Particles based on biopolymer-DNA conjugates

Abstract

The present invention relates to particles comprising a polymer and DNA, wherein the DNA comprises at least one binding site capable of binding to RNA, in particular miRNA. Further, the invention is directed to a pharmaceutical composition comprising the particles and a pharmaceutically acceptable carrier. Moreover, the particles may be used in the treatment disease associated with RNA-overexpression.

Description

PARTICLES BASED ON BIOPOLYMER-DNA CONJUGATESThis application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.TECHNICAL FIELD OF THE INVENTION

[0001] The present invention relates to particles comprising a polymer and DNA, wherein the DNA comprises at least one binding site capable of binding to RNA, in particular miRNA. Further, the invention is directed to a pharmaceutical composition comprising the particles and a pharmaceutically acceptable carrier. Moreover, the particles may be used in the treatment of a disease associated with RNA-overexpression.BACKGROUND ART

[0002] Several systems have been so far created for the targeted transport of drugs into cells.

[0003] Kimna C. et al. [1] descibes a method for application of medication, based on DNA crosslinked Mucin-nanoparticles, which controls by a conformation change the release of their payload. Thereby, a drug is released only in the presence of a specific trigger-DNA. As specific endogenous trigger serves an oncogene microRNA (miRNA), such as miR-21, which is overexpressed. However, the use of two different DNAs is not disclosed.

[0004] Yan H et al. [2] describes the reversible condensation of Mucin into a nanoparticle in view of potential application strategies for drug release, which imitate the cell release of macro molecules condensed in vesicles like Mucine and Heparine.

[0005] Zhang Z et al. [3] is a scientific publication and describes a therapeutic sequential codelivery system using a near-infrared radiation (NIR)-responsive hollow gold nanoparticle (HGNPs) to achieve sequential release of microRNA inhibitor (miR-21 i) / doxirubicin (Dox) to achieve synergistic efficacy.

[0006] In certain pathogenic processes overexpression of miRNA plays an important role, such as in the development of cancer. This overexpressed miRNA could be neutralized by introducing RNA which binds to the miRNA. Thus, there is a need to transport respective RNA to the cells overexpressing the miRNA.SUMMARY OF THE INVENTION

[0007] The invention relates to a particle comprisingA) a) at least one polymer (P) forming particles; b) at least one DNA strand (DNAS1); c) at least one further DNA strand (DNAS2) capable of binding to at least one strand RNA and capabable of binding to at least two strands (DNAS1); wherein the polymer (P) is connected with (DNAS1) optionally via d) at least one linker element (LE1) connecting the polymer (P) with the at least one DNA strand (DNAS1) orB) a) at least one polymer (P) forming particles; b) at least one DNA strand (DNAS1) c) at least one further DNA strand (DNAS3)capable of binding to RNA and capable of binding to at least one strand (DNAS1) d) at least one linker element (LE1) connecting the polymer (P) with the at least one DNA strand (DNAS1) e) at least one linker element (LE2) connecting the polymer (P) with the at least one DNA strand (DNAS3).

[0008] The invention is further directed to a pharmaceutical composition comprising the particle and at least one pharmaceutically acceptable carrier.

[0009] The invention is further directed to the particle or the pharmaceutical composition for use in medicine.

[0010] The invention is further directed to the particle or the pharmaceutical composition for use in the treatment of disease associated with RNA-overexpression, preferably, metabolic diseases cancer, viral infections, cardiovascular diseases, atherosclerosis, diabetes, and obesity.

[0011] The cancer may be selected from the group consisting of breast cancer, glioblastoma, melanoma, colorectal cancer, prostate cancer, lung cancer, liver, thyroid, kidney, Burkitt lymphoma.

[0012] The inventive particles allow the transport of DNA into cells, wherein the DNA also stabilizes the particles. DNA strands comprised by the inventive particles offer binding sites which selectively bind to RNA strands in the cytosol, thereby effectively Sequestering / removing these RNA strands from the cytosol. This is relevant for the treatment of diseases associated with RNA- overexpression, such as cancer, viral infections

[0050] , cardiovascular diseases, atherosclerosis

[0051] , diabetes

[0052] , and obesity

[0053] , For example, in certain tumor cells, micro-RNA variant miR- 21 is overexpressed, which prevents apoptosis. There are embodiments of particles which upon up upon arrival in the cytosol of the cell and embodiments of particles which do not open. However, both embodiments are capable to achieve the binding of RNA present in the cytosol. Moreover, suitable organic moieties like folic acid may be attached to the particles in order to improve targeting of cells and uptake into cells.BRIEF DESCRIPTION OF THE FIGURES

[0013] Fig. 1 : Design of miRNA-sequestering mucin nanoparticles (mucNPs). (A) Nanoparticle design rationale; dashed lines indicate sections of the antimiR strand that hybridize with target miRNA. (B) Two sets of DNA sequences ( / .e., Design 1 : sponge NPs and Design 2: transient NPs) designed to obtain different modes of actions: sponge NPs are stabilized by the strands designed to absorb miRNA whereas the transient NPs silence the miRNA through the displacement of the antimiR strand. Minimum free energy (MFE) of the structures is calculated for their state at 37°C. Color coding of the complexes is based on the structure type. (C) miR-21 depletion activity of the antimiR strandsas proven with qPCR measurements. Data is normalized to RNA samples co-incubated with H2O.The data shown represent mean values, and error bars denote the standard deviation obtained from N = 3 independent biological replicates. (D) PAGE showing the favorable duplex switches from bridge / antimiR to antimiR / miR in the presence of the miR mimic strand. Lanes as follows (left to right): 1 , miR-mimic; 2, bridge; 3, antimir; 4, miR-mimic + bridge; 5, miR mimic + antimir; 6, antimir + bridge;?, antimir + bridge + miR mimic.

[0014] Fig. 2: Characterization of (FA-)mucNPs. (A) DLS measurements indicate that the miRNA-sponge NPs keep their intact shape when incubated with miRNA-mimic, whereas the transient NPs are triggered to destabilize (n = 5). (B) ^-potential measurements of mucin NPs stabilized with 2 set of DNA design (n = 3). (C) Both NP species are stable under storageconditions for 14 days (n = 5). (D) DLS measurements performed with folic-acid conjugated mucin NPs stabilized with two sets of DNAs show the same pattern as the unmodified mucNPs (n = 5). (E) ^-potential measurements of FA-conjugated mucin NPs stabilized with sets of DNA design (n = 3). (F) Both FA-conjugated NP species are stable under storage conditions for 14 days (n = 5). Data shown represents mean values, error bars denote the standard deviation.

[0015] Fig. 3: Effect of FA-mucNPs on target and off-target cells in vitro. (A) Dose-dependent viability of target (HeLa) and off-target (NIH / 3T3) cells incubated with FA-mucNPs (sponge and transient) for 24 h (n = 6). (B) Fraction of dead cells as in target and off-target populations after treatment with FAmucNP variants for 24 h (n = 3). (C) Geometric mean fluorescence intensity (GMFI) obtained by cytometric evaluation of target and off-target cells incubated with Atto488- labeled FA-mucNP variants for 1 , 4, and 24 h (n = 6). (D) The uptake of FA-mucNP variants by target cells in the presence of different uptake pathway inhibitors (n = 6). (E) Representative CLSM images demonstrating the colocalization of Atto-488 labeled FA-mucNPs (green) and FM4- 64-stained endosomes (red) in the cytosols of the target cells. Pearson’s correlation (R) over time (right) was determined by analysing n > 10 cells from n > 4 images. (F) The apoptosis rate of target and off-target cells after being incubated with sponge and transient NPs for 4 h. (G) Comparison of the apoptotic effect of sponge and transient NPs on target cells in a timedependent manner. Data shown in (F) and (G) represent mean values determined from N = 3 biological replicates per group (for each group, 6 separate wells were analyzed per biological replicate). Data shown represent mean values, and error bars denote the standard deviation.

[0016] Fig. 4: Flow cytometry analysis of HeLa cells after treatment with design 1 (sponge) and design 2 (transient) nanoparticles. (A) Representative quadrant analysis. (B) Pie charts describing the mean percentage of necrotic, late apoptotic, early apoptotic, and viable cells obtained with Annexin V / PI double staining followed by flow cytometry analysis. Data shown represent mean values determined from N = 3 biological replicates per group (for each group, 6 separate wells were analysed per biological replicate).

[0017] Fig. 5: In vitro performance of nanoparticles on 3D cell culture models. (A) Spheroid area change after treatment with design 1 (sponge) and design 2 (transient) nanoparticles. Data shown represent mean values determined from minimum 4 samples per group. (B) 3D coculture model where the spheroids were formed by equal numbers of HeLa (red) and 3T3 (blue) cells. After 48 h of nanoparticle incubation. There is a significant reduction in the number of HeLa cells due to the activation of the apoptosis pathways through miR-21 silencing.

[0018] Fig. 6: Purification steps of mucins harvested from porcine stomachs. After harvesting the crude mucus manually from the tissue surfaces, the cellular debris and coarse impurities were removed. After separation from other macromolecules via size exclusion chromatography, mucins are desalted, concentrated, and lyophilized to obtain a protein powder to be stored at - 80 °C.

[0019] Fig. 7: Calibration curves of functional molecules: dopamine standard curve used for the detection of its conjugation to hyaluronic acid (A), and folic acid curve used for the detection of its conjugation to mucin (B).

[0020] Fig. 8: Calibration curves of therapeutically active molecules: timolol maleate (A), tetracycline hydrochloride (B), and doxorubicin hydrochloride (C).

[0021] Figure 9: DLS measurements of PLL / mucin NPs under a dDNA gradient showing the threshold dDNA concentration required to force the particulate structure to unfold (n = 5) (A). Cumulative cargo release from coated mucin NPs under a dDNA gradient showing the amount of dDNA required to initiate a detectable cargo release as an indication of conformational change (n = 5) (B). Data shown represents mean values, error bars denote the standard deviation.DETAILED DESCRIPTION OF THE INVENTION

[0022] The solution of the present invention is described in the following, exemplified in the appended examples, illustrated in the Figures and reflected in the claims.

