Genomic editing methods to treat cardiovascular disease, and compositions for use in practicing the same

Abstract

Methods of editing one or more cardiovascular disease implicated genomic regions of a cell are provided. Aspects of the methods include introducing into a cell: a HyperCas12 nuclease or nucleic acid encoding the same; and a gRNA comprising two or more targeting sequences to edit the one or more cardiovascular disease implicated genomic regions of the cell. Also provided are compositions for practicing embodiments of the methods. The methods and compositions find use in a variety of different applications, including treatment of cardiovascular disease.

Description

[0001] ATTY DKT NO: RENA-002WO GENOMIC EDITING METHODS TO TREAT CARDIOVASCULAR DISEASE, AND COMPOSITIONS FOR USE IN PRACTICING THE SAME CROSS-REFERENCE TO RELATED APPLICATION Pursuant to 35 U.S.C. § 119 (e), this application claims priority to the filing date of United States Provisional Patent Application Serial No.63 / 639,309 filed April 26, 2024, the disclosure of which application is incorporated herein by reference in its entirety. FIELD The present invention relates to the field of multiplex genome editing therapeutics with and without circular crRNA arrays and targeted, minimally-immunogenic nucleic acid delivery to treat atherosclerotic disease. BACKGROUND OF THE DISCLOSURE Genome engineering holds great promise in the treatment of human disease. In the span of approximately 10 years from discovery, the first genome editing therapeutic was approved by the United States Food and Drug Administration, a testament to the potential of this therapeutic class. Given the breadth of human disease that arises from genetic mutations, the ability to correct these mutations offers the hope of potentially curative therapeutics. Cardiovascular disease (CVD) is the number one cause of death in the United States, and CVD is a complication of atherosclerosis. Atherosclerosis refers to the buildup of atherosclerotic plaques in the wall of blood vessels. Plaques are caused by cholesterol, fat, and blood cells and other substances that accumulate in the arterial walls, narrowing them. Atherosclerosis can affect most of the arteries in the body, including the brain, heart, extremities, pelvis, kidneys, and more. A variety of diseases results from atherosclerosis including but not limited to coronary artery disease (CAD), peripheral artery disease (PAD), carotid artery disease, renal artery stenosis, aortic stenosis, vertebral artery disease, mesenteric artery ischemia and more. (source: NIH website, accessed Jan 14, 2024). FH is a genetic disorder that affects approximately 1 in 250 people and increases the risk of cardiovascular disease at a young age. FH is caused by inherited mutations in several genes, including but not limited to LDLR, APOB, LDLRAP1, and PCSK9. Mutations in one of these 4 ATTY DKT NO: RENA-002WO genes are responsible for causing disease in most patients. Patients that have mutations in both copies of their gene develop homozygous FH, with a more severe phenotype. This typically results in LDL levels > 500 mg / dL prior to treatment, with untreated patients developing atherosclerosis prior to age 20 and infrequently surviving beyond the age of 30 without treatment. Homozygous FH occurs in approximately 1 in 300,000 people. (Cuchel M et al. Homozygous familial hypercholesterolemia: new insights and guidance for clinicians to improve detection and clinical management. A position paper from the Consensus Panel on Familial Hypercholesterolaemia of the European Atherosclerosis Society. Eur Heart J.2014; 35(32):2146-2157) A key driver in atherosclerosis development is high levels of low-density lipoprotein cholesterol (LDL-C, referred interchangeably as LDL-C or LDL throughout). It is well understood that lowering LDL confers a protective risk against ASCVD and atherosclerosis, and consequently, patients with high levels of LDL receive chronic, repeated treatments to lower LDL and decrease their risk of severe complications from ASCVD. Some patients have a genetic predisposition to elevated LDL. Certain genes have been implicated in elevated levels of LDL-C, including proprotein convertase subtilisin / kexin type 9 (PCSK) gene and angiopoietin-like-3 (ANGPTL3) gene. The PCSK9 gene, also known as proprotein convertase subtilisin / kexin type 9, is located on chromosome 1p32.3. It spans approximately 22 kilobases (kb) in length and consists of 12 exons. The PCSK9 gene encodes a protein involved in the regulation of cholesterol levels in the blood by promoting the degradation of low-density lipoprotein receptors (LDLRs). Monoclonal anti PCSK9 antibodies are FDA approved and demonstrate LDL lowering. Genomic editing of PCSK9 alone has been shown, in humans and non-human primates (NHPs) to durably lower LDL-C. The gene encoding angiopoietin-like 3 (ANGPTL3) is called ANGPTL3, and it is located on chromosome 1p31.1. The ANGPTL3 gene spans approximately 22.3 kilobases (kb) in length. It contains 7 exons and encodes a protein that plays a critical role in lipid metabolism by inhibiting lipoprotein lipase (LPL) and endothelial lipase (EL), thereby regulating triglyceride and cholesterol levels in the blood. Mutations in the ANGPTL3 gene have been associated with familial combined hypolipidemia and may influence susceptibility to cardiovascular diseases. Results from phase 3 clinical trials with a monoclonal anti-ANGPTL3 antibody (evinacumab) and clinical trial data from anti-sense oligonucleotide (ASO) clearly show significant lipid lowering. Genomic editing of ANGPTL3 alone in non-human primates to durably lower LDL-C. ATTY DKT NO: RENA-002WO An independent risk factor of ASCVD is elevated levels of lipoprotein a (Lp(a)). Lp(a) consists of a lipid-rich domain, primarily cholesteryl esters, and apolipoprotein (a). The gene encoding Lp(a) is called LPA, and it is located on chromosome 6q25.3. The length of the LPA gene varies depending on the specific isoform, but it typically spans several kilobases (kb) in length. Epidemiological, genome-wide association, and Mendialian randomization data provide clear support for a causal role for elevated Lp(a) in the development of ASCVD. (Reyes-Soffer G, et al. Lipoprotein(a): A genetically determined, causal, and prevalent risk factor for atherosclerotic cardiovascular disease: a scientific statement from the American heart association. Arteriosclerosis, thrombosis, and vascular biology.2022;42:e48-e60). Some patients with FH also exhibit elevated levels of Lp(a). There are currently no approved therapeutics to lower Lp(a), despite the known association of elevated Lp(a) and ASCVD. Apolipoprotein CIII‚ encoded by APOC3, is an endogenous inhibitor of lipoprotein lipase (LPL) that is transported on triglyceride-rich lipoproteins. The APOC3 gene is located on chromosome 11q23.1 and spans approximately 3.5 kilobases (kb) in length. LoF variants in APOC3 are proven to reduce triglyceride levels (through increased LPL activity) and provide protection against ASCVD (Stankov S et al. Gain-of-function variants in lipid genes enhance biological insight and point toward therapeutic opportunities. Circulation.2022;146:740-742). A genomic editing therapeutic targeting APOC3 would lower triglyceride levels. Apolipoprotein B (APOB) is a critical structural protein of the atherogenic lipoproteins. It plays multiple roles in regulating lipid metabolism and is considered to be a physiologically relevant measure of the actual number of atherogenic lipid particles. APOB levels indicate the atherogenic particle concentration independent of the particle cholesterol content. There is evidence to suggest that APOB is a more accurate indicator of the cardiovascular risk than either total cholesterol or LDL cholesterol. Measurement of serum apoB reflects total LDL-C, intermediate density lipoproteins (IDL-C), VLDL-C, and lipoprotein(a) (Lp(a)) particle concentrations because each particle contains exactly one molecule of apoB100. ApoB is encoded by the APOB gene and occurs in two forms: full-length apoB100, consisting of 4536 amino acids; and apoB48, a truncated form consisting of the N-terminal 2152 amino acids. Given the high rates of morbidity and mortality secondary to ASCVD, better therapeutics are needed to improve patient outcomes. A safe, effective gene editing therapeutic could potentially ATTY DKT NO: RENA-002WO reduce LDL and / or Lp(a), ApoB, and / or triglycerides, providing a potentially curative therapeutic following a single administration. Achieving this goal requires development of a genome editing therapeutic that can be delivered in vivo and simultaneously edit multiple genes. This therapeutic would have the potential to not only prevent progression of ASCVD, but also to potentially reverse the progression of atherosclerotic disease through the lowering of LDL, Lp(a), and triglycerides. SUMMARY Methods of editing one or more cardiovascular disease implicated genomic regions of a cell are provided. Aspects of the methods include introducing into a cell: a HyperCas12 nuclease or nucleic acid encoding the same; and a gRNA comprising two or more targeting sequences to edit the one or more cardiovascular disease implicated genomic regions of the cell. Also provided are compositions for practicing embodiments of the methods. The methods and compositions find use in a variety of different applications, including treatment of cardiovascular disease. Provided herein are compositions and methods of use of genome editing therapeutics designed to edit polynucleotides or target genes to treat atherosclerosis and cardiovascular disease (CVD), including but not limited to patients who are diagnosed with atherosclerotic cardiovascular disease (ASCVD) and familial hypercholesterolemia (FH). The compositions and components described herein are understood to be separate aspects of the inventive subject matter. The field of genomic engineering utilizes bacterial endonuclease systems that evolved to offer protection against DNA viruses and plasmids. Numerous endonuclease proteins have been discovered, with several translated into human genome engineering applications. The most frequently used endonuclease for human therapeutics is Cas9. Cas9 is a 160 kilodalton dual RNA-guided DNA endonuclease enzyme associated with Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) adaptive immune system in Streptococcus pyogenes. In bacteria, this protein cleaves foreign DNA to protect the bacterial cell. Cas9 is the industry leading endonuclease platform for genomic editing, with excellent editing efficiencies and acceptably low off-target editing effects. However, Cas9 lacks intrinsic RNase activity to process guide RNA. As such, CRISPR-Cas9 systems are typically delivered with a single guide RNA targeting a single gene. To enable multiplexing, or modifying 2 or more genetic targets, Cas9 ATTY DKT NO: RENA-002WO therapeutics would require simultaneous delivery of 2 or more separate guide RNAs. This creates unique drug chemistry, manufacturing and controls (CMC) challenges. In addition, regulatory approval of a therapeutic delivered with multiple individual guide RNAs is more complicated. Consequently, multiplexing applications with Cas9 therapeutics are typically limited to ex vivo therapeutics, where a cell can be processed sequentially with different guide RNAs. In vivo therapeutic programs almost exclusively target a single gene. The Cas12 endonuclease is better equipped to multiplex in that it possesses intrinsic RNA endonuclease activity. As such, Cas12 can cleave a single crispr RNA (crRNA) into multiple guide RNAs after delivery into a cell. However, Cas12 editing efficiencies lag behind Cas9, limiting enthusiasm for their clinical application. To address this, an enhanced Cas12 (enCas12) was developed, however, its editing remained inferior to Cas9. More recently a novel hyper- efficient Cas12 (hyperCas12) was developed via structure-guided protein engineering. Published PCT application Publication No. WO2022174108A1 is hereby incorporated in its entirety by reference. HyperCas12, consisting of 4 mutations (D156R, D235R, E292R, and D350R), has shown significantly improved editing efficiencies, superior to wild type Cas12 and similar to Cas9, with comparable low off target effects. HyperCas12 is therefore an ideal candidate CRISPR enzyme to use for in vivo genomic editing therapeutics, including for the treatment of atherosclerotic and cardiovascular disease. Provided herein, among others, is a composition comprising an engineered codon optimized CRISPR-associated (Cas) 12 mRNA, (hyperCas12) with crRNA designed to target genes in the liver that durably lower LDL-C and Lp(a) thereby treating atherosclerosis, CVD, and ASCVD. In some embodiments, the crRNA is a circular RNA array. In some embodiments, the composition lowers LDL-C, Lp(a), APOC3, ApoB and triglycerides. In some embodiments the composition lowers LDL-C and Lp(a) via genome editing. In some embodiments the composition lowers LDL-C and Lp(a) via base editing. In some embodiments the composition lowers LDL-C and Lp(a) via gene repression. In some embodiments the composition lowers LDL-C and Lp(a) via prime editing. In some embodiments the composition lowers LDL-C, Lp(a) and triglycerides via genome editing. In some embodiments the composition lowers LDL-C, Lp(a) and triglycerides via base editing. In some embodiments the composition lowers LDL-C, Lp(a) and triglycerides via gene ATTY DKT NO: RENA-002WO repression. In some embodiments the composition lowers LDL-C, Lp(a) and triglycerides via prime editing. In some embodiments, the composition lowers LDL-C, Lp(a), triglycerides, and ApoB via genome editing. In some embodiments, the composition lowers LDL-C, Lp(a), triglycerides, and ApoB via base editing. In some embodiments, the composition lowers LDL-C, Lp(a), triglycerides, and ApoB via gene repression. In some embodiments, the composition lowers LDL-C, Lp(a), triglycerides, and ApoB via prime editing. In some embodiments the composition lowers LDL-C via genome editing. In some embodiments the composition lowers LDL-C via base editing. In some embodiments the composition lowers LDL-C via gene repression. In some embodiments the composition lowers LDL-C via prime editing. In some embodiments the composition lowers Lp(a) via genome editing. In some embodiments the composition lowers Lp(a) via base editing. In some embodiments the composition lowers Lp(a) via gene repression. In some embodiments the composition lowers Lp(a) via prime editing. In some embodiments the composition lowers triglycerides via genome editing. In some embodiments the composition lowers triglycerides via base editing. In some embodiments the composition lowers triglycerides via gene repression. In some embodiments the composition lowers triglycerides via prime editing. Provided herein are compositions and methods for editing the PCSK9 gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single nucleotide changes, single-strand breaks (SSB), or double-strand breaks (DSB) within or near the PCSK9 gene or PCSK9 regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the PCSK9 gene, thereby reducing or eliminating the function of the PCSK9 gene. Provided herein are compositions and methods for editing the ANGPTL3 gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic ATTY DKT NO: RENA-002WO acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single nucleotide changes, single-strand breaks (SSB), or double-strand breaks (DSB) within or near the ANGPTL3 gene or ANGPTL3 regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the ANGPTL3 gene, thereby reducing or eliminating the function of the ANGPTL3 gene. Provided herein are compositions and methods for editing the Lp(a) gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single nucleotide changes, single-strand breaks (SSB), or double-strand breaks (DSB) within or near the Lp(a) gene or Lp(a) regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the Lp(a) gene, thereby reducing or eliminating the function of the Lp(a) gene. Provided herein are compositions and methods for editing the APOC3 gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (e.g., hyperCas12) along with one or more crRNA(s) to cause one or more single nucleotide changes, single-strand breaks (SSB), or double-strand breaks (DSB) within or near the APOC3 gene or APOC3 regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the APOC3 gene, thereby reducing or eliminating the function of the APOC3 gene. Provided herein are compositions and methods for editing the APOB gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (e.g., hyperCas12) along with one or more crRNA(s) to cause one or more single nucleotide changes, single-strand breaks (SSB), or double-strand breaks (DSB) within or near the APOB gene or APOB regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the APOB gene, thereby reducing or eliminating the function of the APOB gene. Provided herein are compositions and methods for editing the PCSK9 and ANGPTL3 genes in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (e.g., hyperCas12) along with one or more crRNA(s) to cause one or more single nucleotide changes, single-strand breaks (SSB), or ATTY DKT NO: RENA-002WO double-strand breaks (DSB) within or near the PCSK9 and ANGPTL3 genes or their regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the PCSK9 and ANGPTL3 genes, thereby reducing or eliminating their function. Provided herein are composition and methods for editing the PCSK9, ANGPTL3, and Lp(a) genes in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single nucleotide changes, single-strand breaks (SSB), or double-strand breaks (DSB) within or near the PCSK9, ANGPTL3, and Lp(a) genes or their regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near these genes, thereby reducing or eliminating their respective functions. Provided herein are compositions and methods for editing the PCSK9, ANGPTL3, Lp(a), and APOC3 genes in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (e.g., hyperCas12) along with one or more crRNA(s) to cause one or more single nucleotide changes, single-strand breaks (SSB), or double-strand breaks (DSB) within or near the PCSK9, ANGPTL3, Lp(a), and APOC3 genes or their regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the PCSK9, ANGPTL3, Lp(a), and APOC3 genes, thereby reducing or eliminating their function. Provided herein are compositions and methods for editing the PCSK9, ANGPTL3, Lp(a), APOB, and APOC3 genes in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (e.g., hyperCas12) along with one or more crRNA(s) to cause one or more single nucleotide changes, single-strand breaks (SSB), or double-strand breaks (DSB) within or near the PCSK9, ANGPTL3, Lp(a), APOB, and APOC3 genes or their regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the PCSK9, ANGPTL3, Lp(a), APOB, and APOC3 genes, thereby reducing or eliminating their function. Delivering nucleic acid therapeutics to the tissue of interest is challenging. Many of these challenges have been eloquently addressed through the generation of non-replicating viral ATTY DKT NO: RENA-002WO vectors including AAV, lentivirus, HSV-1 and others. However, there are some limitations for these vectors, and other vectors have also been described to deliver nucleic acids. Lipid nanoparticles (LNPs) have proven to be an effective delivery agent for nucleic acid therapeutics. As highlighted by the global success of the mRNA COVID-19 vaccination campaign, LNPs have now been used to deliver mRNA into hundreds of millions of patients worldwide. LNPs can target multiple organs, including the liver. Because LNPs can carry larger payloads and are preferentially taken up by the liver, a minimally immunogenic LNP is one of several ideal carriers for a liver-targeting, atherosclerosis treating genome editing therapeutic. Other non-limiting carrier options for nucleic acid therapeutics include virus like particles and nucleosome-core proteins. Also described herein are components, compositions, and vectors for performing these methods. Citation or identification of any document in this application is not an admission that such document is available as prior art to the present invention. BRIEF DESCRIPTION OF THE FIGURES FIGS.1A-1B provide representative cRNA targeting for PCSK9. FIG.1A shows SEQ ID NOs: 47-101. FIG.1B shows SEQ ID NOs: 102-158. FIGS.1C-1E provide representative cRNA targeting for ANGPTL3. FIG.1C shows SEQ ID NOs: 159-213. FIG.1D shows SEQ ID NOs: 214-271. FIG.1E shows SEQ ID NOs: 272-288. FIGS.1F-1H provide representative cRNA targeting for Lp(a). FIG.1F shows SEQ ID NOs: 289- 337. FIG.1G shows SEQ ID NOs: 338-395. FIG.1H shows SEQ ID NOs: 396-440. FIGS.2A-2B provide exemplary circular crRNA arrays that may be employed in embodiments of the invention. FIGS.3A- 3E provide a summary of an exemplary experiment. FIG.3A) mRNA (either hyperCas12a or eSpCas9) was combined with a variety of guide RNAs, including GFP RNA (negative control), several single guide crRNAs, linear multiplex crRNAs, and circular multiplex crRNA and transfected into primary human hepatocytes. After harvesting cells and collecting DNA, samples were sent for amplicon sequencing. FIG.3B) representative photos of GFP transfection show approximately 40-45% transfection efficiency. FIG.3C) amplicon sequencing ATTY DKT NO: RENA-002WO data showing no editing for negative control (GFP), with editing rates of 40-45% for both PCSK9 and ANGPTL3 targets. Multiplex arrays PA, PAL and PAPA showed low editing rates of ANGPTL3 with negligible PCSCK9 editing. PAcirc showed >40% editing of both PCSK9 and ANGPTL3. FIG.3D) Amplicon sequencing of negative control (no crRNA) shows no editing. FIG.3E) Amplicon sequencing of PAcirc showing representative edits in the target region. FIGS.4-6 depict base editing in PCSK9 using ABE-Cas and ABE-Cas-Nick. FIGS.7-9 depict base editing in ANGPTL3 using ABE-Cas and ABE-Cas-Nick. FIG.10 shows brightfield microscope images of cells right after thawing (left) and 5 hours after thawing before transfection (right). FIGS.11-15 show microscope images of transfection using GFP. Transfection efficiency is >50% for the test GFP mRNA. FIG.11 shows brightfield and fluorescent images of ABE-Cas- GFP 2 days (top) and 3 days (bottom) after transfection. FIG.12 shows brightfield and fluorescent images of ABE-Cas-GFP 2 days (top) and 3 days (bottom) after transfection. FIG. 13 shows brightfield and fluorescent images of ABE-Cas-nick-GFP 2 days (top) and 3 days (bottom) after transfection. FIG.14 shows brightfield and fluorescent images of ABE-Cas-nick- GFP 2 days (top) and 3 days (bottom) after transfection. FIG.15 shows fluorescent images of ABE-Cas-GFP (top) and ABE-Cas-nick-GFP (bottom) 3 days after transfection. FIG.16 shows a gel image of PCR using different primer pairs targeting PCSK9 (left) and ANGPTL3 (right). DEFINITIONS LNP: lipid nanoparticle lipoprotein lipase (LPL) subtilisin / kexin type 9 (PCSK) angiopoietin-like-3 (ANGPTL3) apolipoprotein C-III (APOC3) single-strand breaks (SSB) or double-strand breaks (DSB) Lp(a): Lipoprotein a ribonucleoprotein particle (RNP) CVD: cardiovascular disease FH: familial hypercholesterolemia ASCVD: atherosclerotic cardiovascular disease pDNA: plasmid DNA mRNA: messenger ribonucleic acid ATTY DKT NO: RENA-002WO VLP: virus-like particles CRISPR: clustered regularly interspaced short palindromic repeats CART: Charge-altering releasable transporter As used herein, the term “tissue” refers to one or more aggregates of cells in a subject (e.g., a living organism, such as a mammal, such as a human) that have a similar function and structure or to a plurality of different types of such aggregates. Tissue may include, for example, organ tissue, muscle tissue (e.g., cardiac muscle; smooth muscle; and / or skeletal muscle), connective tissue, ocular conjunctival tissue, nervous tissue and / or epithelial tissue. As used herein, the term “subject” is used interchangeably in this disclosure with the term “patient”. In certain embodiments, a subject is a “mammal” or “mammalian”, where these terms are used broadly to describe organisms which are within the class mammalia, including the orders carnivore (e.g., dogs and cats), rodentia (e.g., mice, guinea pigs, and rats), and primates (e.g., humans, chimpanzees, and monkeys). In some embodiments, subjects are humans. The term “humans” may include human subjects of both genders and at any stage of development (e.g., fetal, neonates, infant, juvenile, adolescent, adult), where in certain embodiments the human subject is a juvenile, adolescent or adult. While the devices and methods described herein may be applied to perform a procedure on a human subject, it is to be understood that the subject devices and methods may also be carried out to perform a procedure on other subjects (that is, in “non-human subjects”). As used herein, the term “cell-penetrating complex” or the like refer, in the usual and customary sense, to a chemical complex (e.g., a complex or composition disclosed herein and embodiments thereof), capable of penetrating into a cell (a biological cell, such as a eukaryotic cell or prokaryotic cell). In some embodiments, the cell-penetrating complex includes a nucleic acid ionically bound to a cationic amphipathic polymer. In some embodiments, the nucleic acid is unable to substantially penetrate the cell in the absence of the cationic amphipathic polymer. Thus, in some embodiments, the cationic amphipathic polymer facilitates the transport of the nucleic acid into the cell. As used herein, the terms “cationic charge altering releasable transporter,” “CART” and the like refer to the cell-penetrating complexes disclosed herein. The CART compounds are able to release the nucleic acid component within the cell through the action of a pH-sensitive immolation domain within the cationic amphipathic polymer component, which reacts in response to an intracellular pH thereby releasing the nucleic acid with in the cell. ATTY DKT NO: RENA-002WO In some embodiments, the cationic amphipathic polymer degrades rapidly within the cell (e.g. a T1 / 2 of less than 6 hours at pH 7.4). At least in some embodiments, a polyplex, a complex, an electrostatic complex, a CART / mRNA complex, a CART / oligonucleotide complex and nanoparticle can interchangeably be used to refer to a cell-penetrating complex. As used herein, the term “initiator” refers to a compound that is involved in a reaction synthesizing a cationic amphipathic polymer having the purpose of initiating the polymerization reaction. Thus, the initiator is typically incorporated at the end of a synthesized polymer. For example, a plurality of molecules of one type (or formula) of monomer or more than one type of monomers (e.g. two different types of monomers) can be reacted with an initiator to provide a cationic amphipathic polymer. The initiator can be present on at least one end of the resulting polymer and not constitute a repeating (or polymerized) unit(s) present in the polymer. As used herein, the term “nucleic acid” refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single -, double - or multiple - stranded form, or complements thereof. The terms "polynucleotide," "oligonucleotide" "oligo” or the like refer, in the usual and customary sense, to a linear sequence of nucleotides. The term “nucleotide” refers, in the usual and customary sense, to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified versions thereof. Examples of polynucleotides contemplated herein include single and double stranded DNA, single and double stranded RNA, and hybrid molecules having mixtures of single and double stranded DNA and RNA. Examples of nucleic acid, e.g. polynucleotides contemplated herein include any types of RNA, e.g. messenger RNA (mRNA), small interference RNA (siRNA), short hairpin RNA (shRNA), circular translating RNA, circular RNA with internal ribosome entry site, circular RNA with micro RNA (miRNA), guide RNA (GRNA), CRISPR RNA (crRNA), transactivating RNA (tracrRNA), plasmid DNA (PDNA), minicircle DNA, genomic DNA (GNDA), and any fragments thereof. The term “duplex” in the context of polynucleotides refers, in the usual and customary sense, to double strandedness. Nucleic acids can be linear or branched. For example, nucleic acids can be a linear chain of nucleotides or the nucleic acids can be branched, e.g., such that the nucleic acids has one or more arms or branches of nucleotides. Multiple nucleotides can be delivered in a single plasmid, including combining different types of nucleotides (eg, a DNA and an RNAi, or any combination of the nucleotides listed above). Optionally, the branched nucleic acids are repetitively branched to form higher ordered structures such as dendrimers and the like. ATTY DKT NO: RENA-002WO Nucleic acids, including e.g., nucleic acids with a phosphothioate backbone, can include one or more reactive moieties. As used herein, the term reactive moiety includes any group capable of reacting with another molecule, e.g., a nucleic acid or polypeptide through covalent, non- covalent or other interactions. By way of example, the nucleic acid can include an amino acid reactive moiety that reacts with an amino acid on a protein or polypeptide through a covalent, non-covalent or other interaction. The terms also encompass nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, include, without limitation, phosphodiester derivatives including, e.g., phosphoramidate, phosphorodiamidate, phosphorothioate (also known as phosphothioate having double bonded sulfur replacing oxygen in the phosphate), phosphorodithioate, phosphonocarboxylic acids, phosphonocarboxylates, phosphonoacetic acid, phosphonoformic acid, methyl phosphonate, boron phosphonate, or O-methylphosphoroamidite linkages (see Eckstein, OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH, Oxford University Press) as well as modifications to the nucleotide bases such as in 5-methyl cytidine or pseudouridine; and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, modified sugars, and non-ribose backbones (e.g. phosphorodiamidate morpholino oligos or locked nucleic acids (LNA) as known in the art), including those described in U.S. Pat. Nos.5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, CARBOHYDRATE MODIFICATIONS IN ANTISENSE RESEARCH, Sanghui & Cook, eds. Nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g., to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. In some embodiments, the internucleotide linkages in DNA are phosphodiester, phosphodiester derivatives, or a combination of both. ATTY DKT NO: RENA-002WO Nucleic acids can include nonspecific sequences. As used herein, the term “nonspecific sequence” refers to a nucleic acid sequence that contains a series of residues that are not designed to be complementary to or are only partially complementary to any other nucleic acid sequence. By way of example, a nonspecific nucleic acid sequence is a sequence of nucleic acid residues that does not function as an inhibitory nucleic acid when contacted with a cell or organism. An “inhibitory nucleic acid” is a nucleic acid (e.g. DNA, RNA, polymer of nucleotide analogs) that is capable of binding to a target nucleic acid (e.g. an mRNA translatable into a protein) and reducing transcription of the target nucleic acid (e.g. mRNA from DNA) or reducing the translation of the target nucleic acid (e.g. mRNA) or altering transcript splicing (e.g. single stranded morpholino oligo). In some embodiments, the nucleic acid is RNA (e.g. mRNA). In some embodiments the nucleic acid is 10 to 100,000 bases in length. In some embodiments the nucleic acid is between 50 and 10,000 bases in length. In some embodiments the nucleic acid is between 50 and 5,000 bases in length. In some embodiments the nucleic acid is between 50 and 1,000 bases in length. As used herein, the term “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues, wherein the polymer may be conjugated to a moiety that does not consist of amino acids. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. The terms apply to macrocyclic peptides, peptides that have been modified with non-peptide functionality, peptidomimetics, polyamides, and macrolactams. A “fusion protein” refers to a chimeric protein encoding two or more separate protein sequences that are recombinantly expressed as a single moiety. As used herein, the term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, γ- carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical ATTY DKT NO: RENA-002WO structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. The terms “non-naturally occurring amino acid” and “unnatural amino acid” refer to amino acid analogs, synthetic amino acids, and amino acid mimetics which are not found in nature. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes. As used herein, the term “gene” refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular gene product after being transcribed, and sometimes also translated. The term “gene” or “coding sequence” refers to a nucleotide sequence in vitro or in vivo that encodes a gene product. In some instances, the gene consists or consists essentially of coding sequence, that is, sequence that encodes the gene product. In other instances, the gene comprises additional, non-coding, sequence. For example, the gene may or may not include regions preceding and following the coding region, e.g.5′ untranslated (5′ UTR) or “leader” sequences and 3′ UTR or “trailer” sequences, as well as intervening sequences (introns) between individual coding segments (exons). As used herein, the term “transgene” refers to an artificial gene, manipulated in the molecular biology laboratory that incorporates all appropriate elements critical for gene expression. Alternatively, a “transgene” is a gene that has been transferred naturally, or by any genetic engineering techniques, from one organism to another. As used herein, the term “CRISPR” refers to bacterial or archaeal systems that target DNA using RNA-guided, DNA-targeting. CRISPR-Cas systems include Class 1 systems that utilize a complex of multiple cas proteins (for example type I, III, IV CRISPR-Cas systems) and Class 2 systems utilizing a single Cas protein (for example, type II, V, and VI CRISPR-Cas systems). In Class 2 systems, the system comprises a) A guide RNA which comprises a guide sequence linked to a direct repeat sequence, wherein the guide sequence is able to hybridize with a target sequence adjacent to a protospacer adjacent motif (PAM), or one or more nucleotide sequences encoding the guide RNA, and ATTY DKT NO: RENA-002WO b) A Cas effector protein or one or more nucleotide sequences encoding a Cas effector protein. As used herein, the term “Cas protein” refers to a variety of Cas proteins, including well-known ones such as Cas9, Cas12a (Cpf1), Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas14, and Cas mini, each with specific functionalities and applications in genome editing and RNA interference. The CRISPR-Cas system is classified into different types and subtypes based on the presence of signature proteins and their functions. In Class 1, the I type involves Cas3, functioning as a single-stranded DNA nuclease with an HD domain, and an ATP- dependent helicase. Subtypes include I-A (Cas8a, Cas5) where Cas8 is a subunit of the interference module crucial for targeting invading DNA and Cas5 is required for processing and stability of crRNAs. Other subtypes include I-B (Cas8b), I-C (Cas8c), I-D (Cas10d with a domain homologous to the palm domain of nucleic acid polymerases and nucleotide cyclases), I-E (Cse1, Cse2), I-F (Csy1, Csy2, Csy3 implicated in CRISPR-associated transposons), and I-G (GSU0054). In Class 3, the III type involves Cas10, a homolog of Cas10d and Cse1, which binds CRISPR target RNA and promotes the stability of the interference complex. Subtypes include III-A (Csm2), III-B (Cmr5), III-C (Cas10 or Csx11), III-D (Csx10), III-E, and III-F. Class 4 includes the IV type with Casf1, and its subtypes IV-A, IV-B, IV-C. In Class 2, the II type involves Cas9, where nucleases RuvC and HNH produce double-strand breaks (DSBs) and single-strand breaks, ensuring functional spacer acquisition during adaptation. Subtypes include II-A (Csn2, a ring-shaped DNA-binding protein involved in primed adaptation), II-B (Cas4, an endonuclease working with cas1 and cas2 to generate spacer sequences), and II-C characterized by the absence of either Csn2 or Cas4. Class 5 involves the V type with Cas12, which lacks HNH, and its subtypes V-A (Cas12a or Cpf1 with auto-processing pre-crRNA activity for multiplex gene regulation), V-B (Cas12b or C2c1), V-C (Cas12c or C2c3), V-D (Cas12d or CasY), V-E (Cas12e or CasX), V-F (Cas12f or Cas14, C2c10), V-G (Cas12g), V-H (Cas12h), V-I (Cas12i), V-K (Cas12k or C2c5 implicated in CRISPR-associated transposons), and V-U (C2c4, C2c8, C2c9). HyperCas12 is also a Class 5 Cas protein. Class 6 includes the VI type with Cas13, an RNA-guided RNase. Subtypes include VI-A (Cas13a or C2c2), VI-B (Cas13b), VI-C (Cas13c), VI-D (Cas13d), VI-X (Cas13x.1, an RNA-dependent RNA polymerase for prophylactic RNA-virus inhibition), and VI-Y. This classification and subtyping provides a non-exhaustive overview of the diversity within the CRISPR-Cas system based on the signature proteins and their specific functions and is not meant to limit to only the Cas proteins listed herein. ATTY DKT NO: RENA-002WO As used herein, the term "CRISPR RNA" or "crRNA" refers to an RNA molecule having a synthetic sequence and typically comprising two sequence components: a spacer sequence and a guide RNA scaffold sequence (also called a "repeat sequence"). These two sequence components can be in a single RNA molecule or in a double-RNA molecule configuration (also known as a duplex guide RNA that comprises both a crRNA and a trans-activating crRNA (tracRNA)). In some instances, the RNA molecule can have a crRNA component only (without a tracrRNA), for example, the RNAs that work with Cas12a. Thus, a crRNA as used herein generally comprises a repeat sequence and a spacer. In some instances, the repeat sequence is referred to as a "crRNA." As used herein, the term “homology-directed repair” or “HDR” refers to a mechanism in cells to accurately and precisely repair double-strand DNA breaks using a homologous template to guide repair. The most common form of HDR is homologous recombination (HR), a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA. As used herein, the term “nonhomologous end joining” or “NHEJ” refers to a pathway that repairs double-strand DNA breaks in which the break ends are directly ligated without the need for a homologous template. As used herein, the term “genome editing” refers to a type of genetic engineering in which DNA is inserted, replaced, or removed from a target DNA, e.g., the genome of a cell, using one or more nucleases and / or nickases. The nucleases may create specific double-strand breaks (DSBs) at desired locations in the genome and harness the cell's endogenous mechanisms to repair the induced break by HDR (e.g., homologous recombination) or by NHEJ. The nickases create specific single-strand breaks at desired locations in the genome. In one non-limiting example, two nickases can be used to create two single strand breaks on opposite strands of a target DNA, thereby generating a blunt or a sticky end. Any suitable nuclease can be introduced into a cell to induce genome editing of a target DNA sequence including, but not limited to, CRISPR-associated protein (Cas) nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, other endo- or exo-nucleases, variants thereof, fragments thereof, and combinations thereof. In particular embodiments, nuclease-mediated genome editing of a target DNA sequence can be “induced” or “modulated” ATTY DKT NO: RENA-002WO (e.g., enhanced) using the modified single guide RNAs (sgRNAs) described herein in combination with Cas nucleases (e.g., Cas12a polypeptides, Cas12a mRNA, hyperCas12a polypeptides, hyperCas12a mRNA), e.g., to improve the efficiency of precise genome editing via HDR or by NHEJ. “Genome editing” also refers to base editing and prime editing. As used herein, the term “Multiplex Genome editing” refers to multiplex editing in which numerous (2 or more) guide RNAs or Cas enzymes are expressed at once. Multiplex editing can result from the delivery of a Cas protein or Cas mRNA along with a single crRNA that is cleaved into multiple gRNAs by the Cas protein, for example, a Cas12 protein. Multiplex editing can result in upregulation, downregulation, or modulation, or silencing of multiple genetic targets. As used herein, the term “HyperCas12a” refers to a Cas12a harboring four mutations (D156R, D235R, E292R and D350R) as shown in SEQ ID NO: 1, a novel codon optimized version of the hyperCas12a described in the published manuscript “Multiplexed genome regulation in vivo with hyper-efficient Cas12a. Nature Cell Biology. Vol 24. April 2022.590-600), the entirety of which is incorporated herein by reference. As used herein, the term “HyperdCas12a” refers to the nuclease-deactivated version of hyperCas12a as shown in SEQ ID NO: 2. As used herein, the term “protospacer” or “target sequence” refers to a nucleic acid sequence that is complementary and binds to the complementary strand of the target gene. A spacer can be within a guide nucleic acid. As used herein, the term “base editing” refers to genetic engineering in which one or more nucleotides are inserted, replaced, or removed from a genome. In some embodiments, a base editor system comprises a (i) a guide polynucleotide (crRNA) or a nucleic acid encoding the same, and (ii) a base editor fusion protein comprising a programmable DNA binding domain and a deaminase, or a nucleic acid encoding the same. As used herein, the term “base editor” refers to an agent that binds to a polynucleotide and has nucleobase modifying activity. A base editor can comprise a nucleic acid programable nucleotide binding domain in conjunction with a deaminase enzyme. The DNA binding domain ATTY DKT NO: RENA-002WO can be fused or linked to a deaminase domain, resulting in a base editor fusion protein, for example an mRNA encoding the base editor fusion protein. Base editors include cytosine base editors, which substitute a cytosine base for a thymine (C->T) or adenine base editors which substitute an adenine for a guanine (A->G). Base editors may comprise proteins or mRNA encoding proteins. As used herein, the term “base editor system” refers to a gene editing system for editing a single nucleobase of a target nucleotide sequence. A base editor system may comprise a polynucleotide programmable nucleotide binding domain (for example, hyperCas12), a deaminase domain, and a guide polynucleotide (example, crRNA). In some embodiments the base editor is an adenine or adenosine base editor (ABE). In some embodiments, the base editor is a cytosine base editor (CBE). In some embodiments, the base editor comprises mRNA. In various embodiments, the base editor comprises a nucleobase modifying polypeptide (e.g., a deaminase) and a polynucleotide programmable nucleotide binding domain in conjunction with a guide polynucleotide (e.g., guide RNA). In various embodiments, the agent is a biomolecular complex comprising a protein domain having base editing activity, i.e., a domain capable of modifying a base (e.g., A, T, C, G, or U) within a nucleic acid molecule (e.g., DNA). In some embodiments, the polynucleotide programmable DNA binding domain is fused or linked to a deaminase domain. In one embodiment, the agent is a fusion protein comprising one or more domains having base editing activity. In another embodiment, the protein domains having base editing activity are linked to the guide RNA (e.g., via an RNA binding motif on the guide RNA and an RNA binding domain fused to the deaminase). In some embodiments, the domains having base editing activity are capable of deaminating a base within a nucleic acid molecule. In some embodiments, the base editor is capable of deaminating one or more bases within a DNA molecule. In some embodiments, the base editor is capable of deaminating a cytosine (C) or an adenosine (A) within DNA. In some embodiments, the base editor is capable of deaminating a cytosine (C) and an adenosine (A) within DNA. In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is an adenosine base editor (ABE). In some embodiments, the base editor is an adenosine base editor (ABE) and a cytidine base editor (CBE). In some embodiments, the base editor is a nuclease-inactive Cas (e.g., dCAS12, dCas9) fused to an adenosine deaminase. In some embodiments, the base editor is fused to an inhibitor of base excision repair, for example, a UGI domain, or a dISN domain. In some embodiments, the fusion protein comprises a Cas (e.g., Cas12) nickase fused to a deaminase and an inhibitor of base excision repair, such as a UGI or dISN domain. In other ATTY DKT NO: RENA-002WO embodiments the base editor is an abasic base editor. Details of base editors are described in International PCT Application Nos. PCT / 2017 / 045381 (WO2018 / 027078) and PCT / US2016 / 058344 (WO2017 / 070632), each of which is incorporated herein by reference for its entirety. Also see Komor, A.C., et