Repression of cargo expression

The use of miRNA target sites and enzyme-mediated integration in genetic cargo ensures precise protein expression in desired cells, addressing non-specific delivery and integration risks in immune cell engineering, thereby enhancing safety and efficacy.

WO2025219365A1PCT designated stage Publication Date: 2025-10-23BIONTECH SE
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/060325
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-15
Filing Date
2025-04-15
Publication Date
2025-10-23

AI Technical Summary

Technical Problem

Existing in vivo immune cell engineering methods face challenges with non-specific delivery of genetic cargo to desired immune effector cells, leading to risks such as antigen-negative relapse and insertional mutagenesis in non-target cells, particularly in B cell malignancies and hematopoietic stem cells.

Method used

Incorporation of a miRNA target site in the genetic cargo that is recognized by a miRNA specifically expressed in the target cell but not in non-target cells, ensuring precise expression of proteins only in desired cells, combined with enzyme-mediated integration into the genome.

Benefits of technology

Minimizes the risk of non-specific expression and integration in non-target cells, enhancing the safety and efficacy of in vivo immune cell engineering by ensuring targeted protein expression and reducing the likelihood of malignancies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000035_0000
    Figure 00000035_0000
  • Figure 00000036_0000
    Figure 00000036_0000
Patent Text Reader

Abstract

The present application relates to an isolated nucleic acid comprising (i) an open reading frame encoding a protein that is not to be expressed in a specific cell but to be expressed in a cell differing from the specific cell and (ii) a miRNA target site, wherein the miRNA target site is recognized by a miRNA that is expressed in the specific cell but substantially not expressed in the cell differing from the specific cell. The present application further relates to a particle comprising the afore-mentioned isolated nucleic acid as well as a pharmaceutical composition comprising the afore-mentioned particle. The present application is also concerned with a method of expressing a protein in a cell substantially not expressing a miRNA but not expressing the protein in a cell expressing said miRNA, either in vitro or in vivo in a subject, the use of the afore-mentioned nucleic acid, particle and pharmaceutical composition to express a protein in a cell-specific manner; with a method of treating a B cell cancer, an immune cell and a kit related to the afore-mentioned aspects.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] REPRESSION OF CARGO EXPRESSION

[0002] TECHNICAL FIELD

[0003] The present application is in the field of immune cell engineering. It is concerned with an isolated nucleic acid comprising (i) an open reading frame encoding a protein that is not to be expressed in a specific cell but to be expressed in a cell differing from the specific cell and (ii) a miRNA target site, wherein the miRNA target site is recognized by a miRNA that is expressed in the specific cell but substantially not expressed in the cell differing from the specific cell. The present application is further concerned with a particle comprising the afore-mentioned isolated nucleic acid as well as a pharmaceutical composition comprising the afore-mentioned particle. The present application is also concerned with a method of expressing a protein in a cell substantially not expressing a miRNA but not expressing the protein in a cell expressing said miRNA, either in vitro or in vivo in a subject, and with the use of the afore-mentioned nucleic acid, particle and pharmaceutical composition to express a protein in a cell-specific manner. Finally, the present application is concerned with a method of treating a B cell cancer, an immune cell and a kit related to the afore-mentioned aspects.

[0004] BACKGROUND OF THE INVENTION

[0005] Ex vivo manufacturing of genetically engineered immune effector cells, in particular T cells, followed by adoptive cell transfer is an approach providing benefits to patients, in particular patients suffering from cancer. However, this individualized therapy is complex, expensive and limited because of the requirements in infrastructure. A paradigm-shifting solution consists in the engineering of the genetically engineered immune effector cells, in particular T cells, inside the patients using an off the shelf product, which is commonly referred to as “in vivo immune cell engineering”.

[0006] In vivo immune cell engineering inter alia comprises the step of injecting into the patients particles, such as lipid nanoparticles (LNPs) or viral derived particles (such as e.g. viral like particles, lentiviral vectors or adenoviral associated viral particles) that contain genetic cargo (typically DNA and / or RNA) capable of reprograming the desired immune effector cells.

[0007] In order to avoid the uptake of such particles by cells different from the desired immune effector cells, a binding moiety specifically targeting the desired immune effector cells is typically added to the particle surface such that the particles bind to and deliver the genetic cargo ideally only to the desired immune effector cells. However, with the binding moieties used today, the binding and delivery is not 100% specific for the desired immune effector cells. In other words, particles comprising a binding moiety are not entirely capable of specifically delivering their genetic cargo to the desired immune effector cells. Thus, although the targeting moiety helps shifting the delivery of the genetic cargo to the desired immune effector cells, other cells (such as e.g. neutrophils, muscle cells, endothelial cells or liver cells) can pick up the particles, although less efficiently. After injection, such targeted particles can also be taken up passively by cells differing from the desired immune effector cells by mechanisms such as APOE-mediated internalization, phagocytosis, clathrin- dependent and independent endocytosis or caveolin-dependent endocytosis.

[0008] Therefore, the injection of particles is associated with an inherently high risk of delivering the genetic cargo to non-desired cells, i.e. cells other than those targeted by the binding moiety on the surface of the particles.

[0009] More specifically, in the case of patients with B cell malignancies, the genetic cargo delivered by the particles is likely to be a chimeric antigen receptor (CAR) that recognizes a marker at the surface of the tumor B cells. Although the CAR is intended to be expressed by immune effector cells, in particular ? cells, the non-specific uptake of the genetic cargo by a malignant B cell can lead to the target of the CAR being sequestrated inside the tumor cells. As a result, the desired engineered CAR T cells can no longer recognize the target as it is no longer expressed at the surface of the malignant B cells. This is likely to result in a so called antigen-negative relapse, where the malignant B cells are no longer recognized by the genetically modified immune effector cells. Such a scenario can be considered as one of the highest risks of engineering immune effector cells in vivo.

[0010] Another high risk is associated with the delivery of genetic cargo to stem cells, especially hematopoietic stem cells (HSCs). The modification of stem cells using vectors with random integration profiles, such as transposons, lentiviral, and retroviral vectors, carries significant risks due to their random integration into the host genome. These risks include insertional mutagenesis, which can lead to disruption of gene function and activation of oncogenes, potentially resulting in malignancies. Stem cells are particularly vulnerable to these dangers due to their high proliferative capacity and self-renewal properties. These characteristics mean that any genetic modifications, especially those causing insertional mutagenesis or oncogene activation, can be propagated extensively, leading to a higher likelihood of malignancies and other severe consequences over time.

[0011] One such example is the occurrence of leukemia in patients treated with retrovirally modified HSCs in gene therapy trials for X-linked severe combined immunodeficiency (SCID-X1). The leukemia was linked to the insertional activation of the LMO2 proto-oncogene by the retroviral vector. Another example is the development of myelodysplasia and acute myeloid leukemia (AML) in patients who received retrovirally modified HSCs for chronic granulomatous disease (CGD). These conditions were associated with the insertional activation of the MDS1-EVI1 gene by the retroviral vector.

[0012] The above-mentioned high risk results in safety-concerns of the above-mentioned off the shelf product. There is therefore a need for at least minimizing, at best abolishing the risk and the associated safety-concerns. The risk also applies to some extent to the ex vivo manufacturing of genetically engineered immune cells because it cannot be excluded that the cells that are genetically engineered outside the human body have been prepared such that exclusively the cell type to be engineered is present but also other cell types that should not be engineered.