[0023] Definitions

[0024] It is noted that as used herein, the singular forms “a”, “an”, and “the”, include plural references unless the context clearly indicates otherwise. Thus, for example, reference to “a reagent” includes one or more of such different reagents and reference to “the method” includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.

[0025] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0026] The term "and / or" wherever used herein includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term".

[0027] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term “comprising” can be substituted with the term “containing” or “including” or sometimes when used herein with the term “having”. When used herein “consisting of" excludes any element, step, or ingredient not specified.

[0028] The term “including” means “including but not limited to”. “Including” and “including but not limited to” are used interchangeably.

[0029] It should be understood that this invention is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[0030] All publications cited throughout the text of this specification (including all patents, patent application, scientific publications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.

[0031] The content of all documents and patent documents cited herein is incorporated by reference in their entirety.Particles

[0032] The invention is directed to a particle comprisingA) a) at least one polymer (P) forming particles; b) at least one DNA strand (DNAS1); c) at least one further DNA strand (DNAS2) capable of binding to at least one strand RNA and capabable of binding to at least two strands (DNAS1); wherein the polymer (P) is connected with (DNAS1) optionally via d) at least one linker element (LE1) connecting the polymer (P) with the at least one DNA strand (DNAS1) orB) a) at least one polymer (P) forming particles; b) at least one DNA strand (DNAS1) c) at least one further DNA strand (DNAS3) capable of binding to RNA and capable of binding to at least one strand (DNAS1) d) at least one linker element (LE1) connecting the polymer (P) with the at least one DNA strand (DNAS1) e) at least one linker element (LE2) connecting the polymer (P) with the at least one DNA strand (DNAS3).

[0033] Preferably, the polymer (P) is non-toxic. Preferably, the polymer (P) forms particles of the hydrodynamic average diameter of 100 to 400 nm, preferably 120 to 350 nm.

[0034] Preferably, the polymer (P) is a biopolymer; more preferably selected from the group consisting carbohydrates, proteins, glycoproteins, more preferably selected from the group consisting of mucin most preferably MLIC5AC, MLIC5B, and MLIC2.

[0035] Preferably, the DNA strand (DNAS1) is a single strand molecule.

[0036] The DNA strand (DNAS1) may have a length of 10 to 50 bases, more preferably15 to 30 bases.

[0037] In one embodiment the the DNA strand (DNAS1) has a sequence (from 5’ to 3’) selected from the group consisting of SEQ. ID No. 1 : TGGTCTAATTTGCGCG, SEQ. ID No. 2: CCCTATGTTGACGCTAGCTTA.

[0038] The DNA strand (DNAS2) is preferably a single strand molecule. The DNA strand (DNAS2) preferably has a length of 10 to 60 bases, more preferably 20 to 40 bases. In one embodiment the DNA strand (DNAS2) has a sequence (from 5’ to 3’) selected from the group consisting of SEQ. ID No. 3: CGCGCAAATTTCAACATCAGTCTGATAAGCTACGCGCAAATT, SEQ. ID No. 4: GCGTCAACATCAGTCTGATAAGCTAGCG. Preferably, the DNA strand (DNAS2) binds to a RNA molecule, more preferably a micro RNA, most preferably binds to micro RNA selected from the group consisting of: miR-21 , miR-10b, miR-33, miR- 103, miR- 107, miR-141 , miR-155.

[0039] Preferably at least 50%, more preferably at least 70%, most preferably at least 90%, particularly prefered 100% of the overall DNA strands (DNAS2) bind to at least two DNA strands (DNAS1).

[0040] Preferably, all strands (DNAS1) consist of an identical structure / sequence.

[0041] Preferably, the DNA strand (DNAS2) is not bound to the at least one polymer (P) directly or by a linker element such as LE1.

[0042] Preferably, the particle (P) is formed by binding of at least a part of single (DNAS2) strands to two (DNAS1) strands each, thereby connecting (DNAS1) strands, stabilizing the particle.

[0043] DNAS2 is capabable to bind to the at least one RNA strand via at least one binding site present on the DNAS2 strand capable to bind to the RNA.

[0044] DNAS2 is capabable to bind to the at least two strands DNAS1 via at least two binding sites present on the DNAS2 strand capable to bind to the DNAS1.

[0045] Preferably, the sequence identity between DNAS1 and DNAS2 is less than 100%, more preferably less than 90%, most preferably less than 80%, particularly preferred less than 70%, more particularly preferred less than 60%, most particularly preferred less than 50%, very much particularly preferred less than 40%, especially preferred less than 30%, more especially preferred less than 20%, most especially preferred less than 10%.

[0046] In one embodiment, the sequence of the binding site (BSRNA) on (DNAS2) capable of binding to RNA and the at least two binding sites (BSDNAS1) capable of binding to (DNAS1) are completely different from each other. Thereby the RNA binding to the binding site (BSRNA) does not compete with (DNAS1) about binding to (BSDNAS1). As a consequence, preferably the particle does not open up after binding RNA and the bound RNA is adsorbed by the particle (“sponge” embodiment).

[0047] In one embodiment, the sequence of the binding site binding (BSRNA) on (DNAS3) capable of binding to RNA and the at least one binding site (BSDNAS1) capable of binding to (DNAS1) are completely different from each other. Thereby the RNA binding to the binding site (BSRNA) does not compete with (DNAS1) about binding to (BSDNAS1). As a consequence, preferably the particle does not open up after binding RNA and the bound RNA is adsorbed by the particle (“sponge” embodiment).

[0048] In one embodiment, the sequence of the binding site binding (BSRNA) on (DNAS2) capable of binding to RNA comprises at least partially the sequence of at least one of the at least two binding sites (BSDNAS1) capable of binding to (DNAS1). Thereby the RNA binding to the binding site (BSRNA) competes with (DNAS1) at least partially about binding to (BSDNAS1). As a consequence, preferably the particle opens after binding RNA (“transient” embodiment).

[0049] The DNA strand (DNAS3) is capabable to bind to the at least one RNA strand via at least one binding site present on the DNAS3 strand capable to bind to the RNA.

[0050] The DNA strand (DNAS3) is capabable to bind to the at least one strand DNAS1 via at least one binding site present on the DNAS3 strand capable to bind to the DNAS1 .

[0051] In one embodiment, the sequence of the binding site binding (BSRNA) on (DNAS3) capable of binding to RNA comprises at least partially the sequence of the least one binding site (BSDNAS1) capable of binding to (DNAS1). Thereby the RNA binding to the binding site (BSRNA) competes with (DNAS1) at least partially about binding to (BSDNAS1). As a consequence, preferably the particle opens after binding RNA (“transient” embodiment).

[0052] The linker element (LE1) or (LE2) is preferably a disulfide bridge, biotin, cholesterol. an amide group,more preferably a disulfide bridge.

[0053] An amide group may be formed under conditions well known by the person skilled in the art. Analysis of Past and Present Synthetic Methodologies on Medicinal Chemistry: Where Have All the New Reactions Gone?” J. Med. Chem., 2015, ASAP; El-Faham, Ayman; Albericio, Fernando, “Peptide Coupling Reagents, More than a Letter Soup” Chem. Rev., 2011 , 111 , 6557. 2. Pattabiraman, Vijaya R., Bode, Jeffrey W. “Rethinking Amide Bond Synthesis” Nature, 2011 , 480, 471. Many amide coupling conditions are available to generate activated carboxylic acids which react with an amine group, such as acid halides (chloride, fluoride), azides, anhydrides, or carbodiimides. See for example Wuts PG. M., Greene T.W., Greene's Protective Groups in Organic Synthesis, Fourth Edition, Wiley 2006; Brown, Dean G., Bostrom, Jonas, “specific examples of a linker element (LE1) and (LE2) may be prepared from an azide group adding in an 1 ,3-dipolar cycloadditon to the corresponding alkyne resulting in a 1 ,2,3-triazole, thereby coupling the rest carrying the azide group to the rest carrying the alkyne group. See: Lutz J-F et al., Advanced Drug Delivery Reviews, 2008, Vol. 60, Issue 9, p. 958-970.

[0055] The particle is preferably capable of entering a cell.The particle optionally comprises a molecule which is connected with the polymer (P) which facilitates entering of the particle into the cell, preferably selected from folic acid, folate, antibodies, aptameres, peptides and cyclical peptides, ligands that bind to receptors involved in endocytosis processes (such as transferrin or folate), small molecules with affinity for specific cell surface receptors or transporters (glycans or their fragments), engineered proteins or protein domains such as lectins or growth factors, more preferably transferrin, folate and folic acid, most preferably folate and folic acid.

[0056] The hydrodynamic average diameter of the particle is preferably 50 to 500 nm, more preferably 140 to 350 nm or 200 to 300 nm.

[0057] The hydrodynamic average particle diameter, is the average particle diameter of the particles dispersed in water at 25 °C determined with dynamic light scattering measurements (DLS). Preferably, the medium in which the particles are present during the determination of DDLS is water. Data obtained by DLS measurements is evaluated by cumulants analysis, which gives two values, an intensity mean value for the size (DDLS), and a width parameter known as the polydispersity index value (PDI). The calculations for these parameters are defined in the ISO standard document 13321 :1996 E and 22412.

[0058] The polydispersity index (PDI) of the particle diameter is preferably <0.05 to 0.8, more preferably <0.1 to 0.6, most preferably <0.2 to 0.5.

[0059] The concentration of the DNA strand (DNAS2) relative to the polymer (P) is preferably 1.5x1 O'10to 6.0x1 O’10mol (DNAS2) / mg polymer (P), more preferably 2.0 xIO’10to 5.0 xIO’10mol (DNAS2) I mg polymer (P), most preferably 3.5x1O'10to 5.0 x10'10mol (DNAS2) I mg polymer (P) or 2.0 x1O'10to 3.0 x1O'10mol (DNAS2) I mg polymer (P).Pharmaceutical composition

[0060] The invention further relates to a pharmaceutical composition comprising the particle as discussed above and at least one pharmaceutically acceptable carrier.

