Compounds for treatment and prevention of diseases, disorders and conditions

Abstract

The inventions relate to compounds and compositions and their use for the treatment of certain diseases, disorders, defects and conditions, including for the treatment of cells and subjects that contain shortened telomeres or that are in need of or may benefit from telomere extension, telomerase activity and / or telomerase reverse transcriptase activity, as well as for the treatment of cells and subjects for telomere-related diseases and / or telomere-related medical conditions, including cell senescence and cognitive decline. Also provided are methods of extending telomeres through the administration of the provided compounds and compositions to animal cells, either in vitro, ex vivo or in vivo, and kits including the compounds or compositions and instructions for use.

Description

[0001] COMPOUNDS FOR TREATMENT AND PREVENTION OF DISEASES, DISORDERS AND CONDITIONS FIELD The inventions relate to aging, cognitive decline, cell senescence, telomeres, telomerase, telomere reverse transcriptase, and telomere-related diseases, disorders and conditions. INCORPORATION BY REFERENCE All publications, patents, related applications, and other written or electronic materials mentioned, identified or referred to herein, including each and every United States patent, United States patent application publication, non-U.S. patent, non-U.S. and PCT published application, article and other document cited or noted herein, and all those listed as References Cited in any patent or patents that issue herefrom, are hereby incorporated by reference in their entirety. The information incorporated is as much a part of this application, and all patents issuing therefrom or claiming priority thereto, as if all of the text and other content was repeated in the application or patent, will be treated as part of the text and content of this application as filed and any patent issuing therefrom or claiming priority thereto, and any portion of any material incorporated by reference may be included herein by amendment if required. In the event of inconsistent usages between this document and any document incorporated by reference, the usage in the incorporated reference(s) should be considered supplementary to that of this document; for irreconcilable inconsistencies, including definitions appearing in patents or patent applications, the usage in this document controls. TECHNICAL INTRODUCTION The following includes information that may be useful in providing some technical guidance to the present inventions. It is not an admission that any of the information, publications or documents specifically or implicitly referenced herein are prior art, or important, to the inventions described and claimed herein. It is not a suggestion that the brief introductory descriptions are comprehensive. Many scientific articles have been written about these specialized areas and technical disciplines, as well as books and book chapters. To prevent the loss of genes as chromosome ends wear down, the tips of eukaryotic chromosomes have specialized DNA “caps” called telomeres, nucleoprotein complexes that include long chains of nucleotides. Telomeres are composed of specific guanine-rich DNA repeat sequences of 5'-TTAGGG-3' (conserved in vertebrates), and the shelterin complex, which consists of six proteins that maintain the structure and control telomere metabolism. Telomeres protect the ends of linear chromosomes from being recognized as DNA damage that triggers a DNA damage response. Because standard DNA polymerases cannot fully replicate linear DNA templates in the absence of telomerase, which is a DNA-template-independent DNA polymerase, and because of nucleolytic processing, DNA replication results in the generation of chromosomes with progressively shortened telomeres, which shorten each time the cell divides itself to the point where they become so short the cell is unable to divide itself further. As telomeres reach a critical length, they become unable to bind enough telomere-capping proteins and are sensed as exposed DNA ends, which activates DNA damage response pathways that, through the induction of the cell cycle inhibitors p21 and p16, arrest proliferation. These short telomeres, however, retain a sufficient number of telomere-binding proteins to inhibit DNA repair and avoid fusions, and consequently fuel a persistent DNA damage signal that enforces a permanent DNA damage-induced proliferative arrest. This initiates and maintains cellular senescence, a key contributor to organismal ageing and multiple age-related diseases. Activation of the DNA damage response at telomeres results in the formation of telomere-associated DNA damage response foci or telomere-induced DNA damage foci, which are markers of cellular senescence in cultured cells and tissues. Following telomere dysfunction, some cell types may also undergo cell death by apoptosis or autophagy. In addition to irreversible cell cycle arrest, cellular senescence is characterized by changes in chromatin, gene expression, organelles and cell morphology. Importantly, senescent cells secrete a complex set of pro-inflammatory cytokines, known as the senescence-associated secretory phenotype (SASP). This alters the composition of the extracellular matrix, impairs stem cell functions, promotes cell trans-differentiation and can spread the senescence phenotype to surrounding cells (a bystander effect), thereby causing systemic chronic inflammation. SASP is both promoted by DNA damage response and can promote DNA damage response and telomere- induced DNA damage foci formation in an autocrine and paracrine fashion. Telomeres have been referred to by some as an “ageing clock” that determines lifespan at the cellular level. Telomere length is not only linked to age, but also with other conditions including obesity, depression, and stress. Some cells reverse telomere shortening by expressing telomerase, a ribonucleic protein that counteracts the replication-related telomere attrition. Telomerase is an RNA-dependent DNA polymerase that extends the telomeres of chromosomes by addition of guanine-rich repeats, (TTAGGG)n in humans, by de novo DNA synthesis. It is responsible for maintenance of the length of telomeres. Telomerase, also sometimes referred to as terminal transferase, is an enzyme complex comprising two essential components: a telomerase reverse transcriptase (called TERT, or hTERT in humans) that creates single-stranded DNA using single-stranded RNA as a template, and an RNA template embedded within telomerase RNA (called TERC, i.e., telomerase RNA component, or hTERC in humans). Other components of the telomerase complex include the proteins TCAB1, Dyskerin, Gar1, Nhp2, Nop10, and RHAU. Brouilette et al., Arteriosclerosis, Thrombosis, and Vascular Biology 2003, 23:842-846; Hohensinner PJ, et al., Telomere dysfunction, autoimmunity and aging. Aging Dis.2011, 2:524-537. The hTERT gene is translated into a protein of 1132 amino acids. The TERT polypeptide folds with (and carries) TERC, a non-coding RNA that is 451 nucleotides long. TERT has a “mitten” structure that allows it to wrap around the chromosome to add single-stranded telomere repeats. By using TERC, TERT can serially add the 5'-TTAGGG six-nucleotide repeating sequence (in vertebrates), to the 3' strand of chromosomes (the sequence differs in other organisms). TERT is a limiting component of the telomerase complex, and thus treatments that increase TERT can increase telomerase activity. Telomerase activity can be measured using the telomeric repeat amplification protocol (TRAP) assay, which quantifies the ability of a cell lysate or other sample to extend a synthetic telomere-like DNA sequence. Telomerase reverses telomere shortening. The crucial role of TERT (e.g., hTERT) is to catalyze the synthesis of new telomeric repeats based on the RNA template, and other studies have shown that telomere length and telomerase activity or the critical subunit TERT play essential roles in stress-mediated aging. Jacczak B, et al., Potential of Naturally Derived Compounds in Telomerase and Telomere Modulation in Skin Senescence and Aging. Int. J. Mol. Sci.2021, 22:6381. hTERT has also been reported to play other, telomere-independent functions. One of them is associated with the modulation of mitochondrial metabolism and free radical elimination. This area is of high importance in considering the anti-aging and anti-senescence potential of telomerase. Cellular senescence is a cell state of irreversible proliferative arrest driven by different types of stress. Many senescent cells develop a senescent-associated secretory phenotype (SASP) comprising pro-inflammatory cytokines, chemokines, proteases, bioactive lipids, inhibitory molecules, extracellular vesicles, metabolites, lipids and other factors, able to promote chronic inflammation and tissue dysfunction. Senescent cells up-regulate senescent cell anti-apoptotic pathways (SCAPs) that prevent them from dying despite the accumulation of damage to DNA and other organelles. While cellular senescence has roles in tissue remodeling, including in wound repair, prolonged senescence can be maladaptive, leading to age-related diseases. Cellular senescence involves cell- cycle arrest and the release of inflammatory cytokines with autocrine, paracrine and endocrine activities. Senescent cells also exhibit morphological alterations, including flattened cell bodies, vacuolization and granularity in the cytoplasm and abnormal organelles. Several biomarkers of cellular senescence have been identified, including SA-βgal, p16 and p21. In addition to driving ageing, senescence of immune and parenchymal cells contributes to the development of a variety of diseases and metabolic disorders. In the kidney, senescence can contribute to the progression of acute kidney injury and chronic kidney disease. Work has been done to evaluate the therapeutic benefit of compounds to target senescent cells, termed senotherapeutics, for the improvement of age-related diseases. See Zhang et al., Targeting cellular senescence with senotherapeutics: senolytics and senomorphics, The FEBS Journal 2023, 290:1362-1383. According to Zhang et al., senotherapeutics include senolytics, which selectively kill senescent cells or induce senolysis, and senomorphics, which attenuate the pathological SASPs to cause senostasis. In addition to obesity, depression and stress, current evidence also supports the idea that telomere length is associated with a number of chronic conditions including dyslipidemia (Dei Cas A, et al., Nutr Metab Cardiovasc Dis.2013, 23:272-278), hypertension (Yang Z, et al., Hypertension.2009, 53:639-645), atherosclerosis (Kark JD, et al., Atherosclerosis.2013, 229:363-368), stroke (Yetim E, et al., Sci Rep. 2021, 11:10967), coronary artery disease (Fyhrquist F, et al. Telomere length and cardiovascular risk in hypertensive patients with left ventricular hypertrophy: the LIFE study. J Hum Hypertens.2011, 25:711–718), myocardial infarction (Zee RY, Michaud SE, Germer S, Ridker PM. Association of shorter mean telomere length with risk of incident myocardial infarction: a prospective, nested case-control approach. Clin Chim Acta.2009, 403:139–141), and poor cardiovascular disease prognosis (Perez-Rivera JA, et al., Prognostic value of telomere length in acute coronary syndrome. Mech Ageing Dev.2012133:695-697). Other studies indicate that telomere attrition is positively correlated with diabetes and diabetic complications. Adaikalakoteswari A, et al., Association of telomere shortening with impaired glucose tolerance and diabetic macroangiopathy. Atherosclerosis.2007, 195:83-89; Ma D, et al., Association between oxidative stress and telomere length in Type 1 and Type 2 diabetic patients. J Endocrinol Invest.2013, 36:1032-1037; Harte AL, et al., Telomere length attrition, a marker of biological senescence, is inversely correlated with triglycerides and cholesterol in South Asian males with type 2 diabetes mellitus. Exp Diabetes Res.2012, 2012:895185. Among type 2 diabetics, those experiencing complications such as diabetic nephropathy have shorter leukocyte telomere lengths than individuals without complications and those without diabetes. Arsenis NC, et al., Physical activity and telomere length: Impact of aging and potential mechanisms of action. Oncotarget 2017 Jul 4, 8(27):45008-45019. In addition to eliciting a DNA damage response that induces cellular senescence, impacting the regenerative capacity of tissues and giving rise to a range of age-associated diseases, shortened unprotected telomeres also lead to the so-called telomeropathies, in which tissue degeneration occurs prematurely as a consequence of inherited or acquired defects in telomere maintenance. Countries throughout the world are now experiencing the impact of aging disorders as lifespans increase, and a greater fraction of the population suffers from aging-associated and other cognitive impairments, making it important to elucidate means by which to maintain cognitive integrity by protecting against, or even counteracting, the effects of aging. See, e.g., Bishop, N. A., et al., Neural mechanisms of ageing and cognitive decline. Nature 2010, 464(7288), 529-535. These disorders have already become a major burden on society with and increased incidence of dementia and cognitive decline in aging. Although the need for therapeutics for these and other chronic disorders that address aging and age-related disorders, including cell senescence and cognitive impairment, is acute, this therapeutic area largely untilled. See Meron E, et al. Meeting Report: Aging Research and Drug Discovery. Aging (Albany NY).2022, 14(2):530–43. Telomere length and cell function can be preserved by the reserve transcriptase telomerase, and there was much research following the identification of human telomerase. However, there are no drugs on the market and discovery of a simple and safe way to address cognitive decline, manipulate telomerase, preserve telomeres, and create cures for telomere and telomere-related diseases has also remained an unmet medical need. These and other needs are addressed by the inventions described and claimed herein. BRIEF INTRODUCTION TO THE INVENTIONS The inventions described and claimed herein have many attributes and embodiments including, but not limited to, those set forth or described or referenced in this brief introduction. It is not intended to be all-inclusive, and the inventions described and claimed herein are not limited to or by the features or embodiments identified in this introduction, which is included for purposes of illustration and outline only and not restriction. Further description and detail is contained in the Detailed Description and claims, all of which, including this introduction, form a part of the patent specification. Ageing in an organism is a progressive degenerative state accompanied by cellular senescence, tissue stem cell depletion, tissue inflammation, matrix alterations, and metabolic dysfunction. Ageing is also accompanied by structural and neurophysiological changes that drive cognitive decline and susceptibility to degenerative disorders in healthy individuals. These cellular and tissue changes reflect underlying molecular aberrations which lead to genomic instability and damage, including telomere dysfunction. Telomere length and telomerase expression are critical elements protecting cells from cellular senescence and the aging process. There is a long-felt need to address cellular senescence and related conditions and disorders described herein, including cognitive decline, despite the significant efforts that have been undertaken to solve these conditions and disorders that have failed or otherwise fallen short or would benefit from improved treatments. There is also a need to address telomere shortening, and telomere length which has inverse associations with chronic conditions (including cardiovascular disease, obesity, diabetes, etc.). There is a long-felt but unmet need to identify effective modulators of telomere length and telomerase activity. Short telomeres, furthermore, due to genetic or acquired insults, can cause a loss of cellular self- renewal that result in life-threatening diseases for which there are few if any effective medical therapies. In diseases involving short telomeres, e.g., aplastic anemia, hepatic cirrhosis, bone marrow failure, etc., there is an unmet clinical need for new therapies or improved treatments. The disclosure is based, in part, on the discoveries that compounds of the invention can be useful in treating and / or preventing effects of aging, premature aging, cognitive decline, cell senescence, telomeres, telomerase, telomere reverse transcriptase, and telomere-related diseases, disorders and conditions. The compound of the invention is a compound according to Formula I: (I) wherein Y is C—R1; R1is acetyl; R2is hydrogen, C3-8cycloalkyl, C1-6alkyl optionally interrupted by oxygen or substituted by hydroxy, C1-6alkoxy or substituted aminocarbonyl, C1-6alkylcarbonyl, C1-6alkoxycarbonyl, C1-6alkylcarbonyloxy, C1-6alkoxy, nitro, cyano, halo, trifluoromethyl, or CF3-S-; or a group CF3-A-, where A is —CF2—,—CO—, —CH2—, CH(OH), SO2, SO, CH2—O, or CONH; or a group CF2H- A′- where A′ is oxygen, sulphur, SO, SO2, CF2or CFH; trifluoromethoxy, C1-6alkylsulphinyl, perfluoro C2-6alkylsulphonyl, C1-6alkylsulphonyl, C1-6alkoxysulphinyl, C1-6alkoxysulphonyl, aryl, heteroaryl, arylcarbonyl, heteroarylcarbonyl, phosphono, arylcarbonyloxy, heteroarylcarbonyloxy, arylsulphinyl, heteroarylsulphinyl, arylsulphonyl, or heteroarylsulphonyl in which any aromatic moiety is optionally substituted, C1-6alkylcarbonylamino, C1-6alkoxycarbonylamino, C1-6alkyl-thiocarbonyl, C1-6alkoxy-thiocarbonyl, C1-6alkyl- thiocarbonyloxy, 1-mercapto C2-7alkyl, formyl, or aminosulphinyl, aminosulphonyl or aminocarbonyl, in which any amino moiety is optionally substituted by one or two C1-6alkyl groups, or C1-6alkylsulphinylamino, C1-6alkylsulphonylamino, C1-6alkoxysulphinylamino or C1-6alkoxysulphonylamino, or ethylenyl terminally substituted by C1-6alkylcarbonyl, nitro or cyano, or —C(C1-6alkyl)NOH or —C(C1-6alkyl)NNH2; or amino optionally substituted by one or two C1-6alkyl or by C2-7alkanoyl; one of R3and R4is hydrogen or C1-4alkyl and the other is C1-4alkyl, CF3, or CH2Xa, where Xais fluoro, chloro, bromo, iodo, C1-4alkoxy, hydroxy, C1-4alkylcarbonyloxy, —S—C1-4alkyl, nitro, amino optionally substituted by one or two C1-4alkyl groups, cyano or C1-4alkoxycarbonyl; or R3and R4together are C2-5polymethylene optionally substituted by C1-4alkyl; R5is C1-6alkylcarbonyloxy, benzoyloxy, ONO2, benzyloxy, phenyloxy or C1-6alkoxy and R6and R9are hydrogen or R5is hydroxy and R6is hydrogen or C1-2alkyl and R9is hydrogen; R7is heteroaryl or phenyl, both of which are optionally substituted one or more times independently with a group or atom selected from chloro, fluoro, bromo, iodo, nitro, amino optionally substituted once or twice by C1-4 alkyl, cyano, azido, C1-4 alkoxy, trifluoromethoxy and trifluoromethyl; R8is hydrogen, C1-6alkyl, OR11or NHCOR10wherein R11is hydrogen, C1-6alkyl, formyl, C1-6 alkanoyl, aroyl or aryl-C1-6 alkyl and R10 is hydrogen, C1-6 alkyl, C1-6 alkoxy, mono or di C1-6 alkyl amino, amino, amino-C1-6alkyl, hydroxy-C1-6alkyl, halo-C1-6alkyl, C1-6acyloxy-C1-6alkyl, C1-6alkoxycarbonyl-C1-6alkyl, aryl or heteroaryl; the R8—N—CO—R7group being cis to the R5group; and X is oxygen or NR12where R12is hydrogen or C1-6alkyl. For any of the Markush groups set forth above, in some embodiments, each group can include or exclude any of the species listed for that group. In some embodiments, the compound can be Tonabersat, carabersat, or SB-204269. SB-204269 is also known as (trans-(+)-6-acetyl-4S-(4-fluorobenzoylamino)-3, 4-dihydro-2,2-dimethyl-2H- benzo[b]pyran-3R-ol). Carabersat is also known as N-[(3R,4S)-6-Acetyl-3-hydroxy-2,2- dimethyl-3,4-dihydro-2H-chromen-4-yl]-4-fluorobenzamide. Tonabersat is also known as N-(6- Acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydro-2H-chromen-4-yl)-3-chloro-4-fluorobenzamide. For any of the Markush groups set forth above, that group can include or exclude any of the species listed for that group. Where used herein, any reference to a compound of Formula I is also a reference to a prodrug form of a compound of Formula 1. The disclosure is based, in part, on the discoveries that compounds of Formula I can reverse or alleviate telomerase deficiency, shortened telomers and / or reduced telomere length. The disclosure is further based, in part, on the discovery that a compound of Formula I can reverse or alleviate telomerase reverse transcriptase (TERT) deficiency. The disclosure is also based, in part, on the discovery that a compound of Formula I can protect against and alleviate cognitive decline. The specification also includes disclosure of inventions based on the discoveries that a compound of Formula I can reverse cognitive decline. The disclosure is also based, in part, on the discovery that a compound of Formula I can protect against and alleviate cellular senescence. The specification also includes disclosure of inventions based on discoveries that a compound of Formula I can be used to reverse cellular senescence. The disclosure is also based, in part, on the discoveries that a compound of Formula I can protect against aging, including cellular aging. The specification also includes disclosure of inventions based on discoveries that a compound of Formula I can alleviate aging, including cellular aging. The disclosure is also based, in part, on the discoveries that a compound of Formula I can protect against and decrease expression of PECAM-1. In some embodiments of the inventions, uses, methods, doses, dose regimens, compositions and kits are provided to increase telomerase expression in a subject. In some embodiments of the inventions, uses, methods, doses, dose regimens, compositions and kits are provided for to protect against loss of telomerase reverse transcriptase (TERT) or to increase TERT or TERT activity in a subject. In some embodiments of the inventions, uses, methods, doses, dose regimens, compositions and kits are provided to protect against cellular senescence in a subject. In some embodiments of the inventions, uses, methods, doses, dose regimens, compositions and kits are provided to treat cognitive decline in a subject. In some embodiments of the inventions, uses, methods, doses, dose regimens, compositions and kits are provided to alleviate aging in a subject. In some embodiments of the inventions, uses, methods, doses, dose regimens, compositions and kits are provided to reduce, protect against and decrease expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1) in a subject. It is an object of the invention to provide methods, doses, dose regimens, compositions, and kits for a compound of Formula I for the treatment of a subject as described herein. In some embodiments, at least one compound of Formula I is used to reverse or alleviate telomerase deficiency, shortened telomers and / or reduced telomere length in a cell. In some embodiments the at least one inhibitor and / or blocker is used to reverse or alleviate telomerase deficiency, shortened telomers and / or reduced telomere length in a cell in vivo. In some embodiments the at least one inhibitor and / or blocker is used to reverse or alleviate telomerase deficiency, shortened telomers and / or reduced telomere length in a cell ex vivo. In some embodiments the at least one inhibitor and / or blocker is used to reverse or alleviate telomerase deficiency, shortened telomers and / or reduced telomere length in a cell in vitro. In some embodiments the at least one inhibitor and / or blocker is used to reverse or alleviate telomerase deficiency, shortened telomers and / or reduced telomere length in a cell in a subject. In any of these embodiments, the cell may comprise a population of cells. In some embodiments, the at least one compound of Formula I is administered to a subject to reverse or alleviate telomerase deficiency, shortened telomers and / or reduced telomere length in the subject, for example a patient, including, for example, a human patient or subject. In some embodiments, at least one compound of Formula I is used to reverse or alleviate telomerase reverse transcriptase (TERT) deficiency in a cell. In some embodiments, the at least one compound of Formula I is used to reverse or alleviate TERT deficiency in a cell in vivo, in a cell ex vivo, or in a cell in vitro. In some embodiments, the at least one compound of Formula I is used to reverse or alleviate TERT deficiency in a cell in a subject, for example in cell in a patient, including a human patient or subject. In any of these embodiments, the cell may comprise a population of cells. In some embodiments, the at least one compound of Formula I is administered to a subject to reverse or alleviate TERT deficiency in the subject, for example a patient, including, for example, a human patient or subject. In some embodiments, at least one compound of Formula I is used to increase TERT levels or activity in a cell. In some embodiments, the at least one compound of Formula I is used to increase TERT levels or TERT activity in a cell in vivo, in a cell ex vivo, or in a cell in vitro. In some embodiments the at least one inhibitor and / or blocker is used to increase TERT levels or TERT activity in cell in a subject, for example in a cell in a patient, including a human patient or subject. In any of these embodiments, the cell may comprise a population of cells. In some embodiments, the at least one compound of Formula I is administered to a subject to increase TERT levels or TERT activity in the subject, for example a patient, including, for example, a human patient or subject. In some embodiments, at least one compound of Formula I is administered to a subject to protect against and / or alleviate cognitive decline in the subject. In some embodiments, at least one compound of Formula I is administered to a subject to reverse cognitive decline in the subject. In some embodiments, at least one compound of Formula I is used to protect against and / or alleviate cell or cellular senescence. In some embodiments, the at least one compound of Formula I is used to protect against and / or alleviate senescence of a cell in vivo, a cell ex vivo, or a cell in vitro. In some embodiments, the cell comprises a population of cells. In some embodiments, the at least one compound of Formula I is administered to a subject to protect against and / or alleviate senescence of a cell or a population of cells in a subject. In some embodiments, the at least one compound of Formula I is administered to a subject to protect against and / or alleviate cell or cellular senescence in the subject. In some embodiments, at least one compound of Formula I is used to reverse cellular senescence. In some embodiments, the at least one compound of Formula I is used to reverse senescence of a cell in vivo, ex vivo, or in vitro. In some embodiments, the cell comprises a population of cells. In some embodiments, the at least one compound of Formula I is used to reverse cellular senescence in a cell or population of cells in a subject. In some embodiments, the at least one compound of Formula I is used to reverse cellular senescence in a subject. In some embodiments, at least one compound of Formula I is used to protect against aging, including cellular aging. In some embodiments, the at least one compound of Formula I is used to protect against aging of a cell in vivo, of a cell ex vivo, or a cell in vitro. In some embodiments, the at least one is used to protect a cell in a subject against aging. In any of these embodiments, the cell may comprise a population of cells. In some embodiments, the at least one compound of Formula I is used to protect against aging in a subject. In some embodiments, at least one compound of Formula I is used to protect against and decrease PECAM-1 expression in a cell. In some embodiments, the at least one compound of Formula I is used to protect against and decrease PECAM-1 expression in a cell in vivo, in a cell ex vivo, or in a cell in vitro. In some embodiments the at least one inhibitor and / or blocker is used to protect against and decrease PECAM-1 expression in a cell in a subject. In any of these embodiments, the cell may comprise a population of cells. In some embodiments the at least one inhibitor and / or blocker is administered to a subject to protect against and decrease PECAM-1 expression in the subject. In one aspect, the disclosure relates to methods of treating a disease, condition or disorder associated with telomerase deficiency or dysfunction in a subject. The methods include the steps of identifying the subject as having a disease, condition or disorder associated with telomerase deficiency or dysfunction; and administering to the subject an effective amount of a pharmaceutical composition comprising a compound of Formula I, thereby treating the disease, condition or disorder associated with telomerase deficiency or dysfunction in the subject. In some embodiments, these methods and compositions are used to increase telomerase expression in a subject by administering to the subject an effective amount of a pharmaceutical composition comprising a compound of Formula I, thereby increasing telomerase expression in one or more cells in the subject. In some embodiments, the methods and compositions are used to increase telomerase expression in a cell in a subject having a disease, condition or disorder associated with telomerase deficiency or dysfunction. In some embodiments, the methods and compositions are used to increase telomerase expression in a tissue having a disease, condition or disorder associated with telomerase deficiency or dysfunction. In some embodiments, the tissue is in a subject. In some embodiments, the tissue is outside the subject. In some embodiments, methods and compositions of the invention are used to treat a disease, condition or disorder that would benefit from telomerase activity, telomerase expression, increased telomerase activity and / or increased telomerase expression. In some embodiments, these methods and compositions are used to treat a disease, condition or disorder associated with telomerase reverse transcriptase deficiency or dysfunction in a subject by administering to the subject an effective amount of a pharmaceutical composition comprising a compound of Formula I, thereby increasing telomerase expression in one or more cells in the subject. In other embodiments, the methods are used to treat a disease, condition or disorder that would benefit from increased telomerase reverse transcriptase (TERT). In other embodiments, the methods are used to treat a disease, condition or disorder that would benefit from increased TERT activity. In some embodiments, the methods and compositions are used to increase TERT expression in a cell in a subject having a disease, condition or disorder associated with telomerase deficiency or dysfunction. In some embodiments, the methods and compositions are used to increase TERT expression in a tissue having a disease, condition or disorder associated with telomerase deficiency or dysfunction. In some embodiments, the tissue is in a subject. In some embodiments, the tissue is outside the subject. In some embodiments, methods and compositions of the invention are used to increase telomerase reverse transcriptase (TERT) or increase TERT activity in a cell. In some embodiments, methods and compositions of the invention are used to increase telomerase reverse transcriptase (TERT) or increase TERT activity in a cell in a subject. In some embodiments, a cell may comprise a population of cells. In some embodiments, methods and compositions of the invention are used to increase telomerase reverse transcriptase (TERT) or increase TERT activity in a subject. In some embodiments, methods and compositions of the invention are used to increase telomere length in a cell. In some embodiments, methods and compositions of the invention are used to increase telomere length in one or more cells in a subject by administering an agent or agent as described. In some embodiments, methods and compositions of the invention are used to treat a disease, condition or disorder associated with shortened or shortening telomeres. In other embodiments, the methods are used to treat a disease, condition or disorder that would benefit from increased telomeres or increased telomere length. In some embodiments, methods and compositions of the invention are used to treat a disease, condition or disorder associated with cognitive decline. In other embodiments, the methods are used to treat a disease, condition or disorder associated with mild cognitive decline. In some embodiments, a disease, condition or disorder associated with cognitive decline and / or mild cognitive decline is treated by administering to a subject an effective amount of a pharmaceutical composition comprising a compound of Formula I, thereby arresting, slowing, lessening or reversing cognitive decline in the subject. In some embodiments, the methods and compositions are used to treat a disease, condition or disorder associated with CD31 expression. In other embodiments, the methods are used to treat a disease, condition or disorder by reducing CD31 expression. In some embodiments, a disease, condition or disorder associated with CD31 expression is treated by administering to a subject an effective amount of a pharmaceutical composition comprising a compound of Formula I, thereby arresting, slowing, or lessening CD31 expression in the subject, or in one or more cells or tissues of the subject. In some embodiments, any of the methods may further include the step or steps of (a) determining or evaluating telomere length in the subject and / or (b) determining whether to administer an increased amount of the agent(s), administer a decreased amount of the agent(s), pause administration of the agent(s), or cease administration of the agent (or agents). In some embodiments, telomere length is determined or evaluated in one or more cells of the subject. In some embodiments, the method used to determine and / or evaluate telomere length is qPCR. In some embodiments, the disease, disorder or condition associated with telomere length, telomere shortening, telomerase dysfunction, TERT deficiency and / or cellular senescence, or that would otherwise benefit from increased telomere length, increased telomerase levels or activity, increased TERT levels or activity, and / or reduced cell senescence, is a neurological disease, disorder or condition (e.g., dementia, cognitive decline, etc.), a metabolic disease, disorder or condition (e.g., pre-diabetes, diabetes and dyslipidemia), or a cardiovascular disease, disorder or condition (e.g., atherosclerosis, coronary artery disease, stroke, acute coronary syndrome, etc.), obesity, depression or stress. In other embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens for the treatment of telomeropathies based on TERT mutations leading to decreased telomerase levels or activity and which are characterized by shorter or shortened telomeres. In some embodiments, the disorder associated with telomerase dysfunction is aplastic anemia, hematological disorder, hepatic disease or dyskeratosis congenital. In other embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens for the treatment of cognitive decline. In some embodiments, the cognitive decline is mild cognitive decline. In other embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens for the treatment of cell senescence. In some embodiments, the compounds, compositions, methods, kits, doses and dose regimens of the invention for the protect against cell senescence. The inventions described and claimed herein provide compounds, compositions, methods, kits, doses and dose regimens and long-needed means for treating subjects suffering with a disease, disorder or condition associated with telomere length or shortening. In some embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens and means for slowing cellular aging, slowing cognitive decline, slowing cellular senescence. In some embodiments, the inventions are used to increase telomerase expression. In some embodiments, the agent increases the level or activity of telomerase reverse transcriptase (TERT). In some embodiments, the agent protects against loss of TERT. In some embodiments, the agent protects against loss of TERT in the eye. In some embodiments, the agent protects against loss of TERT in the retina. In some embodiments, the agent protects against loss of TERT in retinal pigment epithelial cells. In some embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens and for restoring telomeres. In some embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens and for increasing telomere length and / or size. In some embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens and for modulating or improving telomere length in Type 1 and Type 2 diabetic patients. Telomere shortening is seen even in people with impaired glucose tolerance (IGT) and in some embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens and for modulating or improving telomere length in subjects with IGT or prediabetes. In some embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens and for modulating or improving telomere length in subjects with atherosclerosis. Among subjects with Type 2 diabetes, those with atherosclerotic plaques have greater shortening of telomere length compared to those without plaques and, in some embodiments, the inventions provide compounds, compositions, methods, kits, doses and dose regimens and for modulating or improving telomere length in subjects with Type 2 diabetes having atherosclerotic plaques. In some embodiments, the agent used for the purposes and in the methods described herein – including increasing telomere length, arresting or slowing telomere shortening, increasing telomerase activity and / or expression, increasing TERT activity and / or expression, addressing aging, addressing, cell senescence, addressing cognitive decline, slowing, decreasing or arresting PECAM-1 expression, etc., and treating any of the diseases, disorders or conditions described or referred to herein – is a compound of Formula I. In some embodiments of the invention, the compound of Formula I is a benzoylamino benzopyran. In some embodiments the compound according to Formula I is carabersat. In some embodiments compound according to Formula I is tonabersat. In some embodiments, the tonabersat compound is a tonabersat prodrug. In some embodiments the tonabersat prodrug is a compound according to Formula II. In some embodiments of the inventions, uses, methods, doses, dose regimens, compositions and kits are provided for use in protecting against cognitive decline in a subject. In some embodiments the compounds used to treat cognitive decline are compounds of Formula I In some embodiments, the cell or cell population treated using a compound, composition or method of the invention comprises a human cell or a human cell population. In some embodiments, the tissue treated using a compound, composition or method of the invention is a human tissue. In some embodiments, an organ treated using a compound, composition or method of the invention is a human organ. In some embodiments, the subject treated using a compound, composition or method of the invention is a human. In some embodiments, the compound of Formula I is administered orally, systemically, topically, or parenterally. In some embodiments, administration is local. In some embodiments, the compound of Formula I is administered to the skin. In some embodiments, the compound of Formula I is administered transdermally. In some embodiments, the compound of Formula I is administered to the eye. In some embodiments, the compound of Formula I is administered topically to the eye. In some embodiments of the present invention for topical administration, e.g. to the skin, to the eye, or to an internal organ, the method comprises administering to the subject a therapeutically effective amount of composition comprising an agent (e.g., a compound of Formula I), wherein the composition comprises a compound selected from the group consisting of reverse thermosetting gels, poloxamer gels, nonionic polyoxyethylene-polyoxypropylene block co- polymers (e.g. Pluronic F-127) and cellulose-based carriers (e.g., hydroxyethylcellulose, carboxymethylcellulose hydroxymethylcellulose, hydroxypropylmethylcellulose, etc.) and other pharmaceutically acceptable carriers. In some embodiments, the topical composition for use in the methods of the invention comprises poloxamer F-127 (poloxamer 407 or Pluronic F-127). In some embodiments, the composition for use in the methods of the invention comprises about 20-30 mg / mL of a poloxamer F-127. In some embodiments, the composition for use in the methods of the invention comprises about 22-25 mg / mL of a poloxamer F-127. In some embodiments, the composition for use in the methods of the invention comprises about 22.6 mg / mL of a poloxamer F-127. In some embodiments, a combination of two or more compounds selected from the group consisting of compounds of Formula I are administered to a cell, to a cell population, to a tissue, to an organ, or to a subject. In some embodiments, the compound of Formula I is administered to a subject using any of the dosing schedules described herein in a therapeutically effective amount. In some embodiments, the amount of a compound of Formula I administered to a subject in any of the dosing schedules described herein is one or more of the dose amounts described herein (e.g. milligram per milliliter (mg / mL) compound dosing, micromolar (^M) compound concentration dosing, milligram (mg) compounds dosing, etc.). In some embodiments, the invention provides the use of a compound of Formula I in the manufacture of a medicament for treatment of any of the diseases, disorders or conditions described herein. In some embodiments, the medicament comprises, consists essentially of, or consists of, an agent as described herein, including one or more compounds of Formula I. In some embodiments, the agent is, comprises, or consists essentially of, a molecule according to Formula I (e.g., tonabersat or carabersat), a tonabersat prodrug (e.g., a molecule according to Formula II). In some embodiments, the invention relates to pharmaceutical compositions and articles of manufacture, including kits comprising a therapeutically effective amount of a compound of Formula I, and dose regimens for treating one or more of the diseases, disorders or conditions described herein, including, for example, cognitive decline and cell senescence. In some embodiments, the kit includes or is associated with instructions (e.g. included instructions, online instructions, QR code instructions, etc.) for use. The instructions may provide instructions for dosing and treating diseases, disorders and conditions described or referred to herein. In some embodiments, the kit includes means for administration of the compounds of the invention. In some embodiments, compounds of Formula I are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition. In some embodiments, suitable carriers and diluents include buffered, aqueous solutions, isotonic saline solutions, for example phosphate- buffered saline, isotonic water, and the like. In some embodiments, the carrier is a pluronic or poloxamer gel. In some