[0013] SUMMARY OF THE INVENTION

[0014] The present invention solves the above need in that it includes a safety measure into the genetic cargo, which safety measure makes sure that the genetic cargo is not expressed in non-desired cells.

[0015] In a first aspect, the present invention is directed to an isolated nucleic acid comprising (i) an open reading frame encoding a protein that is not to be expressed in a specific cell but to be expressed in a cell differing from the specific cell and (ii) a miRNA target site, wherein the miRNA target site is recognized by a miRNA that is expressed in the specific cell but substantially not expressed in the cell differing from the specific cell.

[0016] In one embodiment of the first aspect, the miRNA target site is recognized by a miRNA that is expressed in the specific cell but not expressed in the cell differing from the specific cell.

[0017] In one embodiment of the first aspect, the miRNA target site is located 5’ or 3’ of the open reading frame, wherein the miRNA target site is preferably located 3’ of the open reading frame.

[0018] In one embodiment of the first aspect, the open reading frame is operably linked to a promoter, optionally in combination with an enhancer, or a functional fragment thereof. Any promoter, optionally in combination with an enhancer, or functional fragment thereof, that is known in the field can be used, such as e.g. a CMV promoter.

[0019] In one embodiment of the first aspect, the isolated nucleic acid is a DNA or an RNA.

[0020] In one embodiment of the first aspect, the isolated nucleic acid is chemically modified.

[0021] In one embodiment of the first aspect, the isolated nucleic acid is selected from the group consisting of a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome including a retrotransposon (a DNA retrotransposon or an RNA retrotransposon) and a transposon (preferably a DNA transposon), a NHEJ and HDR template, , a virus-derived nucleic acid, a plasmid (preferably a DNA plasmid) including a minimalized plasmid (preferably a DNA minimalized plasmid), an episomal vector (preferably a SMAR based vector), and RNA (including RNA template for reverse transcription). The minimalized plasmid may in particular be a nanoplasmid or a minicircle, preferably a DNA nanoplasmid or a DNA minicircle. In one embodiment of the first aspect, the isolated nucleic acid is a DNA plasmid, preferably a minimalized DNA plasmid, more preferably a DNA nanoplasmid or a DNA minicircle, or an mRNA.

[0022] In one embodiment of the first aspect, the protein is an enzyme that catalyzes a reaction involving a nucleic acid, preferably DNA, wherein this enzyme can be selected from the group consisting of a retrotransposase, a transposase, a recombinase, a CRISPR associated nuclease (such as e.g.

[0023] Cas9 or Cas12), a Zinc-finger (ZF) associated nuclease, a transcription activator-like effector nuclease (TALEN), a meganuclease, an integrase (such as e.g. a viral integrase) and a reverse transcriptase. The enzyme that catalyzes a reaction involving a nucleic acid may be an enzyme that mediates the integration of DNA into the genome of a cell. The enzyme mediating the integration of DNA into the genome of a cell can be selected from the group consisting of a recombinase, a viral integrase, a transposase and a retrotransposase, preferably a transposase and a retrotransposase. In this embodiment, it can be preferred that the isolated nucleic acid is an mRNA.

[0024] In one embodiment of the first aspect, the protein is capable of reprogramming an immune effector cell, preferably a T cell. The protein capable of reprogramming an immune effector cell may in particular be a chimeric antigen receptor (CAR) or a T cell receptor (TCR), preferably a CAR. It can be particularly preferred that the CAR recognizes CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19. In this embodiment, it can be preferred that the isolated nucleic acid is a DNA. It can further be preferred in this embodiment that the DNA is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome.

[0025] In one embodiment of the first aspect, the isolated nucleic acid comprises more than one miRNA target site. It can be preferred in this embodiment that the isolated nucleic acid comprises two, three, four, five, six or seven miRNA target sites, more preferably two to four miRNA target sites.

[0026] In one embodiment of the first aspect, the isolated nucleic acid comprises more than one identical miRNA target site. It can be preferred in this embodiment that the isolated nucleic acid comprises two, three, four, five, six or seven identical miRNA target sites, more preferably two to four identical miRNA target sites.

[0027] In one embodiment of the first aspect, the isolated nucleic acid comprises at least two different miRNA target sites, wherein each of the different miRNA target sites may be present more than once. It can be preferred in this embodiment that the isolated nucleic acid comprises two, three, four or five different miRNA target sites. It can further be preferred that the isolated nucleic acid comprises two different miRNA target sites, wherein each miRNA target site is present twice such that overall four miRNA target sites are present. It can further be preferred that the isolated nucleic acid comprises two different miRNA target sites, wherein each miRNA target site is present four times such that overall eight miRNA target sites are present, e.g. all located 3’ of the open reading frame. It can further be preferred that the isolated nucleic acid comprises three different miRNA target sites, wherein each miRNA target site is present four times such that overall twelve miRNA target sites are present, e.g. four located 5’ of the open reading frame and eight located 3’ of the open reading frame or eight located 5’ of the open reading frame and four located 3’ of the open reading frame.

[0028] If more than one miRNA target site is present, all miRNA target sites may be located 3’ or 5’ of the open reading frame. It can be preferred that at least one miRNA target site is located 5’ of the open reading frame and at least one miRNA target site is located 3’ of the open reading frame.

[0029] In one embodiment of the first aspect, the isolated nucleic acid comprises more than one open reading frame, wherein at least one open reading frame encodes a protein that is not to be expressed in a specific cell but to be expressed in a cell differing from the specific cell. It can be preferred in this embodiment that the isolated nucleic acid comprising two, three, four or five open reading frames, more preferably two or three open reading frames, most preferably two open reading frames. If more than one open reading frame is present, the open reading frames may be linked by a linking sequence, in particular a linking sequence encoding a self-cleaving peptide.

[0030] In one embodiment of the first aspect, the open reading frame encodes more than one protein that is not to be expressed in a specific cell but to be expressed in a cell differing from the specific cell. It can be preferred in this embodiment that the open reading frame encodes two, three, four or five open proteins, more preferably two or three proteins, most preferably two open proteins. If more than one protein is encoded, the sequences may be linked by a linking sequence, in particular a linking sequence encoding a self-cleaving peptide.

[0031] In one embodiment of the first aspect, the miRNA target site is recognized by a miRNA that is expressed in a B cell, preferably a cancer B cell, but substantially not expressed in a T cell. In this embodiment, there may be at least a second miRNA target site, wherein the second miRNA target is recognized by a miRNA that is expressed in a stem cell, preferably a HSC, but substantially not expressed in a T cell. In other words, in one embodiment of the first aspect, there are at least two different miRNA target site, wherein a miRNA target site is recognized by a miRNA that is expressed in a B cell, preferably a cancer B cell, but substantially not expressed in a T cell, and a miRNA target site is recognized by a miRNA that is expressed in a stem cell, preferably a HSC, but substantially not expressed in a T cell.

[0032] In one embodiment of the first aspect, the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa- mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16- 5p and hsa-mir-17-5p.

[0033] In one embodiment of the first aspect, the specific cell is a cancer B cell. In this embodiment, it can be preferred that the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143- 3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16- 5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21- 5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p.