[0061] . As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The "pharmaceutically acceptable carrier" may be in the form of a solid, semisolid, liquid, or combinations thereof. Preferably, the carrier is suitable for enteral (such as oral) or parenteral administration (such as intravenous, intramuscular, subcutaneous, spinal or epidermal administration (e.g., by injection or infusion)). Depending on the route of administration, the active compound, i.e. , the compound of the invention, may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.

[0062] "Carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, including but not limited to peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered orally. Saline and aqueous dextrose are preferred carriers when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions are preferably employed as liquid carriers for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administrationto the patient. For administration by inhalation, the pharmaceutical composition of the invention is conveniently delivered in the form of an aerosol spray presentation from a pressurised pack or a nebulizer, with the use of a suitable propellant (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, nitrogen, or other suitable gas). In the case of a pressurised aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, for example, gelatine, for use in an inhaler or insufflator can be formulated containing a powder mix of the pharmaceutical composition of the invention and a suitable powder base such as lactose or starch The formulation should suit the mode of administration.Medical use

[0063] The particles and the pharmaceutic composition are for use in medicine.

[0064] In a further embodiment, the particles are for use in the treatment of a disease associated with RNA-overexpression, preferably cancer, viral infections, cardiovascular diseases, atherosclerosis, diabetes, and obesity.

[0065] Preferably, the overexpressed RNA is micro RNA which is bound by a binding site of DNAS2 or DNAS3, thus the particles effectively reduce the concentration of micro RNAs in the cytosol.Table 1 : Physiological role of exemplary micro-RNAs

[0066] Preferably, the cancer is selected from the group consisting of breast cancer, glioblastoma, melanoma, colorectal cancer, prostate cancer, lung cancer, liver, thyroid, kidney, pancreatic cancer, bladder cancer, hepatocellular cancer, nasopharyngeal cancer, esophageal cancer, gastric cancer, ovarian cancer, and Burkitt lymphoma.

[0067] A better understanding of the present invention and of its advantages will be had fromthe following examples, offered for illustrative purposes only. The examples are not intended to limit the scope of the present invention in any way.EXAMPLES OF THE INVENTION

[0068] 1. MucinMucin is a large glycoprotein that is the main structural component of mucus. Physiologically, mucins can be classified as secreted gel-forming mucins, secreted non-gel forming mucins, and cell-associated mucins anchored to cellular membranes by a transmembrane domain. Depending on their location and classification, mucins can carry vital functions such as lubrication, protection against pathogens and micro / nanoparticles, and regulation of molecular uptake [5]-[7], These diverse functionalities are made possible by their unique chemical structure carrying a hydrophilic core (glycosylated central region) and hydrophobic moieties (non-glycosylated termini). In detail, mucin macromolecules have an O-glycosylated backbone edged by cysteine regions and von-Willebrand factor-like domains at the termini that carry both anionic and cationic motifs. The protein backbone has a molecular weight of over 0.5 MDa, which including the glycosylation reaches values around a few MDa. The oligomerization due to disulfide bond formations by C-terminal cysteine knots and the carbohydrates increases mucin’s overall molecular weight up to 50 MDa [8], Thus, these properties that mucins hold make them ideal macromolecules for implementing specific functions to biomaterials and obtaining control in various processes, including the transport and adsorption of molecules. However, to ensure a certain level of functionality and to prevent unwanted structural alterations, Marczynski et al. [9] identified that the use of high-quality mucins is essential. Therefore, porcine gastric mucins were manually purified as described previously for further use as building blocks with slight modifications

[0010] , Several additional changes were applied to purified mucins to conjugate desired molecules (e.g., fluorescent molecules, oligonucleotides), or to immobilize them onto surfaces.

[0069] Mucin purificationPorcine gastric mucin MUC5AC was purified manually by following the protocol described in the reference with slight modifications [8], First, mucus from pig stomachs was collected by gently scraping the inner surface of the gastric tissue, diluted 5-fold in 10 mM sodium phosphate-buffered saline (PBS, pH = 7.0) containing 170 mM NaCI and 0.04 % sodium azide (Carl Roth, Karlsruhe, Germany), and stirred at 4 °C overnight. Cellular debris was removed via basic filtration using a tea filter followed by ultracentrifugation (150,000xg at 4 °C for 1 h). Next, mucins were separated by size exclusion chromatography (SEC) using an AKTA purifier system (GE Healthcare, Munich, Germany) equipped with an XK50 / 100 column packed withSepharose 6FF (GE Healthcare). The obtained mucin fraction was collected, NaCI concentration was increased to 1 M, and dialyzed against ddH2O. The dialyzed mucin samples were concentrated by crossflow filtration (Xampler Ultrafiltration Cartridge, GE Healthcare; MWCO: 100 kDa). The resulting concentrate was lyophilized and stored at -80 °C until further use (Fig. 6).

[0070] Mucin modificationsTo enable mucin-based multilayer formation or to detect mucin-based nanomaterials, manually purified mucins were fluorescently labeled (with carboxy modified ATTO390, ATTO488, or ATTO594, ATTO-TEC GmbH, Siegen, Germany) via carbodiimide coupling. Stock solutions of these dyes were prepared by dissolving them to a concentration of cStock = 10.0 mg / mL in either ultrapure water (for ATTO488, ATTO594) or DMSO (for ATTO390). Dye solutions were diluted to a concentration of cATTO = 1.0 mg / mL in 1 mL of 10 mM 2-(N- Morpholino)ethanesulfonic acid hemisodium salt buffer (MES; pH = 5). Afterwards, 5 mM EDC and 5 mM sulfo-NHS were added to this solution, and the mixture was allowed to incubate under shaking in the dark at RT for 3 h. In parallel, 40 mg of purified mucins were solubilized in 19 mL PBS (10 mM, pH = 7). Then, both solutions were mixed thoroughly (Vfinal = 20 mL), and again allowed to react at RT for 3 h, avoiding light. To remove unbound dye molecules, the mixture was dialyzed (Spectrum™ Spectra / Por™ Float-A-Lyzer™ G2, MWCO: 300 kDa, Carl Roth) against ddH2O for 2 days. The labeled mucins were lyophilized and stored at - 80 °C until further use. Oligonucleotides were conjugated to mucin glycoproteins through disulfide bond formation between thiol-modified DNA molecules and cysteine side chains of mucin glycoproteins. To do so, DNA sequences were obtained from Integrated DNA Technologies (IDT, Munchen, Germany) with the modification “Thio-Modifier C6 S-S linker” at the 5’ end, and stored in 0.1 mM EDTA containing 10 mM dithiothreitol (DTT). Before use, DTT was removed using an illustra-NAP-5 column (GE Healthcare, Freiburg, Germany). Next, purified mucins were dissolved to a concentration of 10 mg / mL in ddH2O, and oligonucleotides were added to this mucin solution with a final single-stranded DNA (ssDNA) concentration of 100 pM. The mucin / ssDNA solution was stirred at 4 °C overnight to allow mucin-ssDNA conjugation. Mucin glycoproteins were functionalized with folic acid for specific cell targeting via folate receptors. Folic acid was conjugated to carboxyl groups of mucin using carbodiimide chemistry. The folic acid conjugation to mucin glycoproteins was verified spectroscopically at 358 nm, and the conjugation efficiency was calculated using a folic acid standard curve (Fig. 7).

[0071] 2. Oligonucleotide designIn addition to being the hereditary information carrier in nature, due to their unique physical and chemical properties, DNA molecules are one of the essential tools for nanomedicine and(nano)material science. To form nucleic acid polymers, nucleotides are joined by phosphodiester bonds between the 5’ and 3’ carbon atoms of adjacent sugar rings. DNA base pairs are composed of two chains, running in opposite directions (oriented with opposite chemical polarities), and held together by a specific pairing of purine nucleotides with pyrimidine nucleotides (WatsonCrick base pairing). The linear sequence of nucleotides is commonly described using a one-letter code representing the base sequences (adenine, thymine, guanine, cytosine) beginning with the 5’ end of the chain. Adenine and thymine (A-T) base pairs are connected by two H-bonds, guanine and cytosine (G-C) pairs by three. Thus, slightly higher hybridization energy is observed for C-G rich sequences. The two strands of the DNA double helix are held together by hydrogen bonds between complementary base pairs. When two complementary DNA oligomers form a duplex by hybridization, the hybridization reaction is second order, and the reverse reaction where the duplex dissociation spontaneously takes place is first order (see scheme below).The equilibrium concentration of reactants and the product (duplex) is determined by the equilibrium constant (K) aswhere the kf denotes the forward reaction rate constant, and kr denotes the reverse rate constant. The equilibrium constant K is related to the standard Gibbs free energy change (DG°) of the reaction as described with van’t Hoff equation as _e~ G° / RT where R is the ideal gas constant and T is the absolute temperature. The stacking interactions between two bases of the same strand contribute strongly to the total energy gain of the hybridization reaction, and it depends on which bases are stacked. Therefore, the nearest neighbor model was found to allow for a precise prediction of the free energy DG°

[0019] , The free energy change can be predicted at different temperature, T:AG°(T) = (AH° - TAS°) where T is the absolute temperature, AH° is the change in enthalpy, and AS° is the change in entropy. The stability of the oligonucleotide constructs is strongly dependent on the ambienttemperature. The melting temperature of the product is defined as the temperature where the half of the duplex is dissociated, and can be calculated asBy using the nearest neighbor model, one can calculate not only the thermodynamic properties of the strand hybridization process, but also the thermal stability (melting temperature), and the energy associated with the hybridization of the DNA strands

[0020] ,

[0072] The forward reaction rate is dependent on temperature and the osmolarity of the environment. When electrostatic repulsion is screened, e.g., in high ionic strength buffer conditions, duplex formation is strongly promoted due to ion cloud generated around DNA structures, thus weakening the strong repulsion of negatively charged phosphate backbones. Therefore, typical hybridization environments contain a high salt content