embodiments, the gel is pluronic F-127. In some embodiments, the pharmaceutical composition comprises a buffer. In some embodiments, the buffer comprises or consists essentially of sodium phosphate dibasic heptahydrate or sodium phosphate monobasic or both. In some embodiments, methods of the invention, the doses and the dose regimens, and the compounds of Formula I, described herein are used for the treatment of a subject for one or more of the diseases, disorders or conditions described or referred to herein alone or in combination with or in conjunction with another therapeutic agent. In another aspect the present disclosure provides a method of selecting or quantifying the activity of a candidate compound for the treatment of telomere-associated disease. In some embodiments, the method comprises providing a first isolated cell or preparation of cells; determining (a) telomere length or (b) telomerase reverse transcriptase (TERT) activity or levels in the cell or cell preparation; comparing the telomere length or TERT activity or level in the cell or cell preparation to a reference level; contacting it with a test compound (i.e., one or more candidate agents) to the cell or the cell preparation, or to another to preparation of like or similar cells, and remeasuring telomere length or TERT activity or levels in the cell or preparation of cells. In some embodiments, the test compound is a compound of Formula I . In some embodiments, the test compound is a compound of Formula I that is tested for modulation of telomerase, telomerase reverse transcriptase, telomerase reverse transcriptase expression, or telomerase reverse transcriptase activity. In some embodiments, the test compound can modulate telomerase and / or TERT. In some embodiments, the modulation by the test compound is at the level of gene expression, e.g., the hTERT gene. In yet other instances, the modulation is at the level of activity, e.g., telomerase or TERT activity. Modulation by the test compound can be at the level of protein expression, e.g., telomerase and / or TERT. Modulation by the test compound can be at the level of telomere size or maturity. Modulation by the test compound can be at the level of altering telomere ends. In some embodiments, a test compound contacted with an isolated cell or preparation of cells, can also be used to identify, qualify or quantify a candidate compound to treat a patient. In some embodiments, the test compound modulates human telomerase and / or human TERT species. In some embodiments, a test compound is administered in a high dose. In some embodiments, a test compound is administered a cell isolated from a patient having a disease, disorder or condition. In some embodiments, the test compound is administered to a stem cell, e.g., an iPS cell. In some embodiments, the test compound is administered to a stem cell, e.g., an iPS, cell derived from a patient (e.g., a patient’s skin or other tissue). In some embodiments, the test compound modulates telomerase and / or TERT activity or levels in the stem cell, e.g., an iPS cell. In some embodiments, the test compound modulates telomerase activity and also modulates telomere size. In some embodiments, the test compound promotes accumulation of mature TERT protein. In some embodiments, the cell is an isolated human cell. In some embodiments, the cell is derived from a patient’s skin or other tissue. In some embodiments, the isolated human cell is derived from a patient’s bone marrow. In some embodiments, the cell is an isolated human cell and is derived from a patient’s blood. In some embodiments, the cell used to contact a test compound or other candidate compound or agent is an isolated human cell that is derived from a patient having a telomere disease. In some embodiments, the patient is suspected of having telomere disease. In some embodiments, the patient has symptoms of aplastic anemia. In some embodiments, the patient is diagnosed as having telomere deficiency. In some embodiments, the patient has symptoms of hepatic cirrhosis. In some embodiments, the patient has dyskeratosis congenita. In some embodiments, the cell is isolated from a patient having or suspected of having a hematological disorder. In some embodiments, the isolated cell is from a patient having or suspected of having dyskeratosis congenita. In some embodiments, the method of testing / screening can be performed in an isolated cell, e.g., human cell, obtained from a patient having or suspected of having a hematological disorder. In some embodiments, the invention provides methods for treating a subject or a patient for cognitive decline comprising administering to the subject or patient an effective amount of a compound of Formula I. Administration to the subject or patient of an effective amount of a compound of Formula I lessens, slows, halts, or substantially halts cognitive in the subject. In some embodiments of the methods, the subject or patient has mild cognitive decline. In some embodiments, the invention provides methods for treating a subject or patient for cognitive decline comprising administering to the subject or patient an effective amount of a compound of Formula I. Administration to the subject or patient of an effective amount of a compound of Formula I lessens, slows, halts, or substantially halts cognitive in the subject or patient. In some embodiments of the methods, the subject or patient has mild cognitive decline. In some embodiments, the invention provides methods for modulating senescence in a cell comprising administering to the cell an effective amount of a compound of Formula I . Administration to the cell of an effective amount of a compound of Formula I lessens, slows, halts, or substantially halts cell senescence. In some embodiments of the methods, the cell is an aging cell. In some embodiments, the administration to the cell is in vitro. In some embodiments, the administration to the cell is ex vivo. In some embodiments, the administration is in vitro. In some embodiments, the administration to the cell is in vivo. In some embodiments, the invention provides methods for treating a subject or patient for cell senescence comprising administering to the subject or patient an effective amount of a compound of Formula I. Administration to the subject or patient of an effective amount of a compound of Formula I lessens, slows, halts, or substantially halts cell senescence in the subject or patient. In some embodiments of the methods, the subject or patient has mild neurodegeneration. In some embodiments, the invention provides methods for slowing cellular aging associated with telomere length and / or telomere shortening in a subject or a patient comprising administering to the subject or patient an effective amount of a compound of Formula I. Administration to the subject or patient of an effective amount of a compound of Formula I lessens, slows, halts, or substantially halts cellular aging in the subject or patient. In some embodiments of the methods, cellular aging is temporarily lessened, slowed, halted, or substantially halted. In some embodiments of the methods, the subject is a cell. In some embodiments, the administration to a cell is in vitro. In some embodiments, the administration to a cell is ex vivo. In some embodiments, the administration to the cell is in vivo. In some embodiments, the administration is to a cell on a subject or patient (e.g., skin cells) or to a cell in a subject or patient (e.g., heart, brain, liver, etc.). In some embodiments, the invention provides methods for increasing telomerase expression in a cell comprising administering to the cell an effective amount of a compound of Formula I. Administration to the cell of an effective amount of a compound of Formula I increases telomerase expression or activity in the cell. In some embodiments of the methods, telomerase expression or activity in the cell is temporarily increased. In some embodiments, the method is carried out in vitro. In some embodiments, the invention provides methods for increasing telomerase expression in a subject or patient, or a cell in a subject or patient, comprising administering to the cell an effective amount of a compound of Formula I. Administration to the subject or patient, or to a cell in a subject or patient or from a subject or patient, of an effective amount of a compound of Formula I increases telomerase expression in the subject or patient, or in cell in a subject or patient or from a subject or patient. In some embodiments of the methods, telomerase expression is temporarily increased. In some embodiments, the method is carried out in vivo. In some embodiments, the method is carried out ex vivo. In some embodiments, the invention provides methods for increasing telomerase reverse transcriptase (TERT) expression and / or activity in a cell comprising administering to the cell an effective amount of a compound of Formula I. Administration to the cell of an effective amount of a compound of Formula I increases reverse transcriptase (TERT) expression or activity in the cell. In some embodiments of the methods, reverse transcriptase (TERT) expression or activity in the cell is temporarily increased. In some embodiments, the method is carried out in vitro. In some embodiments, the invention provides methods for increasing telomerase reverse transcriptase (TERT) expression and / or activity in a subject or patient, or in a cell in a subject or patient (or a cell from a subject or patient), comprising administering to the cell an effective amount of a compound of Formula I. Administration to the subject or patient, or a cell in a subject or patient or a cell from a subject or patient, of an effective amount of a compound of Formula I increases telomerase reverse transcriptase (TERT) activity and / or expression in the subject or patient, or a in cell in a subject or patient (or a cell from a subject or patient). In some embodiments of the methods, telomerase reverse transcriptase (TERT) activity and / or expression is temporarily increased. In some embodiments, the method is carried out in vivo. In some embodiments, the method is carried out ex vivo. In some embodiments, the invention provides methods for increasing telomere length in a cell comprising administering to the cell an effective amount of a compound of Formula I. Administration to the cell of an effective amount of a compound of Formula I increases telomere length in the cell. In some embodiments of the methods, telomere length in the cell is temporarily increased or improved. In some embodiments, the method is carried out in vitro. In some embodiments, the method is carried out ex vivo. In some embodiments, the method is carried out in vivo. In some embodiments, the cell is in or on a subject or a patient. In some embodiments, the methods are used for protecting telomere length in a cell, or in a cell in or on a subject or patient by administration of a. In some embodiments, the invention provides methods for increasing telomere length in a cell comprising administering to the cell an effective amount of a compound of Formula I. Administration to the cell of an effective amount of a compound of Formula I increases telomere length in the cell. In some embodiments of the methods, telomere length in the cell is temporarily increased or improved. In some embodiments, the method is carried out in vitro. In some embodiments, the method is carried out ex vivo. In some embodiments, the method is carried out in vivo. In some embodiments, the cell is in or on a subject or a patient. In some embodiments, the methods are used for protecting telomere length in a cell, or in a cell in or on a subject or patient by administration of a compound of Formula I. In some embodiments, the invention provides methods for increasing telomere length in a subject or patient comprising administering to the subject an effective amount of a compound of Formula I. Administration to the subject or patient of an effective amount of a compound of Formula I increases telomere length in cells of the subject. In some embodiments of the methods, an increase in telomere length is targeted to certain cells or organ(s) in or on the subject or patient is temporarily increased. In some embodiments, the method is carried out ex vivo. In some embodiments, the method is carried out in vivo. In some embodiments, the methods are used for protecting telomere length by administration of a compound of Formula I to a subject or patient. In some embodiments, the invention provides methods for treating retinal thinning in a subject or patient comprising administering to the subject an effective amount of a compound of Formula I. Administration to the subject or patient of an effective amount of a compound of Formula I slows, halts, alleviates or reverses retinal thinning in the subject. In some embodiments, the methods are used for protecting against retinal thinning by administration of a compound of Formula I to a subject or patient. In some embodiments of the methods of the invention, the compound is a compound according to Formula II. In some embodiments of the methods of the invention, the compound is tonabersat or carabersat. In some embodiments of the methods of the invention, the compound is a tonabersat prodrug or a carabersat prodrug. In some embodiments of the methods of the invention, a therapeutically or prophylactically effective amount of a compound of Formula I is / are administered to a subject or patient have a disease, disorder, defect, or condition associated with cognitive decline. In some embodiments, the cognitive decline is mild cognitive decline. In some embodiments, the cognitive decline is age- related and / or disease related cognitive decline. In some embodiments, the subject or patient is protected against cognitive decline. In some embodiments, the disease, disorder, defect or condition associated with cognitive decline is selected from the group consisting of Alzheimer’s disease, dementia with Lewy bodies disease, fronto-temporal dementia, early onset dementia, Parkinson’s disease-related cognitive dysfunction, posterior cortical atrophy, primary progressive aphasia and Huntington’s disease. In some embodiments of the methods of the invention, a therapeutically or prophylactically effective amount of a compound of Formula I is / are administered to a subject or patient have a disease, disorder, defect, or condition associated with cell senescence. In some embodiments, the subject or patient is protected against cell senescence. In some embodiments of the methods of the invention, a therapeutically or prophylactically effective amount of a compound of Formula I is / are administered to a subject or patient having a disease, disorder, defect, or condition associated with reduced or shortened telomere length. In some embodiments, the subject or patient is protected against telomere reduction or shortening. In some embodiments of the methods of the invention, a therapeutically or prophylactically effective amount of a compound of Formula I is / are administered to a subject or patient having a disease, disorder, defect, or condition associated with reduced or reduced or deficient telomerase reverse transcriptase (TERT) expression and / or activity. In some embodiments, the telomerase reverse transcriptase is human telomerase reverse transcriptase (hTERT). In some embodiments of the methods of the invention, a therapeutically or prophylactically effective amount of a compound of Formula I is / are administered to a subject or patient have a disease, disorder, defect, or condition associated with telomerase deficiency. In some embodiments, the telomerase is human telomerase (hT). In some embodiments, the disease, disorder, defect or condition associated with telomerase deficiency is selected from the group consisting of short telomere syndrome, dyskeratosis congenital (DC), bone marrow failure syndrome characterized by the reticulated skin hyperpigmentation, nail dystrophy, oral leukoplakia, Revesz syndrome, Hoyeraal-Hreidarsson syndrome, cerebroretinal microangiopathy with calcifications and cysts (CRMCC), inherited aplastic anemia / myelodysplastic syndrome, aplastic anemia, marrow failure, hematological disorder, hepatic disease, aplastic anemia, hepatic cirrhosis, osteoporosis, osteonecrosis, vascular malformations, diabetes, primary immunodeficiency, and inflammatory bowel disease. In some embodiments of the methods of the invention, a therapeutically or prophylactically effective amount of a compound of Formula I is / are administered to a subject or patient at least once per day. In some embodiments of the methods of the invention, a therapeutically or prophylactically effective amount of a compound of Formula I is / are administered orally, topically, or parenterally to a subject or patient. In some embodiments of the methods of the invention, a therapeutically or prophylactically effective amount of a compound of Formula I is / are administered orally, topically, or parenterally to a subject or patient. In some embodiments of the methods of the invention, about 80 to about 400 milligrams per day of a compound of Formula I is administered to a subject or patient. In some embodiments of the methods of the invention, the subject or patient is a human subject or a human patient. BRIEF DESCRIPTION OF THE FIGURES FIG.1 (A) Schematic representation of the design and timeline of a study to determine the ability of compounds of Formula I to treat and prevent cognitive decline, using an exemplary compound (tonabersat). (B) There were no differences difference between tonabersat and vehicle-treated groups in terms of weights (g) during the treatment period from ages 4 to 6 months. There were also no differences between the two treatment groups in terms of (C) distance travelled (cm), and (D) velocity (cm / s) at 4, 6, and 9 months of age. Statistical analysis was carried out with repeated- measures two-way ANOVA with Šídák's multiple comparison’s test. n = 12 mice per group. FIG. 2 Demonstrates the ability of the compounds described herein to protect against and treat cognitive decline in aging animals. (A) Discrimination index decreased significantly by 6 and 9 months compared to 4 months in vehicle-treated but not tonabersat-treated mice. (B) Relative to baseline at 4 months, there was no difference between tonabersat and vehicle treated mice at 6 months. By 9 months, tonabersat-treated mice had significantly higher change in discrimination index compared to the vehicle group. N = 12 mice per group. FIG. 3 Treatment increased connexin43 expression compared to the vehicle group. (A) Connexin43 expression was observed within all hippocampal regions in both treatment groups. (B) An increase in connexin43 expression in the tonabersat treatment group was observed compared to the vehicle group, and found to be statistically significant in the CA2 region. Statistical analysis was carried out with repeated-measures two-way ANOVA with Šídák's multiple comparison’s test. *8*p ≤ 0.001. n = 12 mice per group. FIG. 4 Treatment with an exemplary compound (tonabersat) decreases the number of Iba1+ (green) cells in the hippocampus, and does not affect GFAP (red) expression. (A) GFAP expression was observed in the CA1, 2, 3 and dentate gyrus (DG) of the hippocampus in both vehicle and tonabersat-treated groups. (B) No statistically significant change was observed in the percentage area covered by GFAP labelling between the tonabersat group compared to vehicle. (C) Iba1+ cells were observed in all regions of the hippocampus for both groups. (D) Tonabersat treatment significantly decreased the number of Iba1+ cells in the CA1, CA2 and DG compared to the vehicle group. Statistical analysis was carried out with repeated-measures two-way ANOVA with Šídák's multiple comparison’s test. *p ≤ 0.05, **p ≤ 0.01. n = 12 mice per group. FIG.5 Treatment with an exemplary compound (tonabersat) did not significantly affect NLRP3 (red) but reduced cleaved caspase 1 (green) expression in the hippocampus. (A) NLRP3 expression was observed in the CA1, 2, 3 and dentate gyrus (DG) of the hippocampus in both vehicle and tonabersat-treated groups. (B) However, there was no significant difference in the percentage area covered by NLRP3 labelling between both treatment groups. (C) Cleaved caspase 1 was expressed in all regions of the hippocampus with less labelling observed in the tonabersat treated group compared to vehicle. (D) Tonabersat treatment significantly reduced cleaved caspase 1 levels in the CA1, 2 and 3 regions of the hippocampus compared to the vehicle group. Statistical analysis was carried out with repeated-measures two-way ANOVA with Šídák's multiple comparison’s test. *p ≤ 0.05, **p ≤ 0.01. n = 12 mice per group. FIG. 6 Treatment with an exemplary compound (tonabersat) decreased CD31 expression in the hippocampus. (A) CD31 expression was observed in all hippocampal regions in both treatment groups. (B) Treatment was observed to reduce CD31 levels compared to the vehicle group with statistically significant reductions in the CA2 and CA3 regions. Statistical analysis was carried out with repeated-measures two-way ANOVA with Šídák's multiple comparison’s test. *p ≤ 0.05. n = 12 mice per group. FIG.7 Treatment with an exemplary compound (tonabersat) increased TERT expression within all the hippocampal regions. (A) While TERT was expressed in both the exemplary compound (tonabersat) and vehicle groups, protein levels were higher in the tonabersat-treated mouse hippocampi compared to the vehicle-treated group. (B) Quantification of TERT levels showed that tonabersat treatment significantly increased TERT levels in all hippocampal regions compared to the vehicle group. Statistical analysis was carried out with repeated-measures two-way ANOVA with Šídák's multiple comparison’s test. **p ≤ 0.01, ***p ≤ 0.001. n = 12 mice per group. FIG. 8 Treatment with an exemplary compound (tonabersat) decreases senescence of brain hippocampal neurons in aging mice. (A) Tonabersat decreases expression of senescence- associated beta-galactosidase in the hippocampus of 9-month-old male C57BL / 6J mice. Mice were treated daily via oral gavage with tonabersat or vehicle (tap water) from 4 to 6 months of age. Tissues were collected at 9 months of age. The encircled region 1 in Figures C and D indicates the cornu ammonis (CA) of the hippocampus. The dentate gyrus is the encircled region 2. Sample size = 12 mice per group. Statistical analysis was via 2-way ANOVA with Šídák's multiple comparison’s test. P value (cornu ammonis) = 0.015; P value (dentate gyrus) = 0.014. FIG. 9 Tonabersat treatment protects against loss of TERT in retinal pigment epithelial cells. Tonabersat treatment protected against high glucose (HG) and pro-inflammatory cytokine-induced (IL-1b and TNF-a) TERT downregulation in ARPE-19 cells. Relative to cells grown in only basal medi there was a significant decrease of TERT expression in ARPE-19 cells exposed to HG and cytokines. When ARPE-19 cells were exposed to HG and cytokines along with tonabersat, the decrease in TERT expression was essentially eliminated with no significant difference in TERT levels compared to baseline. FIG.10 Tonabersat protection against TERT downregulation is reduced by ATP. When ARPE- 19 cells were exposed to high glucose, cytokines (IL-1b and TNF-a) and ATP, the effect of treatment with the exemplary compound was reduced. (A) TERT expression was detected in all groups, with higher levels in the unmodified basal media group, and in the HG+Cyt+tonabersat group. The expression of TERT was lower in the HG+Cyt group, and the HG+Cyt group with tonabersat and ATP. (B) Quantification of TERT levels showed that tonabersat treatment was able to protect ARPE-19 cells against HG+Cyt, but that protection was diminished in the presence of ATP. The TERT expression of the HG+Cyt+Ton+ATP group was found to be not significantly different to the non-tonabersat treated HG+Cyt group. FIG.11 There is a negative correlation between IL-1β release and TERT expression. When ARPE- 19 cells were exposed to high glucose, cytokines (IL-1b and TNF-a) and ATP, the release of IL- 1β into the culture media was measured and correlated with the TERT expression in the cells. A negative correlation was found between the TERT expression in the cells and the level of IL-1β in the culture media. FIG.12 Tonabersat treatment protects against cellular senescence in an ATP dependent manner. The expression of beta galactosidase was measured as a marker of cellular senescence. The results in ARPE-19 cells showed increase in beta gal expression with HG+Cyt and this was reversed by 50uM tonabersat. The presence of ATP reversed tonabersat protection in a dose dependent manner from 50nM ATP to 100 nM ATP suggesting that cellular senescence was ATP dependent. FIG. 13 Tonabersat reverses HG+Cyt induced cellular senescence. The expression of beta galactosidase was measured as a marker of cellular senescence in ARPE-19 cells. Groups of cells in culture medium were exposed to HG+Cyt, and for group (B) the culture medium was changed to basal medium and for group (C) a tonabersat containing medium. The cells injured by HG+Cyt and then treated with the exemplary compound tonabersat showed levels of cellular senescence equivalent to cells that had not been injured (A). (D) The analysis of the beta galactosidase expression confirms that there is a significant difference between the untreated and tonabersat treated groups, and no significant difference between the non-injured basal group the injured then tonabersat treated groups. FIG. 14 Tonabersat protects against repeated HG+Cyt induced cellular senescence. The expression of beta galactosidase was measured as a marker of cellular senescence in ARPE-19 cells. Groups of cells in culture medium were exposed to HG+Cyt, and then injured again with HG+Cyt, or with HG+Cyt+Ton. The analysis of the beta galactosidase expression confirms a significant difference in cellular senescence between the untreated and tonabersat treated groups, and a small difference between the non-injured basal group and the tonabersat treated group. The telomere length of the injured cells was found to be smaller relative to basal. The treatment of injured cells with tonabersat restored telomere length, with no significant difference between the basal and tonabersat treated groups. FIG.15 The level of ATP release correlates with the severity of cellular senescence. The level of ATP released in the cell culture media correlates positively with the level of Beta-Galactosidase expression in ARPE-19 cells. FIG.16 The relative telomere length in brain tissue from aged mice was significantly greater in the tonabersat treated group compared to the control, however there was no significant difference in telomere length in cells collected from blood. FIG.17 The relative telomere length in brain tissue of 4 month old mice treated with tonabersat for 2 weeks shows no significant difference in relative telomere length to untreated mice. These results suggest that in brain tissue, tonabersat has an effect on telomere length in aging mice, and is thus able to prevent cognitive decline. FIG.18 The relationship between the discrimination index and telomere length of normal aging mice is shown. FIG. 19 The measured discrimination index is significantly higher in mice with above average telomere length. FIG. 20 When the mice are grouped by discrimination index, there is no significant difference between mice with below average telomere index and above average telomere length. FIG.21 The expression of telomerase reverse transcriptase (TERT) in the hippocampus of mice was determined for wild-type and disease model mice. TERT, which is also a marker for the telomerase enzyme, was assessed for 5xFAD mice that are used as a model for Alzheimer’s disease. TERT was found within the axons in the CA1, 2, 3 and DG regions of the hippocampus in both the 5xFAD and wild-type mice FIG.22 The expression of telomerase reverse transcriptase (TERT) in the hippocampus of mice was determined for experimental autoimmune encephalitis (EAE) mice. TERT was found within the axons in the CA1, 2, 3 and DG regions of the hippocampus in both the EAE and wild-type mice. FIG.23 A study was performed to measure the effect of various brain disease models on relative telomere length in mice. A comparison of relative telomere length shows a significant difference between a group treated with intrahippocampal injection of amyloid β-Peptide, a group treated with ACSF (artificial cerebrospinal fluid), and a control group. FIG. 24 The relative telomere length was determined in brain tissue from 5xFAD mice. There was no significant difference found between wild-type mice and the 5xFAD mice. FIG. 25 Tonabersat treatment reverses TGF-βII release. Tonabersat, MCC950 and XG19 were used to inhibit the release of TGF-βII from ARPE-19 cells by blocking the inflammasome pathway. The combined treatments of tonabersat and MCC950; and MCC950 and XG19 did not produce any additive effects. FIG.26 The therapeutic effects of tonabersat, MCC950 and XG19 were observed in a hypoxic cell model. Treating ARPE-19 cells with CoCl2increased ATP release and beta-galactosidase activity but did not affect LDH (Lactate dehydrogenase) levels. Addition of the modulators tonabersat, XG19 and MCC950 all decreased ATP levels to baseline. Combining the connexin43 hemichannel blockers tonabersat and XG19 with MCC950 did not produce any additional reduction of ATP release. FIG. 27 Tonabersat treatment reverses TGF-βII release induced by by CoCl2. There was no difference found in the release of TGF-βII by cells treated with CoCl2compared to basal cells. Tonabersat decreased TGF-βII levels to 0, both when used alone and when combined with MCC950. While MCC950 and XG19 also decreased TGF-beta levels below baseline, they were not as effective as tonabersat. FIG.28 TGF-βII induces ATP, LDH, and beta-gal release and this is prevented and reversed by inflammasome blockers. TGF-βII treatment was used to induce release of ATP, LDH and beta- gal. When applied as a co-treatment, tonabersat and MCC950 significantly inhibited ATP, LDH, and beta-gal release, though there were no additive effects when both modulators are used together. FIG. 29 Tonabersat treatment prevents expression of senescence marker proteins p16 and p53. using western blotting, the expression of p16, p21, and p53 was investigated. These proteins are known as senescence associated markers. P21 was not expressed in the cells. Expression of p16 and p53 increased significantly with HG + Cyt insult, and the modulator tonabersat appears to decrease levels of both p16 and p53 particularly after 72 h. It was found that the addition of exogenous ATP partially recovers p16 but not p53 levels back towards injury levels. FIG. 30 Tonabersat inhibits p53-mediated sICAM-1 release. A study using ARPE-19 cells showed that sICAM-1 levels are increased by HG+Cyt and reduced with modulator (tonabersat) treatment. The addition of exogenous ATP did not reverse protection conferred by tonabersat. DETAILED INVENTION DISCLOSURES “Telomeres” are known in the art and are regions of repetitive nucleotide sequences associated with specialized proteins at the ends of chromosomes that protect the terminal regions of chromosomal DNA from progressive degradation and ensure the integrity of linear chromosomes by preventing DNA repair systems from mistaking the very ends of the DNA strand for a double- strand break. A telomere is a region of repetitive DNA sequences at the end of a chromosome. Telomeres protect the ends of chromosomes from becoming frayed or tangled. Each time a cell divides, the telomeres become slightly shorter. Eventually, they become so short that the cell can no longer divide successfully, and the cell dies. The present specification relates in part to compounds, compositions and methods having effects of increasing telomerase expression. It also relates in part to compounds, compositions and methods having effects of increasing telomerase activity. The present specification relates in part to compounds, compositions and methods having effects of protecting against loss of TERT (telomerase reverse transcriptase). The present specification also relates in part to compounds, compositions and methods having effects of effective to increase TERT expression. The specification also relates in part to compounds, compositions and methods having effects of effective to increase TERT activity. The present specification relates in part to compounds, compositions and methods useful for extending a telomere. The specification also relates in part to compounds, compositions and methods useful for increasing telomere length. The present specification relates in part to compounds, compositions and methods useful for protecting against cell senescence. It also relates in part to compounds, compositions and methods useful for preventing or reducing cell senescence. It also relates in part to compounds, compositions and methods useful for slowing cell senescence. The present specification relates in part to compounds, compositions and methods useful for reducing cognitive decline. It also relates in part to compounds, compositions and methods useful for slowing cognitive decline. It also relates in part to compounds, compositions and methods useful for preventing cognitive decline. The present specification relates in part to compounds, to compositions containing such compounds, and methods of using the compounds and compositions for preventing, alleviating and treating cell senescence. The present specification relates in part to compounds, to compositions containing such compounds, and methods of using the compounds and compositions for alleviating and treating cognitive decline. The present specification relates in part to compounds, compositions and methods having effects of protecting against expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1). PECAM-1 was originally described as the CD31 differentiation antigen expressed on the surface of human granulocytes, monocytes and platelets). It also relates to compounds, compositions and methods having effects of decreasing expression of PECAM-1. The present specification relates in part to compounds, to compositions containing such compounds, and methods of using the compounds and compositions for preventing, alleviating and treating diseases, caused in whole or in part by a decrease in telomerase expression and / or activity or a reduction in telomere length, and symptoms thereof. The present specification relates in part to compounds, to compositions containing such compounds, and methods of using the compounds and compositions for preventing, alleviating and treating diseases, and symptoms that may be caused in whole or in part by a decrease in TERT expression and / or activity. The present specification relates in part to compounds, to compositions containing such compounds, and methods of using the compounds and compositions for preventing, alleviating and treating diseases, and symptoms that may be caused in whole or in part by cell aging or damage. The present specification relates in part to compounds, to compositions containing such compounds, and methods of using the compounds and compositions for preventing, alleviating and treating diseases, and symptoms that may be caused in whole or in part by cell senescence. The present specification relates in part to compounds, to compositions containing such compounds, and methods of using the compounds and compositions for preventing, alleviating and treating diseases, and symptoms that may be caused in whole or in part by cognitive decline. The present disclosure also provides, among other things, methods of screening for or quantifying the activity of agents that can be used to increase telomerase expression and activity, to protect against loss of telomerase, to increase telomerase reverse transcriptase expression and activity, to protect against loss of telomerase reverse transcriptase, to protect against cellular senescence, to protect against cell aging, to protect against cognitive decline, and to decrease PECAM-1 (CD31) expression, and to protect against increased CD31 expression. In some embodiments, the invention provides methods of screening for or quantifying the activity of agents that modulate telomerase expression. In some embodiments, the invention provides methods of screening for or quantifying the activity of agents that modulate TERT expression. In some embodiments, the invention provides methods of screening for or quantifying the activity of agents that modulate TERT levels. In some embodiments, the invention provides methods of screening for or quantifying the activity of agents that modulate TERT activity. In some embodiments, the invention provides methods of screening for or quantifying the activity of agents that modulate cell senescence. In some embodiments, the invention provides methods of screening for or quantifying the activity of agents that modulate cognitive decline. In some embodiments, the invention provides methods of screening for or quantifying the activity of agents that modulate PECAM-1 expression. The present disclosure also provides methods of diagnosing patients and methods of treating patients having telomere disease. According to one aspect to the present invention, the compounds and compositions described herein increase telomerase expression or telomerase activity or both and are effective for extending a telomere. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in part by a decrease in telomerase expression or a decrease in telomerase activity or both, including those induced or caused, in whole or in any part, by any abnormal or irregular decrease in telomerase expression or activity, or by the length reduction or loss of a telomere, and alleviating symptoms caused thereby. According to another aspect to the present invention, the compounds and compositions described herein are to protect against loss of TERT (telomerase reverse transcriptase), effective to increase TERT expression or TERT activity or both. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in part by decreases in TERT expression, decreases in TERT activity, or both, including those induced or caused, in whole or in any part, by any abnormal or irregular decrease in TERT expression or activity, and alleviating symptoms caused thereby. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in part by decreases in TERT expression, decreases in TERT activity, or both, in the brain. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in part by decreases in TERT expression, decreases in TERT activity, or both, in the hippocampus. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in part by decreases in TERT expression, decreases in TERT activity, or both, in the eye. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in part by decreases in TERT expression, decreases in TERT activity, or both, in retina. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in part by decreases in TERT expression, decreases in TERT activity, or both, in retinal pigment epithelial cells. In another aspect to the present invention, the compounds and compositions described herein are effective to protect against, reduce or delay cell senescence. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in any part by cell senescence. In some embodiments, the compounds and compositions described herein are used for treating or alleviating symptoms caused conditions, diseases and disorders induced or caused in whole or in any part by cell senescence. In some embodiments, the cells protected against senescence or in which cell senescence is reduced or delayed are cells of the eye. In some embodiments, the cells of the eye are cells of the anterior eye. In some embodiments, the cells of the eye are cells of the cornea (including epithelial cells, keratocytes, and endothelial cells, and including stromal keratocytes). In some embodiments, the cells of the eye are cells of the posterior eye. In some embodiments, the cells of the eye are retinal cells. In some embodiments, the retinal cells are cells of the macula, cells of the peripheral retina, cells of the inner limiting membrane (ILM) of the retina (including Müller cells and astrocytes), cells of the nerve fiber layer (NFL) of the retina (including ganglion cells and glial cells), cells of the ganglion cell layer (GCL) of the retina (including ganglion cells, glial cells and amacrine cells), cells of the inner plexiform layer (IPL) of the retina (including bipolar, amacrine, and ganglion cells), cells of the inner nuclear layer (INL) of the retina (including the bipolar, horizontal, amacrine, and Muller cells), cells of the outer plexiform layer (OPL) of the retina (including photoreceptor cells, bipolar cells, and horizontal cells), cells of the outer nuclear layer (ONL) of the retina (including photoreceptor cells), cells of the outer limiting membrane (OLM) of the retina (including Muller cells, photoreceptor cells, junctional complexes between adjacent Muller cells, and junctional complexes between Muller and photoreceptor cells), cells of the photoreceptor layer (PL) of the retina (including cones and rods that form a palisading layer of photoreceptors), and cells of the retinal pigment epithelium (RPE) forming a continuous RPE monolayer. In some embodiments, the cells of the eye are retinal ganglion cells, cone photoreceptors, amacrine cells, horizontal interneurons, rod photoreceptors, bipolar interneurons, and / or Müller glia. In some embodiments, the cells of the eye are cells of the fovea (the central portion of the macula) or cells of the peripheral retina. In some embodiments, the cells of the eye are cells of the choroidal capillaries. In some embodiments, the cells of the eye are cells of the optic nerve or optic tract. In some embodiments, the cells protected against senescence or in which cell senescence is reduced or delayed are cells of the brain. In some embodiments, the cells protected against senescence or in which cell senescence is reduced or delayed are cells of the heart. In other embodiments, the cells protected against senescence or in which cell senescence is reduced or delayed are cells of another organ of the body (e.g., liver, kidney, lung, pancreas, etc.) or cells of the endocrine system (e.g., pituitary gland, thymus, thyroid, etc.), and so on, including other cells of the circulatory system, other cells of the digestive system, other cells of the respiratory system, other cells of the urinary system, other cells of the sensory organs and systems (including the ears), other cells of the central nervous system, other cells of the peripheral nervous system, cells of the lymphatic system (including bone marrow, lymph nodes, thymus and spleen, etc.), cells of the reproductive systems, and / or cells of the musculoskeletal system. Symptoms caused by cell loss and senescence that can be alleviated or treated by compounds, compositions and methods according to some embodiments of the present invention include skin loss, skin wrinkles, skin psoriasis, skin darkening and anemia. In some embodiments, the cells protected against senescence or in which cell senescence is reduced or delayed are cells of the integumentary system. In another aspect to the present invention, the compounds and compositions described herein are effective to protect against cognitive decline. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in any part by cognitive decline, and alleviating symptoms caused thereby. In some embodiments, the cognitive decline is mild cognitive decline. In another aspect to the present invention, the compounds and compositions described herein are effective to decrease CD31 expression. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in any part by cell senescence, and alleviating symptoms caused thereby. In another aspect to the present invention, the compounds and compositions described herein are effective to protect against aging or cell aging. In some embodiments, the compounds and compositions described herein are used for treating conditions, diseases and disorders induced or caused in whole or in any part by aging or cell aging, and alleviating symptoms caused thereby. In some embodiments, the aging is in cells of the skin. In some embodiments, inventions described and claimed herein relate to compounds of Formula I, and their use in methods for the treatment of cognitive decline (including, e.g., mild cognitive decline), in treatment to protect against or slow cognitive decline, in the treatment of cell senescence, in treatment to protect against cell senescence, in treatment to prevent or reduce cell senescence, in treatment to slow cell senescence, in treatment to increase telomerase activity, in treatment to protect against loss of telomerase reverse transcriptase (TERT), in treatment to increase TERT levels, in treatment to increase TERT expression, in treatment to increase TERT activity, in treatment to extend a telomere, in treatment to increase telomere length and / or in treatment to protecting against expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1), and doses and dose regimens therefor. In one aspect this invention relates to pharmaceutical compositions, articles of manufacture, kits and methods for treating a subject having (or at risk for having) cognitive decline (including, e.g., mild cognitive decline), cell senescence, reduced telomerase activity, loss of telomerase reverse transcriptase (TERT) expression or activity, short, shortened or shortening telomeres, and / or unwanted expression or activity of platelet / endothelial cell adhesion molecule-1 (PECAM-1), by administering a therapeutically effective amount of at least one compound of Formula I to a subject or patient. In some embodiments, the agent is administered using a dose and / or dosing regimen described herein. In some embodiments, the agent is administered using another dose and / or dosing regimen. In one embodiment, a composition or compositions comprising a compound of Formula I is applied orally, topically, systemically (including intravenous, intra-arterial, intra-peritoneal, transdermal, intranasal, or by suppository), parenterally (including intramuscular, subcutaneous, or intravenous or intra-arterial injection), and the like, to a subject. In some embodiments, the compound of Formula I administered daily, weekly, or monthly to a subject. In some embodiments, a therapeutically effective amount of tonabersat is administered. In some embodiments, the amount of a compound of Formula I administered to a subject is one or more of the particular dose amounts described herein, including, for example, milligram per milliliter (mg / mL) dosing, micromolar (^M) dosing, milligram (mg) dosing, and so on, etc.). In some embodiments, the compound of Formula I comprises an orally available compound (e.g., tonabersat, or carabersat). See the Examples herein describing the use of an exemplary compound (tonabersat). In some embodiments, the compound is a prodrug of tonabersat (e.g., a tonabersat prodrug according to Formula II). In some embodiments, a compound according to Formula I, or a prodrug according to Formula II, or a pharmaceutically acceptable salt thereof, is administered to a subject at dose ranges of approximately 0.01 to 15 mg / kg / day, more usually 0.1 to 6 mg / kg / day, for example 0.5 to 6 mg / kg / day. The instant inventions provide, inter alia, (1) methods for treating cognitive decline and cellular senescence in a subject or a patient by administration of a therapeutically effective amount of one or more of a compound of Formula I in a dose regimen described herein to treat a disease, disorder, defect or condition; (2) methods for treating methods for treating cellular aging, telomere attrition, TERT deficiency, premature aging, and skin aging in a subject or a patient (e.g. a PED or a PCED) by administration of a compound of Formula I at doses described herein (e.g. in any of the dosing regimens described herein; and (3) the use of such compounds, in the manufacture of a medicament (e.g. a pharmaceutical composition), and kits containing said medicaments that include or are associated with instructions for use in a method of the invention. The instant inventions provide, inter alia, (1) methods for treating mild cognitive decline, age- related cognitive decline, Alzheimer’s disease, dementia with Lewy bodies disease, fronto- temporal dementia, early onset dementia, Parkinson’s disease-related cognitive dysfunction, posterior cortical atrophy, primary progressive aphasia and Huntington’s disease in a subject or a patient by administration of a therapeutically effective amount of one or more of a compound of Formula I in a dose regimen described herein to treat a disease, disorder, defect or condition; (2) methods for treating methods for treating treating short telomere syndrome, dyskeratosis congenital (DC), bone marrow failure syndrome characterized by the reticulated skin hyperpigmentation, nail dystrophy, oral leukoplakia, Revesz syndrome, Hoyeraal-Hreidarsson syndrome, cerebroretinal microangiopathy with calcifications and cysts (CRMCC), inherited aplastic anemia / myelodysplastic syndrome, aplastic anemia, marrow failure, hematological disorder, hepatic disease, aplastic anemia, hepatic cirrhosis, osteoporosis, osteonecrosis, vascular malformations, diabetes, primary immunodeficiency, and inflammatory bowel disease in a subject or a patient (e.g. a PED or a PCED) by administration of a compound of Formula I at doses described herein (e.g. in any of the dosing regimens described herein; and (3) the use of such compounds, in the manufacture of a medicament (e.g. a pharmaceutical composition), and kits containing said medicaments that include or are associated with instructions for use in a method of treatment the invention. In some embodiments, one or more of the compounds of Formula I described or referenced herein are formulated with one more other therapeutically or prophylactically active agents for use in the methods and regimens described herein. Definitions As used herein, the singular forms “a,” “an” and “the” include plural referents unless the content clearly dictates otherwise. As used herein, the terms “about” and “approximately,” when used to modify a numeric value (e.g., “about 80 mg”) or one or more amounts specified in a range of numeric values (e.g., “about 80 mg to about 400 mg”), indicate the numeric value and functionally equivalent values, as well as reasonable deviations from the value known to or understood by those in the art, including persons of ordinary skill in the art or those skilled in the art. For example, values within ±10% or ±5% are within the intended meaning of a recited value. As such, “about 80 mg” is understood to encompass from “76 mg to 84 mg” or from “72 mg to 88 mg” as if written out each time. Thus, as used herein, the terms “about” and “approximately” intended to convey that similar values promote equivalent results or effects recited in the claims. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but can be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about” or “approximate” whether or not expressly stated to be such. It is understood that where “about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise. In other words, when ranges are expressed herein as from “about” one particular value, and / or to “about” another particular value, the range also includes from the one particular value and / or to the other particular value, including the variations noted above or understood in the art. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if “10 to 15” (or “10-15”) is disclosed, then 11, 12, 13, and 14 are also specifically disclosed (even it not spelled out in writing), in addition to 10 and 15, as well as “about 11,” “about 12,” “about 13,” and “about 14.” As used herein, the terms “administering” and “administration” refer to any method of providing a compound or composition to a subject. In some embodiments, the compound or composition is a pharmaceutical preparation. Such methods are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration, intraaural administration, intradural administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can be one-time, intermittent, or continuous. In some embodiments, a compound or composition of the invention is administered therapeutically, e.g., to treat an existing, diagnosed or suspected disease, disorder or condition. In some embodiments, a compound or composition of the invention is administered prophylactically, e.g., administered to prevent or inhibit progression of a disease, disorder or condition, or prevent the spread of a disease, disorder or condition. All cells experience changes with aging. Cellular senescence is a key feature of cell aging. An “aging cell” is a cell that becomes larger and less able to divide and multiply. Among other changes, there can also be an increase in pigments and lipids inside the cell. Cellular aging was first described by Hayflick and Moorhead in 1961. They showed that human cells in culture do not divide indefinitely but reach a limit (called the Hayflick limit) of replication and stop all further division. Cells approach this limit by slowing their divisions and entering cellular senescence, a dormant period. Both insufficient telomere replication and telomere shortening are common signals leading to these events. Telomere length in cells may be measure by the method described in Callicott R and Womack J., Real-time PCR assay for measurement of mouse telomere. Comp Med 2006 Feb;56(1):17-22; or by other methods known in the art. See, e.g., O’Callaghan N et al. A quantitative real-time PCR method for absolute telomere length. Biotechniques. 2008 May;44(6):807-9; Lai TP, et al. Comparison of telomere length measurement methods. Philos Trans R Soc Lond B Biol Sci.20185:373(1741):20160451; Montpetit AJ, et al. Telomere length: a review of methods for measurement. Nurs Res.201463(4):289-99. Other aspects of aging cells are described in issues of the journal Aging Cell. “Cellular senescence” is a phenomenon characterized by the cessation of cell division. It is a form of long-term cell-cycle arrest, caused by excessive intracellular or extracellular stress or damage. The concept of cell senescence is well known, and can be triggered, for example, by oxidative stress, telomere damage / shortening, DNA damage, mitochondrial dysfunction, chromatin disruption, inflammation, epigenetic dysregulation, and oncogene activation. See, e.g., Dodig S, et al. Hallmarks of senescence and aging. Biochem Med (Zagreb).201929(3):03050. In addition to irreversible cell cycle arrest, cellular senescence is characterized by changes in chromatin, gene expression, organelles and cell morphology. Importantly, senescent cells secrete a complex set of pro-inflammatory cytokines, known as the senescence-associated secretory phenotype (SASP). Senescent cells are unique in that they eventually stop multiplying but don’t die off when they should. Instead, they continue to release chemicals that can trigger inflammation. Additionally, a relatively small number of senescent cells can persist and spread inflammation that can damage neighboring cells. It is also understood that the number of senescent cells in a person’s body increases with age. As the aging immune system becomes less efficient, senescent cells accumulate and taint healthy cells. This can affect the ability to withstand stress or illness; recuperate from injuries; and learn new things, as senescent cells in the brain can degrade cognitive functions. Cellular senescence has been connected to various age-related conditions, including diabetes, osteoporosis, cardiovascular disease, stroke, Alzheimer’s disease and related dementias, osteoarthritis, and cancer. It has also been linked to declines in eyesight, mobility, and thinking ability. Hallmarks of senescent cells include increased senescence-associated β-galactosidase activity (SA-β-gal); p16INK4A, p53, and p21 levels; higher levels of DNA damage, including γ-H2AX; the formation of Senescence-Associated Heterochromatin Foci (SAHF); and the acquisition of a Senescence-Associated Secretory Phenotype (SASP), a phenomenon characterized by the secretion of a number of pro-inflammatory cytokines and signaling molecules. Various techniques and protocols exist for monitoring the senescent phenotype including using senescence-associated markers, for example, SA-β-gal, γ-H2AX and SAHF staining, and for quantifying protein and mRNA levels of cell cycle regulators and SASP factors. See, e.g., Hooten N and Evans MK. Techniques to Induce and Quantify Cellular Senescence. J Vis Exp.2017 May 1;(123):55533. Soluble ICAM-1 (sICAM-1) is a further component of SASP. Elevated sICAM-1 levels are a potential circulating biomarker of cellular senescence. Studies have shown that sICAM-1 levels can increase with aging and in conditions with accelerated senescence. When cells undergo senescence due to DNA damage or other stressors, p53 activation can trigger increased production and release of sICAM-1. Potentially, sICAM-1 can contribute to the inflammatory signaling network, promoting senescence in neighboring cells. The phrase “consisting essentially of” refers to specified materials and those additional materials that do not materially affect the basic and novel characteristics of a composition or medicament (or steps, in the case of a method). The basic and novel characteristics of the inventions are described throughout the specification. In some embodiments, a composition or medicament of the invention will comprise, consist essentially of, or consist of at least one compound of Formula I, for example, tonabersat, or prodrug thereof. As used herein, “effective amount” or “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time as described in the dose regimens herein, to achieve a desired result in treatment of a disease, disorder, defect or condition for which one or more compounds or compositions of the invention are administered to a subject or to a patient. For example, and not by way of limitation, a “therapeutically effective amount” can refer to an amount of a compound of Formula I or composition (e.g. a compound or composition comprising or consisting essentially of a compound of Formula I), including but not limited to those disclosed herein, that is able to treat a disease, defect, disorder or condition when administered in accordance with the invention. In some embodiments, “effective amount” or “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time as described in the dose regimens herein or used by those in accordance with methods of the invention, to achieve a desired result or results in the treatment of cognitive decline (including, e.g., mild cognitive decline), in treatment to protect against or slow cognitive decline, in the treatment of cell senescence, in treatment to protect against cell senescence, in treatment to prevent or reduce cell senescence, in treatment to slow cell senescence, in treatment to increase telomerase activity, in treatment to protect against loss of telomerase reverse transcriptase (TERT), in treatment to increase TERT levels, in treatment to increase TERT expression, in treatment to increase TERT activity, in treatment to extend a telomere, in treatment to increase telomere length and / or in treatment to protecting against expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1). Therapeutically effective amounts include an amount that is sufficient to achieve at least one desired therapeutic result, or to have at least one effect on at least one undesired symptom associated with a disease, disorder, defect or condition, including but not limited to those referenced herein. The specific therapeutically effective dose level for any particular patient may be varied or depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors used in the medical arts in determining dose levels. For example, those in the art may start doses of a compound or composition at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. In some embodiments, the result of treatment with an “effective amount” provides a durable result following treatment. In some embodiments, treatment with an effective amount is discontinued following a desired result. In some embodiments, treatment with an effective amount is continued following a desired result. In some embodiments, treatment with an effective amount is paused and then continued following a desired result. The doses disclosed herein are therapeutically effective amounts; however, the methods are not limited to those doses or dose amounts and include the use of other therapeutically effective amounts. In some embodiments aspects, a compound, composition or preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a disease, disorder or condition. As used herein, “prophylactically effective amount” refers to an amount effective to achieve or assure a desired prophylactic result, including, for example, preventing cognitive decline, cell senescence, telomere shortening, etc. The term “in vivo” (Latin for “within the living”) refers to use in a whole, living organism as opposed to an ex vivo or in vitro controlled environment. Animal testing, clinical trials, and use in humans or other living subjects are forms of in vivo research. In vivo testing is often employed over in vitro to observe the overall effects of an experiment on a living subject. Ex vivo work or experimentation is done in live isolated cells, tissues or organs, rather than in a whole organism, for example, cultured cells derived from biopsies. Once cells are disrupted and individual parts are tested or analyzed, this is referred to as in vitro. Methods carried out in vivo include the use of animal models for research. In vivo methods also include the use of methods in humans and other subjects, including for therapy. The term “ex vivo” (Latin: “out of the living”) refers to use outside an organism, and is used to indicate methods, work, experimentation or measurements done in or on tissue in an artificial environment outside an organism. Ex vivo work is often done with the minimum alteration of natural conditions. Ex vivo conditions often allow methods, work, experimentation and / or measurements to be carious out under more controlled conditions than may be possible in in vivo experiments (in the intact organism), albeit at the expense of altering the "natural" environment. A main difference between in vitro and ex vivo assays is that the former is simply a cell system established in a cell culture or in a laboratory. In contrast, the latter is a tissue directly taken from a living organism, or a tissue that has been created artificially. The term “in vitro” (“within the glass,” or “in glass,” e.g., in a test tube or petri dish). In vitro experiments were historically conducted in glass test tubes and Petri dishes, however, modern laboratory practices include the use of single-use plasticware, and other non-glass instruments, in part to avoid cross- contamination, the need for washing, sterilization, etc. In vitro experiments are often performed on cells or cultures of cells, which sometimes include immortalized human or other animal cell lines, or other cell lines, and sometimes include bacteria. When the test subjects are cells, they are derived from living organisms or cell lines and maintained in culture in special conditions. Sometimes those conditions seek to mimic physiological circumstances including temperature and sterility. There is a wide variety of cell types which in many cases can be amplified in plastic flasks and distributed in plates with hundreds of small wells for high throughput screening, for example. Some cell types cannot adhere to plastic and are cultured in suspension, forming aggregates. Three- dimensional cell systems may also be used where the higher cell-cell interaction adds another layer of complexity to cellular communication. Furthermore, advanced in vitro systems such as the organ-on-a-chip technology, offer a next level of complexity introducing, for example, microfluidic channels that reproduce human blood and / or airflow. These are only some examples of in vitro methodologies. As used herein, “kit” means a collection of at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose. Individual member components may be physically packaged together or separately. For example, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as a recorded presentation. As used herein, “instruction(s)” means documents or information describing relevant materials or methodologies pertaining to a kit. These materials may include any combination of the following: background information, list of components and their availability information (purchase information, etc.), brief or detailed protocols for using the kit, trouble-shooting, references, technical support, and any other related documents. Instructions can be supplied with the kit or as a separate member component, either as a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as a recorded presentation. Instructions can comprise one or multiple documents, and include future updates. The term “mild cognitive decline” (also referred to as “mild cognitive impairment” or MCI) refers to an early stage of memory loss or other cognitive ability loss (such as language or visual / spatial perception) in individuals who maintain the ability to independently perform most activities of daily living. Mild cognitive decline includes amnestic MCI (mild cognitive impairment that primarily affects memory, e.g. forgetting important information that would previously have recalled easily, such as appointments, conversations or recent events) and nonamnestic MCI (mild cognitive impairment that affects thinking skills other than memory, including the ability to make sound decisions, judge the time or sequence of steps needed to complete a complex task, or visual perception). As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. References in the specification and claims to parts by weight of a particular agent or component in a composition denotes the weight relationship between the agent or component and any other agents or components in the composition or article for which a part by weight is expressed. Thus, in a compound or composition containing 2 parts by weight of component X and 5 parts by weight component Y, X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the compound. A weight percent (wt. %) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included. Thus, the amount of X in a compound or composition containing X (5 wt.%) contains 5% X. The term “pharmaceutical formulation” refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which does not contain additional components that are unacceptably toxic to a subject to which the formulation would be administered. A “pharmaceutical composition” refers to a mixture of substances suitable for administering to a subject that includes one or more active ingredients or pharmaceutical agents (e.g., one or more compound of Formula I). For example, a pharmaceutical composition may comprise one or more compounds of the invention and a sterile aqueous solution or a pharmaceutically acceptable carrier. A “pharmaceutically acceptable carrier,” as used herein, refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which can be safely administered to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative. As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed, and that they refer to reducing, inhibiting or preventing in whole or in part for the therapeutic and / or prophylactic purposes described herein. Prodrugs are well known to those in the art with knowledge of chemistry. As used herein, a “prodrug” is understood to refer to a compound that, after administration, is metabolized or otherwise converted to an active or more active form with respect to at least one biological property, relative to itself. To produce a prodrug, a pharmaceutically active compound (e.g., tonabersat), or a suitable precursor thereof, is modified chemically such that the modified form is less active or inactive, but the chemical modification is effectively reversible under certain biological conditions such that a pharmaceutically active form of the compound is generated by metabolic or other biological processes. A prodrug can have, relative to the drug, altered metabolic stability or transport characteristics, fewer side effects or lower toxicity, or improved flavor, for example. Prodrugs can also be prepared using compounds that are not drugs but which upon activation under certain biological conditions generate a pharmaceutically active compound. As used herein, for example, a “tonabersat prodrug” or “prodrug of tonabersat” refers to a compound that undergoes a chemical conversion, through a metabolic process or otherwise (e.g., within the body of the mammal or other subject receiving the compound) into an active form of tonabersat that has a desired effect. In other words, a tonabersat prodrug includes a compound that upon activation releases tonabersat or an active analog thereof. As used herein, the term “subject” or the like, including “individual,” and “patient”, all of which may be used interchangeably herein, refers to any mammal, including humans, domestic and farm animals, and zoo, wild animal park, sports, or pet animals, such as dogs, horses, cats, sheep, pigs, cows, etc. In some instances, however, a patient may refer to a subject afflicted with specific a condition, disease, defect, syndrome or disorder. The terms “subject” and “patient” include human and veterinary subjects. The preferred mammal herein is a human, including adults, children, and the elderly. Preferred sports animals are horses and dogs. Preferred pet animals are dogs and cats. The subject may be, for example, an aquatic park animal, such as a dolphin, whale, seal or walrus. In certain embodiments, the subject, individual or patient is a human. The term “subject” does not denote a particular age or sex. In some embodiments, subjects may include animals used in scientific experiments (e.g. mice, rats, rabbits, sheep, goats, or other laboratory subjects). In other embodiments, the term “subjects” may exclude one or more or all animals used in scientific experiments, and a method may specify that is does not include one or more or all animals used in scientific experiments. In some embodiments, subjects may include non-animals and other things used in scientific experiments (e.g., fruit flies, cells, cell cultures, tissues, organs, 3D tissue culture (such as organs-on-a-chip). In other embodiments, the term “subjects” may exclude one or more or all non-animals or other things used in scientific experiments and a method may specify that is does not include one or more or all non-animals or other things used in scientific experiments. In some embodiments of the disclosed methods, a subject has been diagnosed with a need for treatment of one or more conditions or diseases associated with telomere length. In some embodiments of the disclosed methods, the subject has been diagnosed with a need for treatment of one or more conditions or diseases associated with telomerase levels or activity. In some embodiments of the disclosed methods, the subject has been diagnosed with a need for treatment of one or more conditions or diseases associated with TERT levels or activity. In some embodiments of the disclosed methods, the subject has been diagnosed with a need for treatment of cognitive decline, or one or more conditions or diseases associated with cognitive decline. In some embodiments of the disclosed methods, the subject has been diagnosed with a need for treatment of cell senescence, or one or more conditions or diseases associated with cell senescence. In some embodiments of the disclosed methods, the subject has been diagnosed with a need for treatment of one or more conditions or diseases associated with increased PECAM-1 levels, expression or activity. Telomeres, telomerase, and the molecular components of telomerase, including telomerase reverse transcriptase, are well known in the art. See, e.g., Shay, JW and Wright, WE. Telomeres and telomerase: three decades of progress. Nat Rev Genet 201920:299-309. A “telomere” is a region of repetitive nucleotide sequences located at the ends of a chromosome. For vertebrates, the sequence of nucleotides in telomeres is TTAGGG. In humans, this sequence of TTAGGG may be repeated approximately 2,500 times. “Telomerase” is an RNA-dependent DNA polymerase that adds TTAGGG that repeats at the ends of chromosomes. This ribonucleoprotein enzyme is composed of multi-subunits, but its core holoenzyme contains only an RNA template (TERC) and catalytic telomerase reverse transcriptase (TERT). The human TERT protein (1132 amino acids, 127 kDa) contains four conserved structural domains: the telomerase essential N-terminal (TEN) domain, the TERT RNA binding domain (TRBD), the reverse transcriptase (RT) domain and the C-terminal extension (CTE) domain. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified. The TERT protein is responsible for the synthesis of telomeric DNA repeats from the RNA template located within TR. The TERT protein component is present across all known taxa (with the exception of a subgroup of select insects). Cells with impaired telomerase or TERT function have limited capacity for self-renewal, i.e., an abnormal state or condition characterized by an inability of cells (e.g., stem cells) to divide sufficiently. This deficiency in cells can lead to various diseases and disorders, including telomere- related diseases and telomere syndromes, for example. As used herein, “telomeric region” refers to the DNA segment at the ends of a chromosome with repeat telomeric sequences. In the case of vertebrates, it can be the (TTAGGG)n repeat sequence at the ends of chromosomes. As used herein, “sub-telomeric region” means the segment of DNA immediately adjacent to telomere at the centromeric end of telomeres. Subtelomeric region often contains degenerate telomeric repeats. In the case of humans, repeats of TGAGGG and TCAGGG can be present in subtelomeric region. As used herein, a “telomere-related” disease, disorder, defect and / or condition (and grammatical variations thereof), refers to a disease, disorder, defect and / or condition related, in whole or part to, to telomerase, telomerase reverse transcriptase, telomere shortening and / or telomere length, that may be treated by compounds, compositions and methods that help to recover, improve, increase telomeres, telomere length, telomerase activity or telomerase reverse transcriptase activity, including compounds, compositions and methods described or referred to herein, such as, for example, compounds, compositions and methods comprising a compound of Formula I. Telomere-related diseases, disorders and conditions include telomerase-related, telomerase reverse transcriptase-related, and telomere length-related diseases, disorders and conditions. The term “telomere syndrome,” “telomere disease” or “disorder associated with telomerase dysfunction” refers to a disease, disorder, defect, syndrome or condition associated with abnormal telomeres. They include, but not are limited to, short telomere syndrome, dyskeratosis congenital (DC), a bone marrow failure syndrome characterized by the reticulated skin hyperpigmentation, nail dystrophy, and oral leukoplakia; Revesz syndrome, a phenotypic variant of DC; Hoyeraal- Hreidarsson syndrome, an X-linked syndromic intellectual disability considered to be a variant of DC; cerebroretinal microangiopathy with calcifications and cysts (CRMCC), also known as Coats plus syndrome, is an autosomal recessive pleomorphic disorder characterized primarily by intracranial calcifications, leukodystrophy, and brain cysts, resulting in spasticity, ataxia, dystonia, seizures, and cognitive decline; some forms of inherited aplastic anemia / myelodysplastic syndrome; aplastic anemia; marrow failure; hematological disorder hepatic disease (e.g., chronic liver disease, and hepatic cirrhosis). Telomere diseases also include those affecting the blood and immune systems, lungs, liver, skin, mucosal surfaces, bones, cardiovascular system, endocrine system, and / or gastrointestinal system, as cells with the impaired self-renewal capacity can affect the normal function of organs or systems. Some of these disorders include aplastic anemia, hepatic cirrhosis, osteoporosis and osteonecrosis, vascular malformations, diabetes, primary immunodeficiency, and inflammatory bowel disease. This group of diseases are associated with a cellular state marked with decreased self-renewal capacity that can be attributed to an alteration in telomere length. Thus, the term “telomere deficiency” as used herein refers to a cellular state in the body, including stem cells, induced pluripotent cells and fibroblasts, and is often marked by a perturbation in expression or activity of an enzyme that is involved in regulating telomere size, such as TERT. As used herein, the term “telomerase dysfunction” refers to abnormal levels, activity or function of telomerase in a cell or patient. For example, telomerase dysfunction can include telomerase deficiency, including where telomerase levels are lower than normal due, for example, to excess or unwanted telomerase degradation, telomerase under-activity, etc. As used herein, the term “telomerase reverse transcriptase dysfunction” or “TERT dysfunction” refers to abnormal levels, activity or function of telomerase reverse transcriptase in a cell or patient. For example, telomerase reverse transcriptase dysfunction can include telomerase reverse transcriptase deficiency, including reduced TERT levels, reduced TERT activity or reduced TERT function, such as where telomerase levels are lower than normal due to excess or unwanted telomerase reverse transcriptase degradation, and telomerase reverse transcriptase under-activity. A short telomere or abnormal telomere can refer to a telomere that has a length that is significantly shorter than what is expected for the age of the subject. If a subject has telomere lengths that are <1stpercentile in granulocytes and lymphocytes, there is a high probability of a short-telomere syndrome, as discussed in Abhishek A., et al. Short Telomere Syndromes in Clinical Practice – Bridging Bench and Bedside. Mayo Clin Proc. 2018 July; 93(7): 904-916. A telomere length within the 1-10thpercentile range can be considered as at risk of having a short-telomere syndrome. As used herein, “treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to an attempt to alter the course of the individual, tissue or cell being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Thus, the term “treatment” includes the management or care of a subject, or of a patient, with the intent to cure, ameliorate, stabilize, or prevent a disease, disorder, defect or condition. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, disorder, defect or condition, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, disorder, defect or condition. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, disorder, defect or condition; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, disorder, defect or condition; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, disorder, defect or condition. In various aspects, the term covers any treatment of a subject, including a mammal (e.g., a human), and includes: (i) preventing a disease, disorder or condition from occurring in a subject that can be predisposed to the disease, disorder or condition but has not yet been diagnosed as having it; (ii) inhibiting a disease, disorder or condition, i.e., arresting or slowing its development; or (iii) relieving a disease, disorder or condition, i.e., causing regression of the disease, disorder or condition. In some embodiments, the subject is a mammal such as a primate, and, in further embodiments, the subject is a human. In some embodiments, the subject is a non- human mammal. Treatment does not necessarily imply that a subject or patient is treated until total recovery following treatment, or that treatment of a subject or patient results in total recovery. Accordingly, “treatment” may also include maintaining or promoting a complete or partial state of remission in a subject or patient, or an alleviation or relief from symptoms of the disease, disorder, defect of conditions being treated, whether in whole or in part, temporary or permanent. The term “preventing” means preventing in whole or in part or ameliorating or controlling. In some embodiments, compounds, compositions, methods, and kits of the invention are used in the treatment of a subject or a patient for cognitive decline (including, e.g., mild cognitive decline), cell senescence, lack, loss or diminution of telomerase or telomerase activity, loss or diminution of telomerase reverse transcriptase (TERT), TERT expression or TERT activity, telomere length (e.g., telomere shortening), and / or activity or expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1). In some embodiments, a cell or group of cells is treated. In some embodiments, compounds, compositions, methods, and kits of the invention are used in the prevention of cognitive decline (including, e.g., mild cognitive decline), cell senescence, lack, loss or diminution of telomerase or telomerase activity, loss or diminution of telomerase reverse transcriptase (TERT), TERT expression or TERT activity, telomere shortening, and / or unwanted activity or expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1) in a subject or a patient. In some embodiments, these are prevented in a cell or group of cells. In some embodiments, compounds, compositions, methods, and kits of the invention are used alleviation of one or more signs or symptoms of, or diminishment of one or more direct or indirect pathological consequences of cognitive decline (including, e.g., mild cognitive decline), cell senescence, lack, loss or diminution of telomerase or telomerase activity, loss or diminution of telomerase reverse transcriptase (TERT), TERT expression or TERT activity, telomere shortening, and / or unwanted activity or expression of platelet / endothelial cell adhesion molecule-1 (PECAM- 1) in a subject or a patient. In some embodiments, the signs or symptoms of, or one or more direct or indirect pathological consequences, are alleviated or diminished in a cell or group of cells. Telomere diseases or disorders associated with telomerase dysfunction are typically associated with changes in the size of telomere. Proteins involved in the telomere regulatory pathway, including TERT and telomerase itself. Also provided herein are methods of evaluating, screening, comparing, selecting and quantifying one or more activities of agents that modulate these proteins. In some embodiments, methods of the invention feature the use of compounds of Formula I, for example tonabersat and / or carabersat. Carabersat is N-[(3R,4S)-6-acetyl-3-hydroxy-2,2-dimethyl- 3,4-dihydrochromen-4-yl]-4-fluorobenzamide) and is also referred to as trans-(+)-6-acetyl-4-(S)- (4-fluorobenzoylamino)-3,4-dihydro-2,2-dimethyl-2H-1-benzo[b]pyran-3R-ol,hemihydrate. Tonabersat is also known by the IUPAC name N-[(3S,4S)-6-acetyl-3-hydroxy-2,2-dimethyl-3,4- dihydrochromen-4-yl]-3-chloro-4-fluorobenzamide or (3S-cis)-N-(6-acetyl-3,4-dihydro-3- hydroxy-2,2-(dimethyl-d6)-2H-1-benzopyran-4-yl)-3-chloro-4-fluorobenzamide). In some embodiments, the compound of the invention is a compound according to Formula I: wherein Y is C—R1; R1is acetyl; R2is hydrogen, C3-8cycloalkyl, C1-6alkyl optionally interrupted by oxygen or substituted by hydroxy, C1-6alkoxy or substituted aminocarbonyl, C1-6alkylcarbonyl, C1-6alkoxycarbonyl, C1-6alkylcarbonyloxy, C1-6alkoxy, nitro, cyano, halo, trifluoromethyl, or CF3-S-; or a group CF3-A-, where A is —CF2—,—CO—, —CH2—, CH(OH), SO2, SO, CH2—O, or CONH; or a group CF2H- A′- where A′ is oxygen, sulphur, SO, SO2, CF2or CFH; trifluoromethoxy, C1-6alkylsulphinyl, perfluoro C2-6alkylsulphonyl, C1-6alkylsulphonyl, C1-6alkoxysulphinyl, C1-6alkoxysulphonyl, aryl, heteroaryl, arylcarbonyl, heteroarylcarbonyl, phosphono, arylcarbonyloxy, heteroarylcarbonyloxy, arylsulphinyl, heteroarylsulphinyl, arylsulphonyl, or heteroarylsulphonyl in which any aromatic moiety is optionally substituted, C1-6alkylcarbonylamino, C1-6alkoxycarbonylamino, C1-6alkyl-thiocarbonyl, C1-6alkoxy-thiocarbonyl, C1-6alkyl- thiocarbonyloxy, 1-mercapto C2-7alkyl, formyl, or aminosulphinyl, aminosulphonyl or aminocarbonyl, in which any amino moiety is optionally substituted by one or two C1-6alkyl groups, or C1-6alkylsulphinylamino, C1-6alkylsulphonylamino, C1-6alkoxysulphinylamino or C1-6alkoxysulphonylamino, or ethylenyl terminally substituted by C1-6alkylcarbonyl, nitro or cyano, or —C(C1-6 alkyl)NOH or —C(C1-6 alkyl)NNH2; or amino optionally substituted by one or two C1-6alkyl or by C2-7alkanoyl; one of R3and R4is hydrogen or C1-4alkyl and the other is C1-4alkyl, CF3, or CH2Xa, where Xais fluoro, chloro, bromo, iodo, C1-4 alkoxy, hydroxy, C1-4 alkylcarbonyloxy, —S—C1-4 alkyl, nitro, amino optionally substituted by one or two C1-4alkyl groups, cyano or C1-4alkoxycarbonyl; or R3and R4together are C2-5polymethylene optionally substituted by C1-4alkyl; R5is C1-6alkylcarbonyloxy, benzoyloxy, ONO2, benzyloxy, phenyloxy or C1-6alkoxy and R6and R9are hydrogen or R5is hydroxy and R6is hydrogen or C1-2alkyl and R9is hydrogen; R7is heteroaryl or phenyl, both of which are optionally substituted one or more times independently with a group or atom selected from chloro, fluoro, bromo, iodo, nitro, amino optionally substituted once or twice by C1-4alkyl, cyano, azido, C1-4alkoxy, trifluoromethoxy and trifluoromethyl; R8is hydrogen, C1-6alkyl, OR11or NHCOR10wherein R11is hydrogen, C1-6alkyl, formyl, C1-6alkanoyl, aroyl or aryl-C1-6alkyl and R10is hydrogen, C1-6alkyl, C1-6alkoxy, mono or di C1-6alkyl amino, amino, amino-C1-6alkyl, hydroxy-C1-6alkyl, halo-C1-6alkyl, C1-6acyloxy-C1-6alkyl, C1-6alkoxycarbonyl-C1-6alkyl, aryl or heteroaryl; the R8—N—CO—R7group being cis to the R5group; and X is oxygen or NR12where R12is hydrogen or C1-6alkyl. For any of the Markush groups set forth above, in some embodiments, each group can include or exclude any of the species listed for that group. In some embodiments, the compound can be Tonabersat, carabersat, or SB-204269. SB-204269 is also known as (trans-(+)-6-acetyl-4S-(4-fluorobenzoylamino)-3, 4-dihydro-2,2-dimethyl-2H- benzo[b]pyran-3R-ol). Carabersat is also known as N-[(3R,4S)-6-Acetyl-3-hydroxy-2,2- dimethyl-3,4-dihydro-2H-chromen-4-yl]-4-fluorobenzamide. Tonabersat is also known as N-(6- Acetyl-3-hydroxy-2,2-dimethyl-3,4-dihydro-2H-chromen-4-yl)-3-chloro-4-fluorobenzamide. For any of the Markush groups set forth above, that group can include or exclude any of the species listed for that group. In some embodiments, the compound may be a prodrug for use in this invention. In one aspect the prodrug form of a compound of this invention may be a compound of Formula II:

[0002] wherein Q is O or an oxime, R2 is H, A is a direct bond, -C(O)O*-, -C(R3)(R4)O*-, -C(O)O-C(R3)(R4)O*-, or -C(R3)(R4)OC(O)O*- wherein the atom marked * is directly connected to R1, R3 and R4 are selected independently from H, fluoro, C1-4 alkyl, and C1-4 fluoroalkyl, or R3 and R4 together with the atom to which they are attached form a cyclopropyl group, R1 is selected from groups [1], [2], [2A],[3], [4], [5] and [6] wherein the atom marked ** is directly connected to A: wherein R5and R6are each independently selected from H, C1-4alkyl, C1-4fluoroalkyl, and benzyl; R7is independently selected from H, C1-4alkyl, and C1-4fluoroalkyl; R8is selected from: (i) H, C1-4alkyl, or C1-4fluoroalkyl, (ii) the side chain of a natural or unnatural alpha-amino acid, or a peptide as described herein, and (iii) biotin or chemically linked to biotin; R9is selected from H, –N(R11)(R12), –N+(R11)(R12)(R13)X-, and –N(R11)C(O)R14; wherein R11, R12, and R13are independently selected from H, C1-4alkyl, and C1-4fluoroalkyl, R14is H, C1-4alkyl, or C1-4fluoroalkyl, R15is selected from C1-4alkyl and C1-4fluoroalkyl, and X- is a pharmaceutically acceptable anion. In some embodiments, R2is B-R21wherein, B is a direct bond, -C(O)O*-, -C(R23)(R24)O*, C(O)OC(R23)(R24)*, or -C(R23)(R24)OC(O)O* wherein the atom marked * is directly connected to R21, R23and R24are selected independently from H, fluoro, C1-4alkyl, and C1-4fluoroalkyl, R21is selected from groups