[0034] In one embodiment of the first aspect, the specific cell is a cancer B cell expressing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing. In this embodiment, it can be preferred that the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143- 3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16- 5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21- 5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p. It can also be preferred in this embodiment that the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing, and that the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome.

[0035] In one embodiment of the first aspect, the miRNA target site is recognized by a miRNA that is expressed in a stem cell, preferably a HSC, but substantially not expressed in a T cell.

[0036] In one embodiment of the first aspect, the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa-mir-126-3p, hsa-mir-302a-3p, hsa-mir-302b-3p, hsa-mir-302c-3p, hsa-mir-302d-3p, and hsa-mir367-3p, preferably selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa-mir-126-3p.

[0037] In one embodiment of the first aspect, the specific cell is a stem cell, preferably a HSC. In this embodiment, it can be preferred that the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa-mir-126-3p, hsa-mir-302a-3p, hsa- mir-302b-3p, hsa-mir-302c-3p, hsa-mir-302d-3p, and hsa-mir367-3p, preferably selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa-mir-126-3p.

[0038] In one embodiment of the first aspect, the specific cell is HSC. In this embodiment, it can be preferred that the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa-mir-126-3p. It can also be preferred in this embodiment that the isolated nucleic acid is an mRNA comprising an open reading frame encoding a protein, which is an enzyme mediating the integration of DNA into the genome of a cell selected from the group consisting of a recombinase, a viral integrase, a transposase and a retrotransposase.

[0039] In one embodiment of the first aspect, the cell differing from the specific cell is an immune cell driving an immune reaction against the specific cell.

[0040] In a second aspect, the present invention is directed to a particle comprising the isolated nucleic acid according to the first aspect, including all embodiments of the first aspect.

[0041] In one embodiment of the second aspect, the particle is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, a retroviral vector, a herpes simplex viral vector, a baculoviral vector, an Epstein-Barr viral vector, a poxvirus vector, a virosome, and a lipid nanoparticle (LNP).

[0042] In one embodiment of the second aspect, the particle comprises more than one isolated nucleic acid, wherein at least one isolated nucleic acid is an isolated nucleic acid according to the first aspect. It can be preferred in this embodiment that the particle comprises two, three or four isolated nucleic acids, wherein two nucleic acids can be particularly preferred.

[0043] Embodiments relating a particle comprising at least two isolated nucleic acids, wherein one nucleic acid is a nucleic acid of the first aspect comprising an open reading frame encoding an enzyme that mediates the integration of DNA into the genome of a cell

[0044] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. In this embodiment, the enzyme mediating the integration of DNA into the genome of a cell, preferably the transposase or the recombinase, is not expressed in a cell expressing a miRNA that recognizes the miRNA target site comprised in the isolated nucleic acid. Accordingly, because the enzyme mediating the integration of DNA into the genome of a cell, preferably the transposase or the recombinase, is not expressed in the cell, the above-mentioned second isolated nucleic acid is not integrated into the genome of the cell. This in turn means that, because the above-mentioned second isolated nucleic acid is not integrated into the genome of the cell, the protein capable of reprogramming an immune effector cell is not expressed in the cell. It can be preferred in this embodiment that the particle is an LNP.

[0045] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0046] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a- 5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a- 5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25- 3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR- 144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the second isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0047] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a- 5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a- 5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25- 3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR- 144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the second isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0048] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122- 5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir- 146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir- 181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa- mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa- miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the second isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0049] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA expressed in a stem cell, preferably a HSC, but substantially not expressed in a T cell, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0050] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa-mir-126-3p, hsa-mir-302a-3p, hsa-mir-302b-3p, hsa-mir-302c-3p, hsa-mir-302d-3p, and hsa- mir367-3p, preferably selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa- mir-126-3p, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the second isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0051] Embodiments relating a particle comprising at least two isolated nucleic acids, wherein one nucleic acid is a nucleic acid of the first aspect comprising an open reading frame encoding a protein capable of reprogramming an immune effector cell

[0052] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, and wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the enzyme mediating the integration of DNA into the genome of a cell, preferably the transposase or the recombinase, is expressed in the cell and mediates the integration of the above-mentioned isolated nucleic acid according to the first aspect into the genome of the cell. However, because the mRNA transcribed from the integrated nucleic acid according to the first aspect comprises a miRNA target site, the protein capable of reprogramming an immune effector cell is not expressed in a cell expressing a miRNA that recognizes the miRNA target site on the mRNA transcribed from the integrated nucleic acid according to the first aspect. It can be preferred in this embodiment that the particle is an LNP.

[0053] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, and wherein the second isolated nucleic acid is preferably an mRNA. It can be preferred in this embodiment that the particle is an LNP.

[0054] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142- 5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir- 15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir- 20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa- mir-17-5p, and wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, and wherein the second isolated nucleic acid is preferably an mRNA. It can be preferred in this embodiment that the particle is an LNP.

[0055] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142- 5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir- 15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir- 20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa- mir-17-5p, and wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, and wherein the second isolated nucleic acid is preferably an mRNA. It can be preferred in this embodiment that the particle is an LNP.

[0056] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142- 5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir- 15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir- 20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa- mir-17-5p, and wherein the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a transposase or a recombinase, and wherein the second isolated nucleic acid is an mRNA. It can be preferred in this embodiment that the particle is an LNP. In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the miRNA target site is recognized by a miRNA expressed in a stem cell, preferably a HSC, but substantially not expressed in a T cell, and wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, and wherein the second isolated nucleic acid is preferably an mRNA. It can be preferred in this embodiment that the particle is an LNP.

[0057] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa-mir-126-3p, hsa-mir-302a-3p, hsa-mir- 302b-3p, hsa-mir-302c-3p, hsa-mir-302d-3p, and hsa-mir367-3p, preferably selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa-mir-126-3p, and wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. In this embodiment, the particle further comprises a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, and wherein the second isolated nucleic acid is preferably an mRNA. It can be preferred in this embodiment that the particle is an LNP.

[0058] Embodiments relating a particle comprising at least two isolated nucleic acids according to the first aspect, wherein one nucleic acid comprises an open reading frame encoding an enzyme that mediates the integration of DNA into the genome of a cell and one nucleic acid comprises an open reading frame encoding a protein capable of reprogramming an immune effector cell

[0059] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. In this embodiment, the enzyme mediating the integration of DNA into the genome of a cell, preferably the transposase or the recombinase, is not expressed in a cell expressing a miRNA that recognizes the miRNA target site comprised in the isolated nucleic acid. Accordingly, because the enzyme mediating the integration of DNA into the genome of a cell, preferably the transposase or the recombinase, is not expressed in the cell, the above-mentioned second isolated nucleic acid of the first aspect is not integrated into the genome of the cell. This in turn means that, because the above- mentioned second isolated nucleic acid according to the first aspect is not integrated into the genome of the cell, the protein capable of reprogramming an immune effector cell is not expressed in the cell. Additionally, even in the unlikely events of (i) transient expression from the second isolated nucleic acid according to the first aspect or (ii) unspecific recombination of the second isolated nucleic acid according to the first aspect into the genome of the cell and transcription from this unspecifically integrated second nucleic acid according to the first aspect, the protein capable of reprogramming an immune effector cell is not expressed in a cell expressing a miRNA that recognizes the miRNA target site on the mRNA transcribed transiently or from the unspecifically integrated second nucleic acid according to the first aspect. It can be preferred in this embodiment that the particle is an LNP.

