Cyclic peptides that promote readthrough of premature termination codons during translation
Cyclic peptides enhance readthrough of premature termination codons, addressing nonsense mutations by promoting functional protein expression with high efficacy and low toxicity.
Patent Information
- Application Number
- PCT/EP2025/060872
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-03
- Filing Date
- 2025-04-22
- Publication Date
- 2025-10-30
AI Technical Summary
Nonsense mutations in genes lead to premature termination of translation, resulting in non-functional proteins and serious diseases, with existing readthrough compounds having limited efficacy and potential cellular toxicity.
Development of small, cyclic peptides that promote readthrough of premature termination codons by binding to the ribosome and increasing amino acid incorporation, featuring specific amino acid sequences and cyclization for enhanced stability and target affinity.
The cyclic peptides effectively stimulate readthrough of premature termination codons, restoring functional protein expression with minimal cellular toxicity, as demonstrated in yeast and human cell models.
Smart Images

Figure IMGF000064_0001 
Figure IMGF000073_0001 
Figure IMGF000074_0001
Abstract
Description
[0001] Cyclic peptides that promote readthrough of premature termination codons during translation
[0002] Technical field
[0003] The present invention relates to cyclic peptides, which promote translation readthrough of premature termination codons. The present invention further relates to cyclic peptide for use in a method for treating, preventing or managing a disease, disorder or condition associated with a lack of expression of a gene resulting from a premature termination codon.
[0004] Background
[0005] A nonsense mutation turns an amino acid-encoding codon into a premature termination codon (PTC), which is located upstream of the natural termination codon of the gene. Thus, the ribosome terminates translation prematurely upon decoding of the corresponding mRNA. Transcripts bearing PTCs are targeted for degradation by the nonsense-mediated mRNA decay (NMD) surveillance pathway. Yet, 5-30% of all PTC- containing transcripts are estimated to escape NMD (Hoek et al. 2019), and their translation results in the production of shortened and non-functional proteins.
[0006] Nonsense mutations typically lead to a very serious disease phenotype due to a complete loss of protein function (Pranke et al. 2019), and account for about 11% of all described mutations causing genetic disease in humans (Mort et al. 2008). Examples include Duchenne muscular dystrophy, cystic fibrosis, bleeding disorders, and neurodegenerative diseases.
[0007] Translation termination is induced by the presence of a termination codon in the ribosomal A site. In eukaryotic cells, the release factor eRF1 recognizes the termination codon with high fidelity and triggers termination by peptidyl-tRNA hydrolysis, a process which is further stimulated by the GTPase eRF3. Occasionally, a near-cognate tRNA binds the termination codon instead of eRF1 and inserts an amino acid in the growing polypeptide chain, thus allowing the ribosome to continue translation. This process, termed translational readthrough, occurs naturally at an estimated low rate of 0.01- 0.3%. Readthrough occurs more frequently at PTCs relative to natural termination codons, with estimated frequencies in the order of 0.01-2%. One key factor of the apparent differences in frequencies is the location of a termination codon relative to the 3’-end of the mRNA. Translation termination is less efficient when the stop codon is located far upstream in the mRNA sequence (Wu et al. 2020). As PTCs arise from randomly occurring mutations in the open reading frames of mRNAs, an increased distance of PTCs to the 3’-end relative to the NTC is expected to elevate readthrough levels.
[0008] Summary
[0009] There is therefore a need for readthrough compounds that target nonsense mutations with high efficacy and minimal cellular toxicity. The present invention relates to small, cyclic peptides having potential as therapeutics of diseases caused by nonsense mutation and stimulators of nonsense-mutation readthrough in vitro. The present inventors have found that their relatively large size, as compared to small-molecule drugs, makes them suitable for targeting large surfaces such as protein-protein or protein-DNA / RNA interactions. Cyclization also makes the peptides more resistant to degradation and results in a more rigid conformation, allowing them to bind their target with high affinity and selectivity. Specifically, herein are cyclic peptides of 6 amino acid length disclosed, wherein the first amino acid is a cysteine.
[0010] A first aspect of the invention provides a cyclic peptide having the general formula CX1X2X3X4X5, wherein the peptide is cyclized via a peptide bond formed between the N-terminal amino group of C and the C-terminal carboxyl group of X5 and wherein Xi is a canonical aromatic amino acid;
[0011] X2 is a canonical hydrophobic, a canonical polar uncharged amino acid, a canonical aromatic amino acid or arginine;
[0012] X3 is a canonical negatively charged amino acid, a canonical polar uncharged amino acid, a canonical hydrophobic amino acid, glycine or arginine;
[0013] X4 is a canonical hydrophobic, a canonical polar uncharged amino acid, a canonical positively charged amino acid, cysteine, glycine, or glutamic acid; and X5 is glycine, a canonical hydrophobic amino acid, a canonical polar uncharged amino acid, a canonical aromatic amino acid or cysteine.
[0014] A second aspect of the invention provides a cyclic peptide having the general formula CX1X2X3X4X5, wherein the peptide is cyclized via a peptide bond formed between the N-terminal amino group of C and the C-terminal carboxyl group of X5 and wherein: Xi is a canonical aromatic amino acid;
[0015] X2 is a canonical hydrophobic or a canonical polar uncharged amino acid;
[0016] X3 is a canonical negatively charged amino acid, a canonical polar uncharged amino acid, glycine, arginine, alanine, or leucine;
[0017] X4 is a canonical hydrophobic, a canonical polar uncharged amino acid, cysteine, or glutamic acid; and
[0018] X5 is glycine, a canonical hydrophobic amino acid, or a polar uncharged amino acid.
[0019] A third aspect of the invention provides a use of a cyclic peptide as disclosed herein in a method of expressing a gene product.
[0020] A fourth aspect of the invention provides a method of expressing in a cell a functional gene product encoded by a gene containing a premature termination codon, the method comprising: a. providing a cell carrying a gene with said premature termination codon; and b. transfecting and / or transducing said cell with a cyclic peptide as described herein or nucleic acid encoding same.
[0021] A fifth aspect of the invention provides a cyclic peptide as disclosed herein for use in medicine.
[0022] A sixth aspect of the of the invention provides a cyclic peptide as disclosed here for use in the treatment, prevention, or management of a disease, disorder, or condition associated with a decrease of expression of a gene resulting from a premature termination codon.
[0023] Description of Drawings
[0024] Figure 1 : Premature translation termination and translational readthrough. When a ribosome translating an mRNA encounters a premature termination codon, the eukaryotic release factor complex, eRF1-eRF3-GTP, facilitates premature translation termination by peptidyl-tRNA hydrolysis (left). The resulting truncated protein is often non-functional. Translational readthrough (right) allows continued translation to the natural termination codon. Readthrough is caused by the insertion of an amino acid at the place of the termination codon by a near-cognate tRNA.
[0025] Figure 2: (A) Schematic depicting intein-mediated processing to produce cyclized peptides intracellularly. Processing can be followed by Western blotting detecting a reduction in size of the c-myc tagged N-terminal intein (IN), due to the release of the C- terminal intein (IC) and the cyclized peptide from IN. (B) Western blotting detects the expression and processing of the intein-peptide fusion protein by means of an a-c-myc antibody. Lysates of S. cerevisiae IS110-18A cells transformed with constructs encoding the readthrough-stimulating cyclic peptides were used, together with cells expressing an empty vector (EV), not encoding an intein-peptide construct, or random cyclic peptides (RCPs) as controls.
[0026] Figure 3: Selection in S. cerevisiae results in ten cyclic peptides suppressing nonsense mutations. (A) Outline of the selection principle. A genomic reporter gene contains a premature termination codon (PTC). Upon translation, truncated and nonfunctional proteins are produced. The reporter gene is essential for cell growth on the selective medium. Expression of a cyclic peptide that promotes translational readthrough will result in the restoration of full-length, functional protein, and thereby cause cell survival on the selective medium. (B+C) S. cerevisiae IS110-18A were grown on selective medium or on control plates. The presence of galactose, but not glucose, induces cyclic peptide expression, while the omission of leucine selects for transformed cells. The additional removal of methionine allows for the selection of cells expressing cyclic peptides capable of suppressing a nonsense mutation present in the met8 (met8-1 TAG-A) gene. (B) shows representative images of hit colony identification, potentially expressing readthrough-promoting cyclic peptides, in the selection experiment. Images were taken after five days of incubation. (C) shows validation of ten readthrough-promoting cyclic peptides after isolation and retransformation of the encoding constructs into fresh S. cerevisiae cells. The resulting transformants were spotted in ten-fold serial dilutions on the selective medium along with controls. Growth enhancement through nonsense-mutation suppression was evaluated by comparison to cells expressing a random cyclic peptide (RCP) or an empty vector (EV). Images were taken after two days (left column), three days (middle column), or four days (right column) of incubation. Spot assay images are representative of five independent experiments. Figure 4: Spot assays assessing the suppression of ochre and opal stop codons. (A+B) Constructs encoding the readthrough-promoting cyclic peptides were isolated, re-transformed into fresh S. cerevisiae IS110-18A cells, and spotted in ten-fold serial dilutions on a selective medium. The presence of galactose induces cyclic peptide expression, while the omission of leucine selects for transformed cells. The additional removal of lysine (A) or tryptophan (B) allows for the selection of cells expressing cyclic peptides capable of suppressing nonsense mutations in the Iys2 (Jys2-101 TGA-C) and trp5 (trp5-48 TAA-C) genes, respectively. Growth enhancement through nonsense-mutation suppression was evaluated by comparison to cells expressing a random cyclic peptide (RCP) or an empty vector (EV). Images were taken after four days of incubation and are representative of three independent experiments.
[0027] Figure 5: CP06, CP07, CP35 and CP55 quantitatively show prominent stimulation of readthrough and no cytotoxicity in S. cerevisiae. Constructs encoding readthrough- promoting cyclic peptides were isolated and retransformed into fresh S. cerevisiae IS110-18A cells, which were then grown in liquid culture. The presence of galactoseinduces cyclic peptide expression, while the omission of leucine selects for transformed cells. The additional removal of methionine allows for the selection of cells expressing cyclic peptides capable of suppressing a nonsense mutation present in the met8 (met8-1 TAG-A) gene. Growth enhancement through nonsense mutation suppression was assessed by comparison to cells expressing a random cyclic peptide (RCP). Shown are the mean of three biological replicates. Error bars represent standard deviations. *p<0.05 using Student’s t-test individually comparing readthrough CPs to RCP control.
[0028] Figure 6: Mutational analysis of CP55 shows that most amino-acid side chains contribute to its nonsense-mutation suppression activity. (A) Constructs encoding wildtype (WT) CP55 and mutants thereof were transformed into S. cerevisiae IS110-18A and spotted in ten-fold serial dilutions on the selective medium. The presence of galactose induces cyclic peptide expression, while the omission of leucine selects for transformed cells. The additional removal of methionine allows for the selection of cells expressing cyclic peptides capable of suppressing a nonsense mutation present in the met8 (met8-1 TAG-A) gene. Growth enhancement through nonsense mutation suppression was evaluated by comparison to cells expressing a random cyclic peptide (RCP) or an empty vector (EV) not encoding an intein-peptide. Images were taken after four days of incubation and are representative of three independent experiments. (B) Western blotting detects the expression and processing of wild-type CP55 and its mutant derivatives by means of an a-c-myc antibody. Lysates of S. cerevisiae IS110- 18A cells transformed with the relevant CP55-encoding constructs were used, together with cells expressing EV or RCP as controls. IC, intein C; IN, intein N.
[0029] Figure 7: Codon-anticodon mispairing effect of CP55. Experiments were carried out at fixed concentrations of all components, except cyclic peptides (CPs), as given in the Materials and Methods section although no DTT was added to experiments. (A-C) Readthrough assays measuring the amount of formed hexapeptide relative to the amount of eukaryotic 80S ribosomal complexes. Hexapeptide formation is a quantification of readthrough since hexapeptides are formed upon amino-acid insertion at a termination codon. Experiments were performed in the presence of CP55 (A-C) or random cyclic peptide (RCP) (B) in varying concentrations as indicated, and in the presence (A) or absence (B+C) of release factor complex (RFC). (D+E) Termination assays measuring changes in fluorescence anisotropy (A Anisotropy). A decrease in fluorescence anisotropy is a result of the release of labeled peptides from the POST5 complex through peptidyl-tRNA hydrolysis. Experiments were conducted in the presence of varying concentrations of CP55 as indicated. (D) Normalized A Anisotropy as a function of time. Traces were fit using a one-phase decay model. (E) The one- phase decay fits shown in (D) were used to obtain rates of peptide release. Error bars represent standard deviations of at least two technical replicates.
[0030] Figure 8: (A) Example of a single-molecule trace of Stop-PRE6 formation in the presence of CP55, where near-cognate tRNATrp(Cy5) is bound to the termination codon in the A site as an indication of stop-codon readthrough. tRNAGln(Cy3) emission and tRNATrp(Cy5) sensitized emission, respectively excited at 532 nm, showing anti correlation as an indication of FRET, (ii) ALEX intensity signal from direct excitation of tRNATrp(Cy5) at 640 nm. (iii) FRET efficiency between tRNAGln(Cy3) and tRNATrp(Cy5) showing a FRET efficiency of ~0.5. (B) Effects of CP55 at increasing concentration on PRE6 complex formation from the Stop-POST5 complex. Figure 9: Luciferase assay in HEK293T cells a) Dual-luciferase reporter vector. The reporter construct is expressing Firefly (FLuc) and Nano Luciferase (NLuc) from a bidirectional CMV promoter. Upon transfection of HEK 293T cells with this reporter construct, normal protein synthesis was measured by the expression of full-length FLuc, and stop-codon readthrough was measured by the expression of NLuc with a premature termination codon inserted at position E51X (UGA).The cells were then incubated with 200 pM cyclic peptides (CP06 of SEQ ID NO: 1 , CP07 of SEQ ID NO: 2, CP35 of SEQ ID NO: 4, and CP55 of SEQ ID NO: 3) in the culture medium for either b) 16 or c) 40 hours. A random cyclic peptide (RPC) was included as a negative control. The histogram shows the fold increase of Nano / Firefly signal relative to a control containing only DMSO in an amount equivalent to the amount of DMSO added along with cyclic peptides, which were dissolved in DMSO. The strong readthrough inducer, G418, was used as a positive control to validate the responsiveness of the system and confirm assay sensitivity.
[0031] Figure 10: A selection in S. cerevisiae using a refined SICLOPPS library resulted in the identification of an additional 50 cyclic peptides suppressing nonsense mutations. Constructs encoding the readthrough-promoting cyclic peptides were isolated, retransformed into fresh S. cerevisiae IS110-18A cells, and spotted in ten-fold serial dilutions on a selective medium. The presence of galactose in the right-hand panels induces cyclic peptide expression, while the omission of leucine selects for transformed cells. The cytotoxicity of the selected peptides was evaluated by comparing growth on SD / -Leu plates in the presence of either glucose or galactose with the former representing optimal growth conditions, while the latter represents growth upon expression of the cyclic peptide. None of the tested cyclic peptides were found to result in significant growth repression indicating that the peptides are unlikely to be cytotoxic. The additional removal of methionine (SD / -Leu / -Met) allows for the selection of cells expressing cyclic peptides capable of suppressing a nonsense mutation present in the met8 (met8-1 TAG-A) gene. Growth enhancement through nonsense-mutation suppression was evaluated by comparison to cells expressing a random cyclic peptide (RCP) as a negative control or the previously selected CP55 (55) as a representative of a strong readthrough-inducing cyclic peptide. The majority of the 50 cyclic peptides turned out to have strong or moderate readthrough-promoting activity. Images were taken after either three (d3) or four (d4) days of incubation. The spot assays for 16 of the strong readthrough-promoting CPs were repeated five times (CP36, CP45, CP52, CP56, CP63, CP81 , CP197, CP211, CP269, CP305, CP306, CP309, CP312, CP351 , CP372, and CP374). The replicas confirmed the strong readthrough-promoting phenotype and lack of cytotoxicity.
[0032] Detailed description
[0033] Definitions
[0034] As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly states otherwise. Thus, for example, reference to “a cyclic peptide” includes a plurality of such peptides.
[0035] As used herein the term "aromatic amino acid" refers to an a-amino acid in which the side chain comprises a substituted or unsubstituted aryl or heteroaryl group. A canonical aromatic amino acid includes the aromatic amino acids phenylalanine, tyrosine and tryptophan and histidine.
[0036] As used herein the term "hydrophobic amino acid" refers to an a-amino acid with an hydrophobic side chain. A canonical hydrophobic amino acid includes the amino acids alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, tyrosine and valine.
[0037] As used herein the term "polar uncharged amino acid" refers to an a-amino acid with an polar uncharged side chain. A canonical hydrophobic amino acid includes the amino acids serine, threonine, asparagine and glutamine.
[0038] As used herein the term "negatively charged amino acid" refers to an a-amino acid with an negatively charged side chain. A canonical negatively charged amino acid includes the amino acids aspartic acid and glutamic acid.
[0039] As used herein the term "positively charged amino acid" refers to an a-amino acid with a positively charged side chain. A canonical positively charged amino acid includes the amino acids Arginine, Histidine and Lysine.
[0040] The term "canonical amino acid" is used herein as known to the expert skilled in the art and refers to one of the 20 canonical amino acids used for protein biosynthesis. The 20 canonical amino acids include histidine, alanine, valine, glycine, leucine, isoleucine, aspartic acid, glutamic acid, serine, glutamine, asparagine, threonine, arginine, proline, phenylalanine, tyrosine, tryptophan, cysteine, methionine and lysine.
[0041] By “cyclic peptide” is meant a peptide wherein the N-terminal amino group of the N- terminal amino acid is conjugated to the C-terminal carboxylic acid (carboxyl) group of the C-terminal amino acid via a peptide bond.
[0042] A “full-length protein” refers to a protein that were translated till a canonical stop codon ended the translation.