al., “Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage” Nature 533, 420-424 (2016); Gaudelli, N.M., et al., “Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage” Nature 551, 464-471 (2017); Komor, A.C., et al., “Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity” Science Advances 3:eaao4774 (2017), and Rees, H.A., et al., “Base editing: precision chemistry on the genome and transcriptome of living cells.” Nat Rev Genet.2018 Dec;19(12):770-788. doi: 10.1038 / s41576-018-0059-l, the entire contents of which are hereby incorporated by reference. Base Editing Activity: By “base editing activity” is meant acting to chemically alter a base within a polynucleotide (e.g., by deaminating the base). In one embodiment, a first base is converted to a second base. In one embodiment, the base editing activity is cytidine deaminase activity, e.g., converting target C·G to T·A. In another embodiment, the base editing activity is adenosine or adenine deaminase activity, e.g., converting A·T to G·C. In another embodiment, the base editing activity is cytidine deaminase activity, e.g., converting target C·G to T·A and adenosine or adenine deaminase activity, e.g., converting A·T to G·C. Base Editor System: The term “base editor system” refers to a system for editing a nucleobase of a target nucleotide sequence. In various embodiments, the base editor (BE) system comprises (1) a polynucleotide programmable nucleotide binding domain (e.g., Cas9), a deaminase domain and a cytidine deaminase domain for deaminating nucleobases in the target nucleotide sequence; and (2) one or more guide polynucleotides (e.g., guide RNA) in conjunction with the polynucleotide programmable nucleotide binding domain. In various embodiments, the base editor (BE) system comprises a nucleobase editor domain selected from an adenosine deaminase or a cytidine deaminase, and a domain having nucleic acid sequence specific binding activity. In some embodiments, the base editor system comprises (1) a base editor (BE) comprising a polynucleotide programmable DNA binding domain and a deaminase domain for deaminating one or more nucleobases in a target nucleotide sequence; and (2) one or more guide RNAs in conjunction with the polynucleotide programmable DNA binding domain. In some embodiments, the polynucleotide programmable nucleotide binding ATTY DKT NO: RENA-002WO domain is a polynucleotide programmable DNA binding domain. In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is an adenine or adenosine base editor (ABE). In some embodiments, the base editor is an adenine or adenosine base editor (ABE) or a cytidine base editor (CBE). As used herein, the term “prime editing” refers to a genome editing that enables direct, irreversible targeted small insertions, deletions and base swapping without requiring double stranded DNA breaks (DSBs) or donor DNA. This method of nucleic acid editing uses a catalytically impaired Cas endonuclease fused to an engineered reverse transcriptase, programmed with a prime editing guide RNA (pegRNA). (Anzalone A et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 2019: 576.149-157) As used herein, the term “expression” or “expressed” as used herein in reference to a gene means the transcriptional and / or translational product of that gene. The level of expression of a DNA molecule in a cell may be determined on the basis of either the amount of corresponding mRNA that is present within the cell or the amount of protein encoded by that DNA produced by the cell (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 18.1-18.88). The level may also be influenced by gene repression, activation, or termination secondary to genome editing. Expression of a transfected gene can occur transiently or stably in a cell. During “transient expression” the transfected gene is not transferred to the daughter cell during cell division. Since its expression is restricted to the transfected cell, expression of the gene is lost over time. In contrast, stable expression of a transfected gene can occur when the gene is co-transfected with another gene that confers a selection advantage to the transfected cell. Such a selection advantage may be a resistance towards a certain toxin that is presented to the cell. As used herein, the term “plasmid” refers to a nucleic acid molecule that encodes for genes and / or regulatory elements necessary for the expression of genes. Expression of a gene from a plasmid can occur in cis or in trans. If a gene is expressed in cis, gene and regulatory elements are encoded by the same plasmid. Expression in trans refers to the instance where the gene and the regulatory elements are encoded by separate plasmids. ATTY DKT NO: RENA-002WO As used herein, the term “exogenous” refers to a molecule or substance (e.g., nucleic acid or protein) that originates from outside a given cell or organism. Conversely, the term “endogenous” refers to a molecule or substance that is native to, or originates within, a given cell or organism. As used herein, the term “codon-optimized” refers to genes or coding regions of nucleic acid molecules for transformation of various hosts, refers to the alteration of codons in the gene or coding regions of the nucleic acid molecules to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the DNA. Such optimization includes replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that organism. Given the large number of gene sequences available for a wide variety of animal, plant and microbial species, it is possible to calculate the relative frequencies of codon usage. Codon usage tables are readily available, for example, at the “Codon Usage Database” available at www.kazusa.or.jp / codon / . By utilizing the knowledge on codon usage or codon preference in each organism, one of ordinary skill in the art can apply the frequencies to any given polypeptide sequence and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide, but which uses codons optimal for a given species. Codon-optimized coding regions can be designed by various methods known to those skilled in the art. As used herein, the term “vector” refers to a macromolecule or association of macromolecules that comprises or associates with a polynucleotide and which can be used to mediate delivery of the polynucleotide to a cell. Illustrative vectors include, for example, plasmids, viral vectors (virus or the viral genome thereof), liposomes, nanoparticles, lipid nanoparticles (LNP), virus like particles (VLP), charge altering releasable transporter (CART) vectors, and other gene delivery vehicles. These include, but are not limited to the pEPI vectors, pEPito vectors, AR-free miniplasmids, pORT vectors, pCOR vectors, pFAR vectors, post-segregational killing (PSK) systems, RNA IN / RNA OUT systems, RNAI / RNAII systems, overexpression systems, circular covalently closed vectors, minicircle vectors, minivectors, miniknot vectors, linear covalently closed vectors (dumbbell-shaped), MIDGE systems, MiLV systems, Ministring systems, and Mini-intronic plasmids. Additional details on these and other systems can be found in the article by Hardee CL et al (Advances in non-viral DNA vectors for gene therapy. Genes (Basel).2017 Feb; 8(2). Doi: 10.3390 / genes8020065), the entirety of which is incorporate herein by reference. Some vectors described herein contain a scaffold / matrix attachment region (S / MAR), derived ATTY DKT NO: RENA-002WO from the human interferon β-gene. Other authors have shown the involvement of the S / MARs in DNA duplex destabilization and strand opening, suggesting these sequences to be involved in DNA replication and gene expression. Additionally, it was shown that the S / MAR-containing vectors prevent epigenetic silencing of gene expression by shielding the transgene sequence from adjacent regulatory sequences and heterochromatinization, maintaining the vector in a transcriptionally active state leading to sustained protein expression. The terms “transfection”, “transduction”, “transfecting” or “transducing” can be used interchangeably and are defined as a process of introducing a nucleic acid molecule and / or a protein to a cell. Nucleic acids may be introduced to a cell using non-viral or viral-based methods. The nucleic acid molecule can be a sequence encoding complete proteins or functional portions thereof. Typically, a nucleic acid vector, having the elements necessary for protein expression (e.g., a promoter, transcription start site, etc.). Non-viral methods of transfection include any appropriate method that does not use viral DNA or viral particles as a delivery system to introduce the nucleic acid molecule into the cell. Exemplary non-viral transfection methods include calcium phosphate transfection, liposomal transfection, nucleofection, sonoporation, transfection through heat shock, magnetifection, nanoparticles, lipid nanoparticles, virus-like particles, charge altering releasable transporters, nucleic acid binding peptides, cell penetrating peptides, and electroporation. The terms “transfection” or “transduction” also refer to introducing proteins into a cell from the external environment. Typically, transduction or transfection of a protein relies on attachment of a peptide or protein capable of crossing the cell membrane to the protein of interest. See, e.g., Ford et al. (2001) Gene Therapy 8:1-4 and Prochiantz (2007) Nat. Methods 4:119-20. As used herein, the term “expression vector” refers to a vector comprising a region which encodes a gene product of interest and is used for effecting the expression of a gene product in an intended target cell. An expression vector also comprises control elements operatively linked to the encoding region to facilitate expression of the protein in the target. The combination of control elements and a gene or genes to which they are operably linked for expression is sometimes referred to as an “expression cassette,” many which are known and available in the art or can be readily constructed from components that are available in the art. As used herein, the term “expression” refers to the transcription and / or translation of a coding sequence, e.g. an endogenous gene, a heterologous gene, in a cell. ATTY DKT NO: RENA-002WO As used herein, the term “gene product” refers the desired expression product of a polynucleotide sequence such as a polypeptide, peptide, protein including CRISPR protein, or RNA including, for example, a ribozyme, short interfering RNA (siRNA), crRNA, sgRNA, miRNA or small hairpin RNA (shRNA). The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component. As used herein, the terms “operatively linked” or “operably linked” refers to a juxtaposition of genetic elements on a single polynucleotide, wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained. The combination of control elements, e.g. promoter, enhancer(s), etc. and a gene or genes to which they are operably linked for expression is sometimes referred to as an “expression cassette,” a large number of which are known and available in the art or can be readily constructed from components that are available in the art. As used herein, the term "promoter" generally refers to a DNA sequence that contains an RNA polymerase binding site, transcription start site, and / or TATA box and assists or promotes the transcription and expression of an associated transcribable polynucleotide sequence and / or gene (or transgene). A promoter can be synthetically produced, varied, or derived from a known or naturally occurring promoter sequence or other promoter sequence. A promoter can also include a chimeric promoter comprising a combination of two or more heterologous sequences. A promoter of the present application can thus include variants of promoter sequences that are similar in composition but not identical to other promoter sequence(s) known or provided herein. A promoter can be classified according to a variety of criteria relating to the pattern of expression of an associated coding or transcribable sequence or gene (including a transgene) operably linked to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc. Promoters that drive expression in all or most tissues of the plant are referred to as "constitutive" promoters. Promoters that drive expression during certain periods or stages of development are referred to as "developmental" promoters. Promoters that drive enhanced expression in certain tissues of the plant relative to other plant tissues are referred to as "tissue- ATTY DKT NO: RENA-002WO enhanced" or "tissue-preferred" promoters. Thus, a "tissue-preferred" promoter causes relatively higher or preferential expression in specific tissue(s) of the plant but with lower levels of expression in other tissues of the plant. Promoters that express within specific tissue(s) of the plant, with little or no expression in other plant tissues, are referred to as "tissue-specific" promoters. An "inducible" promoter is a promoter that initiates transcription in response to an environmental stimulus such as cold, drought, or light, or other stimuli, such as wounding or chemical application. A non-limiting exemplary inducible promoter includes a TRE promoter. A promoter can also be classified in terms of its origin, such as being heterologous, homologous, chimeric, synthetic, etc. A "heterologous" promoter is a promoter sequence having a different origin relative to its associated transcribable sequence, coding sequence, or gene (or transgene), and / or not naturally occurring in the plant species to be transformed. In some embodiments, the promoter can be a polymerase I promoter. Non-limiting exemplary polymerase I promoters include a CAG promoter, PGK promoter, CMV promoter, EF1α promoter, SV40 promoter, and Ubc promoter, ligand-inducible promoters (e.g., those can be conditionally activated by NFκB, NFAT, or externally supplied chemical compounds). In some embodiments, the CAG promoter is synthetic. In other embodiments, the promoter can be a polymerase III promoter. Non-limiting exemplary polymerase III promoters include the mouse U6 promoter, the human U6 promoter, the H1 promoter, and the 7SK promoter. In some embodiments, the vector provided herein further comprises a reporter gene. For example, the reporter gene can be, without limitations, BFP, GFP, and mCherry. A skilled person knows how to choose or design reporter genes. By an “enhancer” it is generally meant a cis-acting regulatory element that stimulates, i.e. promotes or enhances, transcription of an adjacent gene or genes. By a “silencer” it is meant a cis-acting regulatory element that inhibits, i.e. reduces or suppresses, transcription of an adjacent gene, e.g. by actively interfering with general transcription factor assembly or by inhibiting other regulatory elements, e.g. enhancers, associated with the gene. Enhancers can function (i.e., can be associated with a coding sequence) in either orientation, over distances of up to several kilobase pairs (kb) from the coding sequence and from a position downstream of a transcribed region. Enhancer sequences influence promoter-dependent gene expression and may be located in the 5′ or 3′ regions of the native