[0021] , Software tools can predict the formation of secondary structures from the base sequence for given sequences at envisioned concentration and environmental conditions. Thus, synthetically obtained DNA oligonucleotides can be used as building blocks to generate precisely designed materials

[0022] , After Ned Seeman and his colleagues’ discovery of 4-way DNA arm junctions and their ability to connect networks through sticky ends, the generation of nano- to microstructures made of DNA has been explored exponentially

[0023] , Current DNA nanotechnology applications can be classified into two major compartments: First, structural DNA nanotechnology which focuses on the construction of static structures, and second,, dynamic DNA nanotechnology, where dynamic reaction networks based on DNA hybridization are designed

[0024] , However, obtaining a precisely controlled, functional DNA nanotool for a biomedical application requires the use of a simple design that relies on solid principles. In the projects that this thesis emphasizes, single-stranded oligonucleotides without secondary structures at the working conditions were designed to crosslink glycoproteins and / or to form nanoparticle aggregates to obtain precise control over their state, e.g., reversible condensation and aggregation. Polynucleotides were designed using the software OligoAnalyzer 3.1

[0025] and NLIPACK

[0026] and obtained from Integrated DNA Technologies (IDT, Munchen, Germany) in HPLC purified quality. The minimum free energy of the nucleotides was calculated according to nearest-neighbor empirical parameters. Gibbs free energy (AG°) values were calculated by considering the longest possible stretch of complementary bases. All oligonucleotides were dissolved in RNase-free EDTA (0.1 mM, pH = 8.0, Thermo Fisher), and their concentration was adjusted to 100 pM using a NanoDrop 200c spectrometer (Thermo Fisher). Oligonucleotide solutionswere stored at -20 °C until further use. To enable strong interactions with gold nanoparticles and mucin glycoproteins, oligonucleotides with a thiol modification were used. The latter sequences were obtained in their oxidized form, where the sulfur atoms were protected with disulfide bridges. Thus, these bonds were reduced by storing the oligonucleotides in 0.1 mM EDTA containing 10 mM reducing agent ( / .e., dithiothreitol, DTT) to release thiol groups by chemical reduction. DTT was immediately removed before use by passing the solution through an illustra NAP-5 column (GE Healthcare). Base pairing reactions and the conjugation to macromolecules were further analyzed with agarose gel and SDS-PAGE electrophoresis techniques.

[0073] 3. One-step condensationMucins were condensed as described in Yan et al.

[0027] but with slight modifications. After successful conjugation of DNA strands, mucins were incubated with the corresponding drug solutions for 4 h. Next, 250 pL of (drug-containing) mucin / DNA complexes (cMucin = 10 mg / mL) were added to 1 mL of glycerol solution (30 or 60 % v / v) to enable nanoparticle formation. To coat mucin nanoparticles with a cationic polymer, particles were subjected to a second condensation step. Here, a 30 % (v / v) glycerol solution containing either chitosan (chitosan 90 / 20, Heppe Medical Chitosan, Halle, Germany) or poly(L-lysine) (PLL, Sigma Aldrich) was added to the mucin nanoparticle / glycerol mixture with a final concentration of the cationic polymer of 0.05 mg / mL. Mixtures were dialyzed against 150 mM of NaCI solution to remove glycerol, excess coating substance, or unbound oligonucleotides.

[0074] 4. Dynamic light scattering and zeta potentialDuring dynamic light scattering (DLS) measurements, particles are illuminated with laser light (A = 658 nm from a single-frequency laser diode that provides 40 mW). The dynamic fluctuation in the scattered light is quantified. Due to Brownian motion, dispersed particles move continuously while randomly colliding with the surrounding molecules. The speed of the particles can be related to their size: smaller particles move faster than larger ones, and this relation is defined in the Stokes-Einstein equation with the assumption of spherical geometry and liquid with a low Reynolds number 80. The diffusion coefficient, D, of the particle’s Brownian motion is proportional to the particle’s mobility:where D denotes the diffusion coefficient, kB'. Boltzmann constant, T absolute temperature, h: dynamic viscosity and r: the hydrodynamic radius of a spherical particle.Thus, DLS is an important micro- and nanoparticle characterization tool that gives information about hydrodynamic size, stability, conformational change, degradation, and phase transition temperature of nanoparticulate objects. Another important nanoparticle characteristic is defined with zeta potential, the electrokinetic potential. If the solid-body surface of a material is brought into contact with an electrolyte solution, it undergoes a change in the charge distribution at the interface. Ions closer to the particle proximity are strongly bound on their surface to a distance that generates the Stern layer. Ions after that point are loosely bound to those located at the Stern layer, which overallgenerates the diffuse layer. This phenomenon is called “the electrical double layer (EDL)”, and itexists around each particle. The thickness of the EDL is represented by the Debye length whichdepends on the ionic strength, and thus, on the concentration, charge, and valency of the ions. Within this definition, an internal boundary exists where the ions located at the Stern layer and toan extent of the diffuse layer move with the particles. The EDL model distinguishes between astationary immobile and diffuse mobile layer of counterions that compensate for the surfacecharge. After one point, any ion will stay in its location, and will not be affected by particlemovement. This boundary is called the slipping plane. The electrophoretic potential at theslipping plane is called ^-potential

[0030] , The zeta potential of particles dispersed in liquid is measured by the electrophoretic light scattering (ELS) technique. Therefore, samples are placed into a micro-electrophoresis systemequipped with electrodes to which potential is applied at either end. Particles move towards theoppositely charged electrode and their velocity is measured and expressed in unit field strength astheir electrophoretic mobility. Then, the Henry equation is applied to relate the electrophoreticmobility to the zeta potential:where UE is the electrophoretic mobility, e is dielectric constant, x is zeta potential, h is viscosity, and f(ka)is Henry’s function. For aqueous dispersions that exhibit H+ and OH- as major ionic constituents, zeta potential value is strongly affected by pH and the ionic strength. Importantly, the zeta potential decreases with increasing ionic strength due to a compression of the electrochemical double layer at high ionic strength. A common approach in drug delivery research is to correlate the absolute zeta potential value with the colloidal stability. However, the colloidal stability not only depends on electrostatic repulsive forces but also van der Waals attractive forces, thus, it is also possible to reach a highly stable nanoparticulate system with a low zeta potential value

[0031] , Steric interactions and thedispersant-particle dynamics must be considered in detail for stability assessments.Nanocarriers developed in this thesis were characterized in terms of their hydrodynamic size andzeta potential using a LitesizerTM 500 (Anton Paar). The temperature was either set to the targetvalue or a temperature ramp was applied to detect dynamic size changes. For some particularcases, transmittance, intensity trace, and the polydispersity index (PDI) values were also recordedas further indicators for colloidal behavior {e.g., aggregation, degradation, phase transition) and the broadness of the size distribution.

[0075] 5. Systems used for the detection of released objectsBased on the application area, drug carrier type, and the drug release mechanism, several strategies were applied to detect the released objects (e.g., drug molecules, fluorescence molecules, probe nanoparticles) spectrophotometrically.

[0076] 6. Release from dispersionsIn the settings where the carrier matrix is dispersed in a liquid (e.g., nanoparticle dispersions), dialysis tubes were selected as semi-permeable reservoirs to conduct drug release experiments. First, the (drug carrying) nanoparticle dispersion with a known volume and concentration was placed into dialysis tubes (donor compartment). Dialysis tubes were selected by considering the largest molecular weight cut-off that does not cause loss of the desired molecular species to retain inside the donor. Next, dialysis tubes were placed into a beaker containing drug-free buffer with a known volume. Since the dialysis tubes do not interact with diffused objects, the setting allows for the detection of freely diffusing molecules that are liberated from the carrier matrices.

[0077] 7. In vitro cell culture studiesIn the frame of this thesis, immortalized mouse embryonic fibroblasts (NIH / 3T3) and human epithelial cells (HeLa) were used to assess the biological activity of the fabricated materials. NIH / 3T3 cells were cultured in Dulbecco’s modified Eagle medium (DMEM; Sigma Aldrich) supplemented with 10 % fetal bovine serum (FBS; Sigma Aldrich) and 1 % penicillin / streptomycin. HeLa cells were cultured in minimum essential medium (MEM; Sigma Aldrich) containing 10 % (v / v) FBS, 2 mM L-glutamine solution (Sigma-Aldrich), and 1 % (v / v) nonessential amino acid solution (Sigma-Aldrich). Cultured cells were incubated at 37 °C in a humidified atmosphere and 5 % CO2.

[0078] 8. Fluorescence staining of cellular sub-compartmentsFor a visualization of cells or their sub-compartments, several staining techniques were employed. The cell nuclei were stained with 4,6-diamino-2-phenylindole (DAPI; Ex / Em: 340 / 488 nm; Sigma Aldrich) by incubating cells with 300 nM DAPI solution prepared in PBS for 30 min. The endosomal escape of (fluorescently labeled) nanoparticles was determined with colocalization experiments. Therefore, one-fourth of the cell culture medium was replaced with nanoparticle dispersion containing 1 pL of endosome marker FM 4-64 (10 pg / mL in ddH2O, Ex / Em: 515 / 640 nm; Invitrogen T1330). Cells were incubated for 24 h, washed twice, fixed with 4% formaldehyde, and imaged for analysis. To detect individual cell types in 3D coculture models, cell trackers were used which remain in cells through several generations but do not getting transferred to adjacent cells in a population. To do so, dispersed cells were incubated either with 25 pM CellTracker™ Blue CMAC Dye (Ex / Em: 353 / 466 nm; Thermo Fisher) or 1 pM CellTracker™ Red CMTPX Dye (Ex / Em: 577 / 602 nm; Thermo Fisher) that were dissolved in serum-free medium at 37 °C for 30 min, centrifuged toremove excess dye, and resuspended in dye-free medium.