[0043] A “stop codon” (or “termination codon”) refers to a codon (nucleotide triplet within messenger RNA) that signals the termination of the translation process of the current protein. A “premature stop codon” or “premature termination codon” refers to a stop codon that leads to a truncated, incomplete, and possibly nonfunctional protein product.
[0044] A “truncated protein” refers a protein that has been shortened by a mutation that induces premature termination of messenger RNA translation.
[0045] Cyclic peptides
[0046] The present invention relates to cyclic peptides promoting translation readthrough of one or more premature termination codons. The cyclic peptides are six amino acids in length and the N-terminal amino group of the N-terminal amino acid is conjugated to the C-terminal carboxylic acid group of the C-terminal amino acid via a peptide bond. The cyclic peptides bind to a ribosome and increases the incorporation of amino acids instead of the release factor at premature termination codons.
[0047] One embodiment of the present invention provides for a cyclic peptide having the general formula CX1X2X3X4X5, wherein the peptide is cyclized via a peptide bond formed between the N-terminal amino group of C and the C-terminal carboxyl group of X5 and wherein
[0048] Xi is a canonical aromatic amino acid;
[0049] X2 is a canonical hydrophobic, a canonical polar uncharged amino acid, a canonical aromatic amino acid or arginine; Xa is a canonical negatively charged amino acid, a canonical polar uncharged amino acid, a canonical hydrophobic amino acid, glycine or arginine;
[0050] X4 is a canonical hydrophobic, a canonical polar uncharged amino acid, a canonical positively charged amino acid, cysteine, glycine, arginine or glutamic acid; and
[0051] X5 is glycine, cysteine, a canonical aromatic amino acid, a canonical hydrophobic amino acid, or a canonical polar uncharged amino acid.
[0052] One embodiment of the present invention provides for a cyclic peptide having the general formula CX1X2X3X4X5, wherein the peptide is cyclized via a peptide bond formed between the N-terminal amino group of C and the C-terminal carboxyl group of X5 and wherein
[0053] Xi is a canonical aromatic amino acid;
[0054] X2 is a canonical hydrophobic or a canonical polar uncharged amino acid;
[0055] X3 is a canonical negatively charged amino acid, a canonical polar uncharged amino acid, glycine, arginine, alanine, or leucine;
[0056] X4 is a canonical hydrophobic, a canonical polar uncharged amino acid, cysteine, or glutamic acid; and
[0057] X5 is glycine, a canonical hydrophobic amino acid, or a polar uncharged amino acid.
[0058] In one embodiment of the present invention, Xi is selected from the group consisting of F, W and Y, preferably W and Y.
[0059] In one embodiment of the present invention, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F.
[0060] In one embodiment of the present invention, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, and R.
[0061] In one embodiment of the present invention, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G. In one embodiment of the present invention, X3 is selected from the group consisting of
[0062] D, E, S, T, N, Q, G, R, A, L, V, I, M, F, Y, and W.
[0063] In one embodiments of the present invention, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V.
[0064] In one embodiments of the present invention, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, C, G, and R.
[0065] In one embodiment of the present invention, X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0066] In one embodiment of the present invention, X5 is selected from the group consisting of V, A, G, I, S, T, L, C, M, F and H.
[0067] In one embodiment of the present disclosure:
[0068] Xi is selected from the group consisting of W and Y;
[0069] X2 is selected from the group consisting of S, I and F;
[0070] X3 is selected from the group consisting of D, S and G;
[0071] X4 is selected from the group consisting of S, M and V; and
[0072] X5 is selected from the group consisting of V, A, and G.
[0073] In one embodiment of the present invention, Xi is W, X2 is S, X3 is D, X4 is S and X5 is
[0074] V. In one embodiment of the present invention, Xi is W, X2 is S, X3 is D, X4 is S and X5 is A. In one embodiment of the present invention, Xi is W, X2 is S, X3 is D, X4 is S and X5 is G.
[0075] In one embodiment of the present invention, Xi is W, X2 is S, X3 is D, X4 is M and X5 is V. In one embodiment of the present invention, Xi is W, X2 is S, X3 is D, X4 is M and X5 is A. In one embodiment of the present invention, Xi is W, X2 is S, X3 is D, X4 is M and X5 is G.
[0076] In one embodiment of the present invention, Xi is W, X2 is S, X3 is D, X4 is V and X5 is
[0077] V. In one embodiment of the present invention, Xi is W, X2 is S, X3 is D, X4 is V and X5 is A. In one embodiment of the present invention, Xi is W, X2 is S, X3 is D, X4 is V and X5 is G.
[0078] In one embodiment of the present invention, Xi is W, X2 is S, X3 is S, X4 is S and X5 is V. In one embodiment of the present invention, Xi is W, X2 is S, X3 is S, X4 is S and X5 is A. In one embodiment of the present invention, Xi is W, X2 is S, X3 is S, X4 is S and X5 is G.
[0079] In one embodiment of the present invention, Xi is W, X2 is S, X3 is S, X4 is M and X5 is V. In one embodiment of the present invention, Xi is W, X2 is S, X3 is S, X4 is M and X5 is A. In one embodiment of the present invention, Xi is W, X2 is S, X3 is S, X4 is M and X5 is G.
[0080] In one embodiment of the present invention, Xi is W, X2 is S, X3 is S, X4 is V and X5 is V. In one embodiment of the present invention, Xi is W, X2 is S, X3 is S, X4 is V and X5 is A. In one embodiment of the present invention, Xi is W, X2 is S, X3 is S, X4 is V and X5 is G.
[0081] In one embodiment of the present invention, Xi is W, X2 is S, X3 is G, X4 is S and X5 is V. In one embodiment of the present invention, Xi is W, X2 is S, X3 is G, X4 is S and X5 is A. In one embodiment of the present invention, Xi is W, X2 is S, X3 is G, X4 is S and X5 is G.
[0082] In one embodiment of the present invention, Xi is W, X2 is S, X3 is G, X4 is M and X5 is V. In one embodiment of the present invention, Xi is W, X2 is S, X3 is G, X4 is M and X5 is A. In one embodiment of the present invention, Xi is W, X2 is S, X3 is G, X4 is M and X5 is G.
[0083] In one embodiment of the present invention, Xi is W, X2 is S, X3 is G, X4 is V and X5 is V. In one embodiment of the present invention, Xi is W, X2 is S, X3 is G, X4 is V and X5 is A. In one embodiment of the present invention, Xi is W, X2 is S, X3 is G, X4 is V and X5 is G.
[0084] In one embodiment of the present invention, Xi is W, X2 is I, X3 is D, X4 is S and X5 is
[0085] V. In one embodiment of the present invention, Xi is W, X2 is I, X3 is D, X4 is S and X5 is A. In one embodiment of the present invention, Xi is W, X2 is I, X3 is D, X4 is S and X5 is G.
[0086] In one embodiment of the present invention, Xi is W, X2 is I, X3 is D, X4 is M and X5 is V. In one embodiment of the present invention, Xi is W, X2 is I, X3 is D, X4 is M and X5 is A. In one embodiment of the present invention, Xi is W, X2 is I, X3 is D, X4 is M and X5 is G.
[0087] In one embodiment of the present invention, Xi is W, X2 is I, X3 is D, X4 is V and X5 is V. In one embodiment of the present invention, Xi is W, X2 is I, X3 is D, X4 is V and X5 is A. In one embodiment of the present invention, Xi is W, X2 is I, X3 is D, X4 is V and X5 is G.
[0088] In one embodiment of the present invention, Xi is W, X2 is I, X3 is S, X4 is S and X5 is V. In one embodiment of the present invention, Xi is W, X2 is I, X3 is S, X4 is S and X5 is A. In one embodiment of the present invention, Xi is W, X2 is I, X3 is S, X4 is S and X5 is G.
[0089] In one embodiment of the present invention, Xi is W, X2 is I, X3 is S, X4 is M and X5 is V. In one embodiment of the present invention, Xi is W, X2 is I, X3 is S, X4 is M and X5 is A. In one embodiment of the present invention, Xi is W, X2 is I, X3 is S, X4 is M and X5 is G.
[0090] In one embodiment of the present invention, Xi is W, X2 is I, X3 is S, X4 is V and X5 is V. In one embodiment of the present invention, Xi is W, X2 is I, X3 is S, X4 is V and X5 is A. In one embodiment of the present invention, Xi is W, X2 is I, X3 is S, X4 is V and X5 is G.
[0091] In one embodiment of the present invention, Xi is W, X2 is I, X3 is G, X4 is S and X5 is V. In one embodiment of the present invention, Xi is W, X2 is I, X3 is G, X4 is S and X5 is A. In one embodiment of the present invention, Xi is W, X2 is I, X3 is G, X4 is S and X5 is G.
[0092] In one embodiment of the present invention, Xi is W, X2 is I, X3 is G, X4 is M and X5 is
[0093] V. In one embodiment of the present invention, Xi is W, X2 is I, X3 is G, X4 is M and X5 is A. In one embodiment of the present invention, Xi is W, X2 is I, X3 is G, X4 is M and X5 is G.
[0094] In one embodiment of the present invention, Xi is W, X2 is I, X3 is G, X4 is V and X5 is V. In one embodiment of the present invention, Xi is W, X2 is I, X3 is G, X4 is V and X5 is A. In one embodiment of the present invention, Xi is W, X2 is I, X3 is G, X4 is V and X5 is G.
[0095] In one embodiment of the present invention, Xi is W, X2 is F, X3 is D, X4 is S and X5 is V. In one embodiment of the present invention, Xi is W, X2 is F, X3 is D, X4 is S and X5 is A. In one embodiment of the present invention, Xi is W, X2 is F, X3 is D, X4 is S and X5 is G.
[0096] In one embodiment of the present invention, Xi is W, X2 is F, X3 is D, X4 is M and X5 is V. In one embodiment of the present invention, Xi is W, X2 is F, X3 is D, X4 is M and X5 is A. In one embodiment of the present invention, Xi is W, X2 is F, X3 is D, X4 is M and X5 is G.
[0097] In one embodiment of the present invention, Xi is W, X2 is F, X3 is D, X4 is V and X5 is V. In one embodiment of the present invention, Xi is W, X2 is F, X3 is D, X4 is V and X5 is A. In one embodiment of the present invention, Xi is W, X2 is F, X3 is D, X4 is V and X5 is G.
[0098] In one embodiment of the present invention, Xi is W, X2 is F, X3 is S, X4 is S and X5 is V. In one embodiment of the present invention, Xi is W, X2 is F, X3 is S, X4 is S and X5 is A. In one embodiment of the present invention, Xi is W, X2 is F, X3 is S, X4 is S and X5 is G.
[0099] In one embodiment of the present invention, Xi is W, X2 is F, X3 is S, X4 is M and X5 is V. In one embodiment of the present invention, Xi is W, X2 is F, X3 is S, X4 is M and X5 is A. In one embodiment of the present invention, Xi is W, X2 is F, X3 is S, X4 is M and X5 is G.
[0100] In one embodiment of the present invention, Xi is W, X2 is F, X3 is S, X4 is V and X5 is
[0101] V. In one embodiment of the present invention, Xi is W, X2 is F, X3 is S, X4 is V and X5 is A. In one embodiment of the present invention, Xi is W, X2 is F, X3 is S, X4 is V and X5 is G.
[0102] In one embodiment of the present invention, Xi is W, X2 is F, X3 is G, X4 is S and X5 is V. In one embodiment of the present invention, Xi is W, X2 is F, X3 is G, X4 is S and X5 is A. In one embodiment of the present invention, Xi is W, X2 is F, X3 is G, X4 is S and X5 is G.
[0103] In one embodiment of the present invention, Xi is W, X2 is F, X3 is G, X4 is M and X5 is V. In one embodiment of the present invention, Xi is W, X2 is F, X3 is G, X4 is M and X5 is A. In one embodiment of the present invention, Xi is W, X2 is F, X3 is G, X4 is M and X5 is G.
[0104] In one embodiment of the present invention, Xi is W, X2 is F, X3 is G, X4 is V and X5 is V. In one embodiment of the present invention, Xi is W, X2 is F, X3 is G, X4 is V and X5 is A. In one embodiment of the present invention, Xi is W, X2 is F, X3 is G, X4 is V and X5 is G.
[0105] In one embodiment of the present invention, Xi is Y, X2 is S, X3 is D, X4 is S and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is D, X4 is S and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is D, X4 is S and X5 is G.
[0106] In one embodiment of the present invention, Xi is Y, X2 is S, X3 is D, X4 is M and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is D, X4 is M and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is D, X4 is M and X5 is G.
[0107] In one embodiment of the present invention, Xi is Y, X2 is S, X3 is D, X4 is V and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is D, X4 is V and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is D, X4 is V and X5 is G.
[0108] In one embodiment of the present invention, Xi is Y, X2 is S, X3 is S, X4 is S and X5 is
[0109] V. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is S, X4 is S and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is S, X4 is S and X5 is G.
[0110] In one embodiment of the present invention, Xi is Y, X2 is S, X3 is S, X4 is M and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is S, X4 is M and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is S, X4 is M and X5 is G.
[0111] In one embodiment of the present invention, Xi is Y, X2 is S, X3 is S, X4 is V and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is S, X4 is V and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is S, X4 is V and X5 is G.
[0112] In one embodiment of the present invention, Xi is Y, X2 is S, X3 is G, X4 is S and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is G, X4 is S and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is G, X4 is S and X5 is G.
[0113] In one embodiment of the present invention, Xi is Y, X2 is S, X3 is G, X4 is M and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is G, X4 is M and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is G, X4 is M and X5 is G.
[0114] In one embodiment of the present invention, Xi is Y, X2 is S, X3 is G, X4 is V and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is G, X4 is V and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is S, X3 is G, X4 is V and X5 is G.
[0115] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is D, X4 is S and X5 is V.
[0116] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is D, X4 is S and X5 is A.
[0117] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is D, X4 is S and X5 is G.
[0118] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is D, X4 is M and X5 is V.
[0119] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is D, X4 is M and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is I, X3 is D, X4 is M and X5 is G.
[0120] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is D, X4 is V and X5 is V.
[0121] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is D, X4 is V and X5 is A.
[0122] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is D, X4 is V and X5 is G.
[0123] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is S, X4 is S and X5 is V.
[0124] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is S, X4 is S and X5 is A.
[0125] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is S, X4 is S and X5 is G.
[0126] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is S, X4 is M and X5 is V.
[0127] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is S, X4 is M and X5 is A.
[0128] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is S, X4 is M and X5 is
[0129] G.
[0130] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is S, X4 is V and X5 is V.
[0131] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is S, X4 is V and X5 is A.
[0132] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is S, X4 is V and X5 is G.
[0133] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is G, X4 is S and X5 is V.
[0134] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is G, X4 is S and X5 is A.
[0135] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is G, X4 is S and X5 is G.
[0136] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is G, X4 is M and X5 is
[0137] V. In one embodiment of the present invention, Xi is Y, X2 is I, X3 is G, X4 is M and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is I, X3 is G, X4 is M and X5 is G.
[0138] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is G, X4 is V and X5 is V.
[0139] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is G, X4 is V and X5 is A.
[0140] In one embodiment of the present invention, Xi is Y, X2 is I, X3 is G, X4 is V and X5 is G.
[0141] In one embodiment of the present invention, Xi is Y, X2 is F, X3 is D, X4 is S and X5 is
[0142] V. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is D, X4 is S and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is D, X4 is S and X5 is G.
[0143] In one embodiment of the present invention, Xi is Y, X2 is F, X3 is D, X4 is M and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is D, X4 is M and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is D, X4 is M and X5 is G.
[0144] In one embodiment of the present invention, Xi is Y, X2 is F, X3 is D, X4 is V and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is D, X4 is V and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is D, X4 is V and X5 is G.
[0145] In one embodiment of the present invention, Xi is Y, X2 is F, X3 is S, X4 is S and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is S, X4 is S and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is S, X4 is S and X5 is G.
[0146] In one embodiment of the present invention, Xi is Y, X2 is F, X3 is S, X4 is M and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is S, X4 is M and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is S, X4 is M and X5 is G.
[0147] In one embodiment of the present invention, Xi is Y, X2 is F, X3 is S, X4 is V and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is S, X4 is V and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is S, X4 is V and X5 is G.
[0148] In one embodiment of the present invention, Xi is Y, X2 is F, X3 is G, X4 is S and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is G, X4 is S and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is G, X4 is S and X5 is G.
[0149] In one embodiment of the present invention, Xi is Y, X2 is F, X3 is G, X4 is M and X5 is
[0150] V. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is G, X4 is M and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is G, X4 is M and X5 is G.
[0151] In one embodiment of the present invention, Xi is Y, X2 is F, X3 is G, X4 is V and X5 is V. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is G, X4 is V and X5 is A. In one embodiment of the present invention, Xi is Y, X2 is F, X3 is G, X4 is V and X5 is G.
[0152] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is D, X4 is S and X5 is V.
[0153] In one embodiment, Xi is Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is S, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is S and X5 is V.
[0154] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is S, X3 is D, X4 is selected from the group consisting of A, I, L, M, F, W, Y,
[0155] V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0156] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is S, X3 is D, X4 is S and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0157] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F,
[0158] W, Y, V, S, T, N and Q, preferably S, I and F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is S and X5 is V.
[0159] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is D, X4 is S and X5 is V.
[0160] In one embodiment, Xi is W, X2 is S, X3 is D, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5is V.
[0161] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is D, X4 is S and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0162] In one embodiment, Xi is W, X2 is S, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V. In one embodiment, Xi is W, X2 is S, X3 is selected from the group consisting of D, E,
[0163] S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is S and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0164] In one embodiment, Xi is W, X2 is S, X3 is D, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0165] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is G, X4 is M and X5 is A.
[0166] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is I, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is M and X5 is A.
[0167] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is I, X3 is G, X4 is selected from the group consisting of A, I, L, M, F, W, Y,
[0168] V, S, T, N, Q, E, and C, preferably S, M and V and X5 is A.
[0169] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is I, X3 is G, X4 is M and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0170] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F,
[0171] W, Y, V, S, T, N and Q, preferably S, I and F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is M and X5 is A.
[0172] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is A.