[0060] It is understood that in the embodiments relating to the present section, i.e. an embodiment of the second aspect, where the particle comprises two isolated nucleic acids according to the first aspect, particularly where the first nucleic acid is a DNA and the second nucleic acid is an RNA, it is preferred that the miRNA target site(s) comprised in the first isolated nucleic acid according to the first aspect, preferably a DNA, do not hybridize with the miRNA target site(s) comprised in the second isolated nucleic acid according to the first aspect, preferably an RNA. In other words, it is preferred that the miRNA target site(s) comprised in the first isolated nucleic acid according to the first aspect, preferably a DNA, do not form complementary stretches with the miRNA target site(s) comprised in the second isolated nucleic acid according to the first aspect, preferably an RNA. This can serve to e.g. avoid passive recombination which might in particular take place between a DNA and an RNA, i.e. if the first nucleic acid according to the first aspect is a DNA and the second nucleic acid according to the first aspect is an RNA.

[0061] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, wherein the second isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0062] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a- 5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a- 5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25- 3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR- 144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir- 142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa- mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa- mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, wherein the second isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0063] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a- 5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a- 5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25- 3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR- 144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir- 142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa- mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa- mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, wherein the second isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0064] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122- 5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir- 146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir- 181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa- mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa- miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa- mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16- 5p and hsa-mir-17-5p, and wherein the second isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0065] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA expressed in a stem cell, preferably a HSC, but substantially not expressed in a T cell, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the miRNA target site is recognized by a miRNA expressed in a stem cell, preferably a HCS, but substantially not expressed in a T cell, wherein the second isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0066] In one embodiment of the second aspect, the particle comprises an isolated nucleic acid according to the first aspect, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa-mir-126-3p, hsa-mir-302a-3p, hsa-mir-302b-3p, hsa-mir-302c-3p, hsa-mir-302d-3p, and hsa- mir367-3p, preferably selected from the group consisting of hsa-mir-125a-5p, hsa-mir-125b-5p, hsa- mir-126-3p, and wherein the isolated nucleic acid is preferably an mRNA. In this embodiment, the particle further comprises a second isolated nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-125a- 5p, hsa-mir-125b-5p, hsa-mir-126-3p, hsa-mir-302a-3p, hsa-mir-302b-3p, hsa-mir-302c-3p, hsa-mir- 302d-3p, and hsa-mir367-3p, preferably selected from the group consisting of hsa-mir-125a-5p, hsa- mir-125b-5p, hsa-mir-126-3p, wherein the second isolated nucleic acid is preferably a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome. It can be preferred in this embodiment that the particle is an LNP.

[0067] In a third aspect, the present invention is directed to a pharmaceutical composition comprising the particle according to the second aspect, including all embodiments of the second aspect, and optionally a pharmaceutically acceptable carrier and / or excipient.

[0068] Alternatively, the third aspect may be formulated as particle according to the second aspect, including all embodiments of the second aspect, for use in medicine.

[0069] In a fourth aspect, the present invention is directed to a method of expressing a protein in a cell substantially not expressing a miRNA but not expressing the protein in a cell expressing said miRNA, said method comprising contacting both cells with the isolated nucleic acid according to the first aspect (including all embodiments of the first aspect), the particle according to the second aspect (including all embodiments of the second aspect) or the pharmaceutical composition according to the third aspect (including all embodiments of the third aspect).

[0070] In one embodiment of the fourth aspect, the method is carried out outside the human or animal body, i.e., in vitro.

[0071] In one embodiment of the fourth aspect, the method is part of an adoptive cell transfer therapy, wherein the method is carried out outside the human or animal body. In this embodiment, the cell substantially not expressing a miRNA is preferably a T cell and the cell expressing said miRNA is preferably a cancer cell, more preferably a cancer B cell. In this embodiment, the adoptive cell transfer therapy may be formulated as adoptive immune cell, preferably T cell, therapy.

[0072] In a fifth aspect, the present invention is directed to a method of expressing a protein in a cell substantially not expressing a miRNA but not in a cell expressing said miRNA of a subject, the method comprising administering to the subject the particle according to the second aspect (including all embodiments of the second aspect) or the pharmaceutical composition according to the third aspect (including all embodiments of the third aspect). In one embodiment of the fifth aspect, the method is part of an in vivo cell engineering. In this embodiment, the cell substantially not expressing a miRNA is preferably a T cell of the subject and the cell expressing said miRNA is preferably a cancer cell, more preferably a cancer B cell of the subject. In this embodiment, the in vivo cell engineering may also be referred to as in vivo immune cell engineering.

[0073] In one embodiment of the fifth aspect, the subject is a human.

[0074] In a sixth aspect, the present invention is directed to the use of the isolated nucleic acid according to the first aspect (including all embodiments of the first aspect), the particle according to the second aspect (including all embodiments of the second aspect), or the pharmaceutical composition according to the third aspect (including all embodiments of the third aspect) to express a protein in a cell-specific manner.

[0075] In a seventh aspect, the present invention is directed to a method of treating a B cell cancer in a subject suffering therefrom, said method comprising administering to the subject the particle according to the second aspect (including all embodiments of the second aspect) or the pharmaceutical composition of the third aspect (including all embodiments of the third aspect).

[0076] Alternatively, the seventh aspect may be formulated as the particle according to the second aspect (including all embodiments of the second aspect) or the pharmaceutical composition of the third aspect (including all embodiments of the third aspect) for use in treating a B cell cancer in a subject.

[0077] In one embodiment of the seventh aspect, the subject is a human.

[0078] In one embodiment of the seventh aspect, the particle is an LNP.

[0079] In one embodiment of the seventh aspect, the particle or the pharmaceutical composition is administered in a pharmaceutically effective amount.

[0080] In one embodiment of the seventh aspect, the particle or the pharmaceutical composition is administered systemically, preferably by intravenous injection.

[0081] Embodiments relating to the administration of a particle comprising at least two isolated nucleic acids, wherein one nucleic acid is a nucleic acid of the first aspect comprising an open reading frame encoding an enzyme that mediates the integration of DN A into the genome of a cell

[0082] In one embodiment of the seventh aspect, the following particle or a pharmaceutical composition comprising the same is administered to the subject: A particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the isolated nucleic acid is an mRNA; and (ii) a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome.

[0083] The embodiment in the preceding paragraph may alternatively be formulated as a particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the isolated nucleic acid is an mRNA; and (ii) a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome, for use in treating a B cell cancer in a subject.

[0084] In one embodiment of the seventh aspect, the following particle or a pharmaceutical composition comprising the same is administered to the subject: A particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223- 3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126- 3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is an mRNA; and (ii) a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome.

[0085] The embodiment in the preceding paragraph may alternatively be formulated as a particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa- mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16- 5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is an mRNA; and (ii) a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome, for use in treating a B cell cancer in a subject.