[0021] ,

[0022] , [22A],

[0023] ,

[0024] ,

[0025] and

[0026] wherein the atom marked ** is directly connected to B: wherein R5, R6, R7, R8, R9, and R15are as defined herein. For any of the Formula II Markush groups set forth above, that group can include or exclude any of the species listed for that group. In some embodiments, Q is an oxime of formula =NOR43, wherein R43is (i) selected from H, C1-4fluoroalkyl or optionally substituted C1-4alkyl, and (ii) -A300-R300wherein A300is a direct bond, -C(O)O*-, -C(R3)(R4)O*-, -C(O)O-C(R3)(R4)O*-, or -C(R3)(R4)OC(O)O*- wherein the atom marked * is directly connected to R300, R3and R4are selected independently from H, fluoro, C1-4alkyl, and C1-4fluoroalkyl, or R3and R4together with the atom to which they are attached form a cyclopropyl group, R300is selected from groups [1], [2], [2A], [3], [4], [5] and [6] wherein the atom marked ** is directly connected to A300: wherein R5and R6are each independently selected from H, C1-4alkyl, C1-4fluoroalkyl, and benzyl; R7is independently selected from H, C1-4alkyl, and C1-4fluoroalkyl; R8 is selected from: (iii) H, C1-4alkyl, or C1-4fluoroalkyl, (iv) the side chain of a natural alpha-amino acid, and (v) biotin or chemically linked to biotin; R9is selected from H, -N(R11)(R12), –N+(R1l)(R12)(R13)X-, and -N(R11)C(O)R14; wherein R11, R12, and R13are independently selected from H, C1-4alkyl, and C1-4fluoroalkyl, R14 is H, C1-4 alkyl, or C1-4 fluoroalkyl, R15is selected from C1-4alkyl and C1-4fluoroalkyl, and X- is a pharmaceutically acceptable anion. In one embodiment of Formula II R43, is C1-4 alkyl optionally substituted with a phosphate group (P(O)OR61R62). In an example of such an embodiment OR43is -OCH2P(O)OR61OR62, wherein R61and R62are independently H or C1-4alkyl. In another embodiment of Formula II R43 is an amino acid derivative having the structure C(O)CH(R100)NH2wherein the group R100is the side chain of a natural or unnatural amino acid or a peptide as described herein. In some embodiments, the natural amino acid is selected from one of the 22 canonical amino acids. In some embodiments, the unnatural amino acid is selected from any amino acid which is not one of the 22 canonical amino acids. In some embodiments, the unnatural amino acid is selected from: (cis)-3-Aminobicyclo[2.2.1]heptane-2-carboxylic acid hydrochloride, exo-cis-3- Aminobicyclo[2.2.1]hept-5-ene-2-carboxylic acid hydrochloride, cis-2-Amino-2- methylcyclohexanecarboxylic acid hydrochloride, (R)-2-(Boc-amino)octanedioic acid, Boc-4- (Fmoc-amino)-L-phenylalanine, Boc-(2-indanyl)-Gly-OH, (R)-4-Boc-3-morpholineacetic acid, (S)-4-Boc-3-morpholineacetic acid, Boc-pentafluoro-D-phenylalanine, Boc-pentafluoro-L- phenylalanine, Boc-Phe(2-Br)-OH, Boc-Phe(4-Br)-OH, Boc-D-Phe(4-Br)-OH, Boc-D-Phe(3-Cl)- OH, Boc-Phe(4-NH2)-OH, Boc-Phe(3,5-F2)-OH, 2-(4-Boc-piperazino)-2-(2-fluorophenyl)acetic acid, 2-(4-Boc-piperazino)-2-(4-fluorophenyl)acetic acid, 2-(4-Boc-piperazino)-2-phenylacetic acid, 2-(4-Boc-piperazino)-2-(3-pyridyl)acetic acid, penicillamine, thialysine. quisqualic acid, canavanine. azetidine-2-carboxylic acid, Carboxyglutamic acid, Hydroxyproline, Hypusine, and Pyroglutamic acid. In one embodiment of Formula II OR43is -OC(O)CH(CH(CH3)2)NH2. For any of the Formula II Markush groups set forth above, in some embodiments, each group can include or exclude any of the species listed for that group. In some embodiments “promoiety” refers to a species acting as a protecting group which masks a functional group within an active agent, thereby converting the active agent into a pro-drug. The active agent may be any of the compounds or ocular therapeutics disclosed herein. Typically, the promoiety will be attached to the drug via bond(s) that are cleaved by enzymatic or non-enzymatic means in vivo, thereby converting the pro-drug into its active form. In some embodiments the promoiety may also be an active agent. In some embodiments the promoeity may be bound to a compound of Formula I. In some embodiments the pro-drug may be a compound of Formula II. In some embodiments, the promoeity is a single amino acid which is optionally protected on its functional groups. In some embodiments, the promoeity is a targeting species. In some embodiments, the promoeity is a substrate for an influx or efflux transporters on the cell membrane, for example those described in Gaudana, R. et al. Ocular Drug Delivery. The AAPS Journal, 12:3, 348-360 (2010). The promoeity can be, for example, chemically-linked biotin. The promoeity can be, for example, chemically-linked D-serine. In some embodiments, compounds of Formula I or Formula II, e.g., tonabersat, carabersat or analogues thereof, are nonionic, are in the form of a free base, a free acid, or a pharmaceutically acceptable salt. By way of example, a pharmaceutically acceptable salt includes a hydrochloride salt and salts derived from acid including, but not limited to, hydrobromic acid, hydrochloric acid, phosphoric acid, acetic acid, fumaric acid, maleic acid, salicylic acid, citric acid, oxalic acid, lactic acid, malic acid, succinic acid, methanesulphonic acid and p-toluene sulphonic acid, a salt of itself. In one embodiment, the salt is a hydrochloride salt. In one embodiment, the salt is a succinate salt. In other embodiments, one or more polymorph, one or more isomer, and / or one or more solvate of a compound of Formula I or Formula II, e.g., tonabersat, carabersat or analogues thereof, may be used. In some embodiments, two or more of a compound of Formula I may be administered alone or together. In some embodiments, two or more separate pharmaceutical compositions that each contain one or more of a compound of Formula I are provided for administration. Pharmaceutical compositions are also provided for co-administration in the form of a combined preparation, for example, as an admixture of two or more compounds of Formula I. Treatment of a subject or a patient, including e.g., for one or more of the diseases, disorders, defects or conditions described or referenced herein, with one or more pharmaceutical compositions of the invention, e.g., a compound of Formula I and a second, different compound of Formula I , may comprise their simultaneous, separate, sequential or sustained administration. The term “a combined preparation” includes a “kit of parts” or “article of manufacture” in the sense that the combination partners as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners (a) and (b), i.e. simultaneously, separately or sequentially, whether in pharmaceutical form (e.g. topical or oral) or dressing / matrix form or both in accordance with the methods of the invention. The parts of the kit can then, for example, be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts. In some embodiments, a combined preparation is administered, wherein two or more separate compositions are administered to a subject in accordance with the methods of the invention. In some embodiments, the first composition comprises a therapeutically effective amount of a compound of Formula I, and the second composition comprises a therapeutically effective amount of a second compound of Formula I and / or an ocular treatment agent. In another embodiment a third composition is administered comprising one or more of a compound of Formula I or another therapeutic agent (e.g., for treating cognitive decline, cell senescence, etc.). The compositions may also contain another agent for treatment or prophylaxis. The compositions can be dosed, administered, or formulated in methods of the invention as described herein. Doses and Dose Regimens Examples of effective doses that may be used for the treatment of cognitive decline, mild cognitive decline and other diseases, disorders, defects and conditions described or referenced herein, including diseases, disorders, defects or conditions associated with and cognitive decline, mild cognitive decline, cell senescence, lack, loss or diminution of telomerase or telomerase activity, lack loss or diminution of telomerase reverse transcriptase (TERT), TERT expression, and / or TERT activity, telomere length, telomere shortening, and / or an unwanted or undesired activity or expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1) are described. They include, for example, doses and dose regimens that are useful for the application or administration of a compound of Formula I to treat or prevent cognitive decline, to treat or prevent mild cognitive decline, to protect against or slow cognitive decline, to treat cell senescence, to protect against cell senescence, to prevent or reduce cell senescence, to slow cell senescence, to increase telomerase activity, to protect against loss of telomerase reverse transcriptase (TERT), to increase TERT levels, increase TERT expression, to increase TERT activity to extend a telomere, to increase telomere length, and to protect against expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1) and related diseases, disorders defects and conditions. In some embodiments, a therapeutically or prophylactically effective amount of a compound effective in methods of the invention comprises a composition that includes certain doses of a compound of Formula I. In some embodiments, the dose of a compound is measured in milligrams (mg). In some embodiments, the dose of a compounds is in milligrams per kilogram (mg / kg) of a subject or patient. In some embodiments, the dose is measured in milligrams per kilogram per day (mg / kg / day). In some embodiments, the dose of a compounds is measured in milligrams per milliliter (mg / mL) or micrograms per milliliter (^g / mL). In some embodiments, the dose of a compounds is measured in micromolar (^M) or millimolar (mM) amounts of the compound in in a composition to be administered, or as local, site-of-action or circulating concentration, including as described herein. In some embodiments, the doses may be administered to provide a therapeutically or prophylactically effective amount of a compound of Formula I for cognitive decline or mild cognitive decline. In some embodiments, the therapeutically or prophylactically effective amount of a compound of Formula I may be administered to address cell senescence. In some embodiments, the therapeutically or prophylactically effective amount of a compound of Formula I may be administered to improve telomerase activity, telomerase reverse transcriptase activity, telomere length, or modulate the expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1). The doses may administered to provide a therapeutically or prophylactically effective amount of a compound of Formula I for therapeutic and / or prophylactic treatment of diseases, disorders, defects and conditions relating to one or more of the following: cognitive decline, mild cognitive decline, cell senescence, reduced telomerase activity, reduced telomerase reverse transcriptase activity, reduced telomere length, telomere shortening, and PECAM-1expression. The doses may be administered to provide a therapeutically or prophylactically effective amount of a compound of Formula I for the therapeutic and / or prophylactic treatment of diseases, disorders, defects and conditions referenced or noted herein. In some embodiments, the doses referenced herein are administered orally. In some embodiments, the doses referenced herein are administered by injection (e.g. intravenous (IV), subcutaneous (SC / SQ), intraperitoneal (IP), intradermal (ID), or intramuscular (IM)). In some embodiments, the doses are administered topically to a subject or a patient (e.g., to the skin or the eye). In some embodiments, the doses referenced herein are administered by other routes known in the art. Compounds disclosed herein or used as described herein may also be administered via implant, tissue or organ implant (e.g., hepatic, renal, cerebral, ocular, heart, CNS, etc.) or local administration including via a matrix, by inhalation or spray, sublingually, transdermally, via buccal administration, rectally, as an ophthalmic solution, ocular injection, intra-aortal, intracranial, subdermal, intraperitoneal, subcutaneous, transnasal, sublingual, intrathecal, or rectal or by other means, in dosage unit formulations containing conventional or other pharmaceutically acceptable carriers now known or later developed. In some embodiments, a dose of a compound of Formula I or a composition or compositions containing one or more of the compounds is / are administered to a cell, a group of cells, a subject or a patient in a single dose, or in two or more divided doses, e.g., for one or more daily or weekly or other timed administrations. In some embodiments, doses are administered at least once every day. In some embodiments, doses are administered BID, TID or QID. In some embodiments, doses are administered daily AC, every other day or every other evening. Reference to “administration” refers to administration in a single dose or in divided doses. Wherever a dose is not specified in a dose regimen or method of the invention for the treatment of a disease, disorder, defect or condition, dosing with a therapeutically effective amount of a compound of Formula I or composition(s) is intended. The dosages may be varied or may vary within one or more of the dose ranges or regimens provided depending upon the dosage form employed and the route of administration utilized. For any compounds used in the method of the invention, the therapeutically effective dose can be evaluated, estimated and / or quantified using cell culture assays (e.g., ARPE-19 cells). See, e.g., Example 9 and Figure 9 (treatment with a compound of Formula I protected against loss of TERT in retinal pigment epithelial cells); and, Example 8 and Figure 12 (treatment with a compound of Formula I protects against cellular senescence in an ATP dependent manner). Therapeutically effective doses can also be evaluated, estimated and / or quantified using tissue and / or assays with tissue (e.g., hippocampus). See, e.g., Figures 3, 4, 5 and 6, and Examples 4, 5, 6 and 7. Therapeutically effective doses can also be evaluated, estimated and / or quantified using animals (e.g., mice). See, e.g., Figure 2 and Example 1). Data obtained from cell culture assays, tissue assays, tissue experiments, and animal studies – as well as one or more of the screening methods for quantifying compound activity described herein (see, e.g., “Methods for Quantifying Compound Activity”) – can be used in confirming, evaluating or formulating a range of dosages for use in humans. In some embodiments, a dose may be formulated from cell cultures, tissue assays or experiments, and / or animal models to achieve a concentration or range of a compound of Formula I that includes the IC50. IC50is a quantitative measure that indicates how much of a particular substance (e.g. a drug, compound or composition) is needed to inhibit a given biological process or response or biological component by 50%. The biological component may be a protein, cell, cell receptor, etc. In some embodiments, a dose may be formulated from cell cultures, tissue assays or experiments, and / or animal models to achieve a concentration or range of a compound that includes the EC50. EC50is the concentration of a particular substance (e.g. a drug, compound or composition) that gives half-maximal response. Half maximal effective concentration is a measure of the concentration of a compound that induces a biological response halfway between the baseline and maximum after a specified exposure time. Such information can be used to accurately determine, confirm or refine doses useful in a subject or patient in a method or a use described or referenced herein. The dosage, IC50and EC50can be determined from the concentration of the amount administered, expected mass of the animal model tested (200-300 g per rat for adult Wistar rats), to determine the dose in units of mg / kg from concentration (micromolar) administered or amount (mg) administered. In humans and animals, the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient’s condition but will be initially set by the FDA and / or other regulatory agencies following clinical trials. Every country has its own regulatory authority, which is responsible to enforce the rules and regulations and issue the guidelines to regulate drug development process, licensing, registration, manufacturing, marketing and labeling of pharmaceutical products, including the MHLW (Japan), the MHRA (UK), HEALTH CANADA (CANADA), the EMEA (European Union), the SFDA (China), and MEDSAFE (New Zealand), to name a few of the few regulatory agencies and organizations established in some countries. It will be appreciated that the dose of compound administered (e.g. compound of Formula I), the period of administration, and the general administration regime may differ between subjects depending on such variables as the target site to which it is to be delivered, the severity of any symptoms of a subject to be treated, the type of disorder to be treated, size of unit dosage, the mode of administration chosen, and the age, sex and / or general health of a subject and other factors known to those of ordinary skill in the art. Administration may include a single daily dose, administration of a number of discrete divided doses, or continuous administration, as may be appropriate. By way of example, unit doses may be administered once or more than once per day, for example 1, 2, 3, 4, 5 or 6 times a day to achieve a desired total daily dose. By way of example, compound of Formula I may be administered in a single daily dose or a number of discrete doses, or continuously to achieve a daily dose of approximately about 10 to about 100 mg, about 100 to about 500 mg, about 500 mg to about 1000 mg, about 1000 to 1500 mg, about 1500 mg to about 2000 mg, or 2000 mg to 5000 mg, about 50 to approximately 2000 mg, approximately 25 to approximately 1000 mg, approximately 10 to approximately 500 mg, approximately 5 to approximately 200 mg, approximately 1 to approximately 100 mg, approximately 1 to approximately 50 mg, or approximately 1 to approximately 25 mg, or any range between any two recited dosages or any dose between any two recited dosages. In some embodiments, about 80 mg of compound of Formula I is administered at least once per day, or BID, TID, or QID. In some embodiments, about 50 to about 80 mg of compound of Formula I is administered at least once per day, or BID, TID, or QID. In some embodiments, about 75 to about 100 mg of compound of Formula I is administered at least once per day, or BID, TID, or QID. In some embodiments, about 85 mg to about 125 mg of compound of Formula I is administered at least once per day, or BID, TID, or QID. In some embodiments, about 125 mg to about 200 mg of compound of Formula I is administered at least once per day, or BID, TID, or QID. In one embodiment, tonabersat, or another compound according to Formula I or Formula II, may be administered orally once or more per day at a dose of approximately 2 mg to approximately 40 mg. In one embodiment, tonabersat, or another compound according to Formula I or Formula II, may be administered orally once or more per day at a dose of approximately 40 mg to approximately 80 mg. In one embodiment, tonabersat, or another compound according to Formula I or Formula II, may be administered orally once or more per day at a dose of approximately 80 mg to approximately 100 mg. In one embodiment, tonabersat, or another compound according to Formula I or Formula II, may be administered orally once or more per day at a dose of approximately 100 mg to approximately 200 mg. In one embodiment, tonabersat, or another compound according to Formula I or Formula II, may be administered orally once or more per day at a dose of approximately 200 mg to approximately 300 mg. In one embodiment, tonabersat, or another compound according to Formula I or Formula II, may be administered orally once or more per day at a dose of approximately 300 mg to approximately 500 mg. In one embodiment, tonabersat, or another compound according to Formula I or Formula II, may be administered orally once or more per day at a dose of approximately 500 mg to approximately 1000 mg. In one embodiment, tonabersat, or another compound according to Formula I or Formula II, may be administered orally once or more per day at a dose of approximately 1000 mg to approximately 1500 mg. In one embodiment, tonabersat, or another compound according to Formula I or Formula II, may be administered orally once or more per day at a dose of approximately 1500 mg to approximately 2000 mg. In some embodiments, the doses described herein, including milligram doses, are used for the oral administration of bioavailable compounds. In some embodiments, these doses may be reduced for administration by injection (e.g., by 10-50% or more) or increased for topical administration (e.g., 50% to 100%). The above-noted dose concentrations may be decreased or increased as appropriate based on potency and specificity of the compound, for example, and the nature or amount of a desired effect. In some embodiments, the compound of Formula I may be administered in doses measured in milligrams per kilogram (i.e., at a specified number of milligrams per kilogram of weight of a subject (mg / kg) to which a compound is being administered). In some embodiments, the compound of Formula I may be administered at a dose between about 0.1 to about 50 mg / kg, between about 1.0 to about 30 mg / kg, between about 5 to about 10 mg / kg, between about 10 to about 15 mg / kg, between about 15 to about 20 mg / kg, between about 20 to about 25 mg / kg, between about 25 to about 30 mg / kg, between about 30 to about 40 mg / kg, or between about 40 to about 50 mg / kg, or any range between any two recited dosages or any dose between any two recited dosages. In some aspects, the dose can be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or about 50 mg / kg or any range between any two of the recited dosages or any dose between any two recited numbers. In some embodiments, these doses may be administered in single dose per day, or in divided doses. In some embodiments, these doses may be administered more than once per day (e.g., BID, TID, QID, etc.) In some embodiments, a unit dose of a compound of Formula I , may be administered once or more than once a day in single or divided doses (for example 1, 2, 3, 4, 5 or 6, typically 1 to 4 times a day), such that the total daily dose is in the range (calculated for a 70 kg adult, with other amounts for subjects of different kg weights being adjusted as appropriate) of about 1 to about 1000 mg, for example approximately 1 to approximately 600 mg, or about 50 to approximately 600 mg, or about 500 mg to about 1000 mg, about 1000 to about 2000 mg, or about 2000 mg to about 5000 mg, or any amount or range between any two recited dosages. For example, a compound may be administered to a subject at a dose range, for example, of approximately 0.1 to approximately 5 mg / kg / day, 0.5 to approximately 5 mg / kg / day approximately 5 to approximately 10 mg / kg / day, about 10 to approximately 15 mg / kg / day, approximately 15 to approximately 20 mg / kg / day, approximately 20 to approximately 25 mg / kg / day, approximately 25 to approximately 30 mg / kg / day, approximately 30 to approximately 40 mg / kg / day, approximately 40 to approximately 50 mg / kg / day, or any range between any two recited dosages or any dose between any two recited dosages. In one embodiment, tonabersat may be administered orally once a day at a dose of approximately 2 mg to approximately 40 mg / kg / day. Examples of effective doses that may be used as described herein may also be described in microgram per milliliter (^g / mL) amounts, or milligram per milliliter (mg / ml) amounts. In some embodiments, for the treatment of disease, disorders, defects or conditions described or referenced herein, a concentration of about 0.1 to about 10.0 microgram / ml, or from about 0.5 mg / mL to about 100 mg / mL, or more, or any range between any two of the recited dosages or any dose between any two recited numbers. The dose can be 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 mg / ml or any range between any two of the recited dosages or any dose between any two recited numbers. In some embodiments, the therapeutically effective amount of the compound is present at a concentration ranging from about 0.5 to about 50 mg / mL. In some embodiments, the compound is present at a concentration ranging from about 0.3 to about 30 mg / mL. In some embodiments, the compound agent is present at a concentration ranging from about 0.1 or 1.0 to about 10 mg / mL. In some embodiments, the compound agent is present at a concentration ranging from about 0.1 or 1.0 to about 0.3 or 3.0 mg / mL. In some embodiments, the compound is present at a concentration of about 3.0 mg / mL. The above-noted dose concentrations may be decreased or increased as appropriate based on potency and specificity of the compound, for example, and the nature or amount of a desired effect. In one embodiment, the dose of compounds of formula I, for example tonabersat, and analogs of any of the foregoing compounds is approximately 0.001 micromolar to 0.1 micromolar, 0.1 micromolar and up to approximately 200 micromolar at or around a site of action, or higher, within the circulation to achieve those concentrations at the site of action. By way of example, the dose may be (but not limited to) a final circulating concentration or a concentration at or around a site of action of about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or about 500 micromolar, or any range between any two recited concentrations, or any concentration between any two recited numbers. All descriptions with respect to dosing, unless otherwise expressly stated, apply to the compounds of the invention. All descriptions with respect to dosing, unless otherwise expressly stated, also apply to all indications described or referenced herein. All descriptions with respect to dosing, unless otherwise expressly stated, apply to the therapeutic or prophylactic treatment of cognitive decline, cognitive decline, mild cognitive decline, and diseases, disorders, defects and conditions described or referenced herein, including those relating to or associated with cell senescence, telomere length, telomere shortening, telomerase expression, TERT, TERT expression, other diseases, disorders, defects and conditions described or referenced herein, including those relating to PECAM-1. Formulations Pharmaceutical compositions of the invention include various delivery forms and formulations, as desired or appropriate, including, for example, formulations for oral administration, parenteral administration, local administration, and topical administration of one or more compounds of Formula I , as well as forms and formulations that are appropriate for other forms of administration, including those described or referenced herein, including matrices, implants, liposomes, microparticles, nanoparticles, solutions, gels and drops. The compounds of Formula I may be formulated as compositions for any desired route of administration using methods and techniques in the art, whether now known or later developed. Such delivery forms and formulations include those for the therapeutic and / or prophylactic treatment of a subject or a patient with a compound of Formula I composition as disclosed herein. In some embodiments, pharmaceutical formulations of the invention comprise at least one compound of Formula I and may further comprise one or more pharmaceutically acceptable excipients, diluents and / or carriers. Pharmaceutically acceptable diluents, carriers and / or excipients includes substances useful in preparing a pharmaceutical composition, and are generally safe, non-toxic and neither biologically nor otherwise undesirable. Pharmaceutically acceptable diluents, carriers and / or excipients include those suitable for veterinary use as well as human pharmaceutical use. By way of example, diluents, carriers and / or excipients include solutions, solvents, dispersion media, delay agents, polymeric and lipidic agents, emulsions and the like. By way of further example, suitable liquid carriers, especially for injectable solutions, include water, aqueous saline solution, aqueous dextrose solution, and the like, and vehicles such as liposomes being also especially suitable for administration of agents. Suitable carriers and diluents include buffers, buffered solutions, aqueous solutions, saline, dextrose, glycerol, isotonic saline solutions, for example phosphate-buffered saline, isotonic water, and the like and combinations thereof. In some embodiments, carriers may include propylene glycol, dimethyl isosorbide, and water, and even more particularly, deionized water, monofunctional alcohols and symmetrical alcohols. In some embodiments, a pharmaceutically acceptable carrier or diluent may comprise or contain a thermosetting poloxamer (which may be a liquid or gel, depending on the temperature, e.g., a poloxamer), a carboxycellulose (e.g. carboxymethylcellulose), a collagen (e.g., a Type I collagen), a collagenous material comprising tropocollagen, a hyaluronan or derived-hyaluronic acid, and / or an oil (e.g., Emu oil). Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, and amino acid copolymers. In some embodiments, carriers used in formulations of the invention may include binders, buffering agents, coloring agents, diluents, disintegrants, emulsifiers, fillers, flavorings, glidants, lubricants, pH modifiers, preservatives, stabilizers, surfactants, solubilizers, tableting agents, and wetting agents. Some carriers may be in more than one class, for example vegetable oil may be used as a lubricant in some formulations and a diluent in others. Other pharmaceutically acceptable carriers include sugars, starches, celluloses, powdered tragacanth, malt, gelatin, talc, and vegetable oils. Examples of other matrix materials, fillers, or diluents include lactose, mannitol, xylitol, microcrystalline cellulose, calcium diphosphate, and starch. Examples of surface-active agents include sodium lauryl sulfate and polysorbate 80. Examples of drug complexing agents or solubilizers include the polyethylene glycols, caffeine, xanthene, gentisic acid and cylodextrins. Examples of disintegrants include sodium starch glycolate, sodium alginate, carboxymethyl cellulose sodium, methyl cellulose, colloidal silicon dioxide, and croscarmellose sodium. Examples of binders include methyl cellulose, microcrystalline cellulose, starch, and gums such as guar gum, and tragacanth. Examples of lubricants include magnesium stearate and calcium stearate. Examples of pH modifiers include acids such as citric acid, acetic acid, ascorbic acid, lactic acid, aspartic acid, succinic acid, phosphoric acid, and the like; bases such as sodium acetate, potassium acetate, calcium oxide, magnesium oxide, trisodium phosphate, sodium hydroxide, calcium hydroxide, aluminum hydroxide, and the like, and buffers generally comprising mixtures of acids and the salts of said acids. Optional other active agents may be included in a pharmaceutical composition, which do not substantially interfere with the activity of the compound of the present invention. In some embodiments, the pharmaceutical composition for administration includes an active compound as described or referenced herein and optionally comprises one or more of a phosphoglyceride; phosphatidylcholine; dipalmitoyl phosphatidylcholine (DPPC); dioleoylphosphatidyl ethanolamine (DOPE); dioleyloxypropyltriethylammonium (DOTMA); dioleoylphosphatidylcholine; cholesterol; cholesterol ester; diacylglycerol; diacylglycerolsuccinate; diphosphatidyl glycerol (DPPG); hexanedecanol; fatty alcohol such as polyethylene glycol (PEG); polyoxyethylene-9-lauryl ether; a surface active fatty acid, such as palmitic acid or oleic acid; fatty acid; fatty acid monoglyceride; fatty acid diglyceride; fatty acid amide; sorbitan trioleate (Span®85) glycocholate; sorbitan monolaurate (Span®20); polysorbate 20 (Tween®20); polysorbate 60 (Tween®60); polysorbate 65 (Tween®65); polysorbate 80 (Tween®80); polysorbate 85 (Tween®85); polyoxyethylene monostearate; surfactin; a poloxamer; a sorbitan fatty acid ester such as sorbitan trioleate; lecithin; lysolecithin; phosphatidylserine; phosphatidylinositol; sphingomyelin; phosphatidylethanolamine (cephalin); cardiolipin; phosphatidic acid; cerebroside; dicetylphosphate; dipalmitoylphosphatidylglycerol; stearylamine; dodecylamine; hexadecyl-amine; acetyl palmitate; glycerol ricinoleate; hexadecyl stearate; isopropyl myristate; tyloxapol; poly(ethylene glycol)5000-phosphatidylethanolamine; poly(ethylene glycol)400-monostearate; phospholipid; synthetic and / or natural detergent having high surfactant properties; deoxycholate; cyclodextrin; chaotropic salt; ion pairing agent; glucose, fructose, galactose, ribose, lactose, sucrose, maltose, trehalose, cellbiose, mannose, xylose, arabinose, glucoronic acid, galactoronic acid, mannuronic acid, glucosamine, galatosamine, and neuramic acid; pullulan, cellulose, microcrystalline cellulose, hydroxymethylcellulose (HMC), hydroxypropyl methylcellulose (HPMC), hydroxyethylcellulose (HEC), hydroxypropyl cellulose (HPC), hydroxycellulose (HC), carboxymethylcellulose (CMC), methylcellulose (MC), dextran, cyclodextran, glycogen, hydroxyethylstarch, carageenan, glycon, amylose, chitosan, N,O- carboxylmethylchitosan, algin and alginic acid, starch, chitin, inulin, konjac, glucommannan, pustulan, heparin, hyaluronic acid, curdlan, and xanthan, mannitol, sorbitol, xylitol, erythritol, maltitol, and lactitol, a pluronic polymer, polyethylene, polycarbonate (e.g. poly(1,3-dioxan- 2one)), polyanhydride (e.g. poly(sebacic anhydride)), polypropylfumerate, polyamide (e.g. polycaprolactam), polyacetal, polyether, polyester (e.g., polylactide, polyglycolide, polylactide- co-glycolide, polycaprolactone, polyhydroxyacid (e.g. poly((β-hydroxyalkanoate))), poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polyurea, polystyrene, and polyamine, polylysine, polylysine- PEG copolymer, and poly(ethyleneimine), poly(ethylene imine)-PEG copolymer, glycerol monocaprylocaprate, propylene glycol, Vitamin E TPGS (also known as d-α-Tocopheryl polyethylene glycol 1000 succinate), gelatin, titanium dioxide, polyvinylpyrrolidone (PVP), block copolymers of ethylene oxide and propylene oxide (PEO / PPO), polyethyleneglycol (PEG), sodium carboxymethylcellulose (NaCMC), hydroxypropylmethyl cellulose acetate succinate (HPMCAS). In some embodiments, the pharmaceutical preparation may include a polymer for controlled delivery of the described compounds, including, but not limited to, a pluronic polymer, polyester (e.g., polylactic acid, poly(lactic-co-glycolic acid), polycaprolactone, polyvalerolactone, poly(1,3- dioxan-2one)); polyanhydride (e.g., poly(sebacic anhydride)); polyether (e.g., polyethylene glycol); polyurethane; polymethacrylate; polyacrylate; and polycyanoacrylate. In some embodiments, the polymer may be modified with polyethylene glycol (PEG), with a carbohydrate, and / or with an acyclic polyacetal derived from a polysaccharide. Compositions may be formulated for any desired form or route of delivery, including topical, instillation, parenteral, intramuscular, subcutaneous, transdermal administration, etc. In some embodiments, one more compounds of the invention are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition or formulation. One or more of a compound of Formula I may be formulated as compositions for any desired route of administration, including topical, oral, systemic, transdermal, nasal, sublingual, buccal, etc. including formulations for injection (e.g. intracameral injection, subcutaneous injection, intramuscular injection, intravenous injection, etc.). In some embodiments, formulations of the invention are prepared for oral administration. In some embodiments, formulations of the invention are prepared for administered by injection (e.g. intravenous (IV), subcutaneous (SC / SQ), intraperitoneal (IP), intradermal (ID), or intramuscular (IM)). In some embodiments, the formulations of the invention are prepared for topical or local administration to a subject or a patient (e.g., to the skin or the eye). In some embodiments, the doses referenced herein of the invention are prepared for administration by other routes known in the art. In some embodiments, compounds disclosed or referenced herein are formulated for administration via implant, via tissue or organ implant (e.g., hepatic, renal, cerebral, ocular, heart, CNS, etc.), for local administration including for administration via a patch or in a matrix or bandage, for administration by inhalation or spray, for sublingual administration, for transdermal administration, for buccal administration, for rectal administration, for nasal or transnasal administration, for ocular administration (e.g. as an ophthalmic solution, gel or drop), or for intra-aortal, intracranial, subdermal, intraperitoneal, subcutaneous, sublingual, intrathecal administration, in dosage unit formulations containing conventional or other pharmaceutically acceptable carriers now known or later developed. Other useful formulations include slow or delayed release preparations. Slow and delayed release preparations may be prepared using established methods and techniques well known in the art. Pharmaceutically acceptable salts can also be present, e.g., mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as citrates, acetates, propionates, malonates, benzoates, and the like. In addition, if desired substances such emulsifying agents, stabilizing agents, or preservatives may also be present. In some embodiments, the pharmaceutical compositions of this invention for use in or on a subject or patient may comprise pH stabilizing buffers such as acetate buffers, citrate buffers, phosphate buffers, borate buffers and mixtures thereof. In some embodiments, the buffers useful in the present invention include boric acid, sodium borate, sodium phosphates, including mono, di- and tri-basic phosphates, such as sodium phosphate monobasic monohydrate and sodium phosphate dibasic heptahydrate, and mixtures thereof. In some embodiments, the preservative may be stabilized chlorine dioxide, cationic polymers or quaternary ammonium compounds. In some embodiments the pharmaceutical compositions may also comprise wetting agents, nutrients, viscosity builders, antioxidants, and the like, for example, disodium ethylene diamine tetraacetate, alkali metal hexametaphosphate, citric acid, sodium citrate, sodium metabisulfite, sodium thiosulfate, N-acetylcysteine, butylated hydroxyanisole, butylated hydroxytoluene, polyvinyl alcohol, polyoxamers, polyvinyl pyrrollidone, and mixtures thereof and mixtures thereof. In some embodiments, the pharmaceutical formulations of this invention will not include a preservative. In some embodiments, the composition or formulation comprises sodium phosphate dibasic heptahydrate or potassium phosphate, monobasic or both. Pharmaceutically acceptable excipients are known in the art, including to those of ordinary skill in the art. In some embodiments, the formulations may provide for sustained delivery of a compound to a subject, a patient, or to a selected tissue, organ, segment or compartment of a subject or a patient. In some embodiments, the formulations provide high (including via topical or oral administration, for example) drug bioavailability, are safe and non-toxic, and / or have little systemic side effects or complications at a site of administration. In some embodiments, formulations for use in the methods of this invention have the ease of localized delivery and the ease of oral administration. Any of the compounds of Formula I described or referenced herein may be present in the formulation in a substantially isolated form. It will be understood that the product may be mixed with carriers or diluents that will not interfere with the intended purpose of the product and still be regarded as substantially isolated. A product of the invention may also be in a substantially purified form, in which case it will generally comprise about 75%, about 80%, about 85%, or about 90%, e.g. at least about 88%, at least about 90%, 95% or 98%, or at least about 99% of a compound or dry mass of the preparation. A pharmaceutical composition may be formulated as any pharmaceutically useful form or dosage form, e.g., including tablets, pills, capsules, gel caps, semisolids, powders, syrups, sustained release formulations, solutions, suspensions, elixirs, aerosols, inhalation formulations, liquids for injection and / or infusion, lyophilized compounds and compositions, gels, creams, microparticles, nanoparticles transdermal delivery devices (for example, a transdermal patch), subcutaneous delivery devices (for example, a subcutaneous patch), inserts and implants, in or on a medical device or implant, or any other appropriate compositions, including suppository, buccal, or sublingual formulations. Some dosage forms, such as tablets and capsules, are subdivided into suitably sized unit doses containing appropriate quantities of the active components, e.g., an effective amount to achieve the desired purpose. Compositions may take the form of any standard known dosage form. Persons of ordinary skill in the art to which the invention relates will readily appreciate the most appropriate dosage form having regard to the nature of the condition to be treated and the active agent to be used without any undue experimentation. Pharmaceutical compositions, and methods of manufacturing such compositions, suitable for administration as contemplated herein are known in the art. Examples of known techniques include, for example, U.S. Pat. Nos. 4,983,593, 5,013,557, 5,456,923, 5,576,025, 5,723,269, 5,858,411, 6,254,889, 6,303,148, 6,395,302, 6,497,903, 7,060,296, 7,078,057, 7,404,828, 8,202,912, 8,257,741, 8,263,128, 8,337,899, 8,431,159, 9,028,870, 9,060,938, 9,211,261, 9,265,731, 9,358,478, 9,387,252, and others. In some embodiments, the compounds of the present invention can be formulated as particles. In one embodiment the particles are or include microparticles. In one embodiment the particles are or include nanoparticles. Common techniques for preparing particles include solvent evaporation, solvent removal, spray drying, phase inversion, coacervation, and low temperature casting. Pharmaceutically acceptable excipients, including pH modifying agents, disintegrants, preservatives, and antioxidants, can optionally be incorporated into particles during particle formation. In one embodiment, the particles are derived through a solvent evaporation method. In this method, a compound described herein (or polymer matrix and one or more compounds described herein) is dissolved in a volatile organic solvent, such as methylene chloride. The organic solution containing a compound described herein is then suspended in an aqueous solution that contains a surface active agent such as poly(vinyl alcohol). The resulting emulsion is stirred until most of the organic solvent evaporated, leaving solid nanoparticles or microparticles. The resulting nanoparticles or microparticles are washed with water and dried overnight in a lyophilizer. Nanoparticles with different sizes and morphologies can be obtained by this method. In some embodiments of the invention, a nanoparticle or microparticle comprisespoly(lactic-co- glycolic acid) (“PLGA” ) loaded with one or more of a compound of Formula I. The compounds can be loaded into the particle volume, onto the particle exterior surface, or both. In some embodiments, the particle formulations of any of the compounds of this disclosure may also comprise liposomes. In some embodiments of the invention, compounds may also be formulated to provide controlled release to a cell, group of cells, organ, subject, or patient. In some embodiments of this invention, the formulations may be immediate, or extended or sustained release dosage forms, e.g., for release within several hours, within one day or, for example, within 1-2 days. Compositions may be formulated in accordance with standard methods and techniques known in the art. Techniques and methods include those found in such standard references as Gennaro AR: Remington: The Science and Practice of Pharmacy, 20thed., Lippincott, Williams & Wilkins, 2000, for example. Any container suitable for storing and / or administering a pharmaceutical composition may be used in a product or combination product of the invention. Suitable containers will be known and appreciated by persons skilled in the art. Containers may include vials and syringes. The containers may be suitably sterilized and hermetically sealed. In some embodiments, administering a compound (for example, tonabersat), to a subject or patient provides a therapeutically effective amount of the compound to the subject or patient or a specific organ, compartment or other target part of the subject or patient by means of administration as desired and appropriate depending on the nature of the compound, including but not limited to oral administration, enteral administration, parenteral administration, topical administration, intramuscular administration, intravenous administration, etc. Therapeutically effective amounts include but are not limited to the doses described herein. Described doses and other therapeutically effective amounts are administered in one or more of the therapeutically effective dose regimens described herein. Administration Administration of one or more of a compound of Formula I and compositions may be administered by one of the following routes: oral, topical, systemic (including intravenous, intra-arterial, intra- peritoneal, transdermal, intranasal, or by suppository), parenteral (including intramuscular, subcutaneous, or intravenous or intra-arterial injection), and the like. In some embodiments compounds and compositions are administered orally. Bioavailable systemically administered compounds may be administered, with or without concomitant local administration to a target organ, for example, by oral administration. In some embodiments compounds and compositions are administered transdermally or by inhalation. In some embodiments compounds and compositions are administered topically (e.g., to the skin or eye). In some embodiments compounds and compositions are administered by injection. Topical formulations of the compounds can comprise ointments, gels, which may be, for example, thermosetting gels, drops, sprays, liquids and powders, or a sustained or non-sustained release dosage form. In some embodiments, one of more of the compounds of Formula I is embedded in a matrix comprising a bandage or other implantable device. In some embodiments, the matrix provides for slow or sustained release of the compound. As used herein, “matrix” includes for example, matrices such as polymeric matrices, biodegradable or non-biodegradable matrices, and other carriers useful for making implants or applied structures for delivering one or more compounds. Compositions and methods for the preparation of biodegradable or non-biodegradable matrices have been developed and are known in the art. The pharmaceutical composition may be formulated as any pharmaceutically useful form, e.g., as an aerosol, a cream, a gel, a gel cap, a pill, a microparticle, a nanoparticle, an injection or infusion solution, a capsule, a tablet, a syrup, a transdermal patch, a subcutaneous patch, a dry powder, an inhalation formulation, in a medical device, suppository, buccal, or sublingual formulation, parenteral formulation, or an ophthalmic solution or suspension. Some dosage forms, such as tablets and capsules, are subdivided into suitably sized unit doses containing appropriate quantities of the active components, e.g., an effective amount to achieve the desired purpose. In some embodiments, the pharmaceutical compositions and formulations of this invention can include one or more of the compounds of Formula I in sterile water as the only vehicle. In some embodiments, the pharmaceutical compositions and formulations of this invention can exclude a compound in a vehicle used in cell or animal research that is not approved for human use. In some embodiments, the pharmaceutical compositions and formulations of this invention can include any other vehicle used or known the art. Articles of Manufacture / Kits In some embodiments of the invention, an article of manufacture, or “kit”, containing materials useful for treating or preventing a disease, defect, disorder or condition described or referenced herein is provided. In some embodiments of the invention, an article of manufacture, or “kit”, contains materials useful for treating and / or preventing cognitive decline or mild cognitive decline, cell senescence, reduced telomerase activity, reduced telomerase reverse transcriptase activity, telomere length, shortened telomeres and / or expression of platelet / endothelial cell adhesion molecule-1 (PECAM-1). In some embodiments, the kit comprises a therapeutically or prophylactically effective amount of a compound of Formula I. In some embodiments, the effective amount(s) of a compound in the kit is / are provided for the therapeutic and / or prophylactic treatment of diseases, disorders, defects and conditions relating to one or more of cognitive decline, mild cognitive decline, cell senescence, reduced telomerase activity, reduced telomerase reverse transcriptase activity, reduced telomere length, telomere shortening, and PECAM-1expression. In some embodiments, the kit includes at least one compound of Formula I. In some embodiments, the kit includes a pharmaceutical composition comprising one or more therapeutically or prophylactically effective doses of a compound of Formula I. In some embodiments, the kit comprises one or more pharmaceutical compositions, in separate vessels, or a partitioned vessel, together with packaging and instructions for use. In some embodiments, the kit may also comprise a pharmaceutically acceptable carrier. In some embodiments the kit may also include components for administering a composition, for example, a syringe, needle, microneedle, etc. In some embodiments, the kit includes one or more containers. In some embodiments, one or more containers in a kit comprise one or more compound of Formula I. Suitable containers include, e.g., bottles, vials, etc. The container may be formed from any of a variety of known useful materials, for example, glass or plastic. In some embodiments, the kit includes a label or a package insert or both, on or associated with the container, which includes