[0173] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is G, X4 is M and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0174] In one embodiment, Xi is W, X2 is I, X3 is selected from the group consisting of D, E, S,
[0175] T, N, Q, G, R, A, and L, preferably D, S and G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is A.
[0176] In one embodiment, Xi is W, X2 is I, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is M and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G. In one embodiment, Xi is W, X2 is I, X3 is G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0177] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is Q, X4 is E and X5 is V.
[0178] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is E and X5 is V.
[0179] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is Q, X4 is selected from the group consisting of A, I, L, M, F, W, Y,
[0180] V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0181] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is Q, X4 is E and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0182] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F,
[0183] W, Y, V, S, T, N and Q, preferably S, I and F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is E and X5 is V.
[0184] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is Q, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0185] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is Q, X4 is E and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0186] In one embodiment, Xi is W, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0187] In one embodiment, Xi is W, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is E and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G. In one embodiment, Xi is W, X2 is F, X3 is Q, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0188] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is R, X4 is S and X5 is V.
[0189] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is Y, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is S and X5 is V.
[0190] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is Y, X3 is R, X4 is selected from the group consisting of A, I, L, M, F, W, Y,
[0191] V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0192] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is Y, X3 is R, X4 is S and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0193] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F,
[0194] W, Y, V, S, T, N and Q, preferably S, I and F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is S and X5 is V.
[0195] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is R, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0196] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is R, X4 is S and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0197] In one embodiment, Xi is W, X2 is Y, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0198] In one embodiment, Xi is W, X2 is Y, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is S and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G. In one embodiment, Xi is W, X2 is Y, X3 is R, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0199] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is G, X4 is T and X5 is I.
[0200] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is L, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is T and X5 is I.
[0201] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is L, X3 is G, X4 is selected from the group consisting of A, I, L, M, F, W, Y,
[0202] V, S, T, N, Q, E, and C, preferably S, M and V and X5 is I.
[0203] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is L, X3 is G, X4 is T and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0204] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F,
[0205] W, Y, V, S, T, N and Q, preferably S, I and F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is T and X5 is I.
[0206] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is I.
[0207] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is G, X4 is T and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0208] In one embodiment, Xi is W, X2 is L, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is I.
[0209] In one embodiment, Xi is W, X2 is L, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is T and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G. In one embodiment, Xi is W, X2 is L, X3 is G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0210] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is G, X4 is S and X5 is S.
[0211] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is V, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is S and X5 is S.
[0212] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is V, X3 is G, X4 is selected from the group consisting of A, I, L, M, F, W, Y,
[0213] V, S, T, N, Q, E, and C, preferably S, M and V and X5 is S.
[0214] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is V, X3 is G, X4 is S and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0215] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F,
[0216] W, Y, V, S, T, N and Q, preferably S, I and F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is S and X5 is S.
[0217] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is S.
[0218] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is G, X4 is S and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0219] In one embodiment, Xi is W, X2 is V, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is S.
[0220] In one embodiment, Xi is W, X2 is V, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is S and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G. In one embodiment, Xi is W, X2 is V, X3 is G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0221] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is S, X4 is V and X5 is G.
[0222] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is V and X5 is G.
[0223] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is S, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is G.
[0224] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is S, X4 is V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0225] In one embodiment, Xi is Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is V and X5 is G.
[0226] In one embodiment, Xi is Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is S, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is G.
[0227] In one embodiment, Xi is Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is S, X4 is V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0228] In one embodiment, Xi is Y, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5is G.
[0229] In one embodiment, Xi is Y, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0230] In one embodiment, Xi is Y, X2 is F, X3 is S, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G. In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is A, X4 is T and X5 is V.
[0231] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is T and X5 is V.
[0232] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is A, X4 is selected from the group consisting of A, I, L, M, F, W, Y,
[0233] V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0234] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is A, X4 is T and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0235] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F,
[0236] W, Y, V, S, T, N and Q, preferably S, I and F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is T and X5 is V.
[0237] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is A, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0238] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is A, X4 is T and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0239] In one embodiment, Xi is W, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is V.
[0240] In one embodiment, Xi is W, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is T and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0241] In one embodiment, Xi is W, X2 is F, X3 is A, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G. In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is L, X4 is C and X5 is T.
[0242] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is C and X5 is T.
[0243] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is L, X4 is selected from the group consisting of A, I, L, M, F, W, Y,
[0244] V, S, T, N, Q, E, and C, preferably S, M and V and X5 is T.
[0245] In one embodiment, Xi is selected from the group consisting of F, W and Y, preferably W and Y, X2 is F, X3 is L, X4 is C and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0246] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F,
[0247] W, Y, V, S, T, N and Q, preferably S, I and F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is C and X5 is T.
[0248] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is L, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is T.
[0249] In one embodiment, Xi is W, X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F, X3 is L, X4 is C and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0250] In one embodiment, Xi is W, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is T.
[0251] In one embodiment, Xi is W, X2 is F, X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G, X4 is C and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0252] In one embodiment, Xi is W, X2 is F, X3 is L, X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V and X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
[0253] In one embodiment of the present invention, the cyclic peptide is selected from the group consisting of: CWSDSV (SEQ ID NO: 1), CWIGMA (SEQ ID NO: 2), CYFSVG (SEQ ID NO: 3), CWFQEV (SEQ ID NO: 5), CWYRSV (SEQ ID NO: 6), CWLGTI (SEQ ID NO: 7), CWVGSS (SEQ ID NO: 8), CWFATV (SEQ ID NO: 9) and CWFLCT (SEQ ID NO: 10).
[0254] In one embodiment of the present invention, the cyclic peptide has the general formula CX1X2X3X4X5, wherein the cyclic peptide is selected from the group consisting of: CWSDSV (SEQ ID NO: 1), CWIGMA (SEQ ID NO: 2), CYFSVG (SEQ ID NO: 3),
[0255] CWFQEV (SEQ ID NO: 5), CWYRSV (SEQ ID NO: 6), CWLGTI (SEQ ID NO: 7),
[0256] CWVGSS (SEQ ID NO: 8), CWFATV (SEQ ID NO: 9), CWFLCT (SEQ ID NO: 10) and a sequence differing from any one of SEQ ID NOs: 1-3 and 5-10 in one, two, three, or four positions, such as in one, two, three, or four of the second, third, fourth, fifth, and sixth residues.
[0257] In one embodiment of the present invention, the cyclic peptide has the general formula CX1X2X3X4X5, wherein the cyclic peptide is selected from the group consisting of: CWSDSV (SEQ ID NO: 1), CWIGMA (SEQ ID NO: 2), CYFSVG (SEQ ID NO: 3),
[0258] CWFQEV (SEQ ID NO: 5), CWYRSV (SEQ ID NO: 6), CWLGTI (SEQ ID NO: 7),
[0259] CWVGSS (SEQ ID NO: 8), CWFATV (SEQ ID NO: 9), CWFLCT (SEQ ID NO: 10), and a sequence differing from any one of SEQ ID NOs: 1-3 and 5-10 in one, two, three, or four of the positions Xi, X2, X3, X4, and X5 such that:
[0260] Xi is selected from the group consisting of F, W and Y;
[0261] X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q;
[0262] X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L;
[0263] X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C; and
[0264] X5 is selected from the group consisting of V, A, G, I, S, and T.
[0265] In one embodiment of the present invention, the cyclic peptide has the general formula CX1X2X3X4X5, wherein the cyclic peptide is selected from the group consisting of: CWSDSV (SEQ ID NO: 1), CWIGMA (SEQ ID NO: 2), CYFSVG (SEQ ID NO: 3),
[0266] CWFQEV (SEQ ID NO: 5), CWYRSV (SEQ ID NO: 6), CWLGTI (SEQ ID NO: 7),
[0267] CWVGSS (SEQ ID NO: 8), CWFATV (SEQ ID NO: 9) CWFLCT (SEQ ID NO: 10), and a sequence differing from any one of SEQ ID NOs: 1-3 and 5-10 in one, two, three, or four of the positions Xi, X2, X3, X4, and X5 such that:
[0268] Xi is selected from the group consisting of W and Y; X2 is selected from the group consisting of S, I and F;
[0269] X3 is selected from the group consisting of D, S and G;
[0270] X4 is selected from the group consisting of S, M and V; and
[0271] X5 is selected from the group consisting of V, A, and G.
[0272] In one embodiment, Xi is Y, X2 is F, W or Y, X3 is S, T or A, X4 is V; and X5 is G or S.
[0273] In one embodiment, the cyclic peptide is selected from the group consisting of: CYYSVG (SEQ ID NO: 31), CYFSVG (SEQ ID NO: 3), CYWTVG (SEQ ID NO: 32), CYWAVS (SEQ ID NO: 33) and CYYAVS (SEQ ID NO: 34).
[0274] In one embodiment, Xi is W, X2 is F, W, Y or R, X3 is D or E, X4 is F, C, A, V, I or W, and X5 is V. In one embodiment, the cyclic peptide is selected from the group consisting of: CWWDFV (SEQ ID NO: 35), CWWECV (SEQ ID NO: 36), CWWDAV (SEQ ID NO: 37), CWWDVV (SEQ ID NO: 38), CWYDIV (SEQ ID NO: 39), CWYDVV (SEQ ID NO: 40), CWFDWV (SEQ ID NO: 41) and CWRDFV (SEQ ID NO: 42).
[0275] In one embodiment, Xi is W, X2 is A, L, S or V, X3 is D or E, X4 is S, T or M, and X5 is V, L, I or C. In one embodiment, the cyclic peptide is selected from the group consisting of: CWADTV (SEQ ID NO: 43), CWLDSI (SEQ ID NO: 44), CWADSL (SEQ ID NO: 45), CWLESL (SEQ ID NO: 46), CWVDMC (SEQ ID NO: 47) and CWSDSV (SEQ ID NO: 1).
[0276] In one embodiment, Xi is W, X2 is W, X3 is G or M, X4 is T, G or V and X5 is V, L or M.
[0277] In one embodiment, the cyclic peptide is selected from the group consisting of: CWWGTL (SEQ ID NO: 48), CWWMTV (SEQ ID NO: 49), CWWGGV (SEQ ID NO: 50) and CWWGVM (SEQ ID NO: 51).
[0278] In one embodiment, Xi is W, X2 is V, M or L, X3 is G, T, I, V or L, X4 is T, S or F and X5 is S, T, M, I or A. In one embodiment, the cyclic peptide is selected from the group consisting of: CWVGST (SEQ ID NO: 52), CWVGSS (SEQ ID NO: 8), CWMGTT (SEQ ID NO: 53), CWVGTM (SEQ ID NO: 54), CWVGFT (SEQ ID NO: 55), CWLGTI (SEQ ID NO: 7), CWVTST (SEQ ID NO: 56), CWVISA (SEQ ID NO: 57), CWVVTA (SEQ ID NO: 58) and CWVLSS (SEQ ID NO: 59). In one embodiment, Xi is W, X2 is I or A, X3 is G, X4 is G, M, C or V, and X5 is T, A or V. In one embodiment, the cyclic peptide is selected from the group consisting of: CWIGGT (SEQ ID NO: 60), CWIGMA (SEQ ID NO: 2), CWIGCA (SEQ ID NO: 61) and CWAGVV (SEQ ID NO: 62).
[0279] In one embodiment, Xi is W or Y, X2 is W, F, Y, R or M, X3 is R, X4 is S, T, L or R and X5 is V or F. In one embodiment, the cyclic peptide is selected from the group consisting of: CWWRTV (SEQ ID NO: 63), CWFRSV (SEQ ID NO: 64), CYRRLF (SEQ ID NO: 65) and CWMRRV (SEQ ID NO: 66).
[0280] In one embodiment, Xi is W, X2 is W or F, X3 is A, X4 is T and X5 is V. In one embodiment, the cyclic peptide is selected from the group consisting of: CWWATV (SEQ ID NO: 67), and CWFATV (SEQ ID NO: 9).
[0281] In one embodiment, Xi is W, X2 is W, F, Y, L or A, X3 is D, E, S, T or G, X4 is N, E, S, T or Q and X5 is V or L. In one embodiment, the cyclic peptide is selected from the group consisting of: CWWNTL (SEQ ID NO: 68), CWYNTL (SEQ ID NO: 69), CWLSNL (SEQ ID NO: 70), CWAGNL (SEQ ID NO: 71), CWYTQV (SEQ ID NO; 72) and CWFQEV (SEQ ID NO 5).
[0282] In one embodiment, Xi is W, X2 is A, V, R or I, X3 is F or W, X4 is S and X5 is A or L. In one embodiment, the cyclic peptide is selected from the group consisting of: CWAFSL (SEQ ID NO: 73), CWVFSA (SEQ ID NO: 74), CWRFSL (SEQ ID NO: 75), and CWIWSL (SEQ ID NO: 76)
[0283] In one embodiment, Xi is W, X2 is T, X3 is Y or T, X4 is S and X5 is V or L. In one embodiment, the cyclic peptide is selected from the group consisting of: and CWTYSL (SEQ ID NO: 77) and CWTTSV (SEQ ID NO: 78).
[0284] In one embodiment, Xi is W, X2 is V, X3 is V, X4 is W and X5 is H. In one embodiment, the cyclic peptide is and CWVVWH (SEQ ID NO: 79).
[0285] In one embodiment, Xi is W, X2 is F, X3 is Y or L, X4 is S or C and X5 is S or T. In one embodiment, the cyclic peptide is selected from the group consisting of: CWFYSS (SEQ ID NO: 80) and CWFLCT (SEQ ID NO: 10). C denotes a cysteine residue at the N-terminus of the peptide sequence, and it plays a dual role in both structural formation and functional performance. It is essential for cyclization, as the N-terminal amino group of cysteine forms the peptide bond with the C-terminal carboxyl group of X5, closing the macrocyclic ring. In addition to enabling cyclization, the presence of cysteine appears to be critical for biological activity. Substitution of cysteine with a serine still supports cyclization, but was observed to impair or abolish the readthrough-promoting function, suggesting that the thiol group may be directly involved in molecular recognition or stabilization of the active conformation.
[0286] Xi may be selected from canonical aromatic amino acids such as phenylalanine (F), tyrosine (Y), or tryptophan (W). The presence of an aromatic residue at this position may be structurally significant, as it can engage in TT-TT stacking, hydrophobic interactions, or intramolecular hydrogen bonding that may stabilize the conformation of the ring. Substitution of Xi with non-aromatic or aliphatic residues appear to disrupt these stabilizing interactions and lead to reduced structural integrity or altered bioactivity.
[0287] X2may be a hydrophobic residue (e.g., leucine, isoleucine, valine, tyrosine, tryptophan, phenylalanine), an aromatic amino acid (e.g., tyrosine, tryptophan, phenylalanine), a polar uncharged amino acid (e.g., serine, threonine), or arginine. This position can accommodate residues with relatively large side chains that contribute to the hydrophobic core. While there is some tolerance in the chemical nature of this position, its bulkiness appears to be important for proper orientation of adjacent residues.
[0288] X3may be selected from a broad range of canonical amino acids, including negatively charged (e.g., aspartate, glutamate), polar uncharged (e.g., serine, asparagine), hydrophobic (e.g., alanine, valine, phenylalanine, tyrosine), glycine, or arginine. The high degree of variability at this position suggests a role in fine-tuning conformational dynamics rather than core structure. Glycine at this position appear to enhance local flexibility, while charged residues appear to mediate electrostatic interactions.
[0289] X4may be selected from canonical hydrophobic or polar uncharged residues, a positively charged amino acid, such as arginine, cysteine, glycine, or glutamic acid. This position exhibits the highest tolerance for amino acid variation, indicating that its contribution to the structural core of the ring is minimal. Instead, X4 serves as a flexible adapter residue that facilitates cyclization or allows for functional tuning without significantly affecting the stability of the cyclic scaffold.
[0290] X5may be glycine, a hydrophobic amino acid, a polar uncharged amino acid, an aromatic amino acid or cysteine. The residue at this position forms the C-terminal end of the linear precursor, which cyclizes with the N-terminal cysteine to form the macrocycle. The side chain of X5may affect the efficiency of cyclization and the resulting conformation of the macrocycle. Smaller residues such as glycine may reduce steric hindrance and promote efficient ring closure, while polar residues may modulate solubility and hydrogen bonding potential.
[0291] In one specific embodiment, the cyclic peptide differs at position Xi as indicated herein.
[0292] In one specific embodiment, the cyclic peptide differs at position X2as indicated herein.
[0293] In one specific embodiment, the cyclic peptide differs at position X3as indicated herein.
[0294] In one specific embodiment, the cyclic peptide differs at position X4as indicated herein.
[0295] In one specific embodiment, the cyclic peptide differs at position Xsas indicated herein.
[0296] In one specific embodiment, the cyclic peptide differs at positions Xi and X2 as indicated herein.
[0297] In one specific embodiment, the cyclic peptide differs at positions Xi and X3 as indicated herein.
[0298] In one specific embodiment, the cyclic peptide differs at positions Xi and X4 as indicated herein.
[0299] In one specific embodiment, the cyclic peptide differs at positions Xi and X5 as indicated herein.
[0300] In one specific embodiment, the cyclic peptide differs at positions X2 and X3 as indicated herein.
[0301] In one specific embodiment, the cyclic peptide differs at positions X2 and X4 as indicated herein.
[0302] In one specific embodiment, the cyclic peptide differs at positions X2 and X5 as indicated herein.
[0303] In one specific embodiment, the cyclic peptide differs at positions X3 and X4 as indicated herein. In one specific embodiment, the cyclic peptide differs at positions X3 and X5 as indicated herein.
[0304] In one specific embodiment, the cyclic peptide differs at positions X4 and X5 as indicated herein.
[0305] In one specific embodiment, the cyclic peptide differs at positions Xi, X2 and X3 as indicated herein.
[0306] In one specific embodiment, the cyclic peptide differs at positions Xi, X2 and X4 as indicated herein.
[0307] In one specific embodiment, the cyclic peptide differs at positions Xi, X2 and X5 as indicated herein.
[0308] In one specific embodiment, the cyclic peptide differs at positions Xi, X3 and X4 as indicated herein.