[0086] Embodiments relating the administration of a particle comprising at least two isolated nucleic acids, wherein one nucleic acid is a nucleic acid of the first aspect comprising an open reading frame encoding a protein capable of reprogramming an immune effector cell

[0087] In one embodiment of the seventh aspect, the following particle or a pharmaceutical composition comprising the same is administered to the subject : A particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome; and (ii) a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a transposase or a recombinase, and wherein the second isolated nucleic acid is an mRNA.

[0088] The embodiment in the preceding paragraph may alternatively be formulated as a particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome; and (ii) a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a transposase or a recombinase, and wherein the second isolated nucleic acid is an mRNA, for use in treating a B cell cancer in a subject.

[0089] In one embodiment of the seventh aspect, the following particle or a pharmaceutical composition comprising the same is administered to the subject : A particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa- mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16- 5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome; and (ii) a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a transposase or a recombinase, and wherein the second isolated nucleic acid is an mRNA.

[0090] The embodiment in the preceding paragraph may alternatively be formulated as a particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122- 5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir- 146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir- 181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa- mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa- miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome; and (ii) a second isolated nucleic acid, namely an isolated nucleic acid comprising an open reading frame encoding a transposase or a recombinase, and wherein the second isolated nucleic acid is an mRNA, for use in treating a B cell cancer in a subject.

[0091] Embodiments relating the administration of a particle comprising at least two isolated nucleic acids according to the first aspect, wherein one nucleic acid comprises an open reading frame encoding an enzyme that mediates the integration of DN A into the genome of a cell and one nucleic acid comprises an open reading frame encoding a protein capable of reprogramming an immune effector cell

[0092] In one embodiment of the seventh aspect, the following particle or a pharmaceutical composition comprising the same is administered to the subject : A particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the isolated nucleic acid is an mRNA; and (ii) a second isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the second isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme- assisted integration into the genome.

[0093] The embodiment in the preceding paragraph may alternatively be formulated as a particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the isolated nucleic acid is an mRNA; and (ii) a second isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA expressed in a cancer B cell but substantially not expressed in a T cell, and wherein the second isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome, for use in treating a B cell cancer in a subject.

[0094] In one embodiment of the seventh aspect, the following particle or a pharmaceutical composition comprising the same is administered to the subject : A particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223- 3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126- 3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is an mRNA; and (ii) a second isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa- mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the second isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome.

[0095] The embodiment in the preceding paragraph may alternatively be formulated as a particle comprising (i) an isolated nucleic acid according to the first aspect, wherein the protein is a transposase or a recombinase, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa- mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16- 5p and hsa-mir-17-5p, and wherein the isolated nucleic acid is an mRNA; and (ii) a second isolated nucleic acid according to the first aspect, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19, wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150- 5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a- 3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir- 93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir- 15a-5p, hsa-mir-16-5p and hsa-mir-17-5p, and wherein the second isolated nucleic acid is a nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome, for use in treating a B cell cancer in a subject.

[0096] In one embodiment of the seventh aspect, the B cell cancer is characterized in that the B cell expressed on its surface CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19.

[0097] In one embodiment of the seventh aspect, the B cell cancer is a B cell lymphoma. The B cell lymphoma may be a non-Hodgkin lymphoma or a Hodgkin lymphoma.

[0098] In one embodiment of the seventh aspect, the B cell cancer is selected from the group consisting of non-Hodgkin lymphoma, large B cell lymphoma (L-BCL), diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, chronic lymphocytic leukemia (CLL) I small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphoma (including extranodal marginal zone B -cell lymphoma, nodal marginal zone B-cell lymphoma and splenic marginal zone B-cell lymphoma), Burkitt lymphoma, lymphoplasmacytic lymphoma (Waldenstrom macroglobulinemia), hairy cell leukemia, primary central nervous system lymphoma, and primary intraocular lymphoma.

[0099] In an eighth aspect, the present invention is directed to an immune cell, preferably a T cell, genetically modified to express the nucleic acid according to the first aspect, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell. It is particularly preferred that the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing (in particular a combination of CD19 and CD22), most preferably CD19. It is further particularly preferred that the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir- 142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150-5p, hsa- mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa- mir-19b- 1 -3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir-93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir-15a-5p, hsa-mir-16-5p and hsa-mir-17-5p.

[0100] In a ninth aspect, the present invention is directed to a kit comprising an isolated nucleic acid according to the first aspect (including all embodiments of the first aspect), a particle according to the second aspect (including all embodiments of the second aspect), a pharmaceutical composition according to the third aspect (including all embodiments of the third aspect) or an immune cell, preferably a T cell, according to the eighth aspect.

[0101] In one embodiment of the ninth aspect, the kit further comprises instructions for use of the kit, preferably in a method of the seventh aspect.

[0102] BRIEF DESCRIPTION OF THE FIGURES

[0103] Figure 1 Examples of transgenic cassettes and mRNA constructs incorporating miRNA target sites. Tandem repeats of artificial or naturally occurring miRNA target sites can be incorporated both in the transgenic cassettes intended to express transcript of interest either from genomic locus where delivery vector is integrated or episomally (A) and into the transiently expressed mRNA (B). Each miRNA target site can be represented by a single sequence or a tandem array of 2-4 copies of identical sequence separated by spacers. Transgenic cassettes or mRNA constructs can incorporate a single or multiple types of miRNA target sites represented as a single target site or target site arrays located within 5’ UTR, 3’ UTR or both. Promoter: promoter sequence, Transgene 1 and 2: protein coding sequences; 2A: self cleaving peptide sequence; miRNA1-TS, miRNAn-TS miRNA target sites. PolyA: polyadenylation site, 5’ UTR: 5’ untranslated region, 3’UTR: 3’ untranslated region; CAP: 5’ mRNA cap; AAA: poly-A tail

[0104] DETAILED DESCRIPTION OF THE INVENTION

[0105] Definitions

[0106] As used herein, the singular form of “a” or “an” also includes the corresponding plural unless the context clearly dictates otherwise.

[0107] The term “about” in the context of the present invention denotes an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates a deviation from the indicated numerical value of ±10% and preferably ±5%. It needs to be understood that the term “comprising” is not limiting. For the purposes of the present invention, the term “consisting of’ is considered to be a preferred embodiment of the term “comprising”. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also meant to encompass a group which preferably consists of these embodiments only.

[0108] The term "isolated" as used herein means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not "isolated", but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated". An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell or it can be present in a host cell that has been genetically modified to express the isolated nucleic acid.

[0109] The term “nucleic acid” as used herein is defined as a chain of nucleotides and interchangeably used with the term "polynucleotide". A skilled person has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric "nucleotides". The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e. , the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR, and the like, and by synthetic means. The term "polynucleotide" as used herein is to be interpreted broadly, and includes DNA and RNA, including modified DNA and RNA.

[0110] The term “open reading frame” as used herein refers to a specific sequence of nucleotides comprised in a nucleic acid that typcially starts with a start codon (typically an ATG) and ends with a stop codon (typically a TAA, TAG or TGA), which “encodes" a subject matter as defined next.

[0111] The term “encodes" or “encoding” as used herein refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA, mRNA, or miRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

[0112] The term “protein” as used herein refers to a compound comprised of amino acid residues covalently linked by peptide bonds and is used interchangeably with the terms “peptide” and “polypeptide”. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

[0113] The term “enzyme” as used herein refers to a protein that catalyzes a specific chemical reaction, in the present context preferably inside a cell.