gene. Enhancer sequences may or may not be contiguous with the promoter sequence. Likewise, enhancer sequences may or may not be ATTY DKT NO: RENA-002WO immediately adjacent to the gene sequence. For example, an enhancer sequence may be several thousand base pairs from the promoter and / or gene sequence. A host cell as used herein can be a eukaryotic cell or prokaryotic cell. Non-limiting examples of eukaryotic cells include animal cells, plant cells, and fungal cells. In some embodiments, the eukaryotic cell comprises CHO, primary human hepatocyte, Vero, Cos7, Sp2 / 0, MEL, COS, and insect cells. In some embodiments, the eukaryotic cell comprises mammalian cells. In some embodiments, the eukaryotic cell comprises human cells. In some embodiments, the prokaryotic cell comprises E. coli. A “termination signal sequence” within the meaning of the invention may be any genetic element that causes RNA polymerase to terminate transcription, such as for example a polyadenylation signal sequence. A polyadenylation signal sequence is a recognition region necessary for endonuclease cleavage of an RNA transcript that is followed by the polyadenylation consensus sequence AATAAA. A polyadenylation signal sequence provides a “polyA site”, i.e. a site on a RNA transcript to which adenine residues will be added by post-transcriptional polyadenylation. The terms “identical” or percent “identity” in the context of two or more nucleotide sequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described herein, e.g. the Smith-Waterman algorithm, or by visual inspection. As used herein, the term “sequence identity” refers to the degree of identify between nucleotides in two or more aligned sequences, when aligned using a sequence alignment program. The term “% homology” is used interchangeably herein with the term “% identity” herein and refers to the level of nucleic acid or amino acid sequence identity between two or more aligned sequences, when aligned using a sequence alignment program. For example, as used herein, 80% homology means the same thing as 80% sequence identity determined by a defined algorithm, and accordingly a homologue of a given sequence has greater than 80% sequence identity over a length of the given sequence. Sequence identity may be determined by aligning sequences using any of a number of publicly available alignment algorithm tools, e.g., the local homology algorithm of Smith & Waterman, Adv. Appl. Math.2: 482 (1981), the homology alignment algorithm of Needleman & Wunsch, J Mol. Biol.48: 443 (1970), the search ATTY DKT NO: RENA-002WO for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85: 2444 (1988), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), by the BLAST algorithm, Altschul et al., J Mol. Biol.215: 403-410 (1990), with software that is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ), or by visual inspection (see generally, Ausubel et al., infra). The terms “complement” and “complementary” refer to two antiparallel nucleotide sequences capable of pairing with one another upon formation of hydrogen bonds between the complementary base residues in the antiparallel nucleotide sequences. The term “native”, when used in the context of a polynucleotide or polypeptide herein, refers to a polynucleotide or polypeptide sequence that is found in nature; i.e., that is present in the genome of a wild-type virus or cell. The term “variant’, when used in the context of a polynucleotide or polypeptide herein, refers to a mutants of a native polynucleotide or polypeptide having less than 100% sequence identity with the native sequence or any other native sequence. Such variants may comprise one or more substitutions, deletions, or insertions in the corresponding native gene or gene product sequence. The term “variant” also includes fragments of the native gene or gene product, and mutants thereof, e.g. fragments comprising one or more substitutions, deletions, or insertions in the corresponding native gene or gene product fragment. In some embodiments, the variant retains a functional activity of the native gene product, e.g. ligand binding, receptor binding, protein signaling, etc., as known in the art. The term “fragment,” when referring to a recombinant protein or polypeptide of the invention means a polypeptide having an amino acid sequence which is the same as part of, but not all of, the amino acid sequence of the corresponding full-length protein or polypeptide, which retains at least one of the functions or activities of the corresponding full-length protein or polypeptide. The fragment preferably includes at least 20-100 contiguous amino acid residues of the full- length protein or polypeptide. As used herein, the terms “biological activity” and “biologically active” refer to the activity attributed to a particular gene product, e.g. RNA or protein, in a cell line in culture or in vivo. For ATTY DKT NO: RENA-002WO example, the “biological activity” of an RNAi molecule refers to the ability of the molecule to inhibit the production of a polypeptide from a target polynucleotide sequence. As used herein, the term “antagonist” refers a molecule that acts to inhibit the activity of a target molecule. Antagonists include both structural antagonists that inhibit the activity of the target molecule by, for example, binding directly to the target or inactivating its receptor and functional antagonists, which, for example, decrease production of the target in a biological system or increase production of inhibitors of the target in a biological system. An antagonist may comprise gene editing of a gene to inhibit the activity of that gene. The terms “administering” or “introducing”, as used herein refer to contacting a cell, tissue, or subject with a vector for the purposes of delivering a polynucleotide to the cell or to cells and or organs of the subject. Such administering or introducing may take place in vivo, in vitro or ex vivo. A vector for expression of a gene product may be introduced into a cell by transfection, which typically means insertion of heterologous DNA into a cell by physical means (e.g., calcium phosphate transfection, electroporation, microinjection or lipofection); infection, which typically refers to introduction by way of an infectious agent, i.e. a virus; or transduction, which typically means stable infection of a cell with a virus or the transfer of genetic material from one microorganism to another by way of a viral agent (e.g., a bacteriophage) or a non-viral delivery platform, such as a lipid nanoparticle or a charge altering releasable transporter. “Administration” may be intravenous, oral, ocular, parenteral, bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or include, for example, one or more of topical to the dermis, intradermal, interdermal, transdermal, etc.), enteral, intra-arterial, intradermal, intracranial, intrathecal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intraventricular, within a specific organ (e. g. intrahepatic), intrasynovial, intrastemal, intracranial, mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, intravitreal, subretinal, suprachoroidal, etc. In addition, it can be administered via a biodegradable depot that elutes drug over a defined period of time, such as 1-, 2-, 3-, 4-, 5-,6-, 9-,10-, 11-, 12-, 15-, 18-, 21-, 24-, 36- months or any longer or shorter period of time. As used herein, the term “pharmaceutical composition” refers to a mixture or solution comprising a therapeutically effective amount of an active pharmaceutical ingredient or active pharmaceutical ingredients together with one or more pharmaceutically acceptable excipients, ATTY DKT NO: RENA-002WO carriers, and / or a therapeutic agent to be administered in a subject. As described herein, the pharmaceutical composition may comprise Cas mRNA, crRNA enclosed in a delivery vehicle including, but not limited to, a lipid nanoparticle. The term “host cell”, as used herein refers to a cell which has been transduced, infected, transfected or transformed with a vector. The vector may comprise a plasmid, a viral particle, an LNP, a phage, etc. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to those skilled in the art. It will be appreciated that the term “host cell” refers to the original transduced, infected, transfected or transformed cell and progeny thereof. As used herein, a “therapeutic” gene refers to a gene that, when expressed, confers a beneficial effect on the cell or tissue in which it is present, or on a mammal in which the gene is expressed. Examples of beneficial effects include amelioration of a sign or symptom of a condition or disease, prevention or inhibition of a condition or disease, or conferral of a desired characteristic. Therapeutic genes include genes that correct a genetic deficiency in a cell or mammal. As used herein, the term “a therapeutically effective amount” refers to the amount, or dose, necessary to result in a therapeutic benefit in a subject. A therapeutically effective amount may be administered via a single or multiple treatment administrations. The terms “treatment”, “treating” and the like are used herein to generally mean obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof, e.g. reducing the likelihood that the disease or symptom thereof occurs in the subject, and / or may be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease in a mammal and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; or (c) relieving the disease, i.e., causing regression of the disease. The therapeutic agent may be administered before, during or after the onset of disease or injury. The treatment of ongoing disease, where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient, is of particular interest. Such treatment is desirably performed prior to ATTY DKT NO: RENA-002WO complete loss of function in the affected tissues. The subject therapy will desirably be administered during the symptomatic stage of the disease, and in some cases after the symptomatic stage of the disease. The term “antibody” refers to a polypeptide encoded by an immunoglobulin gene or functional fragments thereof that specifically binds and recognizes an antigen. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. The terms “antigen” and “epitope” interchangeably refer to the portion of a molecule (e.g., a polypeptide) which is specifically recognized by a component of the immune system, e.g., an antibody, a T cell receptor, or other immune receptor such as a receptor on natural killer (NK) cells. As used herein, the term “antigen” encompasses antigenic epitopes and antigenic fragments thereof. As defined herein, the term “inhibition”, “inhibit”, “inhibiting” and the like in reference to an activity and / or functionality of a molecule (e.g. polynucleotide or protein) means negatively affecting (e.g., decreasing or reducing) the activity or function of the molecule relative to the activity or function of the protein in the absence of the inhibition. Thus, inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein or polynucleotide. Similarly, an “inhibitor” is a compound that inhibits a target bio-molecule (i.e. nucleic acid, peptide, carbohydrate, lipid or any other molecules that can be found from nature), e.g., by binding, partially or totally blocking, decreasing, preventing, delaying, inactivating, desensitizing, or down-regulating activity of the target bio-molecule. In the context of gene editing, “inhibition” may comprise gene editing of a target gene or genes to inhibit production of a gene product. In the context of disease prevention treatment, inhibition refers to reduction of a disease or symptoms of disease. According to the methods provided herein, the subject can be administered an effective amount of one or more of agents, compositions or complexes, all of which are interchangeably used ATTY DKT NO: RENA-002WO herein, (e.g. lipid nanoparticle, cell-penetrating complex, nucleic acid therapeutic, CRISPR / Cas therapeutic, vaccine composition) provided herein. The terms “effective amount” and “effective dosage” are used interchangeably. The term “effective amount” is defined as any amount necessary to produce a desired effect (e.g., transfection of nucleic acid into cells and exhibiting intended outcome of the transfected nucleic acid). Effective amounts and schedules for administering the agent can be determined empirically by one skilled in the art. The dosage ranges for administration are those large enough to produce the desired effects, e.g. transfection of nucleic acid, modulation in gene expression, gene editing, induction of stem cells, induction of immune response, reduction in immune response and more. The dosage should not be so large as to cause substantial adverse side effects, such as unwanted cross- reactions, anaphylactic reactions, and the like. Generally, the dosage can vary with the age, condition, sex, type of disease, the extent of the disease or disorder, route of administration, or whether other drugs are included in the regimen, and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any contraindications. As used herein, the term “cholesterol” refers to a lipid composed of four linked hydrocarbon rings forming the bulky steroid structure. As used herein, the term “low-density lipoprotein (LDL)” refers to a particle consisting of an outer rim of lipoprotein and a cholesterol center. LDL can possess a hydrophobic core that includes polyunsaturated fatty acid linoleate along with many esterified and unesterified cholesterol molecules. The core of the LDL molecule may also contain other fats and triglyceride surrounded by a shell of phospholipids and unesterified cholesterol. LDL may comprise LDL-C As used herein, the term “high-density lipoprotein (HDL), refers to the smallest of the lipoprotein particles. It contains the highest proportion of protein to lipids. The lipids carried include cholesterol, phospholipids, and triglycerides in variable amounts. HDL functions to transport fat molecules out of artery walls, reducing the progression of atherosclerosis. As used herein, the term lipoprotein a (Lp(a)) refers to a lipid-rich domain, primarily cholesteryl esters, and apolipoprotein (a). Elevated Lp(a) is an independent risk factor for adverse cardiovascular outcomes. ATTY DKT NO: RENA-002WO As used herein, the term “triglyceride” refers to a tri-ester composed of three fatty acid molecules bound to a glycerol. As used herein, the term “atherosclerotic cardiovascular disease (ASCVD)” includes all manifestations of ASCVD including, but not limited to the following: coronary artery disease, myocardial infarction, aortic stenosis, stroke, peripheral artery disease, kidney disease, carotid artery disease, cardiac valve disease, and aneurysm. As used herein, the term “hypertriglyceridemia” refers to elevated levels of triglycerides. Elevated triglycerides increase the risk of ASCVD and are associated with diabetes mellitus, insulin resistance, kidney failure, nephrotic syndrome, and obesity. It is also associated with familial combined hyperlipidemia, lipoprotein lipase deficiency, lysosomal acid lipase deficiency, hypothyroidism, systemic lupus erythematosus, glycogen storage disease type 1, and cholesteryl ester storage disease. As used herein, the term “prodrug” indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and / or conditions. The term "pharmaceutical composition" and its grammatical equivalents, as used herein, can refer to a mixture or solution comprising a therapeutically effective amount of an active pharmaceutical ingredient together with one or more pharmaceutically acceptable excipients, carriers, and / or a therapeutic agent to be administered to a subject, such as a human in need thereof. The term "pharmaceutically acceptable" and its grammatical equivalents, as used herein, can refer to an attribute of a material that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable, and is acceptable for veterinary as well as human pharmaceutical use. "Pharmaceutically acceptable" can also refer to a material, such as a carrier or diluent, that does not abrogate the biological activity or properties of the compound, and is relatively non-toxic. In other words, the material may be administered to a subject without causing undesirable biological effects or interacting in a ATTY DKT NO: RENA-002WO deleterious manner with any of the components of the pharmaceutical composition in which it is contained. As used herein, the term “pharmaceutically acceptable salt” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. These comprise organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and comprise basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid; and with amino acids, such as the 20 alpha-amino acids involved in the synthesis of proteins in Nature, for example glutamic acid or aspartic acid, and also with phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid, benzenesulfonic acid, 4-methylbenzenesulfoic acid, naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or 3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamates), or with other acid organic compounds, such as ascorbic acid. Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation. Suitable pharmaceutically acceptable cations are well known to those skilled in the art and comprise alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible. For oligonucleotides, preferred examples of pharmaceutically acceptable salts comprise but are not limited to: (I) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamides such as spermine and spermidine, and the like; (II) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (III) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, napthalenesulfonic acid, methanesulfonic acid, p- ATTY DKT NO: RENA-002WO toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (IV) salts formed from elemental anions such as chlorine, bromine, and iodine. Ranges used herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 10 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 as well as all intervening decimal values between the integers. For example, 1.1, 1.2, 1.3, etc. Nested sub-ranges are also included, for example, 1 to 50 may include 1 to 5, 5 to 10, 1 to 10, 1 to 40, etc. Another illustrative example is a range of 20 to 30. In this instance, the range is inclusive of all integers from 20 to 30, such as 20, 21, 22, and so forth. It also encompasses decimal values between these integers, ensuring the representation of the entire numerical spectrum within the specified bounds. Sub-ranges like 25 to 28 or 20 to 25 are naturally included, providing a flexible and comprehensive framework for expressing values within this numerical interval. The concept of inclusive ranges extends to accommodate the intricacies of numerical values, allowing for versatile and precise delineation in various contexts. Before the present invention is described in greater detail, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention. Certain ranges are presented herein with numerical values being preceded by the term "about." The term "about'' is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In ATTY DKT NO: RENA-002WO determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative methods and materials are now described. All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed. It is noted that, as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as an antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation. Additionally, certain embodiments of the disclosed devices and / or associated methods can be represented by drawings which may be included in this application. As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. ATTY DKT NO: RENA-002WO DETAILED DESCRIPTION Methods of editing one or more cardiovascular disease implicated genomic regions of a cell are provided. Aspects of the methods include introducing into a cell: a HyperCas12 nuclease or nucleic acid encoding the same; and a gRNA comprising two or more targeting sequences to edit the one or more cardiovascular disease implicated genomic regions of the cell. Also provided are compositions for practicing embodiments of the methods. The methods and compositions find use in a variety of different applications, including treatment of cardiovascular disease. The present disclosure provides compositions and methods for targeted genomic editing. As used herein, genome editing refers to any change in the genome of a cell in a living organism. Genome (or gene) editing may include insertion, deletion, or translocation. Insertion means the addition of one or more nucleotides in a DNA sequence. Insertions can range from a single insertion, to the insertion of an entire gene. In some embodiments, an insertion can be larger than an entire gene. Deletions refer to a removal of one or more nucleotides in a DNA sequence or removal of a function of a gene. In some embodiments, a deletion can include a single nucleotide, loss of a few nucleotides, deletion of an exon, deletion of an intron, deletion of gene regulatory elements, or the entire gene sequence. In some examples, deletion of a gene refers to reduction or elimination of the function of a gene or its gene product. This can result from insertions or nonsense mutations that disrupt the expression of a gene. Gene or genome correction refers to changing a nucleotide or number of nucleotides to restore the “wild-type” gene sequence, restoring the structure and function of a gene and allowing for normal expression of its gene product. Correction of gene mutations can be achieved by various strategies including base editing, prime editing, and gene editing or gene replacement. Another form of gene editing includes removal or truncation of repeat expansions, such as those seen in trinucleotide repeat disorders. In certain contexts, modifications may encompass gene manipulation techniques such as knock-ins, knockouts, or knockdowns. As defined in this context, a "knock-in" involves the introduction of a DNA sequence or its fragment into a genome. The DNA sequences intended for knock-ins may comprise complete genes, regulatory sequences associated with a gene, or ATTY DKT NO: RENA-002WO any segment or fragment thereof. For instance, one may insert a cDNA encoding the wild-type protein into the genome of a cell containing a mutant gene, illustrating that knock-in strategies do not necessarily replace the defective gene entirely. In some scenarios, a knock-in approach might additionally involve substituting an existing sequence with the provided one, such as replacing a mutant allele with a wild-type copy. Conversely, the term "knock-out" pertains to the elimination of a gene or its expression. This elimination can occur through deletion or addition of a nucleotide sequence leading to a disruption of the reading frame. Alternatively, a gene may be knocked out by replacing part of it with an irrelevant sequence. Finally, the term "knock-down," as used in this context, denotes the reduction in the expression of a gene or its gene products. A gene knock-down may result in the attenuation of protein activity or function, leading to a decrease or elimination of protein levels. Genome editing broadly refers to the process of modifying the nucleotide sequence of a genome, in some instances with precision or in a predetermined manner. Methods of genome editing, as described herein, encompass the use of site-directed nucleases to cleave deoxyribonucleic acid (DNA) at specific target locations within the genome, leading to the creation of single-strand or double-strand DNA breaks at defined locations. These breaks are commonly repaired by natural, endogenous cellular processes, such as homology-directed repair (HDR) and non-homologous end joining (NHEJ), as outlined by Cox et al. in Nature Medicine 21(2), 121-31 (2015). HDR employs a homologous sequence, or donor sequence, as a template for inserting a defined DNA sequence at the break point. The homologous sequence can be within the endogenous genome, like a sister chromatid, or an exogenous nucleic acid, such as a plasmid, single-strand or double-strand oligonucleotide, duplex oligonucleotide, or a virus. This donor sequence possesses regions of high homology with the nuclease-cleaved locus, potentially containing additional sequence changes, including deletions that can be incorporated into the cleaved target locus. NHEJ directly joins the DNA ends resulting from a double-strand break, potentially causing the loss or addition of nucleotide sequences, thereby impacting gene expression. A third repair mechanism, microhomology-mediated end joining (MMEJ), also known as "Alternative NHEJ," yields outcomes similar to NHEJ, with small deletions and insertions at the cleavage site. MMEJ leverages homologous sequences of a few base pairs flanking the DNA break site to drive a more favored DNA end-joining repair outcome. Reports have further elucidated the molecular mechanism of this process; refer to Cho and Greenberg, Nature 518, 174-76 (2015); Kent et al., Nature Structural and Molecular Biology, Adv. Online doi:10.1038 / nsmb.2961 (2015); Mateos-Gomez et al., Nature 518, 254-57 (2015); ATTY DKT NO: RENA-002WO Ceccaldi et al., Nature 528, 258-62 (2015). In specific instances, it may be feasible to predict likely repair outcomes by analyzing potential microhomologies at the DNA break site. Any of the described genome editing mechanisms can be used to create desired genomic alterations. The gene editing process can include the intentional creation of single or double stranded DNA breaks in a target gene or regulatory sequence of the target gene. This can be achieved via site-directed nucleotides, such as crRNA and gRNAs and described herein. CRISPR-Cas Systems: CRISPR-Cas systems are categorizable into two classes, namely Class 1 and Class 2, encompassing six types denoted as I through VI, along with various subtypes. Class 1 systems (Type I, III, and IV) are characterized by multi-Cas protein effector complexes, whereas Class 2 systems (Type II, V, and VI) feature a singular effector protein (Xu et al. CRISPR-Cas systems: overview, innovations and applications in human disease research and gene therapy. Comput Struct Biotechnol J.2020; 18:2401-2415). A CRISPR locus consists of a series of concise repeating sequences known as "repeats." Upon expression, these repeats can adopt secondary structures, such as hairpins, and / or consist of unstructured single-stranded sequences. Typically occurring in clusters, these repeats often exhibit variations between species. The repeats are interspersed with distinctive intervening sequences termed "spacers," forming a repeat-spacer-repeat locus architecture. The spacers demonstrate identical or high homology with recognized sequences from foreign invaders. Each spacer-repeat unit encodes a crisprRNA (crRNA), which undergoes processing to yield a mature form of the spacer-repeat unit. A crRNA encompasses a "seed" or spacer sequence crucial for targeting a specific nucleic acid (in prokaryotes' natural state, the spacer sequence directs attention to foreign invader nucleic acids). Positioned at either the 5′ or 3′ end of the crRNA, the spacer sequence plays a central role in the CRISPR mechanism. A CRISPR locus also comprises polynucleotide sequences encoding CRISPR associated (Cas) genes. Cas genes encode endonucleases that interface with crRNA in cells. Some Cas genes comprise secondary and tertiary structures that may improve stability. Type II Systems ATTY DKT NO: RENA-002WO Type II CRISPR systems require trans-activating CRISPR RNA (tracrRNA). Cas9 is a type II CRISPR system. TracrRNA is modified by endogenous RNaseIII, and then hybridizes to a crRNA repeat in the pre-crRNA array. The crRNA guides the crRNA-tracrRNA-Cas9 complex to the target nucleic acid to which it will hybridize. The target nucleic acid is referred to as a protospacer adjacent motif (PAM). The PAM sequence is G-rich. The PAM is essential to facilitate binding of the site-specific endonuclease (Cas) to its target nucleic acid sequence. Type V CRISPR systems have several key differences compared to type II systems. Perhaps most importantly, Cas12 comprises RNase activity, and does not utilize tracrRNA. Cas12 arrays (crRNA) can be processed into short, mature crRNAs (gRNAs) after delivery into a cell. Cas12a nucleases are also known as Cpfl) and include Acidaminococcus Cas12a (AsCas12a) and Lachnospiraceae bacterium Cas 12a (LbCas12a). Cas12 systems utilizes a T-rich PAM and cleave at a point that is comparatively distant from the PAM, whereas type II systems cleave at a point adjacent to the PAM. The crRNA tends to be short, in some cases 19 to 23 nucleotides in length with a spacers sequence that is about 20 nucleotides long. Cas12 cleaves DNA via a staggered DNA double-stranded break. Exemplary CRISPR / Cas polypeptides include the Cas12 polypeptide “hyperCas12”, a mutated Cas12 engineered to have superior properties as described herein. HyperCas12: As described herein, Cas12a allows for processing of a poly-crRNA into individual crRNAs (guide RNAs) to enable multiplexing. However, while Cas12a has shown some utility in vivo, its editing efficiency in vivo lags Cas9 orthologs and limits its applicability in therapeutic development. Enhanced version of Cas12, including AsCas12a, offer only marginal improvements on Cas12a. HyperCas12a enables simultaneous genome modulation at multiple genomic loci, enabling CRISPR-based treatment of polygenic diseases, which affect a large percentage of patients globally. In some embodiments, the present disclosure demonstrates the superior CRISPR gene editing activity of hyperCas12a. Further, by way of example, the present disclosure demonstrates that the hyperCas12a provided herein is useful for additional Cas12a-based applications, including CRISPR repression, base editing and prime editing. ATTY DKT NO: RENA-002WO The present disclosure also demonstrates that activity-enhancing mutations provided herein, when introduced into the nuclease-active form of Cas12a, enhance gene editing. In some exemplary embodiments, the present disclosure shows that the hyperCas12a described herein effectively gene edits and silences endogenous genes and exhibits synergistic endogenous