[0079] 9. Cytotoxicity assessmentThe in vitro cytotoxicity of materials fabricated in this thesis and their degradation byproducts were assessed with one-step Live / Dead staining (direct) and indirect WST-1 cytotoxicity tests. For direct detection, cells were stained with a solution containing two fluorescent dyes that can separately label live and dead cells. Calcein acetoxymethyl (calcein-AM, Ex / Em: 496 / 516 nm; ThermoFisher) is a membrane-permeant and non-fluorescent molecule until ubiquitous intracellular esterases remove ester groups and render the molecule fluorescent. In contrast, ethidium homodimer-1 dye (EthD-1 , Ex / Em: 493 / 528 nm; ThermoFisher) enters damaged membranes of dead cells and binds to their nucleic acids with high affinity. After incubating with Live / Dead solution for 30 min, cells were imaged using a fluorescence microscope. Stained cells that do not require Z-stacking were imaged using an inverted epifluorescence microscope (DMi8, Leica, Wetzlar, Germany) using either LED405 filter cube (Ex. = 375 - 435, DC = 455, Em. = 592 - 668, Leica) or FITC filter cube (Ex. = 460 - 500, DC = 505, Em. = 592 - 668, Leica). Images were acquired with a digital camera (Orca Flash 4.0 C11440, Hamamatsu, Japan) using the software Leica Application Suite X. For the samples where the z-stacking was required, a confocal microscope (Stellaris 8 Falcon, Leica) equipped with tunable White Light Laser (WLL) and Diode 405 laser was used. The number of viable cells in culture is proportional to the total mitochondrial dehydrogenase activity. The indirect WST-1 assay is based on the cleavage of the tetrazolium salt WST-1 to formazan by cellular mitochondrial dehydrogenases. To assess the cytotoxicity of the degradation products of the materials prepared here, an indirect (following the ISO-10993 standards), or direct cytotoxicity test was applied

[0033] , For the indirect cytotoxicity tests, materials were incubated incorresponding media at 4 °C overnight, and sterile filtered to be used as a culture medium for the cells seeded with a density of 5000 cells / well to 96-well tissue culture well plates. For the direct cytotoxicity assessments, nanoparticle dispersions (in sterile culture medium) were replaced with the culture medium. After desired incubation time, the cytotoxicity of the material extracts was assessed with colorimetric WST-1 assay (Roche) at 450 nm following the manufacturer’s protocol.

[0080] 10. Flow cytometryA flow cytometer equipped with a 488 nm argon-ion laser (15 mW) was used to detect the cellular internalization of (Atto-488 labeled) nanoparticles over 1 h, 4 h, and 24 h (BD FACSCalibur, OS X,BD Biosciences, San Jose, CA). Per sample 10,000 events were recorded and analyzed using CellQuest software (BD Biosciences). In these measurements, membrane-bound nanoparticles in the population were quenched with trypan blue. In cases where the endogenous trigger is not significantly present in off-target cells, nanoparticles were externally triggered by delivering the trigger DNA to the cells using a transfection reagent following the manufacturer’s protocol (INTERFERin®, Polyplus Transfection, lllkirch, France). The responsible mechanism for the uptake of (Atto-488 labeled) nanoparticles was determined by incubating NPs with the cells with blocked uptake pathways for 2 h (200,000 cells / well). To do so, those cells were pre-incubated with one of the following inhibitors for 1 h: 7 pg / mL chlorpromazine (clathrin-mediated endocytosis inhibitor; Sigma Aldrich), 1 pg / mL filipin (caveolae-mediated uptake inhibitor; Sigma Aldrich), or 50 pM amiloride (a specific inhibitor for the Na+ / H+ exchange during macropinocytosis; Sigma Aldrich). As a control group, cells that are not incubated with any of those inhibitors were used. To detect cellular apoptosis, Annexin V / PI double staining kit (eBioscience™, Annexin V Apoptosis Detection Kit FITC; Thermo Fisher Scientific) was used. The Annexin V fluorescent signal corresponds to cellular apoptosis (which can be detected with FL1 laser; 488 nm, 530 / 30 nm) whereas propidium iodide (PI) signal (which can be detected with FL2 laser; 488 nm, 585 / 42 nm) corresponds to necrotic or late apoptotic cells, characterized by the loss of plasma integrity. To determine whether cells undergo an apoptotic pathway upon incubation with mucin NPs, target and off- target cells (100,000 cells / well) were incubated with mucin NP variants for 4 h. Experiments were conducted following the manufacturer’s protocol and 10,000 events / sample were recorded under medium flow. The plotted data (PI vs. Annexin V) were divided in four regions to specify: / ) viable cells (Pl / Annexin V - / -); / / ) early apoptotic cells (Pl / Annexin V - / +); Hi) late apoptotic cells (Pl / Annexin V + / +); and iv) necrotic cells (Pl / Annexin V + / -). The results were analyzed using the software CellQuest (BD Biosciences).

[0081] 11. Fractionation TechniquesTo determine whether drugs / drug carriers are trapped in the cellular membrane or internalized, cells incubated with nanocarriers were subjected to lysis to fractionate the cytosol and membrane parts. To do so, trypsinized and centrifuged cells (200,000 cells / well in 12 well plates) were resuspended in 100 pL of lysis buffer (20 mM HEPES, 10 mM KCI, 2 mM MgCh, 1 mM EDTA, 1 mM EGDA, pH = 7.2) and incubated on ice for 15 min. Next, samples were centrifuged at 20,800xg at 4 °C for 45 min. Supernatants (cytosol fraction) and sedimented pellets that are dissolved in lysis buffer (membrane fraction) were analyzed spectroscopically to determine their cargo content. The miRNA elevation levels were determined by the qPCR technique. To do so, corresponding cells were cultivated up to > 75% confluency, trypsinized, and suspended in PBS. miRNA was isolated from the cells (» 106) following the instructions of the kit (High Pure miRNA Isolation Kit, F. Hoffmann - La Roche AG, Basel, Switzerland) and the concentration was measured using a NanoDrop 2000c spectrometer (Thermo Fisher). Per 20 pL reaction, 200 ng of isolated RNA was reverse transcribed into single-stranded cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher). Stem-loop primers (Invitrogen, Thermo Fisher Scientific) specific for miR-21 as well as U6 ( / .e., the housekeeping gene) were designed as specified by Chen et al.

[0034] (Table A1). miR-21 expression level of the different cells was quantified using real-time polymerase chain reaction (RT-PCR). The reaction was carried out using KiCqStart® SYBR® Green qPCR ReadyMixTM (Sigma-Aldrich) and an “Mx3005P Real-Time PCR System” (Agilent Technologies, Inc., Santa Clara, CA, USA) according to the manufacturer’s specifications. The primers (Invitrogen, Thermo Fisher Scientific) used for RT-PCR reactions were designed according to Xu et al.

[0035] and Zhang et al.

[0036] (Table A1). U6 was used as an internal control to normalize the expression level of target miRNAs. The relative expression of miR-21 was calculated using the 2'ACtmethod with ACt = CtmiR-21 -CtU6.

[0082] 12. Statistical analysis and graphical representationIn this thesis, GraphPad Prism (Prism 9, GraphPad Software, San Diego, CA, USA) software was used for data plotting and statistical analyses. Before each analysis, the normal distribution of the measured values was confirmed with the Shapiro-Wilk or the Kolmogorow- Smirnow-Lilliefors tests. A Student’s t-test was performed for normally distributed populations with homogeneous variances, whereas a Welch’s t-testwas used in case of unequal variances. One-way ANOVA and Tukey’s multiple comparison test were conducted for the comparison between multiple samples. If not stated otherwise, the statistical level of significance was set to p < 0.05 and marked with an asterisk. Schematic representations were created using the software Affinity Designer (v. 1.10.03; Serif Ltd., Nottingham, UK) and BioRender.com.

[0083] 13. Polyacrylamide gel electrophoresisPolyacrylamide gel electrophoresis (PAGE) was employed to demonstrate binding interactions between mucins and thiolated crosslinker DNA strands. As a control, a similar DNA sequence but without thiol-modification was used. As a preparatory step prior to gel electrophoresis, 100 mM crDNA was incubated in the presence of 500 mM dithiothreitol (DTT) and 0.5 mM tris-(2- carboxyethyl)-phosphine hydrochloride (TCEP, Carl Roth, Karlsruhe, Germany) at room temperature (RT) for 2 h. Then, purified mucin was added to the DNA solution to a final mucin concentration of 0.1 mg / mL and incubated overnight. The next day, 6* sample loading buffer (Sigma-Aldrich) was added, and the samples were loaded onto Mini-PROTEAN TBE Precast Gels (BIO-RAD, Munich, Germany). Electrophoresis was performed at 100 V in 0.5* Tris- Borat-EDTA (TBE) buffer (pH 8.0) containing 5 mM DTT. DNA staining was conducted by incubating the gel with an SYBR Safe solution (Sigma-Aldrich) in 0.5x TBE buffer for 1 h. Pictures were recorded on a Molecular Imager Gel Doc XR System (BIO-RAD). Protein bands were visualized by staining the gel with a Coomassie staining solution overnight, and gel imaging was conducted after destaining the gel with a 10% acetic acid solution.

[0084] 14. miRNA expression levels Isolation of miRNA.MicroRNA (miRNA) was isolated from cells using the commercial High Pure miRNA Isolation Kit (F. Hoffmann-La Roche AG, Basel, Switzerland). For each isolation, -106 cells were used. In brief, the cells were lysed by adding 150 pL of 20 % lysis buffer and passing the cell suspension 10x through a sterile 20-gauge needle (0 = 0.9 mm, Sterican; B. Braun SE, Melsungen, Germany). For the isolation of small RNA (<100 nucleotides), the 2-column protocol provided by the manufacturer was followed. The RNA was eluted in PCR-grade water and immediately frozen at -80 °C. The purity of the isolated RNA was checked using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA synthesis: The isolated small RNA was reverse transcribed into single-stranded cDNA using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Per 20 pL reaction, 200 ng of isolated RNA was used. In brief, the RNA was mixed with the provided reverse transcription buffer, dNTPs (0.25 mM each), MultiScribeTM reverse transcriptase (50 U pL-1), nuclease-free water, and suitable primers according to the manufacturer’s specifications. Stemloop primers (Invitrogen, Thermo Fisher Scientific) specific for miR-21 ( / .e., the gene of interest) as well as U6 ( / .e., the housekeeping gene) were designed as specified by Chen et al.