[0114] In the context of the present disclosure, the term "transcription" relates to a process, wherein the genetic code in a DNA sequence is transcribed into RNA. Subsequently, the RNA may be translated into peptide or protein. The term "transcription" comprises "in vitro transcription", wherein the term "in vitro transcription" relates to a process wherein RNA, in particular mRNA, is in vitro synthesized in a cell-free system, preferably using appropriate cell extracts. Preferably, cloning vectors are applied for the generation of transcripts. These cloning vectors are generally designated as transcription vectors and are according to the present invention encompassed by the term "vector". According to the present invention, the RNA used in the present invention preferably is in vitro transcribed RNA (IVT-RNA) and may be obtained by in vitro transcription of an appropriate DNA template. The promoter for controlling transcription can be any promoter for any RNA polymerase. Particular examples of RNA polymerases are the T7, T3, and SP6 RNA polymerases. Preferably, the in vitro transcription according to the invention is controlled by a T7 or SP6 promoter. A DNA template for in vitro transcription may be obtained by cloning of a nucleic acid, in particular cDNA, and introducing it into an appropriate vector for in vitro transcription. The cDNA may be obtained by reverse transcription of RNA.

[0115] The term "translation" relates to the process in the ribosomes of a cell by which a strand of mRNA directs the assembly of a sequence of amino acids to make a peptide or protein.

[0116] The term “expressed” or related terms such as “expression” as used herein is the transcription and / or translation of a particular nucleotide sequence such that the final product, such as in particular a protein or a miRNA, is produced.

[0117] The term "operably linked" as used herein refers to functional linkage between a regulatory sequence and a second nucleic acid sequence, here an open reading frame, resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to an open reading frame (or coding sequence) if the promoter affects the transcription or expression of the open reading frame (or coding sequence). Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

[0118] The term "promoter" as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence. The term "enhancer" as used herein relates to an element that enhances the activity of the promoter. The term "functional fragment thereof" as used herein means that only a part of an endogenous promoter, optionally in combination with an enhancer, is present, which is nevertheless functional in that it acts as promoter.

[0119] The term “cell” as used herein refers to a cell of a specific cell type, such as e.g. an immune cell or, more specifically, a T cell or a B cell. It can also be any type of somatic cell. A “cell” can also be a “cancer cell” as defined below. A “specific cell” as used herein can refer to a single specific cell, such as, e.g., a B cell, or to at least two specific cells, such as, e.g., a cancer B cell and a stem cell.

[0120] The term “immune effector cell” as used herein refers to a cell of the immune system capable of mediating an immune function, particularly to a cell of the immune system capable of killing the target cell it is engineered to recognize.

[0121] The term “miRNA” as used herein refers to a microRNA, which is a small, single-stranded, noncoding RNA containing about 21 to about 23 nucleotides, typically 21 to 23 nucleotides, in particular 22 nucleotides. miRNAs may evolve from the processing of an about 70 nucleotides long hairpin RNA precursor. miRNAs are involved in mRNA silencing, in particular in that they cleave the mRNA strand or downregulate its expression. In order to silence an mRNA, the miRNA is at least partially complementary to its target mRNA. Information about a particular miRNA, in particular information about its length and the nucleotide sequence, can e.g. be found in the RNAcentral database or in other RNA databases known to the skilled person.

[0122] The term “miRNA target site” as used herein refers to a nucleotide sequence that is reverse complementary (in the meaning of perfectly reverse complementary) in at least 6 or 7 nucleotides (ideally in nucleotides 2 to 7 or nucleotides 2 to 8 of the typically 22 nucleotides long miRNA) of the overall about 21 to about 23 nucleotides, in particular 22 nucleotides, of the miRNA target site, preferably reverse complementary in 21 to 23 nucleotides, most preferably reverse complementary in all 22 nucleotides, to the miRNA. Accordingly, a miRNA target site may be a nucleotide sequence of about 21 to about 23 nucleotides, typically 21 to 23 nucleotides, in particular 22 nucleotides. For example, the sequence of the miRNA hsa-mir-126-3p is (from 5’ to 3’) UCGUACCGUGAGUAAUAAUGCG (SEQ ID NO :1). Accordingly, the sequence of a corresponding miRNA target site recognized by miRNA hsa-mir-126-3p may e.g. be (from 5’ to 3’, on DNA level) CGCATTATTACTCACGGTACGA (completely reverse complementary, SEQ ID NO :2) or GGTACG (reverse complementary in the seed region at nucleotides 2 to 7) or CGGTACG (reverse complementary in the seed region at nucleotides 2 to 8).

[0123] The term “substantially not expressed” as used herein means that there is either no expression or expression to a level which does not trigger any significant biological effect.

[0124] The term “DNA” as used herein is the usual abbreviation for deoxyribonucleic acid. It is a nucleic acid molecule, i.e. a polymer consisting of nucleotide monomers. These nucleotides are usually deoxy-adenosine-monophosphate, deoxy-thymidine-monophosphate, deoxy-guanosine- monophosphate and deoxy-cytidine-monophosphate monomers or analogs thereof which are - by themselves - composed of a sugar moiety (deoxyribose), a base moiety and a phosphate moiety, and polymerize by a characteristic backbone structure. The backbone structure is, typically, formed by phosphodiester bonds between the sugar moiety of the nucleotide, i.e. deoxyribose, of a first and a phosphate moiety of a second, adjacent monomer. The specific order of the monomers, i.e. the order of the bases linked to the sugar / phosphate-backbone, is called the DNA-sequence. DNA may be single stranded or double stranded. In the double stranded form, the nucleotides of the first strand typically hybridize with the nucleotides of the second strand, e.g. by A / T-base-pairing and G / C-base-pairing.

[0125] The term “RNA” as used herein relates to a nucleic acid molecule which includes ribonucleotide residues. In preferred embodiments, the RNA contains all or a majority of ribonucleotide residues. As used herein, "ribonucleotide" refers to a nucleotide with a hydroxyl group at the 2'-position of a p- D-ribofuranosyl group. RNA encompasses without limitation, double stranded RNA, single stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations may refer to addition of non-nucleotide material to internal RNA nucleotides or to the end(s) of RNA. It is also contemplated herein that nucleotides in RNA may be non-standard nucleotides, such as chemically synthesized nucleotides or deoxynucleotides. For the present disclosure, these altered RNAs are considered analogs of naturally-occurring RNA. In one embodiment, the RNA may have modified ribonucleotides. Examples of modified ribonucleotides include, without limitation, 5- methylcytidine, pseudouridine and / or 1-methyl-pseudouridine. In some embodiments, the RNA comprises a modified nucleoside in place of at least one (e.g., every) uridine. In some embodiments, the RNA according to the present disclosure comprises a 5'-cap. In one embodiment, the RNA of the present disclosure does not have uncapped 5'-triphosphates. In one embodiment, the RNA may be modified by a 5'- cap analog. The term "5'-cap" refers to a structure found on the 5'-end of an mRNA molecule and generally consists of a guanosine nucleotide connected to the mRNA via a 5' to 5' triphosphate linkage. In one embodiment, this guanosine is methylated at the 7-position. Providing an RNA with a 5'-cap or 5'-cap analog may be achieved by in vitro transcription, in which the 5'-cap is co-transcriptionally expressed into the RNA strand, or may be attached to RNA post- transcriptionally using capping enzymes.