[0309] In one specific embodiment, the cyclic peptide differs at positions Xi, X3 and X5 as indicated herein.
[0310] In one specific embodiment, the cyclic peptide differs at positions Xi, X4 and X5 as indicated herein.
[0311] In one specific embodiment, the cyclic peptide differs at positions X2, X3 and X4 as indicated herein.
[0312] In one specific embodiment, the cyclic peptide differs at positions X2, X3 and X5 as indicated herein.
[0313] In one specific embodiment, the cyclic peptide differs at positions X2, X4 and X5 as indicated herein.
[0314] In one specific embodiment, the cyclic peptide differs at positions X3, X4 and X5 as indicated herein.
[0315] In one specific embodiment, the cyclic peptide differs at positions Xi, X21X3and X4 as indicated herein.
[0316] In one specific embodiment, the cyclic peptide differs at positions Xi, X21X3and X5 as indicated herein.
[0317] In one specific embodiment, the cyclic peptide differs at positions Xi, X2.X4 and X5 as indicated herein.
[0318] In one specific embodiment, the cyclic peptide differs at positions Xi, X31X4and X5 as indicated herein.
[0319] In one specific embodiment, the cyclic peptide differs at positions X2, X31X4and X5 as indicated herein. In one embodiment of the present invention, wherein the cyclic peptide is cell permeable. As used herein, "cell-permeable peptide" refers to a peptide capable of passing a cell membrane to invade inside the cell.
[0320] In one embodiment of the present invention, the cyclic peptide is not cytotoxic. As used herein the term "cytotoxic" means toxic to cells or a selected cell population. The toxic effect may result in cell death and / or lysis. In certain instances, the toxic effect may be a sub lethal destructive effect on the cell, e.g., slowing or arresting cell growth.
[0321] In one embodiment of the present invention, the cyclic peptide does not substantially alter the growth rate of the cell. As intended herein, the term "growth" relates to the multiplication of cells.
[0322] In one embodiment of the present invention, the cyclic peptide increases the growth rate of the cell, such as that the cell multiplies 10% faster, such as 20% faster, such as 30% faster compared to a control where the cyclic peptide is not present.
[0323] In one embodiment of the present invention, the cyclic peptide does not induce apoptosis of the cell.
[0324] Mechanism of promoting translation readthrough
[0325] This invention regards cyclic peptides that promote translation readthrough of premature termination codons. The mechanism of action may be based on A-site binding of the cyclic peptide leading to codon misreading. Several amino acids can be incorporated into the protein to continue translation.
[0326] In one embodiment of the present invention, the cyclic peptide promotes translation readthrough of one or more premature termination codons.
[0327] In one embodiment of the present invention, the cyclic peptide is capable of promoting incorporation of a canonical amino acid at a premature termination codon, whereby the cyclic peptide reduces the production of a truncated protein in a cell at least 0.1%, such as at least 0.5%, such as at least 1%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 50%. In one embodiment of the present invention, the cyclic peptide is capable of promoting incorporation of a canonical amino acid at a premature termination codon, whereby the cyclic peptide increases the ratio of full-length protein to truncated protein at least 0.1 %, such as at least 0.5%, such as at least 1%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 50%.
[0328] In one embodiment of the present invention, the translation readthrough of the premature termination codon is at least 0.1%, such as at least 0.5%, such as at least 1%, such as at least 10% increased, such as at least 25% increased, such as at least 50% increased, such as at least 100% increased, such as at least 500% increased, such as at least 1000% increased compared to cells not transfected with the cyclic peptide.
[0329] The person skilled in the art will appreciate that several methods can be used to determine the presence of truncated and full-length protein in a cell. In one embodiment of the present invention, the determination of the presence or quantification of the presence of the full-length and truncated gene products is carried out with an method selected from the group consisting of immunoprecipitation, enzyme immunoassay (EIA), radioimmunoassay (RIA) or fluorescent immunoassay, a chemiluminescent assay, an agglutination assay, nephelometric assay, turbidimetric assay, a Western blot, a competitive immunoassay, a noncompetitive immunoassay, a homogeneous immunoassay a heterogeneous immunoassay, a bioassay, a reporterassay, mass spectrometry, immunohistochemistry, an assay measuring protein functionality, cell proliferation assays, cell survival assays, apoptosis assays, tumourformation assays, and FACS.
[0330] The person skilled in the art will appreciate that translation readthrough may also be termed nonsense suppression. The term “translation readthrough” means that premature termination codons are selectively suppressed to restore protein function. The person skilled in the art will also appreciate that the cyclic peptide may not promote readthrough for all proteins with a premature termination codon. The efficiency of the translation readthrough of premature termination codons may be dependent on the position of the premature termination codon in the protein-coding mRNA. Furthermore, the person skilled in the art will also appreciate that the cyclic peptide may also promote translation readthrough of mature termination codons. The cyclic peptide may promote readthrough of premature termination codons to a higher degree than mature stop codons. Furthermore, the promotion of translation readthrough of mature stop codons may not lead to a cytotoxic effect.
[0331] In one embodiment of the present invention, the cyclic peptide promotes translation readthrough of one or more premature termination codons without release factor inhibition. In one embodiment of the present invention, the cyclic peptide promotes translation readthrough of one or more premature termination codons essentially without release factor inhibition. “Essentially without” means that the cyclic peptide does not primarily inhibit the release factor. The person skilled in the art will appreciate that the activity of the release factor may be reduced by the cyclic peptide through secondary effects.
[0332] In one embodiment of the present invention, the cyclic peptide binds to a ribosome to promote translation readthrough. As used herein "binding" generally refers to the formation of a non-covalent association between the ligand and the target, although such binding is not necessarily reversible.
[0333] In one embodiment of the present invention, the cyclic peptide binds to one or more of the elongation factor eEF1A, the elongation factor eEF2, 40S ribosomal subunit, 60S ribosomal subunit, tRNA, tRNA-synthetase, release factor or mRNA.
[0334] In one embodiment of the present invention, the cyclic peptide reduces nonsense- mediated decay (NMD). In one embodiment of the present invention, the cyclic peptide reduces nonsense-mediated decay (NMD) by at least 0.1%, such as at least 0.5%, such as at least 1%, such as at least 5%, such as at least 10%.
[0335] In one embodiment of the present invention, the cyclic peptide promotes incorporation of an amino acid at the premature termination codon, such as an amino acid with electrically charged side chains, such as R, H, K, D or E.
[0336] In one embodiment of the present invention, the cyclic peptide promotes incorporation of an amino acid at the premature termination codon, such as an amino acid with polar uncharged side chains, such as S, T, N or Q. In one embodiment of the present invention, the cyclic peptide promotes incorporation of an amino acid at the premature termination codon, such as an amino acid with hydrophobic side chains, such as A, L, I, M, F, W, Y or V.
[0337] In one embodiment of the present invention, the cyclic peptide promotes incorporation of an amino acid at the premature termination codon, such as C, II, G or P.
[0338] In one embodiment of the present invention, the cyclic peptide promotes incorporation of an amino acid at a premature ochre codon, such as incorporation of K, Q, E, S, L or Y.
[0339] In one embodiment of the present invention, the cyclic peptide promotes incorporation of an amino acid at a premature amber codon, such as incorporation of K, Q, E, S, W, L or Y.
[0340] In one embodiment of the present invention, the cyclic peptide promotes incorporation of an amino acid at a premature opal codon, such as incorporation of R, G, S, L, C or W.
[0341] Premature termination codons
[0342] Cis-acting elements influencing the efficiency of termination and readthrough have been identified in several organisms. These modulators of readthrough efficiency include the identity of the stop codon and flanking nucleotides.
[0343] In one embodiment of the present invention, the premature termination codon is an amber (UAG), opal (UGA) or ochre (UAA) stop codon.
[0344] In one embodiment of the present invention, the cyclic peptide promotes translation readthrough of amber (UAG), opal (UGA) and ochre (UAA) stop codons.
[0345] In one embodiment of the present invention, a nucleotide immediately upstream of the stop codon is selected from A, U, C and G. In one embodiment of the present invention, a nucleotide two nucleotides upstream of the stop codon is selected from A, U, C and G. In one embodiment of the present invention, a nucleotide three nucleotides upstream of the stop codon is selected from A, U, C and G. In one embodiment of the present invention, a nucleotide immediately downstream of the stop codon is selected from A, II, C and G. In one embodiment of the present invention, a nucleotide two nucleotides downstream of the stop codon is selected from A, II, C and G. In one embodiment of the present invention, a nucleotide three nucleotides downstream of the stop codon is selected from A, II, C and G.
[0346] In one embodiment of the present invention, the premature termination codon is at least 1, such as at least 5, such as at least 10, such as at least 25, such as at least 50 codons upstream of the canonical stop codon.
[0347] Treatment of diseases
[0348] In another aspect, the present invention relates to the use of a cyclic peptide in a method of expressing a gene product. Nonsense mutations typically lead to a very serious disease phenotype due to a complete loss of protein function and account for about 11% of all described mutations causing genetic disease in humans. Therefore, it is important to find compounds that can promote readthrough of premature termination codons.
[0349] In one embodiment of the present invention, the cyclic peptide is used in medicine.
[0350] In one embodiment of the present invention, the cyclic peptide is used in a method of treating, preventing or managing a disease, disorder or condition associated with a decrease of expression of a gene resulting from a premature termination codon.
[0351] In one embodiment of the present invention, the disease, disorder or condition is associated with at least 1%, such as at least 5%, such as at least 10%, such as at least 20% decreased expression of a gene.
[0352] In one embodiment of the present invention, the disease, disorder or condition is selected from the group consisting of an autoimmune disease, a chronic inflammatory disease, systemic inflammatory response syndrome, a genetic condition, an eye disorder, a lysosomal storage disease, a skin disease, a bleeding disorder, a neurological disorder, muscular dystrophies, cardiovascular diseases, connective tissue disorders, diseases of the urinary system, lung diseases, blood diseases, diseases of the digestive system, mental disorders, diseases involving cognitive impairment or memory deficits and cancer.
[0353] In one embodiment of the present invention, the genetic condition is Duchenne muscular dystrophy or cystic fibrosis.
[0354] In one embodiment of the present invention, the cyclic peptide promotes translation readthrough of a premature termination codon in one or more of the following:
[0355] • gene encoding a-L-iduronidase, such as a-L-iduronidase of the sequence having the GeneBank number AH002600.2 or a gene encoding a functional homologue of said a-L-iduronidase sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0356] • gene encoding ARSB, such as ARSB of the sequence having the NCBI reference sequence NM_198709.3 or a gene encoding a functional homologue of said ARSB sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0357] • gene encoding p-globin, such as p-globin of the sequence having the GeneBank number U01317.1 or a gene encoding a functional homologue of said p-globin sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0358] • gene encoding CFTR, such as CFTR of the sequence having the GeneBank number KU325498.1 or a gene encoding a functional homologue of said CFTR sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0359] • gene encoding CHM, such as CHM of the sequence having the NCBI reference sequence NM_001362518.2 or a gene encoding a functional homologue of said CHM sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0360] • gene encoding DHCR7, such as CHCR7 of the sequence having the NCBI reference sequence NM_001425120.1 or a gene encoding a functional homologue of said DHCR7 sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0361] • gene encoding dystrophin, such as dystrophin of the sequence having the GenBank number AH003182.2 or a gene encoding a functional homologue of said dystrophin sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0362] • gene encoding fibrin-1 , such as fibrin- 1 of the sequence having the NCBI reference sequence NM_001406716.1 or a gene encoding a functional homologue of said fibrin-1 sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0363] • gene encoding KIF1A, such as KIF1A of the sequence having the NCBI reference sequence NM_001379633.1 or a gene encoding a functional homologue of said KIF1A sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0364] • gene encoding NAGLLI, such as NAGLLI of the sequence having the NCBI reference sequence NM_000263.4 or a gene encoding a functional homologue of said NAGLLI sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0365] • gene encoding SCN1A, such as SCN1 A of the sequence having the Genbank number MF358480.1 or a gene encoding a functional homologue of said SCN1A sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0366] • gene encoding SMN1, such as SMN1 of the sequence having the NCBI reference sequence NM_000344.4 or a gene encoding a functional homologue of said SMN1 sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0367] • gene encoding SMPD1 , such as SMPD1 of the sequence having the NCBI reference sequence NM_001365135.2 or a gene encoding a functional homologue of said SMPD1 sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or
[0368] • genetic variants thereof.
[0369] All accession numbers provided herein refers to the primary version of the proteins, and refers to the sequences available in the mentioned database under said accession numbers on 16 April 2024.
[0370] The person skilled in the art will appreciate, that the cyclic peptides can be used to promote translation readthrough of premature termination codons independent of the gene in which the nonsense mutation occurs. The person skilled in the art will appreciate that databases such as OMIM, HGMD, ClinGen, and COSMIC can be used to determine diseases associated with nonsense mutations in specific genes. In one embodiment of the present invention, the premature termination codon is a germline mutation. In one embodiment of the present invention, the nonsense mutation is a somatic mutation.
[0371] In one embodiment of the present invention, the cyclic peptide is used in a method of treatment of a disease associated with premature translation termination. In one embodiment of the present invention, the cyclic peptide is used in a method of treatment of a disease associated with premature translation termination in combination with other nonsense suppressors, such as Gentamicin, Geneticin, Copper, PCT124, paromomycin, PTC-414, NB30 or suppressor tRNA.
[0372] In one embodiment of the present invention, the cyclic peptide as described herein is administered orally, injected, inhaled as spray, locally, rectally, nasally, buccally, vaginally, or through an implanted drug reservoir. In a preferred embodiment, the cyclic peptide is administered orally, intraperitoneally, or by intravenous injection.
[0373] In one embodiment of the present invention, the premature translation termination is due to a gene containing a premature termination codon. The premature termination codon may be any codon as described in the chapter “Premature termination codons”.
[0374] Method of expressing functional gene products
[0375] In another aspect, the present invention relates to a method of expressing in a cell a functional gene product encoded by a gene containing a premature termination codon, the method comprising: a. Providing a cell carrying a gene with said premature termination codon; b. Transfecting and / or transducing said cell with a cyclic peptide as described herein or nucleic acid encoding same.
[0376] The term "expression of a functional gene product" generally refers to process by which information from a gene is used in the synthesis of a functional gene product, which may be a protein. The process may involve transcription, RNA splicing, translation, and post-translational modification of a protein. The nucleic acid sequence encoding a functional gene product may be a portion of an enzyme that is capable of doing at least one activity of the whole enzyme or an entire enzyme. In one embodiment of the present invention, the method is an in vitro method, an ex vivo method, or a non-therapeutic method.
[0377] In one embodiment of the present invention, the transfection is transient transfection, such as nucleofection, transfection via lipid nanoparticles, electroporation, microinjection, nanoparticles and / or peptide-based delivery. The person skilled in the art will appreciate that several methods can be used to transfect cells with the cyclic peptides of the invention and that dependent on the cell and the application of the invention, the method of transfection can vary.
[0378] In one embodiment of the present invention, the transduction is viral transduction, such as transduction via adeno-associated virus, retrovirus, adenovirus or lentivirus. The person skilled in the art will appreciate that several methods can be used to transduce cells with the cyclic peptides of the invention and that dependent on the cell and the application of the invention, the method of transfection can vary.
[0379] In one embodiment of the present invention, the functional gene product is a protein, such as an enzyme, a transporter, a G-protein coupled receptor, an ion channel, a tumour suppressor, a membrane protein, a transcription factor or a secreted protein.
[0380] In one embodiment of the present invention, the cell is selected from the group of a bacteria cell, yeast cell, plant cell, insect cell or mammalian cell. In one embodiment of the present invention, the cell is a yeast cell. In one embodiment of the present invention, the cell is a mammalian cell, such as a human cell.
[0381] In one embodiment of the present invention, the cell carries one or more mutations in the following genes: a-L-iduronidase, ARSB, p-globin, CFTR, CHM, DHCR7, dystrophin, fibrin- 1 (FBN1), KIF1A, NAGLU, SCN1A, SMN1 , or SMPDI as described above.
[0382] In one embodiment of the present invention, the nucleic acid encoding the cyclic peptide further encodes an intein or domains of an intein. The term "intein" and "intein domain" as used herein refers to a naturally occurring or artificially constructed polypeptide sequence embedded within a precursor protein that can catalyze a splicing reaction during post-translational processing of the protein. The person skilled in the art will appreciate, that a plurality of inteins are known in the fields of synthetic biology and protein engineering. When split in two halves, the intein will facilitate circularisation of the peptide (extein) encoded by the intervening sequence.
[0383] Items
[0384] 1 . A cyclic peptide having the general formula CX1X2X3X4X5, wherein the peptide is cyclized via a peptide bond formed between the N-terminal amino group of C and the C-terminal carboxyl group of X5 and wherein
[0385] Xi is a canonical aromatic amino acid;
[0386] X2 is a canonical hydrophobic, a canonical polar uncharged amino acid, a canonical aromatic amino acid or arginine;
[0387] X3 is a canonical negatively charged amino acid, a canonical polar uncharged amino acid, a canonical hydrophobic amino acid, glycine or arginine;
[0388] X4 is a canonical hydrophobic, a canonical polar uncharged amino acid, a canonical positively charged amino acid, cysteine, glycine or glutamic acid; and X5 is glycine, a cysteine, a canonical hydrophobic amino acid, a canonical aromatic amino acid, or a canonical polar uncharged amino acid.
[0389] 2. A cyclic peptide having the general formula CX1X2X3X4X5, wherein the peptide is cyclized via a peptide bond formed between the N-terminal amino group of C and the C-terminal carboxyl group of X5 and wherein
[0390] Xi is a canonical aromatic amino acid;
[0391] X2 is a canonical hydrophobic or a canonical polar uncharged amino acid;
[0392] X3 is a canonical negatively charged amino acid, a canonical polar uncharged amino acid, glycine, arginine, alanine, or leucine;
[0393] X4 is a canonical hydrophobic, a canonical polar uncharged amino acid, cysteine, or glutamic acid; andXs is glycine, a canonical hydrophobic amino acid, or a polar uncharged amino acid.