[0034] (Table 2). The transcription reaction was performed in a three-step procedure: first incubation at 25 °C for 10 min followed by incubation at 37 °C for 2 h, and incubation at 85 °C for 5 min. The amounts of generated cDNA were quantified using a NanoDrop 2000c spectrophotometer, and the cDNA was stored at -80 °C until further use.

[0085] Detection of miRNA-21 expression levels: Following cDNA synthesis, the differences in the miR-21 expression levels between different cell lines (or in one cell line before and after administration of mucin nanoparticles) were quantified using real-time polymerase chain reaction (RT-PCR). The reaction was carried out using the KiCqStart® SYBR® Green qPCR ReadyMix™ (Sigma-Aldrich, St. Louis, MO, USA) and an ‘Mx3005P Real-Time PCR System’ (Agilent Technologies, Inc., Santa Clara, CA, USA) according to the manufacturer’s specifications. In brief, 5 pg of the synthesized cDNA were mixed with 10 pL ‘KiCqStart® SYBR® Green ReadyMixTM’, 1.8 pL of the primer mix (containing forward and reverse primers; final concentration: 300 nM), and nuclease-free water to a final volume of 20 pL per reaction.

[0086] For RT-PCR, the reactions were incubated in the thermal cycler in 8-tube PCR strips (Thermo Fisher Scientific) at 94 °C for 2 min for initial denaturation, followed by 40 cycles of 94 °C for 15 s and 60 °C for 1 min. Dissociation from 65 to 95 °C was conducted to confirm the specificity of the amplification products. U6 was used as an internal control to normalize the expression level of target miRNAs. The relative expression of miR-21 was calculated using the 2-ACt method with ACt = CtmiR-21 -CtU6. All RT-PCR reactions were performed at least in triplicates (n = 3). The total RNA content of 2x 106 HeLa cells (which overexpress miR-21 , target group) grown in a 2D cell culture was harvested in PCR-grade water using the ‘High Pure miRNA Isolation Kit’ following the 1-column protocol provided by the manufacturer. The amount of RNA in the collected fractions was quantified using a NanoDrop 2000c spectrophotometer, and 2 pg of RNA were incubated with antimiR ssDNA in a mass ratio of 1 :1 at 37 °C for 1 h during gentle shaking. As a control, 2 pg of isolated RNA were incubated with PCR-grade water at identical conditions. Afterwards, these reaction mixtures were subjected to the 2-column protocol described by the manufacturer of the ‘High Pure miRNA Isolation Kit’ to isolate only small RNAs (<100 nucleotides) in PCR-grade water. To verify the depletion of free miR-21 from the reaction mixture by base pairing with the provided antimir ssDNA strands, cDNA was synthesized as described above (as explained under cDNA synthesis) followed by quantification using qPCR as indicated before.Table 2: Primers used to quantify miR-21 expression levels (Sequences from 5’ to 3’)

[0087] 15. Calibration curvesStandard curves for the molecules were obtained by measuring the absorbances of serially diluted solutions made of tested molecules with a spectrophotometer (specord 210, Analytikjena, Jena, Germany) or spectrofluorometer (Victor 3, Perkin Elmer, Rodgaum, Germany). As a reference, the solvent that was used for dissolving the test molecule was selected and scanned at the same wavelength range. The wavelength at which the tested molecule gives the highest peak was selected for the preparation of a standard curve that relates the absorbance (or fluorescence) values with the concentration. In the concentration range tested, a linear relation between the absorbance (or fluorescence) values and the tested molecule concentration holds. The concentration range where the coefficient of determination (R2) value over 0.95 acquired was selected to plot the standard curves to determine the concentration of the molecules in a solution with an unknown concentration.• Standard curves used for the spectrometric confirmation of conjugation of functional molecules to the polymers: Fig. 7.• Standard curves used for the spectrometric detection of drug release: Fig. 8.

[0088] 16. Oligonucleotide design

[0089] 16.1 Autonomous strand displacement reactions triggered by endogenous markers to release drugs from DNA-stabilized mucin nanoparticlesTo initiate the drug release in the cells, two set of DNA designs were used in this study, the release is autonomously initiated, experiments were performed with the sequences given in Table 3.Table 3: Designed oligonucleotide sequences for the HeLa-cell specific release experiments. The table lists their dimerization energy, melting temperature and the possible number of hybridized base pairs when they interact with antimir-21 strands.

[0090] 16.2 Targeted miRNA therapy via mucin nanoparticles stabilized with gene silencing strandsHere, two different sets of DNA sequences were designed to obtain different mode of actions: The first set of DNA sequences were designed to stabilize mucin NPs that can adsorb excessive miRNA- 21 from the environment without initiating a conformational change in the mucin NP structure whereas the stability of the second set of sequences were corrupted by the precense of excessive miRNA-21 : Here, NP stability was achieved due to the base pairing interactions between the “miRsilencing” region of the antimiR and bridge DNA. When the cellular miRNA-21 or its synthetic counterpart was incubated with those NPs, a shift in the most favorable structure from bridgeantimiR to miR-antimiR induces a conformational change in the mucin NP structure.Table 4: Designed oligonucleotide sequences.

[0091] . Intracellular delivery mechanisms controlled by strand displacement reactions Stability of the mucin nanoparticles at different pH levels and in the presence of enzymesThe average hydrodynamic size and the derived count rate (a parameter that is function of the number of intact nanoparticles) were tracked to analyze the stability of the nanoparticles. An incubation pH of 7.4 and 5.2 were selected as they represent cytoplasmic and endosomal pH level, respectively. It was found that the nanoparticles maintain their condensed configuration and count rate with a minimal fluctuation in the polydispersity index (PDI). After exposure to trypsin, a slow decrease in the derived count rate was observed over time. This observation can be attributed to the fact that trypsin treatment of mucins removes the terminal domains of the glycoprotein

[0042] , When nanoparticles were exposed to high concentration of DNasel (50 pg / mL), a rapid size change was observed indicating the nanoparticle deformation. However, under physiological DNasel concentration of 0.025 pg / mL, nanoparticles were found stable over time.Table 5: PDI values of mucin nanoparticles that were incubated at different environmental conditions up to 14 days.*data was taken after 4 h

[0092] NPs as antibiotic carriers to combat cellular infectionsNPs developed here can be evaluated as an antibiotic delivery agent to combat intracellular infections such as those induced by Listeria monocytogenes, or Pseudomonas aeruginosa which are challenging to treat. These bacteria lead to severe diseases such as listeriosis, pneumonia, endocarditis, and meningitis, mainly targeting macrophages and epithelial cells

[0045] ,

[0046] , In these cases, the bacterial pathogens hide in the macrophages, where they are protected from systemic antibiotic administration, and persistent infection of macrophages can lead to further spreading of the infection and infection recurrence.

[0047] With the strategy developed here, mucin NPs can be evaluated to target macrophages: even without a cationic polymer coating step, macrophages could quickly internalize mucin NPs in 2 h, possibly dueto their active uptake mechanism as confirmed with confocal imaging and FACS, without causing any cytotoxic effects (Fig. 9).

[0093] Additionally, NPs can also be efficiently loaded with different groups of antibiotics possessing different overall charges, and their release can be triggered with a dDNA trigger. In the preliminary experiments of this study, when the membrane and cytosol fractions of the NP-treated cells were analyzed separately, it was found that the NPs can concentrate the drugs in the cytosol compared to the cells incubated with free drugs possessing » 12 times less drug concentration. Importantly, the delivered dose via mucin NPs exceeds the subtherapeutic levels ( / .e., higher than corresponding MIC values) for various bacterial species, including Staphylococcus spp., some Streptococcus groups, and P. aeruginosa

[0048] ,

[0049] , Therefore, these findings showed that NPs developed here might act as efficient vectors to overcome the diffusion-related rapid clearance of drugs from the extracellular environment. However, although these experiments show that the cytosolic accumulation of drugs is facilitated via a mucin NP system, the setup does not allow for quantifying the liberated TCL upon a trigger DNA transfection. In all cases ( / .e., no transfection, coDNA, and dDNA transfection), 0.30 - 0.45 mM of TCL was detected at cytosol fractions, regardless of their liberated or entrapped state. Thus, to examine whether the drug was successfully liberated under desired conditions, these fractions were subjected to dialysis, allowing free drug molecules to diffuse out while keeping the mucin NP-entrapped drug retained in the membrane. After 2 days of dialysis, a significant decrease in TCL was detected for cytosol fractions transfected with the dDNA - but not for the other two populations. This finding demonstrated that the dDNA transfected cytosols contain liberated TCL molecules, which is consistent with previous observations. From those tests, it can be concluded that the DNA- based release strategy is applicable for different types of drug in the subcellular microenvironment and that cytoplasmic components do not compromise the mechanism.