instructions for dosing. The term “package insert” refers to instructions customarily included in commercial packages of pharmaceutical and research products that contain information about the indications, usage, dosage, administration, contraindications and / or warnings concerning the use of a compound, which may be provided physically or via an online link, for example, such as a QR code or the like. In some embodiments, the label or package Insert indicates that the composition is used for treating or preventing cognitive decline or mild cognitive decline. In some embodiments, the label or package insert indicates that the composition is used for treating or preventing cell senescence, aging or cell aging. In some embodiments, the label or package insert indicates that the composition is used for therapeutic and / or prophylactic treatment of a disease, disorder, defect and / or condition relating to reduced telomerase activity, reduced telomerase reverse transcriptase activity, reduced telomere length, telomere shortening, and / or PECAM-1expression. In some embodiments, the kit, label, package, and / or package insert comprises information on dosed of one or more compounds on separate days and may include packaging and / or instructions for chronologically or daily staggered administration in accordance with methods of the invention. In some embodiments, kits are manufactured for in vivo use, e.g., for delivery of compounds or compositions to a subject or patient. In some embodiments, kits are manufactured for in vitro use, e.g., for delivery of compounds or compositions to a cell or cell culture. In some embodiments, kits are manufactured for ex vivo use, e.g., for delivery of compounds or compositions to a tissue or organ. Manufacture The compounds of the invention may be purchased from available manufacturers, or manufactured using chemistries known in the art for synthesizing organic compounds (e.g. tonabersat, and other compounds of Formula I and Formula II). In some embodiments, a formulation of the invention will comprise a salt of a chemical compound. In some embodiments, the formulations of this invention are substantially pure. By substantially pure is meant that the formulations comprise less than about 10%, 5%, or 1%, and preferably less than about 0.1%, of any compound or non-compound impurity. In some embodiments the total impurities, including metabolites of a compound of the invention, will be not more than 15%. In some embodiments the total impurities, including metabolites of the compound, will be not more than 12%. In some embodiments the total impurities, including metabolites of a compound, will be not more than 11%. In other embodiments the total impurities, including metabolites of a compound, will be not more than 10%. Sterile compositions comprising a compound of the invention may be prepared using aseptic processing by dissolving a compound of Formula I in the formulation vehicle. In some embodiments, the formulation is be sterilized, or further sterilized, by filtration. Excipients used in the manufacture of formulations of the invention are widely used in pharmaceutical products and released to pharmacopeial standards. Methods for Quantifying Compound Activity In another aspect the present disclosure provides methods of evaluating, comparing, selecting, or quantifying the activity of, or determining the presence or amount of a compound of Formula I or composition or candidate compound or composition for use as described herein. In some embodiments, the method comprises the steps of (1) providing a first isolated cell or preparation of cells; (2) determining (a) telomerase expression, levels and / or activity, (b) telomere length, and / or (c) telomerase reverse transcriptase (TERT) expression, levels and / or activity in the cell or cell preparation; (3) optionally, comparing the telomerase, expression, levels and / or activity, the telomere length, and / or the telomerase reverse transcriptase (TERT) expression, levels and / or activity in the cell or cell preparation to a reference level; (4) contacting the cell or cell preparation with a test compound, and / or contacting the test compound with another preparation of like or similar cells, and (5) remeasuring telomerase, expression, levels and / or activity, telomere length, and / or telomerase reverse transcriptase (TERT) expression, levels and / or activity in the cell or preparation of cells. In some embodiments, the results following remeasuring are compared to one or more or all of (i) a positive control run using the same method, (i) a negative control run using the same method, (iii) a historic positive control, (iv) a historic negative control, (v) a reference compound, (vi) a reference compound known to alter telomerase expression, levels and / or activity (positively or negatively), (vii) a reference compound known to alter telomere length (positively or negatively), and / or (viii) a reference compound known to alter telomerase reverse transcriptase (TERT) expression, levels and / or activity (positively or negatively). In some embodiments, telomerase expression, levels and / or activity is / are measured using the method set forth in Example 9. In some embodiments, telomerase expression, levels and / or activity is / are measured using another method known in the art. In some embodiments, telomere length is measured using the method set forth in in Baek, J.H., et al., Chronological Aging Standard Curves of Telomere Length and Mitochondrial DNA Copy Number in Twelve Tissues of C57BL / 6 Male Mouse. Cells 20198(3):247. In some embodiments, telomere length is measured using another method known in the art. In some embodiments, the levels or activity of telomerase reverse transcriptase is / are measured using methods set forth in Example 5. In some embodiments, telomerase activity or levels are averaged. telomerase reverse transcriptase is / are measured using methods set forth in Example 5. In some embodiments, telomerase reverse transcriptase activity or levels are measured using another method known in the art. In some embodiments, a negative control is used (e.g., vehicle). In some embodiments, a positive control is used (e.g., tonabersat). In some embodiments, results a negative control is used (e.g., vehicle). In some embodiments, the method comprises the steps of (1) providing a first isolated cell or preparation of cells; (2) determining or evaluating cellular aging and / or cell senescence in the cell or cell preparation; (3) optionally, comparing the cellular aging and / or cell senescence in the cell or cell preparation to a reference level; (4) contacting the cell or cell preparation with a test compound, and / or contacting the test compound with another preparation of like or similar cells, and (5) remeasuring cellular aging and / or cell senescence in the cell or preparation of cells. In some embodiments, the results following remeasuring are compared to one or more or all of (i) a positive control run using the same method, (i) a negative control run using the same method, (iii) a historic positive control, (iv) a historic negative control, (v) a reference compound, and / or (vi) a reference compound known to alter cellular aging and / or cell senescence (positively or negatively). In some embodiments, the positive control is tonabersat. In some embodiments, a test composition comprising more than one test compounds is evaluated in the method. Positive test compositions are reduced into a smaller number of test compounds and run again. The method is carried out until one or more positive test compounds in the positive test composition is / are identified. In some embodiments of these methods, the isolated cell or preparation is / are retinal pigment epithelial cell(s) (e.g., ARPE-19 cell(s)). In some embodiments of these methods, the isolated cell or preparation is / are brain cell(s). In some embodiments, the “cell or preparation of cells” used in the method is a tissue. In some embodiments, the tissue is brain tissue. In some embodiments, the brain tissue is from the hippocampus. In some embodiments, the cells, cell preparation or tissue are human or of human origin. In some embodiments, methods of evaluating, comparing, selecting, or quantifying the activity of, or determining the presence or amount of a test compound or composition or candidate test compound or composition for use as described herein are carried out in vitro. In other embodiments, the methods are carried out on a chip (e.g., an “organ on a chip”). In some embodiments, the test method is automated. In some embodiments, a test compound is administered in a high dose. In some embodiments, a test compound is administered a cell isolated from a patient having a disease, disorder or condition. In some embodiments, the test compound is administered to a stem cell, e.g., an iPS cell. In some embodiments, the test compound is administered to a stem cell, e.g., an iPS, cell derived from a patient (e.g., a patient’s skin or other tissue). In some embodiments, the test compound modulates telomerase, telomere length, and / or TERT activity or levels in the stem cell, e.g., an iPS cell. In some embodiments, the test compound modulates telomerase activity and also modulates telomere size. In some embodiments, the test compound promotes accumulation of mature TERT protein. In some embodiments, the cell is an isolated human cell. In some embodiments, the cell is derived from a patient’s skin or other tissue. In some embodiments, the isolated human cell is derived from a patient’s bone marrow. In some embodiments, the cell is an isolated human cell and is derived from a patient’s blood. In some embodiments, the cell used to contact a test compound or other candidate compound or agent is an isolated human cell that is derived from a patient having a telomere disease. In some embodiments, the patient is suspected of having telomere disease. In some embodiments, the patient has symptoms of aplastic anemia. In some embodiments, the patient is diagnosed as having telomere deficiency. In some embodiments, the patient has symptoms of hepatic cirrhosis. In some embodiments, the patient has dyskeratosis congenita. In some embodiments, the cell is isolated from a patient having or suspected of having a hematological disorder. In some embodiments, the isolated cell is from a patient having or suspected of having dyskeratosis congenita. In some embodiments, the method of testing / screening can be performed in an isolated cell, e.g., human cell, obtained from a patient having or suspected of having a hematological disorder. In some embodiments, the methods disclosed herein also involve identifying other compounds that can be used to address telomere, telomerase and / or TERT deficiency, or cognitive diseases, disorder, defects or disorders, including diseases, disorder, defects or disorders relating to cognitive decline. In some embodiments, the methods disclosed herein also involve identifying other compounds that can be used to modulate telomere size. EXAMPLES The below work and Examples relate to the inventions described herein, including the use of compounds of Formula I, including for the therapeutic and / or prophylactic treatment of diseases, disorders, defects and conditions relating to one or more of cognitive decline, mild cognitive decline, cell senescence, reduced telomerase activity, reduced telomerase reverse transcriptase activity, reduced telomere length, telomere shortening, and PECAM-1expression. Generally, data are presented as mean ± standard deviation. The specific statistical tests used are included in the figure legends. Adjusted p values less than 0.05 were considered statistically significant. EXAMPLE 1 USE OF COMPOUNDS OF FORMULA I TO TREAT AND PROTECT AGAINST COGNITIVE DECLINE This Example describes the use of compounds of Formula I to treat and prevent cognitive decline, including mild cognitive decline. The middle-aged mice used in this study were protected against cognitive decline, in particular mild cognitive decline, using an exemplary compound (tonabersat). A schematic representation of the study design and timeline is shown in Figure 1(A). Animal Husbandry – Four-month-old male C57BL / 6J mice were utilized in this study. The mice were housed under SPF conditions at the Vernon Jansen Unit (VJU) Animal Facility at the University of Auckland, New Zealand. The mice were exposed to standard 12 h day and 12 h dark (at 500 lux) cycles with access to food and water ad libitum. All assessments were conducted with ethics approval from the Animal Ethics Committee at the University of Auckland and in accordance with the ARRIVE guidelines. Treatment vs. Vehicle – Tonabersat, a benzopyran compound (cis-6-acetyl-4S-(3-chloro-4-fluoro- benzoylamino)-3,4-dihydro-2,2-dimethyl-2H-benzo [b]pyrane-3 S-ol (SB-220453)), was originally clinically evaluated for the treatment of migraine. Controlled clinical trials showed that the compound is well tolerated with no significant safety concerns. Clinical evaluations included monitoring of blood pressure and heart rate. Clinical studies for the migraine indication were not successful. For the treatment group, an oral suspension for a dose of 0.8 mg / kg of tonabersat (SB‐220453; MedChemExpress, USA), was prepared by adding tonabersat powder into tap water then sonicating for 5 min until an even suspension was achieved. The vehicle group was tap water without tonabersat. Mice were randomly allocated to either the vehicle group (n = 12 mice) or the tonabersat treatment group (n = 12 mice) and were administered 100 µl of water without tonabersat or tonabersat suspension via oral gavage daily between 11 am and 2pm for two months to ensure that the systemic concentration of tonabersat was steady throughout the treatment period. For a mouse weighing 40g, a dose rate of 0.8 mg / kg requires the concentration of tonabersat in the 100 µl of water to be 0.2 mg / ml. The mice were assessed immediately following the treatment period (short-term NORT assessment) or three months later (long-term NORT assessment) (Fig.1). Novel Object Recognition Test – The novel object recognition test (NORT) was used to assess long-term spatial memory as previously described; Calvo-Flores Guzmán B et al. The Interplay Between Beta-Amyloid 1–42 (Aβ1–42)-Induced Hippocampal Inflammatory Response, p-tau, Vascular Pathology, and Their Synergistic Contributions to Neuronal Death and Behavioral Deficits. Front. Mol. Neurosci., 2020 Sec. Brain Disease Mechanisms. NORT was performed in a square arena with non-transparent plexiglass walls (25 cm × 29 cm × 25 cm). Each mouse was placed in the arena individually and given 5 min to habituate to the environment. Two identical objects were then introduced in the arena at designated locations, and the mice were given 10 min to explore the objects. After 24 h, the animals were presented with one familiar object and a novel object, and then allowed 5 min to explore the objects. Mice behaviors was monitored and analyzed using the EthoVision XT 9 (Noldus; Wageningen, Netherlands) image tracking system. The researcher was masked throughout NORT assessments and data analysis to reduce bias. NORT Data Analysis – The amount of time spent exploring the novel object is considered as an index of recognition memory. The discrimination index ratio was therefore calculated as: time spent exploring the novel object subtracted by the time spent exploring the familiar object, divided by the summation of the time the mice spent exploring both the novel and familiar object. Mice with discrimination index value above 0 were considered to have good cognitive function and mice with discrimination index value less than 0 were considered to have poor cognitive function. The proportion of mice with improved cognition was also determined by assessing the discrimination index relative to the previous timepoint. In addition to the time spent on the objects, the distance travelled, and the velocity (cm / s) was also determined. Example 1 demonstrates that compounds of Formula I are useful for the treatment of, and protection against, cognitive decline. Figure 1(B) shows there were no differences between the tonabersat- and vehicle-treated groups in terms of weights (g) during the treatment period from ages 4 to 6 months. Figures 1(C) and 1(D), respectively, show that there were also no differences between the two treatment groups in terms of distance travelled (cm), and velocity (cm / s) at 4, 6, and 9 months of age. A decrease in distance travelled and / or increase in velocity would indicate possible increased stress, pain, or anxiety in the mice. Statistical analysis was carried out with repeated-measures two-way ANOVA with Šídák's multiple comparison’s test. n = 12 mice per group. As shown in Figure 2, tonabersat successfully protected against cognitive decline. The discrimination index, derived from the novel object recognition test, was calculated as a measure of long-term memory in tonabersat- and vehicle-treated mice. Results showed that discrimination index decreased significantly at 6 and 9 months in vehicle-treated mice compared to 4 months (Figure 2A). Conversely, there was no significant change in discrimination index in the tonabersat treated mice. Relative to baseline at 4 months, tonabersat treated mice had higher discrimination index at 9 months compared to vehicle treated mice (Figure 2B). EXAMPLE 2 FREE FLOATING IMMUNOHISTOCHEMISTRY Mouse brains were extracted at the end of the study period described in Example 1 following CO2asphyxiation. The brains were then perfused with 15% formalin, cryoprotected using sucrose solutions, and stored at -80 ⁰C. Brains were sectioned from the olfactory bulb through to the spinal cord using a freezing microtome into 50 μm thick sections and stored in a serial layout at 4⁰C in a 12 well plate containing PBS with sodium azide prior to immunohistochemistry experiments. For immunohistochemistry, the ‘Mouse Brain in Stereotaxic Coordinated Second Edition Atlas’ was used to ensure accurate identification of the correct tissue plane containing the hippocampus. Coordinates, Interaural 1.34 mm, Bregma -2.46 mm, were used for the identification of the hippocampus using a light microscope. Selected sections were washed in Tris-buffered saline (TBS) (3 x 10 min) at room temperature with a gentle shake before blocking for 1 hour at room temperature with blocking solution containing 10% normal goat or donkey serum, 0.3% Triton, and 0.25% bovine serum albumin (BSA) in 0.05 M TBS. The sections were subsequently incubated for 48 h at 4⁰C with primary antibodies (Table 1) diluted in the blocking solution. The sections were then washed thrice, 10 min each time, with TBS before incubation in the corresponding secondary antibody solution made up in the blocking solution. The sections were incubated in secondary antibodies for 2 h at room temperature. Cell nuclei were counterstained using 4',6-diamidino-2-phenylindole (DAPI; 1 μg / ml; D9542, Sigma-Aldrich, USA) for 30 min. Following 3 × 10 min TBS washed, the sections being mounted to slides using an anti-fade reagent (CitifluorTM, USA). Slides were then cover slipped and sealed with nail varnish. Table 1 shows the antibodies used in the experiments described in the Examples. Table 1: Primary and secondary antibodies used in this study. Molecular Antibody Working Role Antibody Source Marker Type Dilution Sigma Aldrich, St Cx43 Target protein Primary 1:2000 Louis, MO, USA polyclonal #C6219 Telomerase Rb Abcam plc, Cambridge, TERT Primary 1:500 marker monoclonal UK #ab32020 Invitrogen, Auckland, Cleaved Inflammasome Rb Primary 1:50 New Zealand #PA5- caspase 1 marker polyclonal 38099 Inflammasome Gt NLRP3 Primary 1:200 Abcam plc, #ab4207 marker polyclonal GFAP- Astrocyte Mo Primary 1:2000 Sigma Aldrich #C9205 Cy3 marker monoclonal Microglia Rb Iba-1 Primary 1:4000 Abcam plc, #ab178846 marker monoclonal Mo CD31 Vessel marker Primary 1:200 Abcam plc, #ab24590 monoclonal Gp NeuN Neuronal stain Primary 1:1000 Abcam plc, #ab177487 monoclonal Cell nuclei DAPI - - 1:10000 Sigma Aldrich #D9542 stain Gt anti Rb Gt Alexa - Secondary 1:500 Invitrogen, #A11034 polyclonal Fluor 488 Dk anti Rb Dk Alexa - Secondary 1:500 Invitrogen, #A21206 polyclonal Fluor 488 Jackson Immuno Dk anti Gt Dk Research Laboratories - Secondary 1:500 Cy3 polyclonal Inc., Westgrove, PA, USA #705-165-147 Gt anti Mo Gt - Secondary 1:500 Jackson, #115-165-003 Cy3 polyclonal Dk anti Gp Dk - Secondary 1:500 Jackson, #706-165-148 Cy3 polyclonal EXAMPLE 3 IMAGE ANALYSIS All images described in the Examples were acquired using an Olympus FV1000 confocal laser scanning microscope (Olympus, Japan) and processed using the ImageJ software version 1.50i (National Institute of Health, USA). For each hemisphere of the brain section, two images were taken from each of the CA1, CA2, CA3, and Dentate gyrus (DG) regions of the hippocampus. The researcher was masked during immunohistochemical image acquisition and quantification to reduce any bias. For quantification of protein expression, images were converted into binary images and an equal threshold value was set using the highest intensity images to reduce the background. The percentage area covered by connexin43, GFAP, CD31, NLRP3, cleaved caspase- 1 and TERT labelling was then quantified using the ‘measure’ tool. EXAMPLE 4 EFFECT OF COMPOUNDS OF FORMULA I ON CONNEXIN 43, GFAP AND IBA-1 EXPRESSION IN THE HIPPOCAMPUS This Example describes the use of compounds of Formula I to treat and prevent inflammation. The mice from Example 1 were sacrificed and used in experiments to evaluate expression of connexin 43 and glial fibrillary acidic protein (GFAP) in the hippocampus. The hippocampus is a small part of the brain located in the medial temporal lobes, under the cerebral cortex. The hippocampus is an essential part of the brain’s limbic system, a group of brain structures in the cerebral cortex responsible for behavioral and emotional responses. Hippocampal function plays a critical role in learning, emotional responses, and memory formation and storage. The human brain contains two hippocampi, one on each side of the brain, located a few inches above each ear. Three prominent regions of the hippocampus include the dentate gyrus (DG) and cornu ammonis regions 3 (CA3) and 1 (CA1). The classical understanding of hippocampal information processing proposes that DG acts like a pattern separator, CA3 as an auto-associative storage and pattern completion site and CA1 as a novelty or mismatch detector. See Lehr, AB, et al., CA2 beyond social memory: Evidence for a fundamental role in hippocampal information processing Neuroscience and Biobehavioral Reviews 2021126:398-412. Sandwiched between CA3 and CA1 is the CA2 subregion. It has been unequivocally demonstrated that CA2 plays a critical role in social recognition memory. F.L. Hitti, S.A. Siegelbaum, The hippocampal CA2 region is essential for social memory Nature 2014508:88-92. Since then, a number of studies have corroborated that social recognition memory depends on CA2. Lehr, AB, et al. (2021). All studies used adult male mice. While hippocampal region CA2 is known for its importance in social recognition memory, other evidence supports the idea that CA2 plays a major role in a variety of situations, widely extending beyond social memory and including a fundamental role for CA2 in hippocampus-dependent memory processing. Id. It is understood that CA2 has a central role in the hierarchy of recurrently connected hippocampal subnetworks, and that CA2 sends excitatory projections to all hippocampal regions and receives input from the entorinal cortex of the hippocampus and all other hippocampal regions except CA1. Impairment of the human hippocampus can lead to many brain disorders, such as Alzheimer’s disease, amnesia, epilepsy, schizophrenia, depression, and post-traumatic stress disorder (PTSD). Inflammatory processes in the central nervous system (CNS) are believed to play an important role in the pathway leading to neuronal cell death in a number of neurodegenerative diseases including Parkinson's disease, Alzheimer's disease, prion diseases, multiple sclerosis and HIV-dementia. The inflammatory response is mediated by the activated microglia, the resident immune cells of the CNS, which normally respond to neuronal damage and remove the damaged cells by phagocytosis. Activation of microglia is a hallmark of brain pathology. The ionized calcium-binding adaptor molecule 1 (Iba-1), a cytoplasmic protein, is the most commonly used marker of microglia activation. Glial fibrillary acidic protein (GFAP) is a marker of disease severity in frontotemporal lobar degeneration. It is first expressed as astrocytes mature, and in the adult is strongly upregulated in response to CNS damage. The use of GFAP to predict the rate of cognitive decline and conversion to overt dementia, has been reported, making it useful marker for identifying individuals at risk and enabling rapid initiation of preventive and therapeutic measures. See, e.g., Abdelhak, A., et al. Blood GFAP as an emerging biomarker in brain and spinal cord disorders. Nat Rev Neurol 2022 18:158–172. Results showed that treatment of aging animals with an exemplary compound of Formula I (tonabersat) increased connexin43 expression CA2 region of the hippocampus, as shown in Figure 3. Tonabersat treatment increased connexin43 labelling within the CA2 region compared to the vehicle treatment group, with no difference in labelling observed in the CA1, 3 and DG regions between the groups. As shown in Figure 4, treatment with of mice in Example 1 with an exemplary compound (tonabersat) did not affect GFAP expression but significantly decreased the number of Iba+ cells within the CA1, 2 and dentate gyrus of the hippocampus. GFAP+ cells were observed in the hippocampus in both vehicle and tonabersat treated groups (Figure 4A). There was no statistically significant difference in the proportion of total area covered by GFAP labelling between both treatment groups (Figure 4B). Conversely, tonabersat treatment significantly decreased the total number of Iba1+ cells in the CA1, CA2 and DG regions compared to the vehicle group (Figure 4C, D). Iba1 detection is used to label microglial cells. Increased microglial activation and cell numbers has been implicated in age-related neurodegenerative diseases (see, e.g., Mosher KI, et al., Microglial dysfunction in brain aging and Alzheimer's disease. Biochemical Pharmacology 2014, 88:4, 594-604; and Spittau B. Aging Microglia—Phenotypes, Functions and Implications for Age-Related Neurodegenerative Diseases. Aging Neurosci 2017, 9:194). The decrease inmicroglial numbers is indicative of a reduction in inflammation.EXAMPLE 5 EFFECTS OF COMPOUNDS OF FORMULA I ON INFLAMMASOME PRIMING AND ACTIVATION This Example describes the use of an exemplary compoundsof Formula I (tonabersat) to decrease inflammasome activation. The NLRP3 inflammasome is a critical component of the innate immune system that mediates caspase-1 activation and the secretion of proinflammatory cytokines IL-1β / IL-18 in response to microbial infection and cellular damage. The aberrant activation of the NLRP3 inflammasome has been linked with several inflammatory disorders, which include cryopyrin-associated periodic syndromes, Alzheimer’s disease, diabetes, and atherosclerosis. The NLRP3 inflammasome is activated by diverse stimuli, and multiple molecular and cellular events, including ATP released from connexin hemichannel opening, have been shown to trigger its activation. NLRP3 and cleaved caspase-1 expression were measured as markers of inflammasome priming and activation, respectively. Results showed that NLRP3 was expressed in the hippocampus of both the tonabersat- and vehicle-treated groups of aging mice of Example 1 with no significant differences between both groups in terms of percentage of total area covered by NLRP3 labelling (Figure 5A, B). Conversely, while cleaved caspase 1 was expressed in both treatment groups, the levels of the protein were significantly reduced in the CA1, 2 and 3 regions following tonabersat treatment compared to the vehicle (Figure 5C, D). These results suggest that tonabersat treatment affected inflammasome activation but not priming. This is important because it means that the use of compounds of Formula I do not interfere with the brain’s response to acute inflammation, leaving the NLRP3 inflammasome to perform its physiological role. EXAMPLE 6 USE OF COMPOUNDS OF FORMULA I TO DECREASE CD31 EXPRESSION This Example describes the ability of compounds of Formula I to decrease markers of blain inflammation and supports their use for preventing and treating brain inflammation, including their use for preventing and treating inflammation in the hippocampus. As a label for hippocampal cerebral vascular endothelial cells, studies have shown that increased CD31 occurs in response to brain inflammation. See Mbagwu SI, Filgueira L. Differential Expression of CD31 and Von Willebrand Factor on Endothelial Cells in Different Regions of the Human Brain: Potential Implications for Cerebral Malaria Pathogenesis. Brain Sci.202010(1):31 and Yan BC, et al. Changes in the Blood-Brain Barrier Function Are Associated With Hippocampal Neuron Death in a Kainic Acid Mouse Model of Epilepsy. Front Neurol.20189:775. A recent study indicates that CD31 acts as a molecular rheostat controlling integrin-mediated adhesion at the uropod of egressed neutrophils, thereby triggering their detachment from the outer vessel wall to reach inflammatory sites. Andreata F, et al. CD31 signaling promotes the detachment at the uropod of extravasating neutrophils allowing their migration to sites of inflammation. Elife.202312:e84752. As shown in Figure 6, treatment with tonabersat decreased CD31 expression in the hippocampus of aging mice. Results showed that CD31 positive labelling was observed in all hippocampal regions studied in both Example 1 treatment groups (Figure 6). However, CD31 expression was significantly reduced following tonabersat treatment in the CA2 and CA3 hippocampal regions compared to the vehicle treated group. A reduction in CD31, as a marker of blood brain barrier dysfunction, indicates a decrease in neuroinflammation and blood brain barrier disruption. EXAMPLE 7 THE USE OF COMPOUNDS OF FORMULA I TO INCREASE TERT EXPRESSION This Example describes the use of the exemplary compound of Formula I, tonabersat, to increase expression of telomerase reverse transcriptase (TERT) in the hippocampus of aging mice. TERT, which is also a marker for the telomerase enzyme, was assessed and found to be expressed in both treatment groups described in Example 1. However, TERT levels were markedly elevated in all hippocampal regions in the tonabersat-treated group compared to vehicle treated groups (Figure 7). TERT was found within the axons in the Statum Oriens and Statum Radiatum of CA1, 2 and 3 regions of the hippocampus. EXAMPLE 8 USE OF COMPOUNDS OF FORMULA I TO PROTECT AGAINST CELL SENESCENCE This Example describes the use of an exemplary compound of Formula I (tonabersat) to protect against cell senescence. Cellular senescence was measured by determining and evaluating levels of beta galactosidase in ARPE-19 cells and brain hippocampi sections of aged mice. Beta galactosidase is an established marker of cellular senescence. Itahana K, et al. Methods to detect biomarkers of cellular senescence: the senescence-associated beta-galactosidase assay. Methods Mol Biol.2007371:21-31. Beta-galactosidase in brain hippocampi sections was measured as follows. Brain sections containing the hippocampus were washed with 1x phosphate-buffered saline (PBS) before being fixed at room temperature for 15 minutes. For staining, a solution mix comprising the staining supplement, staining solution, and X-gal dissolved in dimethyl sulfoxide was added to the cells. The cells were left to incubate with the staining solution mix overnight at 37⁰C, enclosed within a resealable Ziplock bag to mitigate any CO₂-related effects. The following day, the cells were observed under a light microscope to assess the development of any blue coloring within cells, indicative of beta galactosidase (Beta-Gal) staining. Images were obtained using a light microscope at 10x magnification. Images were then quantified using the ImageJ software. The results are presented as percentage area covered with beta- galactosidase staining. As shown in Figure 8, results showed that SA-beta-galactosidase staining was present in all hippocampal regions in the vehicle treated mice described in Example 1. Treatment with tonabersat decreased SA-beta-galactosidase expression within both the CA and DG regions of the hippocampus. As shown in Figure 12, treatment with a compound of Formula I protects against cellular senescence, and it does so in an ATP dependent manner. The results showed increase in beta galactosidase expression with HG+Cyt and that this increase was reversed by 50µM tonabersat. The presence of ATP reversed tonabersat protection in a dose dependent manner from 50nM ATP to 100 nM ATP, showing that cellular senescence was ATP dependent. ATP released into the culture media was measured using the Perkin Elmer ATPLite assay kit (#6096941) as per manufacturer’s instructions. As shown in Figure 15, increasing ATP release correlated positively with increasing Beta-Galactosidase expression in ARPE-19 cells. Figure 13 and 14 examined tonabersat’s ability to reverse HG+Cyt induced cellular senescence. In Figure 13, HG+Cyt was added to the cells on day 1. On day 2, the culture medium was changed to either basal or tonabersat (100 µM) to determine what happens if the injury is removed before addition of tonabersat. The treated cells were compared to cells in which the injury is removed and replaced with untreated basal media. The results showed that HG+Cyt mediated Beta-Galactosidase upregulation is not reversed when the media is changed to basal media after 24 h in HG+Cyt. On the contrary, tonabersat treatment after 24 h exposure to HG+Cyt reversed Beta-Galactosidase upregulation. For Figure 14, cells exposed to HG+Cyt on day 1 were either treated again with the injury or with HG+Cyt+Ton. Results showed that despite repeated HG+Cyt insults, tonabersat reduced Beta- Galactosidase expression such that there was no difference between the tonabersat treated group and the untreated cells. Beta-Galactosidase expression was measured as follows: ARPE-19 cells at passage 16 were cultured in T75 flasks and subsequently seeded in a 96-well plate at a density of 50,000 cells / mL. After allowing the cells to grow for three days to reach confluency, they were subjected to different treatments, constituting five experimental arms: basal (n=10), HG+Cyt (n=10), HG+Cyt+Ton (100 μM) (n=10), HG+Cyt+Ton (100 μM)+ATP (50 nM) (n=10), and HG+Cyt+Ton (100 μM)+ATP (100 nM) (n=10). The concentration of glucose in the high glucose (HG) group was 32.5mM while basal media contained 17.5mM of glucose. The cytokines used to stimulate the cells were a combination of interleukin-1beta and tumor necrosis factor-alpha (10ng / mL for each). Following the treatments, the cell treatment media was carefully collected and preserved for subsequent experiments. The cells were then washed with 1x phosphate-buffered saline (PBS) before being fixed at room temperature for 15 min. Subsequently, two 5-minute washes with 1x PBS were performed on the fixed cells. For staining, a solution mix comprising the staining supplement, staining solution, and X-gal dissolved in dimethyl sulfoxide was added to the cells. The cells were left to incubate with the staining solution mix overnight at 37⁰C, enclosed within a resealable Ziplock bag to mitigate any CO₂-related effects. The following day, the cells were observed under a light microscope to assess the development of any blue colouring within cells, indicative of B- Gal staining. Images were obtained using a light microscope at 10x magnification. Images were then quantified using the ImageJ software. The results are presented as percentage area covered with B-gal staining. The telomere length of the ARPE-19 cells were measured via qPCR using an adapted and validated Cawthon method, as follows: Genomic DNA was extracted from ARPE-19 cells with standard isolation procedures using the Abcam DNA isolation kit (ab156893). Two master mixes of PCR reagents were prepared, one with the T primer pair, the other with the S primer pair. 30 ul of T master mix was added to each sample well and to the standard curve well, same with the S master mix. The composition of T and S PCRs were identical except for the oligonucleotide primers. The final concentrations of reagents in the PCR were 150 nM 6-ROX and 0.2× Sybr Green I (Molecular Probes), 15 mM Tris–HCl pH 8.0, 50 mM KCl, 2 mM MgCl2, 0.2 mM each dNTP, 5 mM DTT, 1% DMSO and 1.25 U AmpliTaq Gold DNA polymerase (Applied Biosystems). The final telomere primer concentrations were: tel 1, 270 nM; tel 2, 900 nM. The final 36B4 (single copy gene) primer concentrations were: 36B4u, 300 nM; 36B4d, 500 nM. The primer sequences (written 5′→3′) were: tel 1, GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT; tel 2, TCCCGACTATCCCTATCCCTATCCCTATCCCTATCC-CTA; 36B4u, CAGCAAGTGGGAAGGTGTAATCC; 36B4d, CCCATTCTATCATCAACGGGTACAA. All PCRs were performed on the Prism 7700 Sequence Detection System (Applied Biosytems, Foster City, CA), a thermal cycler equipped to excite and read emissions from fluorescent molecules during each cycle of the PCR. The thermal cycling profile for both amplicons began with a 95°C incubation for 10 min to activate the AmpliTaq Gold DNA polymerase. For telomere PCR, there followed 18 cycles of 95°C for 15 s, 54°C for 2 min. For 36B4 PCR, there followed 30 cycles of 95°C for 15 s, 58°C for 1 min. The ratio of the telomere length to the single copy gene (36B4), also known as the T / S ratio, was determined. The T / S ratio was the calculated relative the basal group. The results show that HG + Cytokines decreased telomere length by about 30% (Figure 14C). Tonabersat treatment restored telomere lengths back to basal with no significant difference in telomere length between basal and tonabersat treated groups. The results suggest that the compound of Formula I acts on both senescence and telomere attrition whether or not the two pathogenic pathways are linked. EXAMPLE 9 USE OF COMPOUNDS OF FORMULA I TO INCREASE TELOMERASE EXPRESSION This Example describes the use of an exemplary compound of Formula I (tonabersat) to increase telomerase expression. Telomerase expression was measured using western blotting and immunohistochemistry in ARPE-19 cells. ARPE-19 cells at passage 18 were cultured in an 8 well chamber slide for immunohistochemistry to examine expression of hTERT. The media collected from the 8 well chamber slide was then used to assess the activity of IL-1β following treatments. Treatments were made up in culture medium containing Dulbecco’s Modified Eagle Medium / Nutrient Mixture F-12 (DMEM-F12) supplemented with GlutaMAX (ThermoFisher, #10565042) and anti-mycotic and anti-biotic solution (AA; 1X; ThermoFisher, #15240062). The treatment groups were culture medium only (basal group); high glucose (32.5mM) and proinflammatory cytokines interleukin 1-beta (IL-1β; 10 mg / mL; Thermofisher Scientific, #PHC0814) and tumour necrosis factor-alpha (TNF-α; 10 mg / mL; Thermofisher Scientific, #PHC3015) (HG + Cyt group); HG + Cyt + Tonabersat (100µM; MedChemExpress, USA) (HG + Cyt + Ton group); and HG + Cyt + Ton + adenosine triphosphate (ATP; 100 nM; AK scientific, #3420AH) (HG + Cyt + Ton + ATP group). Telomerase expression was measured as follows: For western blotting, cell culture media was removed from treated cells then 100 µL of Laemmli buffer and a tablet of protease and phosphatase inhibitor (#A32961, Thermo Fisher Scientific Inc., USA). The cell layers was scraped using pipette tips and transferred into centrifuge tubes. A new tip was used for each well to prevent cross- contamination. Samples were centrifuged at 10,000 g for 3 × 10 min at 4°C. Total protein was determined using a Bradford Protein Assay (Bio-Rad Laboratories, Inc., USA, #5000112) and absorbance was measured using SpectraMax i3x Multi-Mode Microplate Reader (Molecular Devices, LLC., USA). Equivalent amounts of retinal protein (7 µg per lane) were separated by SDS-polyacrylamide gel electrophoresis using 8-16% Mini-PROTEAN TGX stain-free gel (#4568106, Bio-Rad Laboratories, Inc., USA), then transferred onto a polyvinylidene difluoride (PVDF) membrane using a Trans-Blot Turbo Transfer System (#17001917, Bio-Rad Laboratories, Inc., USA To minimize non-specific binding, the membrane was blocked with 5% non-fat milk in Tris Buffered Saline with Tween20 (TBST) for 1 h at room temperature, followed by overnight incubation with rabbit anti-hTERT antibody (Abcam plc, UK #ab32020) at 4°C overnight. The next day, membranes were washed in TBST 3 times for 10 min and incubated in in goat anti-rabbit horse-radish peroxidase (DAKO, Denmark #P0448) for 2 h at room temperature and washed again in TBST. Enhanced chemiluminescent substrate was added to the membrane and incubated in the dark for 5 min (Pierce™ ECL Plus Western Blotting Substrate #32132, Thermo Fisher Scientific Inc., USA). Images were acquired using ChemiDoc MP Imaging System (#17001402 Bio-Rad Laboratories, Inc., USA). Image Lab 6.1 (Bio-Rad Laboratories, Inc., USA) was used to quantify the expression of the chemiluminescent blots, relative to the total protein present on the stain-free blot. For immunohistochemistry, cells were fixed with 4% paraformaldehyde for 10 min and permeabilized with 0.1% Triton X-100 in phosphate-buffered saline (PBS) for 10 min. Cells were blocked in 10% normal goat serum in PBS for 1 h, and then incubated overnight at 4 °C with either mouse anti-RPE65 (1:1000; Abcam, UK) and goat anti-α-SMA rabbit anti-hTERT antibody (Abcam plc, UK #ab32020). The following day, the cells were washed twice, 10 min each with PBS, after which cells were incubated at room temperature for 2 h with goat anti-rabbit Alexafluor 488 secondary antibody (Invitrogen, New Zealand, #A11034). Cells were washed in PBS twice for 10 min. Cell nuclei were labelled stained with DAPI (Sigma-Aldrich, USA, #D9542), and slides were mounted using CitifluorTM anti-fade reagent and sealed with nail varnish. Following 24 h of incubation, culture media was collected for the analysis of IL-1β activity using an immunoassay (Promega, #W6010). Briefly, the spent culture media was added to an opaque 96 well assay plate, and a series of standards using human IL-1β and culture medium was prepared, ranging from 40 ng / ml – 22 pg / ml, based on the manufacturer’s guidelines. An antibody mixture comprising of Anti-hIL-1β mAb-SmBiT and Anti-hIL-1β mAb-LgBiT was made up and added to both the standards and samples. The plate was then incubated at room temperature for 90 min allowing for optimal antigen – antibody binding. Next, the plate was subjected to 5 min incubation at room temperature with Lumit Detection Reagent B (buffer + substrate) before luminescence readings were taken using a plate reader (SpectraMax i3x, Molecular Devices). IL-1β levels were then determined based on the standard curve and recorded in pg / mL. hTERT expression (integrated density) determined via immunohistochemistry was then correlated with IL-1β levels (pg / mL). As shown in Figure 9, treatment with a compound of Formula I protected against loss of telomerase reverse transcriptase (TERT) in retinal pigment epithelial (ARPE-19) cells. Tonabersat treatment protected against high glucose and pro-inflammatory cytokine-induced (IL-1b and TNF-a) TERT downregulation in ARPE-19 cells. Figure 10 shows using immunohistochemistry that the protection conferred by tonabersat against hTERT downregulation is mediated by ATP. As shown in Figure 11, There is a negative correlation between IL-1β release and TERT expression. The with IL-1β levels measured in the culture media was correlated against the level of TERT expressed in the cultured cells, showing that higher levels of IL-1β levels was correlated with lower TERT expression. EXAMPLE 10 USE OF COMPOUNDS OF FORMULA I TO INCREASE TELOMERE LENGTH This Example describes the use of an exemplary compound of Formula I (tonabersat) to increase telomere length. Telomerase expression was measured using western blotting and immunohistochemistry in ARPE-19 cells. Animal Husbandry – Four-month-old male C57BL / 6J mice were utilized in this study. The mice were housed under SPF conditions at the Vernon Jansen Unit (VJU) Animal Facility at the University of Auckland, New Zealand. The mice were exposed to standard 12 h day and 12 h dark (at 500 lux) cycles with access to food and water ad libitum. All assessments were conducted with ethics approval from the Animal Ethics Committee at the University of Auckland and in accordance with the ARRIVE guidelines. For the treatment group, an oral suspension for a dose of 0.8 mg / kg of tonabersat (SB‐220453; MedChemExpress, USA), was prepared by adding tonabersat powder into tap water then sonicating for 5 min until an even suspension was achieved. The vehicle group was tap water without tonabersat. Mice were randomly allocated to either the vehicle group (n = 12 mice) or the tonabersat treatment group (n = 12 mice) and were administered 100 µl of water without tonabersat or tonabersat suspension via oral gavage daily between 11 am and 2pm for two months to ensure that the systemic concentration of tonabersat was steady throughout the treatment period. For a mouse weighing 40g, a dose rate of 0.8 mg / kg requires the concentration of tonabersat in the 100 µl of water to be 0.2 mg / ml. Tissue and blood were collected from the mice at 9 months of age. Telomere length was measured via qPCR using the method as described in Example 8. The ratio of the telomere length to the single copy gene (36B4), also known as the T / S ratio (Telomere / Single Copy Gene ratio), was determined. T / S ratio was the calculated relative the basal group. The Ct (Cycle threshold) value represents the number of PCR amplification cycles required for the fluorescent signal to cross a threshold level. 1. Calculate mean Ct values for TEL and SCG for each sample. 2. Calculate ΔCt = CtTEL - CtSCG for each sample. 3. Calculate T / S ratio (=2^-ΔCt) for each sample. 4. Normalize using the reference DNA sample: • ΔΔCt = ΔCtsample - ΔCtreference • Fold Change = 2^-ΔΔCt As shown in Figure 16, telomere length in brain tissue was significantly greater in the tonabersat treated group compared to the control, however there was no significant difference in telomere length in cells collected from blood. Shown in Figure 17 is the comparison of telomere length between mice treated with tonabersat for 2 weeks and the untreated naïve group, when the brain tissue was collected from the mice at 4 months of age. In this comparison, tonabersat treatment did not influence the telomere length relative to Naïve mice. These results suggest that in brain tissue, tonabersat has an effect on telomere length, only in aging mice, and is thus able to prevent cognitive decline. The mice were assessed for cognitive decline using the novel object recognition test (NORT) as described in Example 1. The relationship between the discrimination index and telomere length of normal aging mice is shown in Figure 18. The measured discrimination index is significantly higher in mice with above average telomere length as shown in Figure 19. However, when the mice are grouped by discrimination index, there was no significant difference between the two groups, as shown in Figure 20. EXAMPLE 11 DETERMINING TERT EXPRESSION IN MOUSE MODELS OF AGE-RELATED BRAIN AND RETINAL DISEASES The expression of telomerase reverse transcriptase (TERT) in the hippocampus of mice was determined for wild-type and disease model mice. TERT, which is also a marker for the telomerase enzyme, was assessed for 5xFAD mice that are used as a model for Alzheimer’s disease, and experimental autoimmune encephalitis (EAE) mice that are used as a model of Multiple Sclerosis within the brain. Tissues samples of hippocampus were prepared as described in Example 2, and image analysis was performed as described in Example 3. TERT was found within the axons in the CA1, 2, 3 and DG regions of the hippocampus in both the 5xFAD and wild-type mice (Figure 21). The same comparison was also made for EAE mice. Tissues samples of hippocampus were prepared as described in Example 2, and image analysis was performed as described in Example 3. TERT was found within the axons in the CA1, 2, 3 and DG regions of the hippocampus in both the EAE and wild-type mice (Figure 22). EXAMPLE 12 TELOMERE LENGTH QUANTIFICATION IN DISEASE MODELS A study was performed to measure the effect of various brain disease models on relative telomere length in mice. Animal Husbandry – Four-month-old male C57BL / 6J mice were utilized in this study. The mice were housed under SPF conditions at the Vernon Jansen Unit (VJU) Animal Facility at the University of Auckland, New Zealand. The mice were exposed to standard 12 h day and 12 h dark (at 500 lux) cycles with access to food and water ad libitum. All assessments were conducted with ethics approval from the Animal Ethics Committee at the University of Auckland and in accordance with the ARRIVE guidelines. One group of mice was left untreated as a control; a second group was treated with intrahippocampal injection of amyloid β-Peptide; a third group was treated with intrahippocampal injection of amyloid β-Peptide followed by treatment with tonabersat; a fourth group was treated with only tonabersat; and a fifth group was treated with ACSF (artificial cerebrospinal fluid). Telomere length from brain tissue was determined using the method as described in Example 8. A comparison of relative telomere length shows a significant difference between the group treated with intrahippocampal injection of amyloid β-Peptide and the group treated with ACSF (Figure 23). The relative telomere length was determined in brain tissue from the mice of Example 11. There was no significant difference found between wild-type mice and 5xFAD mice (Figure 24). EXAMPLE 13 TONABERSAT TREATMENT REVERSES TGF-ΒII RELEASE This Example describes the use of an exemplary compound of Formula I (tonabersat) to inhibit the release of TGF-βII from ARPE-19 cells by blocking the inflammasome pathway (Figure 25). The combined treatments of tonabersat and MCC950; and MCC950 and XG19 did not produce any additive effects. The cells were tested using the treatments shown in Table 2, and the following protocol. Table 2: Treatment volumes used in this study.