[0394] 3. The cyclic peptide according to any one of the preceding items, wherein Xi is selected from the group consisting of F, W and Y, preferably W and Y. 4. The cyclic peptide according to any one of the preceding items, wherein X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, R and Q, preferably S, I and F.
[0395] 5. The cyclic peptide according to any one of the preceding items, wherein X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, V, I, M, F, Y, W and L, preferably D, S and G.
[0396] 6. The cyclic peptide according to any one of the preceding items, wherein X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, G, R and C, preferably S, M and V.
[0397] 7. The cyclic peptide according to any one of the preceding items, wherein X5 is selected from the group consisting of V, A, G, I, S, T, L, C, M, F and H preferably V, A, and G.
[0398] 8. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWSDSV (SEQ ID NO: 1), CWIGMA (SEQ ID NO: 2), CYFSVG (SEQ ID NO: 3), CWFQEV (SEQ ID NO: 5), CWYRSV (SEQ ID NO: 6), CWLGTI (SEQ ID NO: 7), CWVGSS (SEQ ID NO: 8), CWFATV (SEQ ID NO: 9) and CWFLCT (SEQ ID NO: 10).
[0399] 9. The cyclic peptide according to any one of the preceding items, wherein Xi is tyrosine;
[0400] X2 is a canonical aromatic amino acid;
[0401] X3 is a serine, threonine or alanine;
[0402] X4 is valine; and
[0403] X5 is glycine or serine.
[0404] 10. The cyclic peptide according to any one of the preceding items, wherein X2 is selected from the group consisting of F, W and Y.
[0405] 11. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CYYSVG (SEQ ID NO: 31), CYFSVG (SEQ ID NO: 3), CYWTVG (SEQ ID NO: 32), CYWAVS (SEQ ID NO: 33) and CYYAVS (SEQ ID NO: 34).
[0406] 12. The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane;
[0407] X2 is a canonical aromatic amino acid or arginine;
[0408] X3 is aspartic acid or glutamic acid;
[0409] X4 is a canonical hydrophobic amino acid or cysteine; and X5 is valine.
[0410] 13. The cyclic peptide according to any one of the preceding items, wherein X2 is selected from the group consisting of F, W, Y and R.
[0411] 14. The cyclic peptide according to any one of the preceding items, wherein X4 is selected from the group consisting of F, C, A, V, I and W.
[0412] 15. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWWDFV (SEQ ID NO: 35), CWWECV (SEQ ID NO: 36), CWWDAV (SEQ ID NO: 37), CWWDVV (SEQ ID NO: 38), CWYDIV (SEQ ID NO: 39), CWYDVV (SEQ ID NO: 40), CWFDWV (SEQ ID NO: 41) and CWRDFV (SEQ ID NO: 42).
[0413] 16. The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane;
[0414] X2 is alanine, leucine, serine or valine;
[0415] X3 is aspartic acid or glutamic acid;
[0416] X4 is serine, threonine or methionine; and
[0417] X5 is valine, leucine, isoleucine or cysteine.
[0418] 17. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWADTV (SEQ ID NO: 43), CWLDSI (SEQ ID NO: 44), CWADSL (SEQ ID NO: 45), CWLESL (SEQ ID NO: 46), CWVDMC (SEQ ID NO: 47) and CWSDSV (SEQ ID NO: 1).
[0419] 18. The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane;
[0420] X2 is tryptophane;
[0421] X3 is glycine or methionine;
[0422] X4 is threonine, glycine or valine; and
[0423] X5 is valine, leucine or methionine. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWWGTL (SEQ ID NO: 48), CWWMTV (SEQ ID NO: 49), CWWGGV (SEQ ID NO: 50) and CWWGVM (SEQ ID NO: 51). The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane;
[0424] X2 is valine, methionine or leucine;
[0425] X3 is glycine, threonine, isoleucine, valine or leucine;
[0426] X4 is threonine, serine or phenylalanine; and
[0427] X5 is serine, threonine, methionine, isoleucine or alanine. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWVGST (SEQ ID NO: 52), CWVGSS (SEQ ID NO: 8), CWMGTT (SEQ ID NO: 53), CWVGTM (SEQ ID NO: 54), CWVGFT (SEQ ID NO: 55), CWLGTI (SEQ ID NO: 7), CWVTST (SEQ ID NO: 56), CWVISA (SEQ ID NO: 57), CWVVTA (SEQ ID NO: 58) and CWVLSS (SEQ ID NO: 59). The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane;
[0428] X2 is isoleucine or alanine;
[0429] X3 is glycine;
[0430] X4 is glycine, methionine, cysteine or valine; and X5 is threonine, alanine or valine. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWIGGT (SEQ ID NO: 60), CWIGMA (SEQ ID NO: 2), CWIGCA (SEQ ID NO: 61) and CWAGVV (SEQ ID NO: 62). The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane or tyrosine;
[0431] X2 is tryptophane, phenylalanine, tyrosine, arginine or methionine;
[0432] X3 is arginine;
[0433] X4 is serine, threonine, leucine or arginine; and X5 is valine or phenylalanine. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWWRTV (SEQ ID NO: 63), CWFRSV (SEQ ID NO: 64), CYRRLF (SEQ ID NO: 65) and CWMRRV (SEQ ID NO: 66). The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane;
[0434] X2 is tryptophane or phenylalanine;
[0435] X3 is alanine;
[0436] X4 is threonine; and
[0437] X5 is valine. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWWATV (SEQ ID NO: 67), and CWFATV (SEQ ID NO: 9). The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane;
[0438] X2 is tryptophane, phenylalanine, tyrosine, leucine or alanine;
[0439] X3 is aspartic acid, glutamic acid, Serine, threonine or glycine;
[0440] X4 is asparagine, glutamic acid, serine, threonine or glutamine; and X5 is valine or leucine. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWWNTL (SEQ ID NO: 68), CWYNTL (SEQ ID NO: 69), CWLSNL (SEQ ID NO: 70), CWAGNL (SEQ ID NO: 71), CWYTQV (SEQ ID NO; 72) and CWFQEV (SEQ ID NO 5). The cyclic peptide according to any one of the preceding items, wherein
[0441] Xi is tryptophane;
[0442] X2 is alanine, valine, arginine or isoleucine;
[0443] X3 is phenylalanine or tryptophane;
[0444] X4 is serine; and
[0445] X5 is alanine or leucine. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWAFSL (SEQ ID NO: 73), CWVFSA (SEQ ID NO: 74), CWRFSL (SEQ ID NO: 75), and CWIWSL (SEQ ID NO: 76) The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane;
[0446] X2 is threonine;
[0447] X3 is tyrosine or threonine;
[0448] X4 is serine; and
[0449] X5 is valine or leucine. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: and CWTYSL (SEQ ID NO: 77) and CWTTSV (SEQ ID NO: 78). The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane;
[0450] X2 is valine;
[0451] X3 is valine;
[0452] X4 is tryptophane; and
[0453] X5 is histidine. The cyclic peptide according to any one of the preceding items, wherein Xi is tryptophane; X2 is phenylalanine;
[0454] X3 is tyrosine or leucine;
[0455] X4 is serine or cysteine; and
[0456] X5 is serine or threonine.
[0457] 36. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is selected from the group consisting of: CWFYSS (SEQ ID NO: 80) and CWFLCT (SEQ ID NO: 10).
[0458] 37. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes translation readthrough of one or more premature termination codons.
[0459] 38. The cyclic peptide according to item 37, wherein the premature termination codon is an amber (UAG), opal (UGA) or ochre (UAA) stop codon.
[0460] 39. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes translation readthrough of amber (UAG), opal (UGA) and ochre (UAA) stop codons.
[0461] 40. The cyclic peptide according to any one of the preceding items, wherein a nucleotide immediately upstream the stop codon is selected from A, U, C and G.
[0462] 41. The cyclic peptide according to any one of the preceding items, wherein a nucleotide immediately downstream the stop codon is selected from A, U, C and G.
[0463] 42. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes translation readthrough of one or more premature termination codons without release factor inhibition.
[0464] 43. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide binds to a ribosome to promote translation readthrough. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide binds to one or more of the elongation factor eEF1A, the elongation factor eEF2, 40S ribosomal subunit, 60S ribosomal subunit, tRNA, tRNA-synthetase, release factor or mRNA. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide reduces nonsense-mediated decay (NMD). The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide binds to A-site of a ribosome. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes incorporation of an amino acid at the premature termination codon, such as an amino acid with electrically charged side chains, such as R, H, K, D or E. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes incorporation of an amino acid at the premature termination codon, such as an amino acid with polar uncharged side chains, such as S, T, N or Q. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes incorporation of an amino acid at the premature termination codon, such as an amino acid with hydrophobic side chains, such as A, L, I, M, F, W, Y or V. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes incorporation of an amino acid at the premature termination codon, such as C, II, G or P. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes incorporation of an amino acid at a premature ochre codon, such as incorporation of K, Q, E, S, L or Y. 52. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes incorporation of an amino acid at a premature amber codon, such as incorporation of K, Q, E, S, W, L or Y.
[0465] 53. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide promotes incorporation of an amino acid at a premature opal codon, such as incorporation of R, G, S, L, C or W.
[0466] 54. The cyclic peptide according to any one of the preceding items, wherein said cyclic peptide is capable of promoting incorporation of a canonical amino acid at a premature termination codon, whereby the cyclic peptide reduces the production of a truncated protein in a cell at least 0.1%, such as at least 0.5%, such as at least 1%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 50%.
[0467] 55. The cyclic peptide according to any one of the preceding items, wherein said cyclic peptide is capable of promoting incorporation of a canonical amino acid at a premature termination codon, whereby the cyclic peptide increases the ratio of full-length protein to truncated protein at least 0.1 %, such as at least 0.5%, such as at least 1%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 50%.
[0468] 56. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is cell permeable.
[0469] 57. The cyclic peptide according to any one of the preceding items, wherein the cyclic peptide is not cytotoxic.
[0470] 58. Use of a cyclic peptide according to any of items 1 to 57 in a method of expressing a gene product.
[0471] 59. The cyclic peptide according to any one of items 1 to 57, for use in medicine.
[0472] 60. The cyclic peptide according to any one of items 1 to 57 for use in the treatment, prevention or management of a disease, disorder or condition associated with a decrease of expression of a gene resulting from a premature termination codon. The cyclic peptide according to item 60, wherein the disease, disorder or condition is associated with at least 1%, such as at least 5%, such as at least 10%, such as at least 20% decreased expression of a gene. The cyclic peptide for use according to item 61 , wherein the disease, disorder or condition is selected from the group consisting of an autoimmune disease, a chronic inflammatory disease, systemic inflammatory response syndrome, a genetic condition, an eye disorder, a lysosomal storage disease, a skin disease, a bleeding disorder, a neurological disorder, muscular dystrophies, cardiovascular diseases, connective tissue disorders, diseases of the urinary system, lung diseases, blood diseases, diseases of the digestive system, mental disorders, diseases involving cognitive impairment or memory deficits and cancer. The cyclic peptide for use according to item 62, wherein the genetic condition is Duchenne muscular dystrophy or cystic fibrosis. The cyclic peptide for use according to any one of items 61 to 63, wherein the cyclic peptide promotes translation readthrough of a premature termination codon in one or more of the genes a-L-iduronidase, ARSB, p-globin, CFTR, CHM, DHCR7, dystrophin, fibrin- 1 (FBN1), KIF1A, NAGLU, SCN1A, SMN1 , or SMPD1. The cyclic peptide for use according to any one of items 61 to 63, wherein the cyclic peptide promotes translation readthrough of a premature termination codon in a gene, wherein the gene is selected from: a. gene encoding a-L-iduronidase, such as a-L-iduronidase of the sequence having the GeneBank number AH002600.2 or a gene encoding a functional homologue of said a-L-iduronidase sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or b. gene encoding ARSB, such as ARSB of the sequence having the NCBI reference sequence NM_198709.3 or a gene encoding a functional homologue of said ARSB sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or c. gene encoding p-globin, such as p-globin of the sequence having the GeneBank number U01317.1 or a gene encoding a functional homologue of said p-globin sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or d. gene encoding CFTR, such as CFTR of the sequence having the GeneBank number KU325498.1 or a gene encoding a functional homologue of said CFTR sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or e. gene encoding CHM, such as CHM of the sequence having the NCBI reference sequence NM_001362518.2 or a gene encoding a functional homologue of said CHM sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or f. gene encoding DHCR7, such as CHCR7 of the sequence having the NCBI reference sequence NM_001425120.1 or a gene encoding a functional homologue of said DHCR7 sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or g. gene encoding dystrophin, such as dystrophin of the sequence having the GenBank number AH003182.2 or a gene encoding a functional homologue of said dystrophin sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or h. gene encoding fibrin-1 , such as fibrin- 1 of the sequence having the NCBI reference sequence NM_001406716.1 or a gene encoding a functional homologue of said fibrin-1 sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or i. gene encoding KIF1A, such as KIF1A of the sequence having the NCBI reference sequence NM_001379633.1 or a gene encoding a functional homologue of said KIF1A sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or j. gene encoding NAGLLI, such as NAGLLI of the sequence having the NCBI reference sequence NM_000263.4 or a gene encoding a functional homologue of said NAGLLI sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or k. gene encoding SCN1A, such as SCN1A of the sequence having the Genbank number MF358480.1 or a gene encoding a functional homologue of said SCN1A sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or l. gene encoding SMN1, such as SMN1 of the sequence having the NCBI reference sequence NM_000344.4 or a gene encoding a functional homologue of said SMN1 sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or m. gene encoding SMPD1 , such as SMPD1 of the sequence having the NCBI reference sequence NM_001365135.2 or a gene encoding a functional homologue of said SMPD1 sharing at least 70%, such as at least 80%, for example at least 90%, such as at least 95% sequence identity therewith, or n. genetic variants thereof. The cyclic peptide according to any one of items 1 to 57 for use in a method of treatment of a disease associated with premature translation termination. The cyclic peptide for use according to item 66, wherein the premature translation termination is due to a gene contain a premature termination codon. The cyclic peptide for use according to item 67, wherein the premature termination codon is an amber (UAG), opal (UGA) or ochre (UAA) stop codon. 69. The cyclic peptide for use according to any one of items 61 to 68, wherein the cyclic peptide is used in a method of treatment of a disease associated with premature translation termination in combination with other nonsense suppressors, such as Gentamicin, Geneticin, Copper, PCT124, paromomycin, PTC-414, NB30 or suppressor tRNA.
[0473] 70. The cyclic peptide for use according to any one of items 61 to 68, wherein the cyclic peptide is administered orally, injected, inhaled as spray, locally, rectally, nasally, buccally, vaginally, or through an implanted drug reservoir.
[0474] 71. A method of expressing in a cell a functional gene product encoded by a gene containing a premature termination codon, the method comprising: a. Providing a cell carrying a gene with said premature termination codon; and b. Transfecting and / or transducing said cell with a cyclic peptide according to any one of items 1 to 57 or nucleic acid encoding same.
[0475] 72. The method according to item 71 , wherein the method is an in vitro method, an ex vivo method, or a non-therapeutic method.
[0476] 73. The method according to any one of items 71 to 72, wherein the transfection is transient transfection, such as nucleofection, transfection via lipid nanoparticles, electroporation, microinjection, nanoparticles and / or peptide-based delivery.
[0477] 74. The method according to any one of items 71 to 73, wherein the transduction is viral transduction, such as transduction via adeno-associated virus, retrovirus, adenovirus or lentivirus.
[0478] 75. The method according to any one of items 71 to 74, wherein the functional gene product is a protein, such as an enzyme, a transporter, a G-protein coupled receptor, an ion channel, a tumour suppressor, a membrane protein, a transcription factor or a secreted protein. 76. The method according to any one of items 71 to 75, wherein the premature termination codon is at least 1 , such as at least 5, such as at least 10, such as at least 25, such as at least 50 codons upstream of the canonical stop codon.
[0479] 77. The cyclic peptide according to any one of items 1 to 57, the cyclic peptide for use according to any of items 58 to 70, or the method according to any one of items 71 to 76, wherein the determination of the presence or quantification of the presence of the full-length and truncated gene products is carried out with an method selected from the group consisting of immunoprecipitation, enzyme immunoassay (EIA), radioimmunoassay (RIA) or fluorescent immunoassay, a chemiluminescent assay, an agglutination assay, nephelometric assay, turbidimetric assay, a Western blot, a competitive immunoassay, a noncompetitive immunoassay, a homogeneous immunoassay a heterogeneous immunoassay, a bioassay, a reporter-assay, mass spectrometry, immunohistochemistry, an assay measuring protein functionality, cell proliferation assays, cell survival assays, apoptosis assays, tumour-formation assays, and FACS.
[0480] 78. The method according to any one of items 71 to 77, wherein the cell is selected from the group of a bacteria cell, yeast cell, plant cell, insect cell or mammalian cell.
[0481] 79. The method according to any one of items 71 to 78, wherein the cell is a yeast cell.
[0482] 80. The method according to any one of items 711 to 79, wherein the cell is a mammalian cell, such as a human cell.
[0483] 81. The method according to any one of items 71 to 80, wherein the cyclic peptide does not substantially alter the growth rate of the cell.
[0484] 82. The method according to any one of items 71 to 81 , wherein the cyclic peptide increases the growth rate of the cell, such as that the cell multiplies 10% faster, such as 20% faster, such as 30% faster compared to a control where the cyclic peptide is not present. 83. The method according to any one of items 71to 82, wherein the cyclic peptide does not induce apoptosis of the cell.
[0485] 84. The method according to any one of items 71 to 83, wherein the cell carries one or more mutations of a-L-iduronidase, ARSB, p-globin, CFTR, CHM, DHCR7, dystrophin, fibrin- 1 (FBN1), KIF1A, NAGLU, SCN1A, SMN1 , or SMPDI.