gene silencing. In other exemplary embodiments, the present disclosure demonstrates the enhanced multiplex silencing of endogenous genes driven by the hyperCas12a described herein. Moreover, the engineered Cas12a proteins and systems described herein can be useful as a platform for regenerative biology and therapy. For example, there is high interest in the direct reprogramming of lineage-determined cells from one cell fate to another as a therapeutic strategy for the loss of a certain cell population in diseases. The engineered Cas12a proteins and systems described herein enable the simultaneous manipulation of the endogenous expression of a slew of fate-determining transcription factors, which will have wide applicability for regenerative biology. Furthermore, the engineered Cas12a proteins and systems described herein can be used in an organoid context. Additionally, the engineered Cas12a proteins and systems described herein are useful for cell therapy. For instance, recognition of tumor- associated antigens is a pillar of immunotherapy, and multiplex CRISPR activation (CRISPRa) can be used to augment the expression of tumor antigens, especially those that may be lowly expressed (or downregulated) at a level that would bypass an effective T-cell-mediated response. Engineered Cas12 In some embodiments, the Cas protein is a Cas12a. Cas12a is an RNA-programmable DNA endonuclease with intrinsic RNase activity that allows processing of its own crRNA array, enabling multigene editing from a single RNA transcript. Typically, a Cas12a nuclease binds double-stranded DNAs (dsDNA). Cas12a (also known as Cpf1) is a Class 2, Type V RNA- guided endonuclease from the CRISPR system. Variants from several species have been characterized. It catalyzes site-specific cleavage of double-stranded DNA at sites with a TTTV (where V is A, C, or G) PAM. In some embodiments, the present disclosure provides engineered Cas12a proteins for multiplex CRISPR-based genetic modulation. ATTY DKT NO: RENA-002WO The engineered Cas12a protein provided herein can be nuclease active (i.e., having the Cas12a nuclease activity) or nuclease dead (i.e., not having the Cas12a nuclease activity). The loss of nuclease activity can be the result of mutations. In some embodiments, the engineered Cas12a protein is a deactivated Cas protein. As used herein, a "deactivated Cas protein" (dCas) refers to a nuclease comprising a domain that retains the ability to bind its target nucleic acid but has a diminished or eliminated ability to cleave a nucleic acid molecule, as compared to a control nuclease. In certain embodiments, a catalytically inactive nuclease is derived from a "wild-type" Cas protein, referring to a naturally occurring nuclease. A catalytically inactive Cas12a can produce a nick in the targeting DNA strand. In some embodiments, the catalytically inactive Cas12a can produce a nick in the non- targeting DNA strand. In some embodiments, the catalytically inactive Cas12a, referred to as nuclease dead Cas12a (dCas12a), lacks all DNase activity. In some aspects, the engineered Cas12a proteins are variants of nuclease dead Cas12a from Lachnospiraceae bacterium (ArCas12a). In an exemplary embodiment, the engineered Cas12a protein is a quadruple dCas12a mutant protein having the D156R, D235R, E292R, and D350R mutations, also called "hyperdCas12a" or "hyperdCas12a" for short. The engineered Cas12a proteins provided herein exhibit minimal off-target effects compared to the wild-type Cas12a protein. Further, the hyperdCas12a provided herein has enhanced function in gene activation, repression, and base editing. In some embodiments, the engineered Cas12a proteins are variants of the nuclease-active Cas12a from Lachnospiraceae bacterium (LbCas12a). In an exemplary embodiment, the engineered Cas12a protein is a quadruple dCas12a mutant protein having the D156R, D235R, E292R, and D350R mutations. The present disclosure demonstrates that the four activity- enhancing mutations, when introduced into the nuclease-active form of Cas12a, enable the resulting engineered Cas12a protein, hyperCas12a to have more effective gene knockout or repression activity. In some embodiments hyperCas12a comprises codon optimized mRNA. In other embodiments, the engineered Cas12a protein provided herein comprises one or more mutations selected from D156R, D235R, E292R, and D350R. In certain embodiments, the engineered Cas12a protein comprises at least two, three, or four mutations. In certain embodiments, the engineered Cas12a protein comprises a single mutation. In certain embodiments, the engineered Cas12a protein comprises the D156R mutation. ATTY DKT NO: RENA-002WO For instance, in one exemplary embodiment, an engineered Cas12a protein provided herein comprises the mutations of D156R and E292R. In another exemplary embodiment, an engineered Cas12a protein provided herein comprises the mutations of D156R and D350R. In certain embodiments, an engineered Cas12a protein provided herein comprises the mutations of D156R, E292R, and D122R. In another embodiment, an engineered Cas12a protein provided herein comprises the mutations of D156R, E292R, and D235R. In yet another embodiment, an engineered Cas12a protein provided herein comprises the mutations of D156R, E292R, and D350R. In some specific embodiments, an engineered Cas12a protein provided herein comprises mutations of D235R, E292R, and D350R. In some specific embodiments, an engineered Cas12a protein provided herein comprises all four mutations of D156R, D235R, E292R, and D350R. In some embodiments, the engineered Cas12a provided herein comprises a codon optimized sequence that is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity to a sequence set forth in SEQ ID NO: 1. In other exemplary embodiments, the engineered Cas12a provided herein comprises a sequence that is at least about 80%, 90%, or 95% identical to a sequence set forth in SEQ ID NO: 1. In one specific embodiment, the engineered Cas12a protein provided herein comprises the sequence of SEQ ID NO: 1, and the engineered Cas12a protein is a nuclease active form of Lachnospiraceae bacterium Cas12a, also called "hyperCas12a." The hyperCas12a protein comprises all of the four mutations of D156R, D235R, E292R, and D350R. HyperCas12a may comprise mRNA. In some embodiments, the engineered Cas12a provided herein comprises a sequence that is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity to a sequence set forth in SEQ ID NO: 2. In other exemplary embodiments, the engineered Cas12a protein provided herein comprises a sequence that is at least about 80%, 90%, or 95% identical to a sequence set forth in SEQ ID NO: 2. In one specific embodiment, the engineered Cas12a protein provided herein comprises the sequence of SEQ ID NO: 2, and the engineered Cas12a protein is a mutant nuclease dead form of Lachnospiraceae bacterium Cas12a, also called "hyperdCas12a." The hyperCas12a protein comprises all of the four mutations of D156R, D235R, E292R, and D350R. HyperdCas12a may comprise mRNA. ATTY DKT NO: RENA-002WO In some embodiments, the engineered Cas12a protein provided herein comprises a sequence that is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity to a sequence set forth in SEQ ID NO: 3. In other exemplary embodiments, the engineered Cas12a protein provided herein comprises a sequence that is at least about 80%, 90%, or 95% identical to a sequence set forth in SEQ ID NO: 3. In one specific embodiment, the engineered Cas12a protein provided herein comprises the sequence of SEQ ID NO: 3, and the engineered Cas12a protein is a nuclease active, high fidelity form of Lachnospiraceae bacterium Cas12a. The HFhyperCas12 protein comprises all of the five mutations of D156R, D235R, E292R, D350R, and N260A. HFhyperCas12 may comprise mRNA. In some embodiments, the engineered Cas12a protein provided herein comprises a sequence that is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity to a sequence set forth in SEQ ID NO: 4. In other exemplary embodiments, the engineered Cas12a protein provided herein comprises a sequence that is at least about 80%, 90%, or 95% identical to a sequence set forth in SEQ ID NO: 4. In one specific embodiment, the engineered Cas12a protein provided herein comprises the sequence of SEQ ID NO: 4, and the engineered Cas12a protein is a mutant nuclease dead form of Lachnospiraceae bacterium Cas12a fused with a base editor. In some embodiments, the Cas12a protein has all of the four mutations of D156R, D235R, E292R, and D350R. In some embodiments hyperCas12a fused with a base editor may comprise mRNA. In some embodiments, the engineered Cas12a protein provided herein comprises a sequence that is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity to a sequence set forth in SEQ ID NO: 5. In other exemplary embodiments, the engineered Cas12a protein provided herein comprises a sequence that is at least about 80%, 90%, or 95% identical to a sequence set forth in SEQ ID NO: 5. In one specific embodiment, the engineered Cas12a protein provided herein comprises the sequence of SEQ ID NO: 5, and the engineered Cas12a protein is a form of Lachnospiraceae bacterium Cas12a fused with a base editor and a nickase. The Cas12a protein has all four mutations of D156R, D235R, E292R, and D350R, and also comprises a nickase. In some embodiments hyperCas12a fused with a base editor and nickase may comprise mRNA. ATTY DKT NO: RENA-002WO In some embodiments, the engineered Cas12a proteins comprise a sequence that is at least 65%, 70%, 75%, or 80% identical to the nucleotide sequence of the wild-type (WT) LbdCas12a or WT nuclease dead form of LbCas12a, as set forth in SEQ ID NO 6, respectively. In some embodiments, the engineered Cas12a protein comprises one or more mutations compared to the LbdCas12a or LbdCas12a nucleases. In certain embodiments, the one or more mutations are selected from the list consisting of D122R, E125R, D156R, E159R, D235R, E257R, E292R, D350R, E894R, D952R, and E981R. In some embodiments, the engineered Cas12a proteins comprise a sequence that is at least 65%, 70%, 75%, or 80% identical to the nucleotide sequence of the wild-type (WT) LbCas12a or WT nuclease active form of LbCas12a, as set forth in SEQ ID NO 7, respectively. In some embodiments, the engineered Cas12a protein comprises one or more mutations compared to the LbCas12a or LbCas12a nucleases. In certain embodiments, the one or more mutations are selected from the list consisting of D122R, E125R, D156R, E159R, D235R, E257R, E292R, D350R, E894R, D952R, and E981R. Exemplary nucleic acid sequences of Cas12 nuclease sequences described herein are provided in Table 1. TABLE 1: Exemplary nucleic acid sequences of hyperCas12 Codon optimized HyperCas12 (SEQ ID NO: 1) A A C A C T T A G A G ATTY DKT NO: RENA-002WO ACAGAGAGAGTCTGTCCTTCTACGGAAGAGGCTACACCAGCGACGAAGAAGTGCTGGAGGTGTTCAGGAACACCCTG AACAAGAACAGCGAAATCTTCAGCAGCATCAAAAAGCTCGAAAAACTGTTCAAGAACTTCGACGAGTACAGCAGCGC G G T G C G A G G A C C G G T T A T C G A C G T A C T A C T C A C G A G ATTY DKT NO: RENA-002WO CCTCGGCAGCGGCAGCCCCGCTGCCAAGCGGGTTAAGCTGGACGGCGGATCTCCTGCCGCCAAGAGAGTGAAGCTGG ACGACGGCATCGGCTGA A A C A C T T A G A G G C G G T G C G A G G A C C G G T T A T C ATTY DKT NO: RENA-002WO ATGATGACAACCCCTATGTCATCGGAATTgccCGAGGAGAAAGAAACCTGCTGTACATCGTGGTGGTGGATGGCAAG GGCAATATCGTGGAACAGTACTCACTGAATGAGATCATCAACAACTTCAACGGCATCCGGATCAAGACAGACTACCA C G T A C T A C T C A C G A G G A A C A C T T A G A G G C G G T G C ATTY DKT NO: RENA-002WO GTGAAGTCGTTCGAAAACTACATCAAGGCCTTCTTCGGCGAGGGCAAGGAGACCAACAGAGATGAGAGCTTCTACGG CGATTTCGTGCTGGCCTACGACATCCTGCTGAAGGTCGACCACATCTACGATGCTATCAGGAACTACGTGACCCAGA G G A C C G G T T A T C G A C G T A C T A C T C A C G A G G a c a a ATTY DKT NO: RENA-002WO gccttgcgtgatgtgcgccggcgccatgatccactctaggatcggccgcgtggtgtttggcgtgaggaactcaaaaa gaggcgccgcaggctccctgatgaacgtgctgaactaccccggcatgaatcaccgcgtcgaaattaccgagggaatc c a G A C G T T A C G A A G A A G G A G C T C C A T C T G C G C G A A C ATTY DKT NO: RENA-002WO TTCAACGGCATCCGGATCAAGACAGACTACCACAGCCTGCTGGACAAGAAAGAGAAGGAGAGATTCGAGGCCAGACA GAACTGGACCAGCATCGAGAACATCAAGGAGCTGAAGGCCGGCTACATCAGCCAGGTGGTGCACAAAATCTGTGAAC A G G C T T C G A G G G C G a c a a a c c a G A C G T T A C G A A G ATTY DKT NO: RENA-002WO AAGAAGTGCTGGAGGTGTTCAGGAACACCCTGAACAAGAACAGCGAAATCTTCAGCAGCATCAAAAAGCTCGAAAAA CTGTTCAAGAACTTCGACGAGTACAGCAGCGCCGGCATCTTCGTGAAGAACGGCCCTGCAATTAGCACCATTTCAAA G G A G C T C C A T C T G C G C G A A C A C A G G C T T C G A G G G C ATTY DKT NO: RENA-002WO TCTTATCCTTATGATGTCCCTGATTACGCCAGCCTCGGCAGCGGCAGCCCCGCTGCCAAGCGGGTTAAGCTGGACGG CGGATCTCCTGCCGCCAAGAGAGTGAAGCTGGACGACGGCATCGGCTGA a a c a c c t a g a g g c g g t g t g a g g a c g g g t t a t c g a c ATTY DKT NO: RENA-002WO tgaaggccggctatatctctcaggtggtgcacaagatctgcgagctggtggagaagtacgatgccgtgatcgccctg gaggacctgaactctggctttaagaatagccgcgtgaaggtggagaagcaggtgtatcagaagttcgagaagatgct a a t t t t c g c g a a c a c c t a g a g g c g g t g t g a g g a c ATTY DKT NO: RENA-002WO aagaatggcacattcaagaagggcgatatgtttaacctgaatgactgtcacaagctgatcgacttctttaaggatag catctcccggtatccaaagtggtccaatgcctacgatttcaacttttctgagacagagaagtataaggacatcgccg g t t a t c g a c g t a a t t t t c g c g In some embodiments, the engineered Cas12a proteins provided herein exhibit improved activities compared to the corresponding wild-type (WT) Cas12a protein, i.e., the nuclease- active form or the nuclease-dead form, respectively. In some embodiments, the engineered Cas12a protein provided herein can exhibit improved activation compared to the WT Cas12a protein. In other embodiments, the engineered Cas12a protein provided herein can show improved epigenetic modifications compared to the WT Cas12a protein. In some embodiments, the engineered Cas12a protein provided herein can exhibit improved activation compared to the WT Cas12a protein. In still other embodiments, the engineered Cas12a protein provided herein can have improved gene knockout, gene knock-in, and mutagenesis activities compared to the WT Cas12a protein. ATTY DKT NO: RENA-002WO In further embodiments, the engineered Cas12a protein provided herein can show improved gene editing of single or multiple bases compared to the WT Cas12a protein. In yet other embodiments, the engineered Cas12a protein provided herein can have improved prime gene editing compared to the WT Cas12a protein. In some embodiments, the engineered Cas12a protein provided herein is less susceptible to variations in crRNA concentration compared to the WT Cas12a protein. In some embodiments, the engineered Cas12a protein provided herein exhibits an increased level of activation under a crRNA:Cas12a ratio of about 1:1 or lower compared to the WT Cas12a protein. In some embodiments, the engineered Cas12a protein provided herein exhibits an increased level of activation under a crRNA:Cas12a ratio of about 1:0.9, about 1:0.8, about 1:0.7, about 1:0.6, about 1:0.5, about 1:0.4, about 1:0.3, about 1:0.2, about 1:0.1, or lower. In some embodiments, the engineered Cas12a protein provided herein exhibits an increased level of activation under a Cas12a:crRNA ratio of about 1:0.9, about 1:0.8, about 1:0.7, about 1:0.6, about 1:0.5, about 1:0.4, about 1:0.3, about 