[0003] To prepare the reagents, all components are brought to room temperature (18-25 °C). The 5X Assay Diluent B is diluted with deionized or distilled water. Assay Diluent A is used for serum and plasma samples, while 1X Assay Diluent B is used for cell culture supernatants. The standard is prepared by reconstituting the Standard Protein in Assay Diluent A or B to achieve a 50 ng / mL concentration, followed by serial dilutions. The wash buffer is prepared by diluting 20 mL of the 20X Wash Buffer Concentrate with water to obtain 400 mL of 1X Wash Buffer. The detection antibody is diluted 80-fold with 1X Assay Diluent B, and the HRP-Streptavidin solution is diluted 500-fold. To activate latent TGF-βII, samples are mixed with HCl, incubated, and neutralized with NaOH / HEPES. For the assay procedure, standards and samples are added to the wells, incubated, washed, the biotinylated antibody is added, incubated, washed, the Streptavidin solution is added, incubated, washed, the TMB substrate is added, incubated, and finally the Stop Solution is added and absorbance is measured at 450 nm. EXAMPLE 14 THE THERAPEUTIC EFFECTS OF TONABERSAT, MCC950 AND XG19 WAS OBSERVED IN A HYPOXIC CELL MODEL This study found that treating ARPE-19 cells with CoCl2increased ATP release and beta- galactosidase activity but did not affect LDH (Lactate dehydrogenase) levels (Figure 26). Addition of tonabersat, XG19 and MCC950 all decreased ATP levels to baseline. Combining the connexin43 hemichannel blockers tonabersat and XG19 with MCC950 did not produce any additional reduction of ATP release. While all drugs significantly decreased beta galactosidase activity, combining either tonabersat or XG19 with MCC950 resulted in significantly less beta galactosidase compared to each drug on their own. The protocol used was to double-injure the ARPE-19 cells by firstly applying a 100 µM dose of CoCl2, and then after 24 hours applying another 100 µM dose of CoCl2. Cells treated with one or more modulators were treated at the same time as the second application of CoCl2. ATP and LDH release, and beta-galactosidase activity was measured following treatment. The dose applied of tonabersat was 100 µM, MCC950 was 10 µM, and XG19 was 25 µM. EXAMPLE 15 TONABERSAT TREATMENT REVERSES TGF-ΒII RELEASE INDUCED BY COCL2 The study performed in this Example showed that the release of TGF-βII by ARPE-19 cells induced by CoCl2was inhibited by an exemplary compound of Formula I. A study was performed in ARPE-19 cells similarly to that described in Example 14. There was no difference found in the release of TGF-βII by cells treated with CoCl2compared to basal cells (Figure 27). Tonabersat decreased TGF-βII levels to 0, both when used alone and when combined with MCC950. While MCC950 and XG19 also decreased TGF-beta levels below baseline, they were not as effective as tonabersat. There was no apparent additive effect when XG19 was combined with MCC950. EXAMPLE 16 TGF-ΒII INDUCES ATP, LDH, AND BETA-GAL RELEASE AND THIS IS PREVENTED AND REVERSED BY INFLAMMASOME BLOCKERS In this Example, TGF-βII treatment was used to induce release of ATP, LDH and beta-gal. When applied as a co-treatment, tonabersat and MCC950 significantly inhibited ATP, LDH, and beta- gal release, though there were no additive effects when both drugs are used together (Figure 28). When applied as a post-treatment, both drugs reverse ATP and Beta-gal but not LDH release. The protocols for the different measurements are as follows. Beta gal: Reagent preparation involves making a 1X PBS solution (3 mL per well) and a 20X X- gal stock solution by dissolving 20 mg X-gal in 1 mL DMSO or DMF. The X-gal solution is stored at -20°C, protected from light, for up to one month. Always use polypropylene or glass containers for X-gal, avoiding polystyrene. For sample preparation, remove the culture medium, wash cells with 1 mL 1X PBS, and fix cells or frozen tissue sections with 0.5 mL Fixative Solution for 10-15 minutes at room temperature. While cells are in the Fixative Solution, prepare the Staining Solution Mix in a polypropylene tube. For each well, mix 470 µL Staining Solution, 5 µL Staining Supplement, and 25 µL 20 mg / mL X-gal in DMF. This protocol ensures accurate staining and measurement of Beta Galactosidase activity in various samples. LDH: 11.4 mL of MQ water was added to the substrate mix and mixed gently. The assay buffer (600 µL) was combined with the substrate mix to create the reaction mixture. Samples (50 µL each) were added to a 96-well clear bottom plate, followed by 50 µL of the reaction mixture, bringing the total volume to 100 µL per well. The plate was incubated at room temperature in the dark (covered with tin foil) for 30 minutes. After incubation, 50 µL of stop solution was added to each well. Absorbance was then measured at 490 nm and 680 nm to complete the assay. ATP: 5 mL of buffer solution was added to Lyophilized Substrate Solution powders. The buffer solution was pipetted along the wall of the brown bottle to ensure all powders were dissolved, and then gently pipetted up and down to mix the powder with the buffer solution. The mixture was incubated at room temperature for 10 minutes. Under a fume hood, the bag of white plates was opened. Then, 50 µL of the ATP solution was added to a white 96-well plate, followed by 50 µL of culture media to each well containing the ATP solution. EXAMPLE 17 TONABERSAT TREATMENT PREVENTS EXPRESSION OF SENESCENCE MARKER PROTEINS P16 AND P53 In this Example, using western blotting, the expression of p16, p21, and p53 was investigated. These proteins are known as senescence associated markers. P21 was not expressed in the cells. Expression of p16 and p53 increased significantly with HG + Cyt insult, and the exemplary compound tonabersat appears to decrease levels of both p16 and p53 particularly after 72 h (Figure 29). It was found that the addition of exogenous ATP partially recovers p16 but not p53 levels back towards injury levels. WB protocol: Equivalent amounts of protein (40 µg per lane) are separated by SDS- polyacrylamide gel electrophoresis using an 8-16% Mini-PROTEAN TGX stain-free gel (#4568106, Bio-Rad Laboratories, Inc., USA), then transferred onto a polyvinylidene difluoride (PVDF) membrane using a Trans-Blot Turbo Transfer System (#17001917, Bio-Rad Laboratories, Inc., USA). Non-specific binding is blocked by incubating the membrane in 5% non-fat milk dissolved in Tris Buffered Saline with Tween20 (TBST) at room temperature for 1 hour, followed by incubation in primary antibodies at 4°C overnight. The next day, membranes are washed in TBST three times for 10 minutes each, incubated in horseradish peroxidase-conjugated secondary antibodies for 2 hours at room temperature, and washed again in TBST. Details of antibodies are listed in Table 1. Enhanced chemiluminescent substrate is added to the membrane and incubated in the dark for 5 minutes (Pierce™ ECL Plus Western Blotting Substrate #32132, Thermo Fisher Scientific Inc., USA). Images are acquired using the ChemiDoc MP Imaging System (#17001402, Bio-Rad Laboratories, Inc., USA). Image Lab 6.1 (Bio-Rad Laboratories, Inc., USA) is used to quantify the expression of the chemiluminescent blots. The total protein measurement on the stain- free gel is used as the loading control, taking into account the total protein present on the stain- free blot. It has been suggested that p53 might act by sensing dysfunctional telomeres as damaged DNA, inhibition of p53 was found to prevent senescence even in the presence of shortened telomeres suggesting other telomere-independent pathways. P53 activation usually induces cleavage of ICAM-1 to its soluble form (sICAM-1) in an NF-kB dependent manner from the cell surface. EXAMPLE 18 TONABERSAT INHIBITS P53-MEDIATED SICAM-1 RELEASE In this Example, a study using ARPE-19 cells showed that sICAM-1 levels are increased by HG+Cyt and reduced with a compound of Formula I (tonabersat) treatment (Figure 30). The addition of exogenous ATP did not reverse protection conferred by tonabersat. This is in line with the previous finding that exogenous ATP only partially reverses p53 levels. These results also support our hypothesis (and previous studies) that suggest that increased p53 in SIPS (stress-induced premature senescence) is associated with elevated ICAM-1 levels. Patents, publications, scientific articles, web sites, and other documents and materials referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the inventions pertain. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such patents, publications, scientific articles, web sites, electronically available information, and other referenced materials or documents. Reference to any applications, patents and publications in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world. The specific methods and compositions described herein are representative of preferred embodiments and are exemplary and not intended as limitations on the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art upon consideration of this specification and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention, including the use of compounds other than those described or referenced herein. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. Thus, for example, in each instance herein, in embodiments or examples of the present invention, any of the terms “comprising”, “consisting essentially of”, and “consisting of” may be replaced with either of the other two terms in the specification. Also, the terms “comprising”, “including”, containing”, etc. are to be read expansively and without limitation. It is understood that the methods and processes illustratively described herein suitably may be practiced in differing orders of steps, and that they are not necessarily restricted to the orders of steps indicated herein or in the claims. It is also understood that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. Under no circumstances may the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein. Furthermore, titles, headings, or the like are provided to enhance the reader’s comprehension of this document and should not be read as limiting the scope of the present invention. Any examples of aspects, embodiments or components of the invention referred to herein are to be considered non-limiting. The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims. The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. Other embodiments are within the following claims. In addition, where features or embodiments of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