[0486] 85. The method according to any one of items 71 to 84, wherein the translation readthrough of the premature termination codon is at least 0.1%, such as at least 0.5%, such as at least 1%, such as at least 10% increased, such as at least 25% increased, such as at least 50% increased, such as at least 100% increased, such as at least 500% increased, such as at least 1000% increased compared to cells not transfected with the cyclic peptide.
[0487] 86. The method according to any one of items 71 to 85, wherein the nucleic acid encoding the cyclic peptide further encodes an intein.
[0488] Examples
[0489] Example 1: Production cyclized peptides intracellularly
[0490] Aim:
[0491] To produce cyclized peptides intracellularly in S. cerevisiae.
[0492] Material and Methods:
[0493] SICLOPPS library construction
[0494] Two different yeast SICLOPPS library were prepared by cloning the intein gene segments from Synechocystis sp. PCC6803 as described in Wu et al. 1998 into the pESC-LEU yeast epitope tagging vector (Agilent Technologies #217452) in a reversed order, with positioning to add a c-myc tag to the C-terminus of intein N. Prior to this, the unique Nhel restriction site was removed from pESC-LEU using site-directed mutagenesis. In one library, the cyclic peptide-encoding sequence (TGC-(NNS)5) was introduced between the intein segments in PCR reactions using a degenerate library primer. In the second library, the peptide encoding sequence was a 1 :1 mixture of TGC-TAC-(NNS)4 or TGC-TGG-(NNS)4. PCR fragments with inserted randomized sequences were used as a DNA template in “zipper” PCR reactions to remove potential mismatches as described in Tavassoli and Benkovic 2007. Purified PCR products and the intein-containing vector were digested with restriction enzymes, ligated, and purified by drop dialysis. The ligated products were transformed by electroporation in highlycompetent E. coli SIG 10 cells (Sigma-Aldrich) and plated on large dishes of LB agar + 100 pg / mL ampicillin. The SICLOPPS library was obtained by collecting bacterial colonies and purifying plasmid DNA. The resulting library was estimated to hold 8 x 107individual library members. Empty vector, used throughout the study as a negative control, denotes pESC-LEU with insertion of the intein gene segments, but with no insertion of randomized peptide-encoding sequence. The lack of inserted randomized sequence affects the reading frame, thereby only allowing for expression of the C-terminal intein.
[0495] Large-scale library transformation in S. cerevisiae
[0496] S. cerevisiae IS110-18A (([PSI]" MATa aro7-1 ieu2-2 ilv1-2 his4-166 lys2-101 met8-1 trp5-48 ura4-1) cells as described in Baradaran-Heravi et al. 2016 were transformed with the constructed SICLOPPS library using a large-scale method employing lithium acetate and heat shock as described in Kritzer et al. 2009. An overnight stationary- phase culture in yeast peptone dextrose (YPD) medium was used to prepare a 330-mL culture in YPD starting at an OD600 of 0.2 and incubated at 30°C with shaking until reaching exponential-phase growth (OD600 -0.6-0.7). Cells were pelleted by centrifugation, washed in Tris-EDTA (TE) buffer (10 mM Tris-HCI, 1 mM EDTA, pH 7.5), and resuspended in 1.5 mL TE containing 0.1 M lithium acetate. 1 mL of cells were added to a tube containing 20 pg SICLOPPS library plasmid DNA and 2 mg boiled salmon testes single-stranded carrier DNA (Sigma-Aldrich). The DNA was mixed with 6 mL TE and 0.1 M lithium acetate in 40% PEG 4000, thoroughly mixed by vortexing, and incubated for 30 minutes at 30°C with shaking. 700 pL dimethyl sulfoxide (DMSO) was added to the cells and gently mixed by turning the tube. Cells were heat-shocked for 15 minutes at 42°C in a water bath and allowed to recover in 10 mL YPD for one hour at 30°C. Subsequently, the cells were pelleted, washed in TE buffer, resuspended in TE buffer, and plated on a large (245 x 245 mm) dish of synthetic defined (SD) / -Leu agar added 2% glucose. A small volume of cells was retained, serially diluted, and plated separately to estimate the number of transformants. The plates were wrapped in parafilm and left for three days in a 30°C incubator. Western blotting
[0497] S. cerevisiae IS110-18A cells were transformed with plasmid constructs expressing readthrough-promoting cyclic peptides or mutants thereof using standard lithium acetate treatment and heat shock. Controls expressing an empty vector or random cyclic peptides (c(Cys-Ser-Gly-Val-Leu-Glu) and c(Leu-Trp-Thr-Leu-Gly), respectively) as described in Birkmose et al. 2023) were included. Colonies of transformed cells were cultured until reaching stationary phase in SD / -Leu added 2% galactose at 30°C with shaking. Cultures were chilled on ice, pelleted by centrifugation, and washed in ice-cold H2O. Cell pellets were frozen in liquid nitrogen and stored at -70°C. Cell lysis was performed by resuspension in a lysis buffer followed by rapid freeze-thawing, using 1 mL lysis buffer per 109cells. Aliquots of lysed cells were mixed with an SDS loading buffer. Proteins were separated by SDS-PAGE, transferred to a PVDF membrane, and the membrane was analyzed by Western blotting applying standard procedures. Used antibodies were a primary antibody, mouse a-c-myc (Sigma-Aldrich #M4439) diluted 1 :1000, and a secondary antibody, horseradish peroxidase (HRP)- conjugated goat a-mouse (Dako) diluted 1:5000.
[0498] Results:
[0499] Processing to release the peptide in a cyclized form resulted in the cleavage of the C- terminal intein (4 kDa) and the N-terminal intein (15.5 kDa), which are encoded in a reversed order in SICLOPPS libraries to facilitate cyclization. This allows for the detection of processing by means of a c-myc-tag, located in the C-terminus of the construct (Figure 2 A). S. cerevisiae strain IS110-18A cells were individually transformed with each of the ten readthrough-promoting cyclic peptide constructs, and lysates of cells grown to stationary phase were analyzed by Western blotting to detect expression and processing. All unprocessed intein-peptides could be detected (Figure 2 B, upper band). Expression levels were generally high. Processing to release cyclized peptides could be detected for all candidates except CP58, which was generally expressed at a lower level (Figure 2 B, lower band).
[0500] Conclusion:
[0501] The inventors of the present disclosure conclude that cyclized peptides are produced in the S. cerevisiae IS110-18A cells. Example 2: Identification of nonsense mutation-suppressing cyclic peptides Aim:
[0502] To identify cyclic peptides, which can suppress premature amber stop codons.
[0503] Material and Methods:
[0504] Selection in S. cerevisiae and isolation of candidate library members
[0505] S. cerevisiae colonies transformed with the cyclic peptide library, encoding (TGC- (NNS)5, were scraped off agar plates and collected in TE buffer. The cell suspension was washed in TE buffer and resuspended in TE buffer. Cell counts were estimated via OD600 measurements. Following this, 800,000 cells were plated on 24 140-mm Petri dishes of SD / -Leu / -Met agar added 2% galactose. The same number of cells were also plated on the following control plates: SD / -Leu agar + 2% galactose, SD / -Leu agar + 2% glucose, SD / -Leu / -Met agar + 2% glucose, and SD / -Leu / -Met agar + 2% glucose + 200 pg / mL G418 (Sigma-Aldrich). The plates were wrapped in parafilm and placed in a 30°C incubator. Colony formation was followed for five days. As cells generally grew more slowly on galactose-containing medium compared to medium with glucose, representative images were taken on separate days to enable a comparison of similar growth stages of cells. Yeast colonies surviving on the selective medium were picked and individually cultured in SD / -Leu added 2% glucose at 30°C with shaking until reaching stationary phase, and total DNA was extracted for each culture using a yeast DNA extraction kit (Thermo Scientific). Plasmid DNA was amplified by electroporation in E. coli SIG10 cells. Plasmid DNA was extracted from separate overnight cultures of transformed E. coli cells grown in LB + 100 pg / mL ampicillin at 37°C with shaking, using the GeneJET Plasmid Miniprep Kit (Thermo Scientific).
[0506] Spot assays
[0507] Purified plasmid constructs expressing candidate readthrough-promoting cyclic pep- des or mutants thereof were individually transformed into S. cerevisiae IS110-18A cells using standard lithium acetate treatment and heat shock. Colonies of transformed cells were cultured overnight in SD / -Leu added 2% glucose at 30°C with shaking. Cultures were diluted in sterile H2O or the appropriate selective medium to an GD600 of 1.0. Dilutions with adjusted cell counts were then further ten-fold serially diluted in sterile H2O and spotted on selective medium and control agar plates. Plates were wrapped in parafilm and incubated at 30°C with colony formation being followed for five days. As cells generally grew more slowly on galactose-containing medium compared to medium with glucose, representative images for control plates were taken on separate days to enable a comparison of similar growth stages of cells. All images of cells grown on readthrough-selective, galactose-containing medium were taken after four days of incubation. The ability of cyclic peptides to suppress nonsense mutations was evaluated by comparing cells grown on the selective medium expressing cyclic peptides to cells expressing an empty vector or expressing a random cyclic peptide (c(Cys-Ser-Gly-Val-Leu-Glu)). The sequences of cyclic peptide constructs enhancing cell growth when expressed were determined by Sanger sequencing (Eurofins Genomics TubeSeq).
[0508] Results:
[0509] Enhanced cell growth obtained via PTC readthrough was assessed by comparison to cells expressing a random cyclic peptide (RCP) or an empty vector (EV), both of which should be unable to grow on a selective medium. After selection from the library, (TGC- (NNS)5), the validation resulted in the identification of ten library members reproducibly suppressing nonsense mutations at various degrees (Figure 3 C). The strongest nonsense suppressors, as judged by enhanced cell growth, were CP06 (SEQ ID NO: 1), CP07 (SEQ ID NO: 2), CP35 (SEQ ID NO: 4), and CP55 (SEQ ID NO: 3) (Figure 3 C). Interestingly, a comparison of cells grown on glucose- and galactose-containing non-selective medium revealed that some of the identified readthrough-promoting cyclic peptides caused general growth inhibition, while the expression of others did not affect cell growth (Figure 3 C). No growth inhibition was observed for CP06 (SEQ ID NO: 1), CP07 (SEQ ID NO: 2), CP35 (SEQ ID NO: 4), and CP55 (SEQ ID NO: 3).
[0510] Conclusion:
[0511] Ten candidate readthrough-promoting cyclic peptides of varying potency were discovered in the yeast selection, of which some displayed no observable effect on general cell growth.
[0512] Example 3: Readthrough cyclic peptides can suppress several endogenous nonsense mutations
[0513] Aim:
[0514] To identify cyclic peptides, which can suppress premature amber, ochre and opal stop codons. Material and methods:
[0515] The spot assay was performed as described in Example 2 except that selection was based on nonsense suppression of lys2-101 TGA-C and trp5-48 TAA-C nonsense mutations. The same cyclic peptides as in Examples 1 and 2 were used.
[0516] Results:
[0517] Nonsense-mutation suppression in the Iys2-101 (T GA-C) gene could be observed for several cyclic peptides (Figure 4). However, a high level of background growth of cells on the medium lacking lysine likely masked the readthrough effect of the weakly acting cyclic peptides (Figure 4). To further investigate if the cyclic peptides could suppress a TAA nonsense mutation, the readthrough-stimulating capacity of the four most promising candidates was tested using the trp5-48 (TAA-C) reporter gene. Despite a high background cell growth, CP06 (SEQ ID NO: 1), CP07 (SEQ ID NO: 2), and CP55 (SEQ ID NO: 3) could suppress the TAA nonsense mutation located in this gene (Figure 4). Of note, CP35 (SEQ ID NO: 4) showed a strong nonsense-mutation suppression in met8-1, but no observable activity for any other reporter genes tested (Figure 4C). Remarkably, eight of the ten readthrough-promoting cyclic peptides contained a tryptophan residue at the first randomized position. This feature is likely to promote their nonsense suppression activity. Exceptions to this are CP55, which contains another aromatic amino acid, tyrosine, at the same position, and CP35 (SEQ ID NO: 4), which generally differs from the other cyclic peptides with a positively charged lysine and three hydrophobic isoleucines. Constructs encoding readthrough- promoting cyclic peptides were Sanger-sequenced to obtain the amino acid compositions of the cyclic peptides. Each cyclic peptide contains a fixed cysteine and five additional amino acid positions that were randomized in the DNA library that they are derived from. Note that since peptides are cyclized head-to-tail, position Xs is connected to the cysteine through the peptide backbone (Table 1).
[0518] Table 1: Sequences of ten readthrough-promoting cyclic peptides. Constructs encoding readthrough-promoting cyclic peptides were Sanger-sequenced to obtain the amino acid compositions of the cyclic peptides. (-) labelled fields were not tested.
[0519] Conclusion:
[0520] The inventors of the present disclosure conclude that CP06 (SEQ ID NO: 1), CP07 (SEQ ID NO: 2), and CP55 (SEQ ID NO: 3) can suppress premature amber, ochre and opal stop codons. The other cyclic peptides can also suppress premature stop codons, but not all of amber, ochre and opal stop codon.
[0521] Example 4: Five cyclic peptides display no cellular toxicity
[0522] Aim:
[0523] To identify cyclic peptides with no cellular toxicity.
[0524] Material and methods:
[0525] Growth assay in liquid culture
[0526] Colonies of S. cerevisiae IS110-18A cells transformed with readthrough-promoting cyclic peptides were pre-incubated in 5 mL SD / -Leu added 2% galactose at 30°C with shaking for 24 hours to ensure, that cells were already expressing cyclic peptides at the start of the growth assays. The cells were washed in sterile H2O and used to set up 15-mL cultures in non-selective SD / -Leu + 2% galactose or readthrough-selective SD / -Leu / -Met + 2% galactose medium with a starting OD600 of 0.15. Growth of the cultures was monitored over several days by measuring OD600 on suitable cell culture dilutions and comparing to the growth of cells expressing a random cyclic peptide (c(Cys-Ser-Gly-Val-Leu-Glu) described in Birkmose et al. 2023).
[0527] Results:
[0528] Four readthrough-promoting cyclic peptides, namely CP06 (SEQ ID NO: 1), CP07 (SEQ ID NO: 2), CP35 (SEQ ID NO: 4), and CP55 (SEQ ID NO: 3), were chosen as the lead candidates based on their strong readthrough promotion and lack of growth inhibition on solid medium (Figure 4C). Cell division was monitored via the optical density at 600 nm (OD600) at specific time points. General cell growth under conditions not selecting for readthrough promotion was monitored by culturing cells in a medium containing galactose to induce cyclic peptide expression and omission of leucine to select for cells transformed with cyclic peptide-encoding constructs. Cultures were established using starter cultures containing galactose, thereby ensuring that the cells were already expressing the cyclic peptides from the beginning of the experiments. The relatively slow general growth of the yeast cultures was likely due to the use of galactose as the sole carbon source. Any potential cellular toxicity mediated by expression of the readthrough cyclic peptides was assessed by comparing growth to cultures expressing a control random cyclic peptide. Notably, almost no reduction in cell growth was observed for any of the cultures expressing the readthrough-promoting cyclic peptides (Figure 5). At 24 and 48 hours, growth was even significantly enhanced for cultures expressing CP06 (SEQ ID NO: 1), CP07 (SEQ ID NO: 2), and CP35 (SEQ ID NO: 4) compared to the control. Growth of the culture expressing CP55 (SEQ ID NO: 3) was enhanced at 24 hours, but with a small albeit significant reduction in cell numbers (mean QD600 of 4.2 for CP55 (SEQ ID NO: 3) and 4.4 for random cyclic peptide) at 48 hours (Figure 5).
[0529] Nonsense-mutation suppression was assessed by additional removal of methionine and monitoring cell numbers in the same manner and timeframe as for the cultures without selection pressure. All cultures expressing readthrough-promoting cyclic peptides showed significant increases in cell numbers compared to control cultures, indicating nonsense-mutation suppression in the met8-1 reporter gene (Figure 5). Conclusion:
[0530] The inventors of the present disclosure conclude that CP06 (SEQ ID NO: 1), CP07 (SEQ ID NO: 2), CP35 (SEQ ID NO: 4) and CP55 (SEQ ID NO: 3) do not show cellular toxicity.
[0531] Example 5: Cyclization and most amino acid positions are important for readthrough Aim:
[0532] To understand the structural motifs contributing to the functionality of the cyclic peptides.
[0533] Material and methods:
[0534] Site-directed mutagenesis and alanine scanning
[0535] The SICLOPPS library-derived plasmid expressing CP55 (SEQ ID NO: 3), specifically pESC-LEU with insertion of the CP55-encoding sequence flanked by cyclizing intein domains, was used as a DNA template for mutagenesis. Mutations introduced in CP55 (SEQ ID NO: 3) were C1S, Y2A, Y2W, F3A, V4A, S5A, and G6A using the Quikchange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) and mutagenic primers (SEQ ID NOs: 11 - 26). Mutations in intein N (T69A+H72A), blocking the first step in intein processing as described in Ghosh et al. 2001 , or mutations in intein C (H24L+F26A), blocking the final processing step leading to a release of cyclized peptide as described in Ding et al. 2003, were introduced using a modified Quikchange protocol with primers (SEQ ID NOs: 27 - 30) containing extended non-overlapping segments as described in Liu and Naismith 2008. Vectors with confirmed mutations were re-transformed into E. coli, followed by repeated plasmid purification and Sanger sequencing for double verification of the relevant mutations as well as the absence of any unintended mutations.
[0536] Results:
[0537] Mutational analysis, including alanine scanning, was conducted on the best readthrough-promoting candidate, CP55 (SEQ ID NO: 3) (Figure 6), to gain a better understanding of structural motifs contributing to its functionality. Mutagenesis was done at the DNA level by substituting codons in the cyclic peptide-encoding DNA construct. C1 was mutated to serine (and not alanine) to investigate the importance of a thiol group, while still retaining the ability of the peptide to cyclize. The remaining residues were systematically mutated to alanine. Y2 was also mutated to tryptophan to investigate if tryptophan is favorable in the context of CP55’s sequence (SEQ ID NO:3) since most other identified readthrough cyclic peptides have a tryptophan succeeding cysteine (Table 1). Moreover, constructs encoding wild-type CP55 (SEQ ID NO:3) with point mutations in the intein gene segments were made to assess, if the readthrough activity is facilitated by the cyclized peptide, or by an unprocessed or partially processed intein-peptide intermediate. The introduction of the mutations T69A and H72A in the N-terminal intein blocks the first step in intein processing, while the mutations H24L and F26A in the C-terminal intein will block the final processing step that leads to the release of cyclized peptides.