[0126] The term “mRNA” as used herein relates to an RNA transcript which encodes a peptide or protein. As established in the field, mRNA generally contains a 5' untranslated region (5'-UTR), a peptide coding region and a 3' untranslated region (3'-UTR). In some embodiments, the RNA is produced by in vitro transcription or chemical synthesis. In one embodiment, the mRNA is produced by in vitro transcription using a DNA template where DNA refers to a nucleic acid that contains deoxy ribonucleotides.

[0127] The term “chemically modified” with respect to a nucleic acid or DNA or RNA, respectively, as used herein refers to chemically modified nucleotides, such as e.g. the above-mentioned ribonucleotides in the RNA definition. The term also includes any chemical modifications in the phosphate-groups linking the nucleotides.

[0128] The term “reaction involving a nucleic acid” as used herein means that the nucleic acid is modified in any way, e.g. by introducing a single- or double-strand cut into the nucleic acid, integrating another nucleic acid into the nucleic acid, reverse transcribing the nucleic acid, or transcribing the nucleic acid.

[0129] The term “integration of DNA into the genome of a cell” as used herein means that the genome of a cell is modified such that an exogenous DNA is present in the genome after its integration therein, wherein the exogenous DNA is preferably the isolated nucleic acid according to the first aspect of the present invention (or derived thereform).

[0130] The term “nucleic acid comprising at least one recognition site for enzyme-assisted integration into the genome” as used herein means a nucleic acid, such as e.g. a minimalized DNA plasmid (in particular a DNA nanoplasmid or DNA minicircle), containing at least one, preferably two, recognition sites for enzyme-assisted integration into the genome such that a corresponding enzyme, in particular a transposase or a recombinase, recognizes the at least one, preferably two, recognition sites and catalyzes the integration into the genome.

[0131] The term “capable of reprogramming an immune effector cell” as used herein means that the immune effector cell is modified such that it recognizes a target, which it had substantially not recognized before, e.g. the immune effector cell recognizes and in particular attacks a cell, in particular a cancer cell, which it had not recognized and attacked before to a substantial level.

[0132] The term “chimeric antigen receptor” or “CAR” as used herein relates to an artificial receptor comprising a single molecule or complex of molecules which recognizes directly or indirectly, i.e. binds to, a target structure (e.g. an antigen) on a target cell such as a cancer cell (e.g. by binding of an antigen binding domain to an antigen expressed on the surface of the target cell) or binds to a target that can lead to tumor recognition upon presence of a linker molecule and may confer specificity onto an immune effector cell such as a T cell expressing said CAR on the cell surface. Preferably, recognition of the target structure by a CAR, either directly or indirectly, results in activation of an immune effector cell expressing said CAR. A CAR may comprise one or more protein units said protein units comprising one or more domains. The term "CAR" does not include T cell receptors.

[0133] The term "T cell receptor" or "TCR" as used herein means an engineered T cell receptor that allows the cell expressing the same to recognize a target cell expressing the peptide-MHC recognized by the T cell receptor.

[0134] The term "antigen" as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. Antigens can also be recognized by a CAR. The skilled person will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be naturally occurring or recombinant antigens.

[0135] The term "expressed on the cell surface" or "associated with the cell surface" means that a molecule is associated with and located at the plasma membrane of a cell, wherein at least a part of the molecule faces the extracellular space of said cell and is accessible from the outside of said cell, e.g., by antibodies located outside the cell. In this context, a part is preferably at least 4, preferably at least 8, preferably at least 12, more preferably at least 20 amino acids. The association may be direct or indirect. For example, the association may be by one or more transmembrane domains, one or more lipid anchors, or by the interaction with any other protein, lipid, saccharide, or other structure that can be found on the outer leaflet of the plasma membrane of a cell. For example, a molecule associated with the surface of a cell may be a transmembrane protein having an extracellular portion or may be a protein associated with the surface of a cell by interacting with another protein that is a transmembrane protein.

[0136] In the context of the present invention, the term "tumor antigen" refers to an antigen that is common to specific hyperproliferative disorders such as cancer.

[0137] The term "adoptive cell transfer therapy" consists in transferring in a patient a cell product that is capable of recognizing a diseased cell, preferably a cancer cell. Adoptive cell therapy can be done with a cell engineered to recognize the diseased cell, preferably the cancer cell, via expression of specific TCRs or CARs. Adoptive cell transfer therapy with CAR-engineered T cells expressing chimeric antigen receptors is an anti-cancer therapeutic as CAR-modified T cells can be engineered to target substantially any tumor antigen. For example, patient's T cells may be genetically engineered (genetically modified) to express CARs specifically directed towards antigens on the patient's tumor cells, then infused back into the patient.

[0138] The term “cancer cell” or “cancer” as used herein is defined as disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer and the like. In one embodiment, a cancer comprises a solid tumor. In one embodiment, a cancer is a liquid cancer.

[0139] The term “particle” as used herein refers to a delivery vehicle to deliver the nucleic acid comprised therein into a cell, wherein a “particle” may e.g. be a vector or an LNP as defined in the following.

[0140] The term "vector" as used herein refers to a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. A "lentivirus" as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells. They can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SI , and FI are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo.

[0141] The term “lipid nanoparticle” or “LNP” as used herein refers to a particle comprising at least one lipid, preferably a cationic lipid, wherein the lipid forms a complex with and / or encapsulates the nucleic acid comprised therein.

[0142] As used herein, the term "pharmaceutically acceptable" as used in connection with a composition of the invention refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not produce undesired reactions when administered to a mammal (e.g., human). The term "pharmaceutically acceptable" can also mean approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans. A "pharmaceutically acceptable carrier and / or excipient" refers to an ingredient in a pharmaceutical composition or formulation, other than an active ingredient, which is nontoxic to a subject.

[0143] The term “subject” as used herein refers to a human or another mammal (e.g. mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate) that can be afflicted with or is susceptible to a disease or disorder (e.g., cancer) but may or may not have the disease or disorder. In many embodiments, the subject is a human being. Unless otherwise stated, the term "subject" does not denote a particular age, and thus encompass adults, elderlies, children, and newborns. In embodiments, the "subject" is a "patient", e.g., a human patient. The term "patient" means a subject for treatment, in particular a diseased subject.

[0144] The term "treatment" or "treating" as used herein relates to the management and care of a subject for the purpose of combating a condition such as a disease or disorder. The term is intended to include the full spectrum of treatments for a given condition from which the subject is suffering, such as administration of a therapeutically effective composition to alleviate the symptoms or complications, to delay the progression of the disease, disorder or condition, to alleviate or relief the symptoms and complications, and / or to cure or eliminate the disease, disorder or condition as well as to prevent the condition, wherein prevention is to be understood as the management and care of an individual for the purpose of combating the disease, condition or disorder and includes the administration of the active compounds to prevent the onset of the symptoms or complications.

[0145] As used herein, the term "instructions" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the invention. The instructional material of the kit of the invention may, for example, be affixed to a container which contains the compositions of the invention or be shipped together with a container which contains the compositions. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compositions be used cooperatively by the recipient.