Claims

CLAIMS WE CLAIM:

1. A method for: treating a subject for cognitive decline or a disease, disorder or condition associated with cognitive decline; treating a subject for cell senescence; treating a subject for a disease, disorder or condition associated with short telomere length or deficient TERT activity; increasing telomerase expression; increasing telomerase reverse transcriptase (TERT) activity; or for slowing cellular aging associated with telomere length; the method comprising administering to the subject an effective amount of a compound of Formula I or a prodrug thereof:(I) wherein Y is C—R1; R1is acetyl; R2is hydrogen, C3-8cycloalkyl, C1-6alkyl optionally interrupted by oxygen or substituted by hydroxy, C1-6alkoxy or substituted aminocarbonyl, C1-6alkylcarbonyl, C1-6alkoxycarbonyl, C1-6alkylcarbonyloxy, C1-6alkoxy, nitro, cyano, halo, trifluoromethyl, or CF3-S-; or a group CF3-A-, where A is —CF2—,—CO—, —CH2—, CH(OH), SO2, SO, CH2—O, or CONH; or a group CF2H-A′- where A′ is oxygen, sulphur, SO, SO2, CF2orCFH; trifluoromethoxy, C1-6alkylsulphinyl, perfluoro C2-6alkylsulphonyl, C1-6alkylsulphonyl, C1-6alkoxysulphinyl, C1-6alkoxysulphonyl, aryl, heteroaryl, arylcarbonyl, heteroarylcarbonyl, phosphono, arylcarbonyloxy, heteroarylcarbonyloxy, arylsulphinyl, heteroarylsulphinyl, arylsulphonyl, or heteroarylsulphonyl in which any aromatic moiety is optionally substituted, C1-6alkylcarbonylamino, C1-6 alkoxycarbonylamino, C1-6 alkyl-thiocarbonyl, C1-6 alkoxy-thiocarbonyl, C1-6 alkyl- thiocarbonyloxy, 1-mercapto C2-7alkyl, formyl, or aminosulphinyl, aminosulphonyl or aminocarbonyl, in which any amino moiety is optionally substituted by one or two C1-6 alkyl groups, or C1-6 alkylsulphinylamino, C1-6 alkylsulphonylamino, C1- 6 alkoxysulphinylamino or C1-6alkoxysulphonylamino, or ethylenyl terminally substituted by C1-6alkylcarbonyl, nitro or cyano, or —C(C1-6alkyl)NOH or —C(C1-6alkyl)NNH2; or amino optionally substituted by one or two C1-6alkyl or by C2-7alkanoyl; one of R3and R4is hydrogen or C1-4alkyl and the other is C1-4alkyl, CF3, or CH2Xa, where Xais fluoro, chloro, bromo, iodo, C1-4alkoxy, hydroxy, C1-4alkylcarbonyloxy, —S—C1-4alkyl, nitro, amino optionally substituted by one or two C1-4alkyl groups, cyano or C1-4alkoxycarbonyl; or R3and R4together are C2-5polymethylene optionally substituted by C1-4alkyl; R5is C1-6alkylcarbonyloxy, benzoyloxy, ONO2, benzyloxy, phenyloxy or C1-6alkoxy and R6and R9are hydrogen or R5is hydroxy and R6is hydrogen or C1-2alkyl and R9is hydrogen; R7is heteroaryl or phenyl, both of which are optionally substituted one or more times independently with a group or atom selected from chloro, fluoro, bromo, iodo, nitro, amino optionally substituted once or twice by C1-4alkyl, cyano, azido, C1-4alkoxy, trifluoromethoxy and trifluoromethyl; R8is hydrogen, C1-6alkyl, OR11or NHCOR10wherein R11is hydrogen, C1-6alkyl, formyl, C1-6alkanoyl, aroyl or aryl-C1-6alkyl and R10is hydrogen, C1-6alkyl, C1-6alkoxy, mono or di C1-6alkyl amino, amino, amino-C1-6alkyl, hydroxy-C1-6alkyl, halo-C1-6alkyl, C1-6acyloxy-C1-6alkyl, C1-6alkoxycarbonyl-C1-6alkyl, aryl or heteroaryl; the R8—N—CO— R7group being cis to the R5group; and X is oxygen or NR12where R12is hydrogen or C1-6alkyl.

2. The method of claim 1, wherein the disease, disorder or condition associated with cognitive decline is selected from the group consisting of mild cognitive decline, age-related cognitive decline, Alzheimer’s disease, dementia with Lewy bodies disease, fronto- temporal dementia, early onset dementia, Parkinson’s disease-related cognitive dysfunction, posterior cortical atrophy, primary progressive aphasia and Huntington’s disease.

3. The method of claim 1, wherein the disease, disorder or condition associated with short telomere length or reduced or deficient TERT activity is selected from the group consisting of short telomere syndrome, dyskeratosis congenital (DC), bone marrow failure syndrome characterized by the reticulated skin hyperpigmentation, nail dystrophy, oral leukoplakia, Revesz syndrome, Hoyeraal-Hreidarsson syndrome, cerebroretinal microangiopathy with calcifications and cysts (CRMCC), inherited aplastic anemia / myelodysplastic syndrome, aplastic anemia, marrow failure, hematological disorder, hepatic disease, aplastic anemia, hepatic cirrhosis, osteoporosis, osteonecrosis, vascular malformations, diabetes, primary immunodeficiency, and inflammatory bowel disease.

4. The method of claim 1 or 2, wherein the subject has or has been diagnosed with mild cognitive decline.

5. The method of claim 1 wherein the method for increasing telomerase expression is a method for increasing telomerase expression in a cell.

6. The method of claim 1 wherein the method for increasing telomerase expression is a method for increasing telomerase expression in a subject.

7. The method of claim 1 wherein the method for increasing telomerase reverse transcriptase (TERT) activity is a method for increasing telomerase reverse transcriptase (TERT) activity in a cell.

8. The method of claim 1 wherein the method for increasing telomerase reverse transcriptase (TERT) activity is a method for increasing telomerase reverse transcriptase (TERT) activity in a subject.

9. The method of claim 1 wherein the method for slowing cellular aging associated with telomere length is a method for method of slowing cellular aging associated with telomere length in a cell.

10. The method of claim 1 wherein the method for slowing cellular aging associated with telomere length is a method of slowing cellular aging associated with telomere length in a subject.

11. The method of any one of claims 1 to 10 compound according to Formula I is tonabersat.

12. The method of any one of claims 1 to 10 wherein compound according to Formula I is a tonabersat prodrug.

13. The method of any one of claims 1 to 10, wherein the prodrug is a compound according to Formula II:wherein Q is O or an oxime, R2 is H, A is a direct bond, -C(O)O*-, -C(R3)(R4)O*-, -C(O)O-C(R3)(R4)O*-, or - C(R3)(R4)OC(O)O*- wherein the atom marked * is directly connected to R1, R3 and R4 are selected independently from H, fluoro, C1-4 alkyl, and C1-4 fluoroalkyl, or R3 and R4 together with the atom to which they are attached form a cyclopropyl group, R1 is selected from groups [1], [2], [2A],[3], [4], [5] and [6] wherein the atom marked ** is directly connected to A:wherein R5and R6are each independently selected from H, C1-4alkyl, C1-4fluoroalkyl, and benzyl; R7is independently selected from H, C1-4alkyl, and C1-4fluoroalkyl;R8is selected from: (i) H, C1-4alkyl, or C1-4fluoroalkyl, (ii) the side chain of a natural or unnatural alpha-amino acid, or a peptide as described herein, and (iii) biotin or chemically linked to biotin; R9is selected from H, –N(R11)(R12), –N+(R11)(R12)(R13)X-, and –N(R11)C(O)R14; wherein R11, R12, and R13are independently selected from H, C1-4alkyl, and C1-4fluoroalkyl, R14is H, C1-4alkyl, or C1-4fluoroalkyl, R15is selected from C1-4alkyl and C1-4fluoroalkyl, and X- is a pharmaceutically acceptable anion. In some embodiments, R2is B-R21wherein, B is a direct bond, -C(O)O*-, -C(R23)(R24)O*, C(O)OC(R23)(R24)*, or -C(R23)(R24)OC(O)O* wherein the atom marked * is directly connected to R21, R23and R24are selected independently from H, fluoro, C1-4alkyl, and C1-4fluoroalkyl, R21is selected from groups [21], [22], [22A], [23], [24], [25] and [26] wherein the atom marked ** is directly connected to B:wherein R5, R6, R7, R8, R9, and R15are as defined herein.

14. A compound of Formula I or prodrug, thereof as defined in Claim 1, for use in the treatment of cognitive decline, cell senescence, cellular aging, premature aging, or a disease associated with short telomere length or reduced or deficient TERT activity.

15. A compound of Formula I or prodrug thereof, as defined in Claim 1, for the treatment of cognitive decline, cell senescence, cellular aging, premature aging, or a disease associated with short telomere length or reduced or deficient TERT activity.

16. A compound of Formula I or prodrug thereof, as defined in Claim 1, for the manufacture of a medicament for the treatment of cognitive decline, cell senescence, cellular aging, premature aging, or a disease associated with short telomere length or reduced or deficient TERT activity.

Images