[0094] Threshold trigger DNA amount required to trigger cationic polymer coated mucin NPs To investigate whether addition of a cationic polymer coating to the NP formulation step rendered the dDNA induced decondensation of NPs, PLL-coated NPs were incubated with a concentration series of dDNA solutions which corresponds to 1 - 10 dDNA per cDNA / crDNA pair. In parallel, a similar set of conditions (however, in the range of 1 - 20 dDNA per crDNA crosslink) were tested to detect the minimum dDNA concentration that initiates a remarkable drug release from mucin NPs.The invention further comprises the following items:1. Particle comprisingA) a) at least one polymer (P) forming particles; b) at least one DNA strand (DNAS1); c) at least one further DNA strand (DNAS2) comprising at least one binding site capable of binding to RNA and at least two binding sites capable of binding to (DNAS1); wherein the polymer (P) is connected with (DNAS1) optionally via d) at least one linker element (LE1) connecting the polymer (P) with the at least one DNA strand (DNAS1) orB) a) at least one polymer (P) forming particles; b) at least one DNA strand (DNAS1); c) at least one further DNA strand (DNAS3) comprising at least one binding site capable of binding to RNA and at least one binding site capable of binding to (DNAS1): d) at least one linker element (LE1) connecting the polymer (P) with the at least one DNA strand (DNAS1): e) at least one linker element (LE2) connecting the polymer (P) with the at least one DNA strand (DNAS3).2. The particle of item 1 , wherein the polymer (P) i) is non-toxic to cells; and / or ii) is a biopolymer; preferably selected from the group consisting carbohydrates, proteins, more preferably selected from the group consisting of mucin most preferably MLIC5AC, MLIC5B, MUC2.3. The particle of items 1 or 2, wherein the DNA strand (DNAS1) i) is a single strand molecule; and / or ii) has a length of 10 to 50 bases, more preferably 15 to 30 bases, and / or iii) has a sequence (from 5’ to 3’) selected from the group consisting of SEQ. ID No. 1 : TGGTCTAATTTGCGCG, SEQ. ID No. 2: CCCTATGTTGACGCTAGCTTA.4. The particle of items 1 to 3, wherein the DNA strand (DNAS2)i) is a single strand molecule; and / or ii) has a length of 10 to 60 bases, more preferably20 to 40 bases, and / or iii) has a sequence (from 5’ to 3’) selected from the group consisting of SEQ. ID No. 3:CGCGCAAATTTCAACATCAGTCTGATAAGCTACGCGCAAATT, SEQ. ID No. 4: GCGTCAACATCAGTCTGATAAGCTAGCG and / or iv) binds to a RNA molecule, preferably a micro RNA; and / or v) binds to micro RNA selected from the group consisting of: miR-21 , miR-10b, miR-33, miR- 103, miR-107, miR-141 , miR-155.5. The particle of items 1 to 4, wherein the linker element (LE1) or (LE2) is a disulfide bridge, biotin, cholesterol, an amide group,6. The particle of items 1 to 5, wherein the particle is capable of entering a cell; and wherein optionally the particle comprises a molecule which is connected with the polymer (P) which facilitates entering of the particle into the cell, preferably selected from folic acid, antibodies, aptameres.7. The particle of items 1 to 6, wherein i) the hydrodynamic diameter of the particle is 50 to 500 nm, preferably 140 to 350 nm or 200 to 300 nm; and / or ii) the polydispersity index (PDI) of the particle diameter is <0.05 to 0.8, preferably <0.1 to 0.6, more preferably <0.2 to 0.5 and / or iii) the concentration of the DNA strand (DNAS2) relative to the polymer (P) is 1.5x1 O'10to 6.0x1 O'10mol (DNAS2) I mg polymer (P), preferably 2.0 x10'10to 5.0 x10'10mol (DNAS2) I mg polymer (P), more preferably 3.5x1 O'10to 5.0 x10'10mol (DNAS2) I mg polymer (P) or 2.0 x10'10to 3.0 x10'10mol (DNAS2) I mg polymer (P).8. The particle of items 1 to 7, wherein the particle comprises a further pharmaceutically active compound.9. The particle of item 8, wherein the pharmaceutically active compound is i) a small molecule of a molecular weight of 100 g / mol to 800 g / mol, preferably and / or ii) a) encapsulated by the polymer (P) without forming a covalent bond orb) covalently bonded to the polymer (P) and / or iii) is for use in the treatment of cancer.10. A pharmaceutical composition comprising the particle according to items 1 to 7 and at least one pharmaceutically acceptable carrier.11. The particle of items 1 to 9 or the pharmaceutical composition of item 10 for use medicine.12. The particle of items 1 to 9 or the pharmaceutical composition of item 10 for use in the treatment of a disease associated with RNA-overexpression, preferably cancer, viral infections, cardiovascular diseases, atherosclerosis, diabetes, and obesity.13. The particle or pharmaceutical composition for use of item 10, the cancer is selected from the group consisting of breast cancer, glioblastoma, melanoma, colorectal cancer, prostate cancer, lung cancer, liver, thyroid, kidney, pancreatic cancer, bladder cancer, hepatocellular cancer, nasopharyngeal cancer, esophageal cancer, gastric cancer, ovarian cancer, and Burkitt lymphoma.REFERENCES1. Kimna C et al. DNA Strands Trigger the Intracellular Release of Drugs from Mucin- Based Nanocarriers. ACS Nano. 2021 Feb 23;15(2):2350-2362. doi: 10.1021 / acsnano.0c04035. Epub 2020 Aug 11. PMID: 328060312. Yan H et al. Reversible Condensation of Mucins into Nanoparticles. Langmuir. 2018 Nov 13;34(45): 13615-13625. doi: 10.1021 / acs.langmuir.8b02190. Epub 2018 Nov 5. PMID: 30350704.3. Zhang Z et al. Antitumor Activity of Anti-miR-21 Delivered through Lipid Nanoparticles. Adv Healthc Mater. 2023 Jan;12(6):e2202412. doi: 10.1002 / adhm.202202412. Epub 2022 Dec 9. PMID: 36412002.4. L. Ma Chapter Six - MicroRNA and Metastasis, Advances in Cancer Research Volume 132, 2016, Pages 165-207.5. Coles, J. M., Chang, D. P. & Zauscher, S. Molecular mechanisms of aqueous boundary lubrication by mucinous glycoproteins. Current Opinion in Colloid & Interface Science 15, 406- 416 (2010).6. Song, D., Cahn, D. & Duncan, G. A. Mucin biopolymers and their barrier function at airway surfaces. Langmuir 36, 12773-12783 (2020).7. McGuckin, M. A., Linden, S. K., Sutton, P. & Florin, T. H. Mucin dynamics and enteric pathogens. Nature Reviews Microbiology 9, 265-278 (2011).8. Bansil, R. & Turner, B. S. Mucin structure, aggregation, physiological functions and biomedical applications. Current Opinion in Colloid & Interface Science 11 , 164-170 (2006).9. Marczynski, M. et al. Structural Alterations of Mucins Are Associated with Losses in Functionality. Biomacromolecules (2021).10. Schdmig, V. J. et al. An optimized purification process for porcine gastric mucin with preservation of its native functional properties. RSC Advances 6, 44932-44943 (2016).11. Hemshekhar, M. et al. Emerging roles of hyaluronic acid bioscaffolds in tissue engineering and regenerative medicine. International Journal of Biological Macromolecules 86, 917-928 (2016).12 Burdick, J. A. & Prestwich, G. D. Hyaluronic acid hydrogels for biomedical applications. Advanced materials 23, H41-H56 (2011).13. Augst, A. D., Kong, H. J. & Mooney, D. J. Alginate hydrogels as biomaterials. Macromolecular bioscience 6, 623-633 (2006).14. Rogers, C. I., Pagaduan, J. V., Nordin, G. P. & Woolley, A. T. Single-monomer formulation of polymerized polyethylene glycol diacrylate as a nonadsorptive material for microfluidics. Analytical chemistry 83, 6418-6425 (2011).15. Rogers, C. I. et al. Microfluidic valves made from polymerized polyethylene glycol diacrylate. Sensors and Actuators B: Chemical 191 , 438-444 (2014).16. Yang, F. et al. The effect of incorporating RGD adhesive peptide in polyethylene glycol diacrylate hydrogel on osteogenesis of bone marrow stromal cells. Biomaterials 26, 5991-5998 (2005).17. Zhang, X., Yang, D. & Nie, J. Chitosan / polyethylene glycol diacrylate films as potential wound dressing material. International journal of biological macromolecules 43, 456-462 (2008). 18. Anselmo, A. C. et al. Elasticity of nanoparticles influences their blood circulation, phagocytosis, endocytosis, and targeting. ACS nano 9, 3169-3177 (2015).19. SantaLucia, J. A unified view of polymer, dumbbell, and oligonucleotide DNA nearestneighbor thermodynamics. Proceedings of the National Academy of Sciences 95, 1460-1465 (1998).20. SantaLucia, J., Allawi, H. T. & Seneviratne, P. A. Improved nearest-neighbor parameters for predicting DNA duplex stability. Biochemistry 35, 3555-3562 (1996).21. Jeon, B.-j. et al. Salt-dependent properties of a coacervate-like, self-assembled DNA liquid. Soft Matter 14, 7009-7015 (2018).22. Lin, C., Liu, Y., Rinker, S. & Yan, H. DNA tile based self-assembly: building complex nanoarchitectures. ChemPhysChem 7, 1641-1647 (2006).23. Seeman, N. C. & Kallenbach, N. R. Design of immobile nucleic acid junctions. Biophysical journal 44, 201-209 (1983).24. Simmel, F. C., Yurke, B. & Singh, H. R. Principles and applications of nucleic acid strand displacement reactions. Chemical reviews 119, 6326-6369 (2019).25. Owczarzy, R. et al. IDT SciTools: a suite for analysis and design of nucleic acid oligomers. Nucleic acids research 36, W163-W169 (2008). 26. Zadeh, J. N. et al. NUPACK: analysis and design of nucleic acid systems. Journal of computational chemistry 32, 170-173 (2011).27. Pawar, A., Thakkar, S. & Misra, M. A bird's eye view of nanoparticles prepared by electrospraying: advancements in drug delivery field. Journal of controlled release 286, 179- 200 (2018).28. Nguyen, D. N., Clasen, C. & Van den Mooter, G. Pharmaceutical applications of electrospraying. Journal of pharmaceutical sciences 105, 2601-2620 (2016).29. Crouzier, T., Beckwitt, C. H. & Ribbeck, K. Mucin multilayers assembled through sugar-lectin interactions. Biomacromolecules 13, 3401-3408 (2012).30. Bhattacharjee, S. DLS and zeta potential-what they are and what they are not? Journal of controlled release 235, 337-351 (2016).31. Missana, T. & Adell, A. On the applicability of DLVO theory to the prediction of clay colloids stability. Journal of Colloid and Interface Science 230, 150-156 (2000).32. Missana, T. & Adell, A. On the applicability of DLVO theory to the prediction of clay colloids stability. Journal of Colloid and Interface Science 230, 150-156 (2000).33. Wallin, R. F. & Arscott, E. A practical guide to ISO 10993-5: Cytotoxicity. Medical Device and Diagnostic Industry 20, 96-98 (1998).34. Chen, C. et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic acids research 33, e179-e179 (2005).35. Xu, X. M. et al. Expression of miR-21, miR-31, miR-96 and miR-135b is correlated with the clinical parameters of colorectal cancer. Oncology letters 4, 339-345 (2012). 13336. Zhang, P. et al. In situ amplification of intracellular microRNA with MNAzyme nanodevices for multiplexed imaging, logic operation, and controlled drug release. ACS nano 9, 789-798 (2015).37. Jordan, J. L. & Fernandez, E. J. QCM-D sensitivity to protein adsorption reversibility. Biotechnology and bioengineering 101, 837-842 (2008).37. Sarode, P. B., Bahekar, S. P. & Chandak, H. S. DABCO / AcOH jointly accelerated copper (I)- catalysed cycloaddition of azides and alkynes on water at room temperature. Synlett 27, 2681- 2684 (2016).38. Winkeljann, B., Bussmann, A. B., Bauer, M. G. & Lieleg, O. Oscillatory tribology performed with a commercial shear rheometer. Biotribology 14, 11-18 (2018).39. Tan, S. H., Nguyen, N.-T., Chua, Y. C. & Kang, T. G. Oxygen plasma treatment for reducing hydrophobicity of a sealed polydimethylsiloxane microchannel. Biomicrofluidics 4, 032204 (2010).40. Eddington, D. T., Puccinelli, J. P. & Beebe, D. J. Thermal aging and reduced hydrophobic recovery of polydimethylsiloxane. Sensors and Actuators B: Chemical 114, 170-172 (2006).41. Klarhdfer, M., Csapo, B., Balassy, C., Szeles, J. & Moser, E. High-resolution blood flow velocity measurements in the human finger. Magnetic Resonance in Medicine: An Official Journal of the International Society for Magnetic Resonance in Medicine 45, 716-719 (2001).42. Korin, N. et al. Shear-activated nanotherapeutics for drug targeting to obstructed blood vessels. Science 337, 738-742 (2012).43. Zhang, Y., Yu, J., Bomba, H. N., Zhu, Y. & Gu, Z. Mechanical force-triggered drug delivery. Chemical reviews 116, 12536-12563 (2016).44. Kasdorf, B. T. et al. Mucin-inspired lubrication on hydrophobic surfaces. Biomacromolecules 18, 2454-2462 (2017).45. Del Porto, P. et al. Dysfunctional CFTR alters the bactericidal activity of human macrophages against Pseudomonas aeruginosa. Pios One 6, e19970 (2011).46. Schmiedl, A., Kerber-Momot, T., Munder, A., Pabst, R. & Tschernig, T. Bacterial distribution in lung parenchyma early after pulmonary infection with Pseudomonas aeruginosa. Cell and tissue research 342, 67-73 (2010).47. Proctor, R. A. et al. Small colony variants: a pathogenic form of bacteria that facilitates persistent and recurrent infections. Nature Reviews Microbiology 4, 295 (2006).48. The European Committee on Antimicrobial Susceptibility Testing, Breakpoint tables for interpretation of MICs and zone diameters, version 9.0, <http: / / www.eucast.org / clinical_breakpoints / > (2019).49. Li, X.-Z., Livermore, D. M. & Nikaido, H. Role of efflux pump (s) in intrinsic resistance of Pseudomonas aeruginosa: resistance to tetracycline, chloramphenicol, and norfloxacin. Antimicrobial agents and chemotherapy 38, 1732-1741 (1994).50. C. L. Jopling, M. Yi, A. M. Lancaster, S. M. Lemon, and P. Sarnow, “Modulation of hepatitis C virus RNA abundance by a liver-specific microRNA,” Science 309, 15771581 (2005).51. A. F. Ibrahim et al., “MicroRNA replacement therapy for miR-145 and miR- 33a is efficacious in a model of colon carcinoma,” Cancer Res. 71, 52145224 (2011).52. Y. Gu et al., “miR-192-5p silencing by genetic aberrations is a key event in hepatocellular carcinomas with cancer stem cell features,” Cancer Res. 79, 941953 (2019)53. B. Herrera et al., “Global microRNA expression profiles in insulin target tissues in a spontaneous rat model of type 2 diabetes, ’’Diabetologia 53,10991109 (2010).