[0538] Constructs encoding wild-type CP55 (SEQ ID NO: 3) and its mutated variants were transformed into S. cerevisiae IS110-18A cells, which were subsequently cultured, and spotted on a selective medium lacking methionine. Strikingly, almost all mutations either abolished or greatly reduced the nonsense suppression ability of CP55 (SEQ ID NO:3) (Figure 6). Only S4 did not seem to contribute greatly to the readthrough- promoting activity, as mutating the amino acid to alanine resulted in only minor effects on growth enhancement. Importantly, mutations in the intein segments that hinder processing completely abolished the activity, demonstrating that the active readthrough compound is the fully cyclized CP55 (SEQ ID NO: 3) that results after splicing and release from the inteins domains (Figure 6).
[0539] Conclusion:
[0540] The inventors of the present disclosure conclude that all amino acids of the cyclic peptides are contributing to the functionality of the cyclic peptides and that cyclization is required for their readthrough-promoting activity.
[0541] Example 6: Studies on CP55 indicate interference with codon-anticodon base pairing Aim:
[0542] To investigate the mechanism of readthrough-promoting cyclic peptides
[0543] Material and methods:
[0544] Synthesis of cyclic peptides
[0545] The readthrough-promoting cyclic peptide CP55 (c(CYFSVG)) and a random cyclic peptide (c(CSGVLE)) were synthesized by 9-fluorenylmethyloxycarbonyl (Fmoc) solidphase peptide synthesis on a 2-chloro-trityl resin preloaded with the first amino acid. Chain elongation was achieved with single couplings using 3.5 equivalents each of amino acid, 1 -hydroxy-7- azabenzotriazole (HOAt), and hexafluorophosphate azabenzotriazole tetramethyl uranium (HATLI) and 7 equivalents of diisopropylethylamine (DIEA). After 2 h, the resin was washed with dimethylformamide (DMF) (3 x 1 min), dichloromethane (DCM) (3 x 1 min), and DMF again (5 x 1 min). The Fmoc group was removed by treatment with piperidine-DMF (1 :4) (3 x 1 min); followed by washing as described above. The protected peptide was cleaved from the resin with hexafluoroisopropanol-DCM (1 :4), (3 x 30 min), the filtrate was collected, and evaporated to dryness. In-solution cyclization C->N terminus was carried out using 7- azabenzotriazol-1-yloxy)tripyrrolidinophosphoniumhexafluoro-phosphate (PyAOP) (1 equivalent) in the presence of HOAt (1 equivalent) / DIEA (2 equivalents) in DMF-DCM (6:94) as described in Ramesh et al. 2016. Following overnight reaction, DCM was evaporated, and water was added to precipitate the peptide. The peptide was then lyophilized and treated with trifluoroacetic acid (TFA):triisopropylsilane:H2O (95:2.5:2.5) for 2 hours. TFA was evaporated, the peptide precipitated in ether, lyophilized, and characterized. In both cases, the main product was the desired cyclic peptide c(CYFSVG) (calculated: 657.76 found: 657.68) and c(CSGVLE) (calculated: 589.68; found: 589.44 and 611.42 + Na).
[0546] Components for in vitro assays
[0547] Eukaryotic 40S and 60S ribosomal subunits were isolated from Artemia salina (brine shrimp) cysts. E. coli 70S ribosomes, used as a carrier in co-sedimentation assays, were likewise purified as described in Ng et al. 2021. Translation elongation factors eEF1A and eEF2 were purified from yeast as described in Ng et al. 2021 , while full- length human release factors eRF1 and eRF3 were expressed in E. coli and purified as previously described in Ghelfi et al. 2023. S. cerevisiae Trp-tRNATrp, Gln-tRNAGln, and Tyr-tRNATyrwere prepared as described previously in Ng et al. 2021 . Briefly, the tRNAs were isolated from bulk tRNAs via hybridization to complementary DNA oligos and charged with their cognate [3H]-labelled amino acid. RNA transcripts containing a cricket paralysis virus IRES (to facilitate translation initiation without initiation factors), a sequence encoding a short polypeptide, and a termination codon for translation termination or readthrough assays were prepared by in vitro transcription as described in Zhang et al. 2016 and Ng et al. 2018. The two assays were used to determine rates of peptide release and levels of readthrough, respectively. The IRES-containing mRNA encodes the peptide FKVRQ upstream of the termination codon, which was followed by two codons resulting in a readthrough-prone context (UGA CUA AUG; the stop codon is shown in bold).
[0548] Fluorescence anisotropy termination assay
[0549] Termination assays were conducted as described in Huang et al. 2022. For the assay, 10 pL of POST5 mix containing Atto 647-labeled POST5 complex, GTP, DTT, and Buffer 4 (40 mM Tris HCI (pH 7.5), 80 mM NH4CI, 5 mM magnesium acetate, 100 mM potassium acetate, 3 mM p-mercaptoethanol) were added to a 384-well plate. Aliquots of eRF1 and eRF3, which were stored at -80°C, were thawed on ice and mixed in Buffer 4 with added GTP and DTT. The final concentrations in the assays were 0.05 pM POST5 complex, 1 mM GTP, 1 mM DTT, 0.13 pM eRF1 , and 1.6 pM eRF3. Cyclic peptides were added at varying concentrations to POST5 mix, release factor mix, or both. POST5 and release factor mixes were incubated briefly at room temperature, and 10 pL of release factor mix was then quickly added simultaneously to wells containing POST5 mixes using a multichannel pipette. The assay was conducted using a plate reader with 640 nm excitation and 700 nm polarization filters at 25°C. Fluorescence anisotropy decay traces were processed in GraphPad Prism, using a one-phase decay model to obtain rates of peptide release. The IC50 of CP35 was obtained using the model: Y=100 / (1+10A(X-Log(ICso))), with X being Iog10-transformed cyclic peptide concentrations and Y being normalized (values from 0% to 100%) rates of peptide release. All obtained peptide release rates were based on two technical replicates.
[0550] Co-sedimentation readthrough assay
[0551] Readthrough assays were conducted as reported in Ng et al. 2018, Ng et al. 2021. First, 10 pL aliquots were prepared containing POST5 complex in Buffer 4 with added GTP and DTT at room temperature. A mixture containing aminoacyl-tRNA (see below), elongation factors eEF1A and eEF2, release factors eRF1 and eRF3, cyclic peptide, GTP, and DTT in Buffer 4 were prepared, and the reactions were initiated by adding 10 pL of the mix to the POST5 mix at room temperature. The reactions were quenched after exactly 90 seconds by adding an excess (80 pL) of 0.5 M ice-cold MES buffer (pH 6.0) and placing the reactions on ice. The tRNA used was [3H]-labelled Trp-tRNATrpfor reactions using the IRES mRNA containing a UGA termination codons. The final concentrations of components in the reactions were 0.05 pM POST5 complex, 1 mM GTP, 1-2 mM DTT, 0.2 pM tRNA, 1 pM eEF1A, 1 pM eEF2, 0.04 pM eRF1 , 0.1 pM eRF3, and varying concentrations of cyclic peptide. Ribosomes were pelleted by first adding 100 pmol E. coli 70S carrier ribosomes, followed by ultracentrifuging through 165 pL of a 1.1 M sucrose solution in Buffer 4 at 540,000 x g for 90 minutes at 4°C. Ribosomal pellets were resuspended in Buffer 4, and [3H] radioactivity was measured to determine amino acid incorporation at termination codons. A small fraction of the resuspended ribosomes was used for measuring absorbance at 260 nm, to determine yields of ribosomal RNA after ultracentrifugation. A reaction with no cyclic peptide added was included as a negative control, thereby quantifying basal, non-stimulated readthrough. All experiments were performed in at least two technical replicates.
[0552] Results:
[0553] Strikingly, CP55 (SEQ ID NO: 3) was able to increase readthrough (Figure 7), suggesting that CP55 (SEQ ID NO: 3) suppresses nonsense mutations in cells via direct interactions with the protein synthesis machinery. The experiment was performed in the presence of the release factor complex (RFC), which reduces readthrough to very low levels when no readthrough-inducing compound is added (Figure 7A). The addition of CP55 (SEQ ID NO: 3) at varying concentrations strongly increased amino acid incorporation at the termination codon, although with an unusual concentration dependence. Almost no difference was observed between 0.1 and 0.5 mM CP55 (SEQ ID NO: 3) added, while the addition of 1 mM CP55 (SEQ ID NO: 3) further increased readthrough (Figure 7A).
[0554] Further experiments showed that readthrough levels are higher when CP55 (SEQ ID NO: 3) is added relative to when RCP is added, indicating a specific readthrough- promoting effect of CP55 (SEQ ID NO: 3) (Figure 7B). Adding both to the same reaction inhibited the readthrough-stimulatory effect of CP55 (SEQ ID NO: 3), which could be due to RCP inhibiting the assay. Importantly, the experiments were performed in the absence of RFC, indicating that CP55 (SEQ ID NO: 3) promotes readthrough independently of release factor activity (Figure 7B). In subsequent experiments, CP55 (SEQ ID NO: 3) exhibited a concentration-dependent increase in readthrough in the absence of RFC, with a half maximal effective concentration (ECso) of approximately 0.2 mM (Figure 7C). Note that basal readthrough levels are naturally higher in the absence of RFC even when no stimulatory compound is added. In termination assays, CP55 (SEQ ID NO: 3) did not affect the peptide release rate, thereby supporting that its effect on readthrough is independent of release factor activity (Figures 7D and 7E). Conclusion:
[0555] The inventors of the present disclosure conclude that the readthrough effect of CP55 (SEQ ID NO: 3) is initiated through the direct promotion of tRNA mispairing.
[0556] Example 7: Studies on CP55 indicate that CP55 facilitates binding of near-cognate tRNA at the termination codon
[0557] Aim:
[0558] To investigate the mechanism of readthrough-promoting cyclic peptides
[0559] Material and methods:
[0560] Components for the in vitro assays were produced as described in example 6. Readthrough at a stop codon by insertion of an amino acid by accommodation of a near-cognate tRNA in the presence and absence of test peptides was measured by single-molecule total internal reflection fluorescence (TIRF) microscopy. All sm-TIRF studies were conducted at 24 °C. An enzymatic oxygen scavenging system to reduce photobleaching consisted of 2 mM protocatechuic acid (PCA), 50 nM protocatechunate 3,4 dioxygenase (PCD, Sigma Aldrich), 1 mM cyclooctatetraene (COT, Sigma Aldrich), 1 mM 4-nitrobenzyl alcohol (NBA, Sigma Aldrich), and 1.5 mM 6-hydroxy-2, 5,7,8- tetramethyl-chromane-2-carboxylic acid (Trolox, Sigma-Aldrich) which was used for all dilutions, complex formation, and single-molecule imaging. A custom-built objectivetype total internal reflection fluorescence (TIRF) microscope, based on a commercial inverted microscope (Eclipse Ti-E, Nikon), was used to record image stacks at a frame rate of 100 ms. The microscope could perform alternating-laser excitation (ALEX) between 532 nm and 640 nm laser beams using an acousto-optic tunable filter (AOTF) to switch wavelengths.
[0561] Biotinylated Stop-POST5 and Trp-POST5 ribosomal complexes containing FKVRQ- tRNAGln(Cy3) in the P-site, and a UGA stop codon for Stop-POST5 or a UGG codon for Trp-POST5 at the A site was injected into the streptavidin-coated PEGylated slide chamber. After a 5 min incubation, excess unbound ribosomes were washed out. Then tRNATrp(Cy5) ± CP55 (in the presence of eEF1A and GTP) was injected and incubated for 5 mins to form the Stop-PRE6 or Trp-PRE6 complex, and then excess reagents were flowed out and movies were recorded. Trp-PRE6 or Stop-PRE6 formation (when near-cognate tRNATrp(Cy5) accommodated into the A-site containing a stop codon) was confirmed by a tRNA-tRNA FRET signal (FRET efficiency=~0.5) between tRNAGln(Cy3) in the P-site and the peptidyl-tRNA, FKVRQW-tRNATrp(Cy5), in the A-site (Fig. 8A). The recorded movies were analyzed by a custom-made software program developed as an Imaged plugin (http: / / rsb.info.nih.gov / ij), and in Python. The number of traces for each experiment varied from -150-1000. The number of experiments ranged from 2-4. Error bars are the mean ± s.e.m which is calculated from the total number of traces. The number of Stop-PRE6 formations, a measure of readthrough, increased as a function of added CP55 (Fig 8B).
[0562] Results:
[0563] CP55 (SEQ ID NO: 3) facilitates binding of near-cognate tRNA at the termination codon, leading to the formation of Stop-PRE6 complex.
[0564] Conclusion:
[0565] The inventors of the present disclosure conclude that the readthrough effect of CP55 (SEQ ID NO: 3) is based on A-site binding of the cyclic peptide.
[0566] Example 8: Luciferase assay in HEK293T cells
[0567] Materials and methods:
[0568] HEK 293T cells were transfected with a luciferase reporter construct expressing -Firefly luciferase as a normalization control and Nano luciferase as the reporter from individual, bidirectional CMV promoters. The Nano luciferase reporter has a premature termination codon inserted at position E51X (UGA)..
[0569] The cells were then incubated with 200 pM cyclic peptides (CP06 of SEQ ID NO: 1, CP07 of SEQ ID NO: 2, CP35 of SEQ ID NO: 4, and CP55 of SEQ ID NO: 3) in the culture medium for either 16 or 40 hours. The aminoglycoside G418 was used as a potent positive control, while a random cyclic peptide (RCP) served as the negative control. A sample containing DMSO in the same amount used to deliver the cyclic peptides was included to normalize the fluorescence readings.
[0570] Results:
[0571] CP55 increases the readthrough of the premature stop codon 2-fold after 16 hours and 1.5-fold after 40 hours. CP07 increases the readthrough of the premature stop codon 1.5-fold after 16 hours. RCP has almost the exact same Nano / Firefly signal as DMSO only (Figure 9). G418 increases the readthrough 90-fold after 16 hours and 35-fold after 40 hours (not shown). Conclusion:
[0572] The inventors of the present disclosure conclude that the cyclic peptides can increase the readthrough of premature stop codons in human cell lines.
[0573] Example 9: Identification of further nonsense mutation-suppressing cyclic peptides Material and methods:
[0574] The experiments were performed as described in example 2 using the library encoding a 1 :1 mixture of TGC-TAC-(NNS)4 and TGC-TGG-(NNS)4. CP55 was added as positive control.
[0575] Results:
[0576] Enhanced cell growth obtained via PTC readthrough was assessed by comparison to cells expressing a random cyclic peptide (RCP) or an empty vector (EV), both of which should be unable to grow on a selective medium. CP55 was used as positive control. The validation resulted in the identification of 50 additional library members reproducibly suppressing nonsense mutations at various degrees (Figure 10). A comparison of cells grown on glucose- and galactose-containing non-selective medium revealed that most of the identified readthrough-promoting cyclic peptides did not inhibit general growth (see column in the table below reporting on cytotoxicity). The results obtained for peptides marked with an asterisk have been independently confirmed in six biological replicates.
[0577] Conclusion:
[0578] 50 candidate readthrough-promoting cyclic peptides of varying, but mostly high potency were discovered in the yeast selection, of which most displayed no observable effect on general cell growth.