[0146] The concept underlying the present invention

[0147] The concept underlying the present invention is outlined in the following based on an in vivo CAR T cell engineering therapy for the treatment of malignant B cells.

[0148] Thus, in order to specifically prevent this risk and improve the outcome of in vivo CAR T cell therapy in patients with malignant B cells, (a) specific miRNA target site(s) is / are introduced into the genetic cargo comprised in particles used for the in vivo therapy such that the encoded transgene(s) of the genetic cargo is / are not expressed in specific cells, namely in cells that express and / or comprise a miRNA recognizing the specific miRNA target site(s). A miRNA target site is at least completely complementary to the bases of the miRNA seed (the miRNA target site can of course also be completely complementary to the miRNA and not only the seed thereof), with the result that the genetic cargo comprising the miRNA target site is targeted for degradation or reduced translation, respectively, which is induced by the miRNA recognizing (in the meaning of binding to, in particular via hybridization) the miRNA binding site. As an example and without being limited thereto, the part of a cargo of a particle encoding an enzyme such as a recombinase, a transposase or a retrotransposase that mediates the integration of another part of the genetic cargo into the genome of the cells receiving the cargo, is modified to contain (a) target site(s) for (a) microRNA(s) that is / are expressed in cells where the enzyme should not be expressed. To further improve the cell restrictions, similar or other miRNA target sites can be added to repress the genes after insertion of part of the cargo into the genome.

[0149] Further, as another example and without being limited thereto, an LNP can contain a DNA transposon that encodes for a CAR and an mRNA that encodes for a transposase. In order to avoid either the CAR or the transposase from being expressed in the malignant B cell, a miRNA target site is introduced into the DNA transposon and / or the transposase encoding mRNA, whereby the miRNA target sites are recognized by miRNAs that are expressed prevalently in the malignant B cells. Therefore, after injection of the particles into a patient, the malignant B cells that are potentially picking up the particels and their genetic cargo are not subject to modification in order to express the CAR, because the miRNA targeting sites in the genetic cargo prevent expression of the cargo in the malignant B cells.

[0150] Still further, as another example and without being limited thereto, the same strategy can be applied to implement miRNAs target sites into the genetic cargo to avoid expression of the cargo in any cell that could be considered a risk if it unspecifically picks up the genetic cargo of a particle.

Claims

CLAIMS1 . An isolated nucleic acid comprising (i) an open reading frame encoding a protein that is not to be expressed in a specific cell but to be expressed in a cell differing from the specific cell and (ii) a miRNA target site, wherein the miRNA target site is recognized by a miRNA that is expressed in the specific cell but substantially not expressed in the cell differing from the specific cell.

2. The isolated nucleic acid according to claim 1 , wherein the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150- 5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a- 3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir- 93-5p, preferably selected from the group consisting of hsa-mir-126-3p, hsa-miR-144-3p, hsa-mir- 15a-5p, hsa-mir-16-5p and hsa-mir-17-5p.

3. The isolated nucleic acid according to claim 1 or 2, wherein the isolated nucleic acid is selected from the group consisting of a nucleic acid comprising at least one recognition site for enzyme- assisted integration into the genome, a minimalized DNA plasmid including a DNA nanoplasmid or a DNA minicircle, and mRNA.

4. The isolated nucleic acid according to any one of claims 1 to 3, wherein the protein is an enzyme that mediates the integration of DNA into the genome of a cell, preferably selected from the group consisting of a recombinase, a transposase and a retrotransposase.

5. The isolated nucleic acid according to any one of claims 1 to 3, wherein the protein is capable of reprogramming an immune effector cell, preferably a chimeric antigen receptor (CAR), more preferably a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing.

6. A particle comprising the isolated nucleic acid according to any one of claims 1 to 5.

7. The particle according to claim 6, wherein the particle is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, a retroviral vector, a herpes simplex viral vector, a baculoviral vector, an Epstein-Barr viral vector, a poxvirus vector, a virosome, and a lipid nanoparticle (LNP).

8. The particle according to claim 6 or 7, wherein the particle is an LNP comprising (i) the isolated nucleic acid according to claim 4, wherein the enzyme is a transposase or a recombinase, the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p,hsa-mir-146a-5p, hsa-mir-150-5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a-3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223- 3p, hsa-mir-25-3p, and hsa-mir-93-5p, and the nucleic acid is mRNA, and / or (ii) the isolated nucleic acid according to claim 5, wherein the protein is a CAR recognizing CD19, CD22, CD20, BCMA, CD70, CD79b, CD30 or any combination of the foregoing, the miRNA target site is recognized by a miRNA selected from the group consisting of hsa-mir-106b-5p, hsa-mir-122-5p, hsa-mir-126-3p, hsa-mir-142-3p, hsa-mir-142-5p, hsa-mir-143-3p, hsa-miR-144-3p, hsa-mir-146a-5p, hsa-mir-150- 5p, hsa-mir-155-5p, hsa-mir-15a-5p, hsa-mir-16-5p, hsa-mir-17-5p, hsa-mir-181a-5p, hsa-mir-19a- 3p, hsa-mir-19b-1-3p, hsa-mir-20a-5p, hsa-mir-21-5p, hsa-mir-223-3p, hsa-mir-25-3p, and hsa-mir- 93-5p, and the nucleic acid is a nucleic acid comprising at least one recognition site for enzyme- assisted integration into the genome.

9. A pharmaceutical composition comprising the particle according to any one of claims 6 to 8 and optionally a pharmaceutically acceptable carrier and / or excipient.

10. A method of expressing a protein in a cell substantially not expressing a miRNA but not expressing the protein in a cell expressing said miRNA, said method comprising contacting both cells with the isolated nucleic acid according to any one of claims 1 to 5, the particle according to any one of claims 6 to 8 or the pharmaceutical composition according to claim 9.11 . A method of expressing a protein in a cell of a subject substantially not expressing a miRNA but not in a cell of the subject expressing said miRNA, the method comprising administering to the subject the particle according to any one of claims 6 to 8 or the pharmaceutical composition according to claim 9.

12. Use of the isolated nucleic acid according to any one of claims 1 to 5 or of the particle according to any one of claims 6 to 8 or of the pharmaceutical composition according to claim 9 to express a protein in a cell-specific manner.

13. The particle according to claim 8 or the pharmaceutical composition according to claim 9 for use in treating a B cell cancer in a subject.

14. An immune cell, preferably a T cell, genetically modified to express the nucleic acid according to any one of claims 1 to 5, wherein the protein is a protein capable of reprogramming an immune effector cell, preferably a T cell.

15. A kit comprising the isolated nucleic acid according to any one of claims 1 to 5, the particle according to any one of claims 6 to 8, the pharmaceutical composition according to claim 9 or the immune cell according to claim 14, optionally further comprising instructions for use of the kit.

Citation Information

Patent Citations

  • Immune cells with chimeric antigen receptors or chimeric autoantibody receptors

    CA3236678A1

  • Regulatable or conditional expression systems

    US20070054872A1

  • Gene vector control by cardiomyocyte-expressed micrornas

    US20230103731A1

  • Methods of engineering allogeneic t cells with a transgene in a TCR locus and associated compositions and methods

    WO2023069790A1

  • Engineered polynucleotides for cell selective expression

    WO2024026257A2