Claims

CLAIMS1. Particle comprisingA) a) at least one polymer (P) forming particles; b) at least one DNA strand (DNAS1); c) at least one further DNA strand (DNAS2) capable of binding to at least one strand RNA and capabable of binding to at least two strands (DNAS1); wherein the polymer (P) is connected with (DNAS1) optionally via d) at least one linker element (LE1) connecting the polymer (P) with the at least one DNA strand (DNAS1) orB) a) at least one polymer (P) forming particles; b) at least one DNA strand (DNAS1); c) at least one further DNA strand (DNAS3) capable of binding to RNA and capable of binding to at least one strand(DNAS1);d) at least one linker element (LE1) connecting the polymer (P) with the at least one DNA strand (DNAS1): e) at least one linker element (LE2) connecting the polymer (P) with the at least one DNA strand (DNAS3).

2. The particle of claim 1 , wherein the polymer (P) i) is non-toxic to cells; and / or ii) is a biopolymer; preferably selected from the group consisting carbohydrates, proteins, more preferably selected from the group consisting of mucin most preferably MLIC5AC, MLIC5B, MUC2.

3. The particle of claims 1 or 2, wherein the DNA strand (DNAS1) i) is a single strand molecule; and / or ii) has a length of 10 to 50 bases, more preferably 15 to 30 bases, and / or iii) has a sequence (from 5’ to 3’) selected from the group consisting of SEQ. ID No. 1: TGGTCTAATTTGCGCG, SEQ. ID No. 2: CCCTATGTTGACGCTAGCTTA; and / or iv) wherein 80%, preferably 90%, more prefrably 98%, particulary preferred 100% of all DNAS1 strands have an identical DNA sequence4. The particle of claims 1 to 3, whereinthe DNA strand (DNAS2) i) is a single strand molecule; and / or ii) has a length of 10 to 60 bases, more preferably20 to 40 bases, and / or iii) has a sequence (from 5’ to 3’) selected from the group consisting of SEQ. ID No. 3:CGCGCAAATTTCAACATCAGTCTGATAAGCTACGCGCAAATT, SEQ. ID No. 4: GCGTCAACATCAGTCTGATAAGCTAGCG and / or iv) binds to a RNA molecule, preferably a micro RNA; and / or v) binds to micro RNA selected from the group consisting of: miR-21 , miR-10b, miR-33, miR- 103, miR-107, miR-141 , miR-155; and / or vi) wherein at least 50%, more preferably at least 70%, most preferably at least 90%, particularly prefered 100% of the overall DNA strands (DNAS2) bind to at least two DNA strands (DNAS1); and / or vii) is not bound to the at least one polymer (P) directly or by a linker element such as LE1 ; and / or viii) is capabable to bind to the at least one RNA strand via at least one binding site present on the DNAS2 strand capable to bind to the RNA and / or ix) is capabable to bind to the at least two strands DNAS1 via at least two binding sites present on the DNAS2 strand capable to bind to the DNAS1 .

5. The particle of claims 1 to 4, wherein the DNA strand (DNAS3) i) is capabable to bind to the at least one RNA strand via at least one binding site present on the DNAS3 strand capable to bind to the RNA; and / or ii) is capabable to bind to at least one strand DNAS1 via at least one binding sites present on the DNAS3 strand capable to bind to the DNAS1.

6. The particle of claims 1 to 5, wherein the linker element (LE1) or (LE2) is a disulfide bridge, biotin, cholesterol, an amide group,7. The particle of claims 1 to 6, wherein the particle is capable of entering a cell; and wherein optionally the particle comprises a molecule which is connected with the polymer (P) which facilitates entering of the particle into the cell, preferably selected from folic acid, antibodies, aptameres.

8. The particle of claims 1 to 7, wherein i) the hydrodynamic diameter of the particle is 50 to 500 nm, preferably 140 to 350 nm or 200 to 300 nm; and / or ii) the polydispersity index (PDI) of the particle diameter is <0.05 to 0.8, preferably <0.1 to 0.6, more preferably <0.2 to 0.5 and / or iii) the concentration of the DNA strand (DNAS2) relative to the polymer (P) is 1.5x1 O'10to 6.0x1 O'10mol (DNAS2) I mg polymer (P), preferably 2.0 x10'10to 5.0 x10'10mol (DNAS2) I mg polymer (P), more preferably 3.5x1 O'10to 5.0 x10'10mol (DNAS2) I mg polymer (P) or 2.0 x10'10to 3.0 x10'10mol (DNAS2) I mg polymer (P).

9. The particle of claims 1 to 8, wherein the particle comprises a further pharmaceutically active compound.

10. The particle of claim 9, wherein the pharmaceutically active compound is i) a small molecule of a molecular weight of 100 g / mol to 800 g / mol, preferably and / or ii) a) encapsulated by the polymer (P) without forming a covalent bond or b) covalently bonded to the polymer (P) and / or iii) is for use in the treatment of cancer.11 . A pharmaceutical composition comprising the particle according to claims 1 to 10 and at least one pharmaceutically acceptable carrier.

12. The particle of claims 1 to 10 or the pharmaceutical composition of claim 11 for use medicine.

13. The particle of claims 1 to 10 or the pharmaceutical composition of claim 11 for use in the treatment of a disease associated with RNA-overexpression, preferably cancer, viral infections, cardiovascular diseases, atherosclerosis, diabetes, and obesity.

14. The particle or pharmaceutical composition for use of claim 11 , the cancer is selected from the group consisting of breast cancer, glioblastoma, melanoma, colorectal cancer, prostate cancer, lung cancer, liver, thyroid, kidney, pancreatic cancer, bladder cancer, hepatocellular cancer, nasopharyngeal cancer, esophageal cancer, gastric cancer, ovarian cancer, and Burkitt lymphoma.

Images