[0579] Sequence overview
[0580] SEQ ID NO:1 : CP06
[0581] CWSDSV
[0582] SEQ ID NO: 2: CP07
[0583] CWIGMA
[0584] SEQ ID NO: 3: CP55 CYFSVG
[0585] SEQ ID NO: 4: CP35
[0586] CIKIIP SEQ ID NO: 5: CP27
[0587] CWFQEV
[0588] SEQ ID NO: 6: CP29
[0589] CWYRSV
[0590] SEQ ID NO: 7: CP40
[0591] CWLGTI
[0592] SEQ ID NO: 8: CP43
[0593] CWVGSS
[0594] SEQ ID NO: 9: CP58
[0595] CWFATV
[0596] SEQ ID NO: 10: CP61
[0597] CWFLCT
[0598] SEQ ID NO: 11 : GAL1_fwd
[0599] ATTTTCGGTTTGTATTACTTC
[0600] SEQ ID NO: 12: GAL1_rev
[0601] GTTCTTAATACTAACATAACT
[0602] SEQ ID NO: 13: CP55_C1S_1
[0603] CGATCGCCCACAATTCCTACTTCTCGGTGG
[0604] SEQ ID NO: 14: CP55_C1S_2
[0605] CCACCGAGAAGTAGGAATTGTGGGCGATCG
[0606] SEQ ID NO: 15: CP55_Y2A_1
[0607] GATCGCCCACAATTGCGCCTTCTCGGTGGGCTGC SEQ ID NO: 16: CP55_Y2A_2
[0608] GCAGCCCACCGAGAAGGCGCAATTGTGGGCGATC
[0609] SEQ ID NO: 17: CP55_F3A_1
[0610] GCCCACAATTGCTACGCCTCGGTGGGCTGCCT
[0611] SEQ ID NO: 18: CP55_F3A_2
[0612] AGGCAGCCCACCGAGGCGTAGCAATTGTGGGC
[0613] SEQ ID NO: 19: CP55_S4A_1
[0614] CCCACAATTGCTACTTCGCGGTGGGCTGCCT
[0615] SEQ ID NO: 20: CP55_S4A_2
[0616] AGGCAGCCCACCGCGAAGTAGCAATTGTGGG
[0617] SEQ ID NO: 21 :CP55_V5A_1
[0618] CAATTGCTACTTCTCGGCGGGCTGCCTCAGTTTTG
[0619] SEQ ID NO: 22: CP55_V5A_2
[0620] CAAAACTGAGGCAGCCCGCCGAGAAGTAGCAATTG
[0621] SEQ ID NO: 23: CP55_G6A_1
[0622] GCTACTTCTCGGTGGCCTGCCTCAGTTTTGG
[0623] SEQ ID NO: 24: CP55_G6A_2
[0624] CCAAAACTGAGGCAGGCCACCGAGAAGTAGC
[0625] SEQ ID NO: 25: CP55_Y2W_1
[0626] GCAGCCCACCGAGAACCAGCAATTGTGGGCGA
[0627] SEQ ID NO: 26: CP55_Y2W_2
[0628] TCGCCCACAATTGCTGGTTCTCGGTGGGCTGC
[0629] SEQ ID NO: 27: ICmut_1
[0630] AAGACCTTAATGCTCTGCTAGCCAATGGGGCGATCG SEQ ID NO: 28: ICmut_2
[0631] AGCAGAGCATTAAGGTCTTGGGGAAGACCAATATCAAATATTCTTTGC
[0632] SEQ ID NO: 29: INmut_1
[0633] GCTGCCTCTGACGCCCGCTTTTTAACCACCGATTATCAACTGTTG
[0634] SEQ ID NO: 30: INmut_2
[0635] GGCGTCAGAGGCAGCTCGGATTACTGAGCCATCTTCCAATTCATATTC
[0636] SEQ ID NO: 31 : candidate #259
[0637] CYYSVG
[0638] SEQ ID NO: 32: candidate #404
[0639] CYWTVG
[0640] SEQ ID NO: 33: candidate #9
[0641] CYWAVS
[0642] SEQ ID NO: 34: candidate #63
[0643] CYYAVS
[0644] SEQ ID NO: 35: candidate #309
[0645] CWWDFV
[0646] SEQ ID NO: 36: candidate # 376
[0647] CWWECV
[0648] SEQ ID NO: 37: candidate #306
[0649] CWWDAV
[0650] SEQ ID NO: 38: candidate #270
[0651] CWWDW
[0652] SEQ ID NO: 39: candidate #196
[0653] CWYDIV SEQ ID NO: 40: candidate #197
[0654] CWYDVV
[0655] SEQ ID NO: 41 : candidate #8
[0656] CWFDWV
[0657] SEQ ID NO: 42: candidate #90
[0658] CWRDFV
[0659] SEQ ID NO: 43: candidate #38
[0660] CWADTV
[0661] SEQ ID NO: 44: candidate #88
[0662] CWLDSI
[0663] SEQ ID NO: 45: candidate # 305
[0664] CWADSL
[0665] SEQ ID NO: 46: candidate #65
[0666] CWLESL
[0667] SEQ ID NO: 47: candidate #286
[0668] CWVDMC
[0669] SEQ ID NO: 48: candidate #351
[0670] CWWGTL
[0671] SEQ ID NO: 49: candidate #159
[0672] CWWMTV
[0673] SEQ ID NO: 50: candidate #74
[0674] CWWGGV SEQ ID NO: 51 : candidate #219
[0675] CWWGVM
[0676] SEQ ID NO: 52 : candidate #374
[0677] CWVGST
[0678] SEQ ID NO: 53 : candidate #410
[0679] CWMGTT
[0680] SEQ ID NO: 54 : candidate #82
[0681] CWVGTM
[0682] SEQ ID NO: 55 : candidate #211
[0683] CWVGFT
[0684] SEQ ID NO: 56 : candidate #10
[0685] CWVTST
[0686] SEQ ID NO: 57 : candidate #372
[0687] CWVISA
[0688] SEQ ID NO: 58 : candidate #294
[0689] CWVVTA
[0690] SEQ ID NO: 59 : candidate #182
[0691] CWVLSS
[0692] SEQ ID NO: 60 : candidate #269
[0693] CWIGGT
[0694] SEQ ID NO: 61 : candidate #189
[0695] CWIGCA
[0696] SEQ ID NO: 62: candidate #194
[0697] CWAGVV SEQ ID NO: 63: candidate #312
[0698] CWWRTV
[0699] SEQ ID NO: 64: candidate #42
[0700] CWFRSV
[0701] SEQ ID NO: 65: candidate #29
[0702] CYRRLF
[0703] SEQ ID NO: 66: candidate #121
[0704] CWMRRV
[0705] SEQ ID NO: 67: candidate # 45
[0706] CWWATV
[0707] SEQ ID NO: 68: candidate #56
[0708] CWWNTL
[0709] SEQ ID NO: 69: candidate #84
[0710] CWYNTL
[0711] SEQ ID NO: 70: candidate #220
[0712] CWLSNL
[0713] SEQ ID NO: 71 : candidate #299
[0714] CWAGNL
[0715] SEQ ID NO: 72: candidate #48
[0716] CWYTQV
[0717] SEQ ID NO: 73: candidate #174
[0718] CWAFSL SEQ ID NO: 74: candidate #81
[0719] CWVFSA
[0720] SEQ ID NO: 75: candidate #154
[0721] CWRFSL
[0722] SEQ ID NO: 76: candidate #73
[0723] CWIWSL
[0724] SEQ ID NO: 77: candidate #391
[0725] CWTYSL
[0726] SEQ ID NO: 78: candidate #106
[0727] CWTTSV
[0728] SEQ ID NO: 79: candidate #52
[0729] CWVVWH
[0730] SEQ ID NO: 80: candidate #36
[0731] CWFYSS
[0732] References
[0733] Baradaran-Heravi, A., A. D. Balgi, C. Zimmerman, K. Choi, F. S. Shidmoossavee, J. S. Tan, C. Bergeaud, A. Krause, S. Flibotte, Y. Shimizu, H. J. Anderson, V. Mouly, E. Jan, T. Pfeifer, J. B.174 Jaquith and M. Roberge (2016). "Novel small molecules potentiate premature termination codon readthrough by aminoglycosides." Nucleic Acids Res 44(14): 6583-6598
[0734] Birkmose N, Frydendahl Ell, Knudsen CR. Optimized Construction of a Yeast SICLOPPS Library for Unbiased In Vivo Selection of Cyclic Peptides. Biochemistry. 2024 Dec 17;63(24):3273-3286. doi: 10.1021 / acs.biochem.4c00013.
[0735] Ding, Y., M. Q. Xu, I. Ghosh, X. Chen, S. Ferrandon, G. Lesage and Z. Rao (2003). "Crystal structure of a mini-intein reveals a conserved catalytic module involved in side chain cyclization of asparagine during protein splicing." J Biol Chem 278(40): 39133- 39142.
[0736] Ghelfi, M. D., S. Y. Bhat, H. Li and B. S. Cooperman (2023). "A High-Throughput Assay for In Vitro Determination of Release Factor-Dependent Peptide Release from a Pretermination Complex by Fluorescence Anisotropy-Application to Nonsense Suppressor Screening and Mechanistic Studies." Biomolecules 13(2).
[0737] Ghosh, I., L. Sun and M. Q. Xu (2001). "Zinc inhibition of protein trans-splicing and identification of regions essential for splicing and association of a split intein*." J Biol Chem 276(26): 24051-24058
[0738] Hoek, T. A., D. Khuperkar, R. G. H. Lindeboom, S. Sonneveld, B. M. P. Verhagen, S. Boersma, M. Vermeulen and M. E. Tanenbaum (2019). "Single-Molecule Imaging Uncovers Rules Governing Nonsense-Mediated mRNA Decay." Mol Cell 75(2): 324- 339.e311.
[0739] Huang, S., A. Bhattacharya, M. D. Ghelfi, H. Li, C. Fritsch, D. M. Chenoweth, Y. E. Goldman and B. S. Cooperman (2022). "Ataluren binds to multiple protein synthesis apparatus sites and competitively inhibits release factor-dependent termination." Nat Commun 13(1): 2413
[0740] Kritzer, J. A., S. Hamamichi, J. M. McCaffery, S. Santagata, T. A. Naumann, K. A. Caldwell, G. A. Caldwell and S. Lindquist (2009). "Rapid selection of cyclic peptides that reduce alphasynuclein toxicity in yeast and animal models." Nat Chem Biol 5(9): 655-663.
[0741] Liu, H. and J. H. Naismith (2008). "An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol." BMC Biotechnol 8: 91.
[0742] Mort, M., D. Ivanov, D. N. Cooper and N. A. Chuzhanova (2008). "A meta-analysis of nonsense mutations causing human genetic disease." Hum Mutat 29(8): 1037-1047. Ng, M. Y., H. Li, M. D. Ghelfi, Y. E. Goldman and B. S. Cooperman (2021). "Ataluren and aminoglycosides stimulate read-through of nonsense codons by orthogonal mechanisms." Proc Natl Acad Sci II S A 118(2).
[0743] Ng, M. Y., H. Zhang, A. Weil, V. Singh, R. Jamiolkowski, A. Baradaran-Heravi, M. Roberge, A. Jacobson, W. Friesen, E. Welch, Y. E. Goldman and B. S. Cooperman (2018). "New in Vitro Assay Measuring Direct Interaction of Nonsense Suppressors with the Eukaryotic Protein Synthesis Machinery." ACS Med Chem Lett 9(12): 1285- 1291
[0744] Pranke, I., A. Golec, A. Hinzpeter, A. Edelman and I. Sermet-Gaudelus (2019). "Emerging Therapeutic Approaches for Cystic Fibrosis. From Gene Editing to Personalized Medicine." Front Pharmacol 10: 121.
[0745] Ramesh, S., T. Govender, H. G. Kruger, F. Albericio and B. G. de la Torre (2016). "An improved and efficient strategy for the total synthesis of a colistin-like peptide." Tetrahedron Letters 57(17): 1885-1888
[0746] Tavassoli, A. and S. J. Benkovic (2007). "Split-intein mediated circular ligation used in the synthesis of cyclic peptide libraries in E. coli." Nat Protoc 2(5): 1126-1133.
[0747] Wu, C., B. Roy, F. He, K. Yan and A. Jacobson (2020). "Poly(A)-Binding Protein Regulates the Efficiency of Translation Termination." Cell Rep 33(7): 108399
[0748] Wu, H., Z. Hu and X. Q. Liu (1998). "Protein trans-splicing by a split intein encoded in a split DnaE gene of Synechocystis sp. PCC6803." Proc Natl Acad Sci U S A 95(16): 9226-9231
[0749] Zhang, H., M. Y. Ng, Y. Chen and B. S. Cooperman (2016). "Kinetics of initiating polypeptide elongation in an IRES-dependent system." Elife 5.
Claims
Claims1 . A cyclic peptide having the general formula CX1X2X3X4X5, wherein the peptide is cyclized via a peptide bond formed between the N-terminal amino group of C and the C-terminal carboxyl group of X5 and whereinXi is a canonical aromatic amino acid;X2 is a canonical hydrophobic, a canonical polar uncharged amino acid, a canonical aromatic amino acid or arginine;X3 is a canonical negatively charged amino acid, a canonical polar uncharged amino acid, a canonical hydrophobic amino acid, glycine or arginine;X4 is a canonical hydrophobic, a canonical polar uncharged amino acid, a canonical positively charged amino acid, cysteine, glycine or glutamic acid; and X5 is glycine, a canonical hydrophobic amino acid, or a canonical polar uncharged amino acid a canonical aromatic amino acid or cysteine.
2. The cyclic peptide according to claim 1 , wherein Xi is selected from the group consisting of F, W and Y, preferably W and Y.
3. The cyclic peptide according to any one of the preceding claims, wherein X2 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N and Q, preferably S, I and F.
4. The cyclic peptide according to any one of the preceding claims, wherein X3 is selected from the group consisting of D, E, S, T, N, Q, G, R, A, and L, preferably D, S and G.
5. The cyclic peptide according to any one of the preceding claims, wherein X4 is selected from the group consisting of A, I, L, M, F, W, Y, V, S, T, N, Q, E, and C, preferably S, M and V.
6. The cyclic peptide according to any one of the preceding claims, wherein X5 is selected from the group consisting of V, A, G, I, S, and T, preferably V, A, and G.
7. The cyclic peptide according to any one of the preceding claims, wherein the cyclic peptide is selected from the group consisting of: CWSDSV (SEQ ID NO: 1), CWIGMA (SEQ ID NO: 2), CYFSVG (SEQ ID NO: 3), CWFQEV (SEQ ID NO: 5), CWYRSV (SEQ ID NO: 6), CWLGTI (SEQ ID NO: 7), CWVGSS (SEQ ID NO: 8), CWFATV (SEQ ID NO: 9) and CWFLCT (SEQ ID NO: 10).
8. The cyclic peptide according to any claim 1, wherein the cyclic peptide is selected from the group consisting of: CYYSVG (SEQ ID NO: 31), CYFSVG (SEQ ID NO: 3), CYWTVG (SEQ ID NO: 32), CYWAVS (SEQ ID NO: 33) and CYYA S (SEQ ID NO: 34).
9. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWWDFV (SEQ ID NO: 35), CWWECV (SEQ ID NO: 36), CWWDAV (SEQ ID NO: 37), CWWDVV (SEQ ID NO: 38), CWYDIV (SEQ ID NO: 39), CWYDVV (SEQ ID NO: 40), CWFDWV (SEQ ID NO: 41) and CWRDFV (SEQ ID NO: 42).
10. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWADTV (SEQ ID NO: 43), CWLDSI (SEQ ID NO: 44), CWADSL (SEQ ID NO: 45), CWLESL (SEQ ID NO: 46), CWVDMC (SEQ ID NO: 47) and CWSDSV (SEQ ID NO: 1).
11. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWWGTL (SEQ ID NO: 48), CWWMTV (SEQ ID NO: 49), CWWGGV (SEQ ID NO: 50) and CWWGVM (SEQ ID NO: 51).
12. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWVGST (SEQ ID NO: 52), CWVGSS (SEQ ID NO: 8), CWMGTT (SEQ ID NO: 53), CWVGTM (SEQ ID NO: 54), CWVGFT (SEQ ID NO: 55), CWLGTI (SEQ ID NO: 7), CWVTST (SEQ ID NO: 56), CWVISA (SEQ ID NO: 57), CWVVTA (SEQ ID NO: 58) and CWVLSS (SEQ ID NO: 59).
13. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWIGGT (SEQ ID NO: 60), CWIGMA (SEQ ID NO: 2), CWIGCA (SEQ ID NO: 61) and CWAGVV (SEQ ID NO: 62).
14. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWWRTV (SEQ ID NO: 63), CWFRSV (SEQ ID NO: 64), CYRRLF (SEQ ID NO: 65) and CWMRRV (SEQ ID NO: 66).
15. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWWATV (SEQ ID NO: 67), and CWFATV (SEQ ID NO: 9).
16. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWWNTL (SEQ ID NO: 68), CWYNTL (SEQ ID NO: 69), CWLSNL (SEQ ID NO: 70), CWAGNL (SEQ ID NO: 71), CWYTQV (SEQ ID NO; 72) and CWFQEV (SEQ ID NO 5).
17. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWAFSL (SEQ ID NO: 73), CWVFSA (SEQ ID NO: 74), CWRFSL (SEQ ID NO: 75), and CWIWSL (SEQ ID NO: 76).
18. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: and CWTYSL (SEQ ID NO: 77) and CWTTSV (SEQ ID NO: 78).
19. The cyclic peptide according to claim 1 , whereinXi is tryptophane;X2 is valine;X3 is valine;X4 is tryptophane; andX5 is histidine.
20. The cyclic peptide according to claim 1 , wherein the cyclic peptide is selected from the group consisting of: CWFYSS (SEQ ID NO: 80) and CWFLCT (SEQ ID NO: 10).
21. The cyclic peptide according to any one of the preceding claims, wherein the cyclic peptide promotes translation readthrough of one or more premature termination codons.
22. The cyclic peptide according to claim 21, wherein the premature termination codon is an amber (UAG), opal (UGA) or ochre (UAA) stop codon.
23. The cyclic peptide according to any one of the preceding claims, wherein the cyclic peptide binds to a ribosome to promote translation readthrough.
24. The cyclic peptide according to any one of the preceding claims, wherein the cyclic peptide reduces nonsense-mediated decay (NMD).
25. The cyclic peptide according to any one of the preceding claims, wherein the cyclic peptide binds to A-site of a ribosome.
26. The cyclic peptide according to any one of the preceding claims, wherein said cyclic peptide is capable of promoting incorporation of a canonical amino acid at a premature termination codon, whereby the cyclic peptide reduces the production of a truncated protein in a cell at least 0.1%, such as at least 0.5%, such as at least 1%, such as at least 10%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 50%.
27. The cyclic peptide according to any one of the preceding claims, wherein the cyclic peptide is not cytotoxic.
28. Use of a cyclic peptide according to any of claims 1 to 27 in a method of expressing a gene product.
29. The cyclic peptide according to any one of claims 1 to 27 for use in the treatment, prevention or management of a disease, disorder or condition associated with a decrease of expression of a gene resulting from a premature termination codon.
30. The cyclic peptide according to any one of claims 1 to 27 for use in the treatment, prevention or management of a disease, disorder or condition selected from the group consisting of an autoimmune disease, a chronic inflammatory disease, systemic inflammatory response syndrome, a genetic condition, an eye disorder, a lysosomal storage disease, a skin disease, a bleeding disorder, a neurological disorder, muscular dystrophies, cardiovascular diseases, connective tissue disorders, diseases of the urinary system, lung diseases, blood diseases, diseases of the digestive system, mental disorders, diseases involving cognitive impairment or memory deficits and cancer.
31. The cyclic peptide for use according to claim 30, wherein the genetic condition is Duchenne muscular dystrophy or cystic fibrosis.
32. A method of expressing in a cell a functional gene product encoded by a gene containing a premature termination codon, the method comprising: a. Providing a cell carrying a gene with said premature termination codon; and b. Transfecting and / or transducing said cell with a cyclic peptide according to any one of claims 1 to 27 or nucleic acid encoding same.
33. The method according to claim 32, wherein the method is an in vitro method, an ex vivo method, or a non-therapeutic method.