4.56 ± 0.19). However, the 10 mg / kg of Roxadustat experimental group (4.78 ± 0.09, P = 0.98) still had severe inflammatory infiltration and tubular injury.
[0102] Masson's trichrome staining analysis (Fig. 10, panel F, G) showed that interstitial fibrosis was significantly reduced in the first tarenflurbil experimental group (5 mg / kg of tarenflurbil) (17.2 ± 2.3%, P < 0.05) and the second tarenflurbil experimental group (10 mg / kg of tarenflurbil) (17.2 ± 2.6%, P < 0.05) compared to the UUO control group (26.0 ± 1.9%). However, the 10 mg / kg of Roxadustat experimental group (21.8 ± 1.6%, P = 0.37) did not show a reduction in fibrosis.
[0103] These results confirm that tarenflurbil has a significant therapeutic effect on kidney damage and ischemia caused by ureteral obstruction.
[0104] Table 2
[0105] The methods of the present application have been described by preferred embodiments, and those skilled in the art can obviously make changes or appropriate changes and combinations to the methods and applications described herein within the content, spirit and scope of the present application to realize and apply the present technology. Those skilled in the art can refer to the content herein to make appropriate improvements to process parameters. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application.
Claims
1. Use of tolfenamic acid or a pharmaceutically acceptable salt thereof or a pharmaceutical composition comprising tolfenamic acid or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for preventing, alleviating or treating a disease associated with HIF-2α activity.
2. Use according to claim 1, characterized in that, The pharmaceutically acceptable salt of the tolfenamic acid is an acid addition salt or a base addition salt.
3. Use according to claim 1, characterized in that, The pharmaceutically acceptable salt of the said halofenic acid is selected from at least one of the following structures:
4. Use according to claim 1, characterized in that, The pharmaceutically acceptable salt of the said oxaceprol is 5. Use according to any one of claims 1 to 4, characterized in that, The pharmaceutical composition further comprises a pharmaceutically acceptable excipient.
6. Use according to any one of claims 1 to 5, characterized in that, The disease associated with HIF-2α activity includes hematopoietic disorder, anemia, ischemic state associated with surgery and its consecutive symptoms after surgery, wound healing of surgery, chronic kidney disease, cardiovascular disease, infection, inflammatory disease, cancer and impairment of health state occurring during cancer treatment, or consecutive symptoms of acute and prolonged cerebral ischemic state.
7. Use according to any one of claims 1 to 5, characterized in that, The disease associated with HIF-2α activity includes renal anemia, primary anemia, anemia accompanying neoplastic disease, chemotherapy-induced anemia, anemia due to blood loss, iron deficiency anemia, vitamin deficiency anemia, aplastic anemia, hemolytic anemia, anemia due to iron utilization disorder (iron deficiency anemia) or due to other endocrine disorder (e.g., hypothyroidism), ischemic state and its consecutive symptoms caused by cardiac intervention using a heart-lung machine (e.g., shunt surgery, heart valve transplantation), carotid intervention, aortic intervention and intervention using an instrument opening or penetrating the skull, primary glomerulonephritis, hypertensive renal arteriosclerosis, diabetic nephropathy, secondary glomerulonephritis, tubulointerstitial lesion (chronic pyelonephritis, chronic uric acid nephropathy, obstructive nephropathy, drug-induced nephropathy, etc.), ischemic nephropathy, genetic nephropathy (polycystic kidney, hereditary nephritis), cardiac insufficiency, coronary heart disease, angina pectoris, myocardial infarction, stroke, arteriosclerosis, primary, pulmonary and malignant hypertension and peripheral arterial occlusive disease, HIV infection, rheumatoid arthritis, or diseases in the range of rheumatic forms or other forms of diseases considered as autoimmune diseases after treatment with cytostatic agents, antibiotics and radiation therapy, impairment of health state occurring during drug treatment of such diseases (e.g., stroke, birth asphyxia); or, the disease associated with HIF-2α activity includes anemia, ischemia or ischemic disease, vascular disease, angina pectoris, myocardial infarction, metabolic disorder or cancer; or, the disease associated with HIF-2α activity includes renal anemia and / or nephropathy.
8. Use according to any one of claims 1 to 7, characterized in that, The tolfenamic acid or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising tolfenamic acid or a pharmaceutically acceptable salt thereof, prevents, alleviates or treats a disease associated with HIF-2α activity by having an up-regulating effect on a downstream VEGF gene regulated by HIF-2α.
9. Use according to any one of claims 1 to 7, characterized in that, The tolfenamic acid or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising tolfenamic acid or a pharmaceutically acceptable salt thereof, prevents, alleviates or treats a disease associated with HIF-2α activity by having an up-regulating effect on a downstream EPO gene regulated by HIF-2α.
Citation Information
Patent Citations
Personalized starvation therapy for cancer
WO2023108146A1
Pharmaceutical composition and use thereof
WO2023217239A1