1:0.2, about 1:0.1, or lower. In some embodiments, the ability to lower the crRNA concentration compared to the engineered Cas12 protein is due to the ability to deliver multiple gRNAs to a single target in a single crRNA, effectively increasing the concentration of gRNA received by the target tissue. In some embodiments, the engineered Cas12a protein provided herein comprises mutations that increase the fidelity of the Cas12a protein, minimizing off-target editing. In some embodiments, the mutations comprise N260A, designed to increase the fidelity of gene edits and minimize off-target editing. In some embodiments, the Cas12a protein provided herein comprises all four mutations of D156R, D235R, E292R, and D350R, and additionally comprises the N260A mutation, thereby maximizing editing efficiency while simultaneously increasing the fidelity of gene editing. In some embodiments, the Cas12a protein provided herein comprises D156R, D235R, E292R, D350R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D156R, D235R, E292R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D156R, D235R, D350R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D156R, E292R, D350R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D235R, E292R, D350R, and N260A mutations. In some embodiments, the Cas12a protein ATTY DKT NO: RENA-002WO provided herein comprises D156R, D235R, E292R, D350R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D156R, D235R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D156R, E292R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D156R, D350R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D235R, E292R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D235R, D350R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises E292R, D350R, and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D156R and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D235R and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises E292R and N260A mutations. In some embodiments, the Cas12a protein provided herein comprises D350R and N260A mutations. Each of these combinations represents a distinct configuration of mutations within the Cas12a protein, offering a range of possibilities for genetic modulation. In some embodiments, hyperCas12 is delivered as plasmid DNA. In some embodiments, hyperCas12 is delivered as mRNA. In some embodiments, mRNA consists of non-chemically modified nucleotides. In some embodiments, mRNA consists of chemically modified nucleotides, including, but not limited to N1-methylpseudouridine, 5- methoxyuridine, and pseudouridine. All chemically modified nucleotides described by Li et al are incorporated by reference (Li et al. Effects of chemically modified messenger RNA on protein expression. Bioconjugate Chem.2016, 27, 849-853). In some embodiments, the mRNA features uridine depletion to reduce immune response without requiring HPLC purification. In some embodiments, the mRNA features uridine depletion to reduce immune response while still utilizing HPLC purification. In some embodiments, hyperCas12 mRNA 5’ cap structure is chemically modified. In some embodiments, hyperCas12 mRNA 5’ cap structure is chemically modified resulting in increased stability, increased protein expression, and reduced immunogenicity. In some embodiments, hyperCas12 mRNA 5’ cap structure is chemically modified utilizing enzymatic capping. In some embodiments, hyperCas12 mRNA 5’ cap structure is chemically modified utilizing CleanCap technology. In some embodiments, hyperCas12 mRNA 5’ cap structure is ATTY DKT NO: RENA-002WO chemically modified utilizing CleanCap® M6 analog. In some embodiments, hyperCas12 mRNA 5’ cap structure is chemically modified utilizing CleanCap® AG 3’ OMe analog. In some embodiments, hyperCas12 mRNA 5’ cap structure is chemically modified utilizing CleanCap® AG analog. In some embodiments, hyperCas12 mRNA 5’ cap structure is chemically modified utilizing CleanCap® AU analog. The present disclosure also demonstrates that delivery of a single mRNA encoding hyperCas12a along with a poly-crRNA array simultaneously targets PCSK9, ANGPTL3, and Lp(a) loci in primary human hepatocytes. In some embodiments, delivery of a single mRNA encoding hyperCas12a along with a poly-crRNA array simultaneously targets PCSK9 and ANGPTL3 loci in primary human hepatocytes. In some embodiments, delivery of a single mRNA encoding hyperCas12a along with a poly-crRNA array simultaneously targets PCSK9, ANGPTL3, and APOC3 loci in primary human hepatocytes. In some embodiments, delivery of a single mRNA encoding hyperCas12a along with a poly-crRNA array simultaneously targets PCSK9, ANGPTL3, Lp(a) and APOC3 loci in primary human hepatocytes. In some embodiments, delivery of a single mRNA encoding hyperCas12a along with a poly-crRNA array simultaneously targets PCSK9, ANGPTL3, Lp(a), APOC3, and APOB loci in primary human hepatocytes. Base Editing The systems disclosed herein can be used for base editing (see, e.g., Anzalone, A. V., et al., Nat. Biotechnol.38, 824-844 (2020), which is incorporated herein by reference in its entirety). Cas nuclease used as a base editor for base editing is discussed in more detail below. There are generally three classes of base editors: cytosine base editors (CBEs), adenine base editors (ABEs), and dual-deaminase editor (also called SPACE, synchronous programmable adenine and cytosine editor). Base editing requires a nickase or nuclease fused or coupled to a deaminase that makes the edit, a gRNA targeting the nuclease to a specific locus, and a target base for editing within the editing window specified by the nuclease. Cytosine base editors (CBEs) uses a cytidine deaminase coupled with an inactive nuclease. These fusions convert cytosine to uracil without cutting DNA. Uracil is then subsequently converted to thymine through DNA replication or repair. Fusing an inhibitor of uracil DNA ATTY DKT NO: RENA-002WO glycosylase (UGI) to a nuclease prevents base excision repair which changes the U back to a C mutation. To increase base editing efficiency, the cell can be forced to use the deaminated DNA strand as a template by using a nuclease nickase, instead of a nuclease. The resulting editor, can nick the unmodified DNA strand so that it appears “newly synthesized” to the cell. Thus, the cell repairs the DNA using the U-containing strand as a template, copying the base edit. Adenine base editors (ABEs) can convert adenine to inosine, resulting in an A to G change. Creating an adenine base editor requires an additional step because there are no known DNA adenine deaminases. Directed evolution can be used to create one from the RNA adenine deaminase TadA. While cytosine base editors often produce a mixed population of edits, some ABEs do not display significant A to non-G conversion at target loci. The removal of inosine from DNA is likely infrequent, thus preventing the induction of base excision repair. In terms of off-target effects, ABEs also generally compare favorably to other methods. Suitable target nucleic acids will be readily apparent to one of skill in the art depending on the particular need or outcome. The target nucleic acid may be in, for example, a region of euchromatin (e.g., highly expressed gene), or the target nucleic acid may be in a region of heterochromatin (e.g., centromere DNA). A target nucleic acid of the present disclosure may be methylated or it may be unmethylated. The target gene can be any target gene used and / or known in the art. Prime Editing Prime editing is a versatile and precise genome editing method that directly writes new genetic information into a specified DNA site. Such method is explained fully in the literature (see, e.g., Anzalone, A. V., et al. Nature 576, 149-157 (2019). Prime editing uses a catalytically-impaired Cas endonuclease (e.g., Cas9, Cas12) that is fused to an engineered reverse transcriptase (RT) and programmed with a prime-editing guide RNA (pegRNA). The skilled person in the art would appreciate that the pegRNA both specifies the target site and encodes the desired edit. The catalytically-impaired Cas endonuclease also comprises a Cas nickase that is fused to the reverse transcriptase. During genetic editing, the Cas nickase part of the protein is guided to the DNA target site by the pegRNA. The reverse transcriptase domain then uses the pegRNA to template reverse transcription of the desired edit, directly polymerizing DNA onto the nicked ATTY DKT NO: RENA-002WO target DNA strand. The edited DNA strand replaces the original DNA strand, creating a heteroduplex containing one edited strand and one unedited strand. Afterward, the prime editor (PE) guides resolution of the heteroduplex to favor copying the edit onto the unedited strand, completing the process. The prime editors refer to a Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (RT) fused to a Cas nickase. Fusing the RT to the C-terminus of the Cas nickase may result in higher editing efficiency. An example of such a complex is called PE1, e.g., where Cas9(H840A) is fused to M-MLV The Cas9(H840A) can also be linked to a non-M-MLV reverse transcriptase such as a AMV-RT or XRT (Cas9(H840A)-AMV-RT or XRT). The Cas 9(H840A) can be replaced with Cas12a / b or Cas9(D10A). A Cas9 (wild type), Cas9(H840A), Cas9(D10A) or Cas 12a / b nickase fused to a pentamutant of M-MLV RT (D200N / L603W / T330P / T306K / W313F), having up to about 45-fold higher efficiency is called PE2. The M-MLV RT can comprise one or more of the mutations Y8H, P51L, S56A, S67R, E69K, V129P, T197A, H204R, V223H, T246E, N249D, E286R, Q291L, E302K, E302R, F309N, M320L, P330E, L435G, L435R, N454K, D524A, D524G, D524N, E562Q, D583N, H594Q, E607K, D653N, and L671P. The reverse transcriptase can also be a wild-type or modified transcription xenopolymerase (RTX), avian myeloblastosis virus reverse transcriptase (AMV-RT), Feline Immunodeficiency Virus reverse transcriptase (FIV-RT), FeLV-RT (Feline leukemia virus reverse transcriptase), HIV-RT (Human Immunodeficiency Virus reverse transcriptase). PE3 involves nicking the non-edited strand, potentially causing the cell to remake that strand using the edited strand as the template to induce HR. The nicking of the non-edited strand can involve the use of a nicking guide RNA (ngRNA). Nicking the non-edited strand can increase editing efficiency. For example, nicking the non- edited strand can increase editing efficiency by about 1.1 fold, about 1.3 fold, about 1.5 fold, about 1.7 fold, about 1.9 fold, about 2.1 fold, about 2.3 fold, about 2.5 fold, about 2.7 fold, about 2.9 fold, about 3.1 fold, about 3.3 fold, about 3.5 fold, about 3.7 fold, about 3.9 fold, 4.1 fold, about 4.3 fold, about 4.5 fold, about 4.7 fold, about 4.9 fold, or any range that is formed from any two of those values as endpoints. Although the optimal nicking position varies depending on the genomic site, nicks positioned 3′ of the edit about 40 to about 90 bp from the pegRNA-induced nick can generally increase editing efficiency without excess indel formation. The prime editing practice allows starting with ATTY DKT NO: RENA-002WO non-edited strand nicks about 50 bp from the pegRNA-mediated nick, and testing alternative nick locations if indel frequencies exceed acceptable levels. The guide RNA can guide the insertion or deletion of one or more genes of interest or one or more nucleic acid sequences of interest into a target genome. The gRNA can also refer to a prime editing guide RNA (pegRNA), a nicking guide RNA (ngRNA), a single guide RNA (sgRNA), and the like. The pegRNA and the like refer to an extended sgRNA comprising a primer binding site (PBS), a reverse transcriptase (RT) template sequence, and an integration site sequence that can be recognized by recombinases, integrases, or transposases. For example, the PBS can have a length of at least about 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, or more nt. For example, the PBS can have a length of about 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, or any range that is formed from any two of those values as endpoints. For example, the RT template sequence can have a length of at least about 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, 35 nt, 36 nt, 37 nt, 38 nt, 39 nt, 40 nt, 41 nt, 42 nt, 43 nt, 44 nt, 45 nt, 46 nt, 47 nt, 48 nt, 49 nt, 50 nt, or more nt, For example, the RT template sequence can have a length of about 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, 35 nt, 36 nt, 37 nt, 38 nt, 39 nt, 40 nt, 41 nt, 42 nt, 43 nt, 44 nt, 45 nt, 46 nt, 47 nt, 48 nt, 49 nt, 50 nt, or any range that is formed from any two of those values as endpoints. The ngRNA and the like refer to an RNA sequence that can nick a strand such as an edited strand and a non-edited strand. The ngRNA can induce nicks at about one or more nt away from the site of the gRNA-induced nick. For example, the ngRNA can nick at least at about 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 24, 25, 26, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, or more nt away from the site of the gRNA induced nick. ATTY DKT NO: RENA-002WO The gRNA can target a nuclease or a nickase such as Cas9, Cas 12a / b Cas9(H840A) or Cas9 (D10A) molecule to a target nucleic acid or sequence in a genome. The gRNA can bind to a DNA nickase bound to a reverse transcriptase domain. A “modified gRNA,” as used herein, refers to a gRNA molecule that has an improved half-life after being introduced into a cell as compared to a non-modified gRNA molecule after being introduced into a cell. The gRNA can facilitate the addition of the insertion site sequence for recognition by integrases, transposases, or recombinases. During genome editing, the primer binding site allows the 3′ end of the nicked DNA strand to hybridize to the pegRNA, while the RT template serves as a template for the synthesis of edited genetic information. The pegRNA can for example, without limitation, (i) identify the target nucleotide sequence to be edited, and (ii) encode new genetic information that replaces the targeted sequence. The pegRNA can for example, without limitation, (i) identify the target nucleotide sequence to be edited, and (ii) encode an integration site that replaces the targeted sequence. As used herein, the terms “reverse transcriptase,” “reverse transcriptase domain,” and the like refer to an enzyme or an enzymatically active domain that can reverse a RNA transcribe into a complementary DNA. The reverse transcriptase or reverse transcriptase domain is a RNA dependent DNA polymerase. Such reverse transcriptase domains encompass, but are not limited, to a M-MLV reverse transcriptase, or a modified reverse transcriptase such as, without limitation, Superscript® reverse transcriptase (Invitrogen; Carlsbad, Calif.), Superscript® VILO™ cDNA synthesis (Invitrogen; Carlsbad, Calif.), RTX, AMV-RT, and Quantiscript Reverse Transcriptase (Qiagen, Hilden, Germany). The pegRNA-PE complex disclosed herein recognizes the target site in the genome and the Cas9 for example nicks a protospacer adjacent motif (PAM) strand. The primer binding site (PBS) in the pegRNA hybridizes to the PAM strand. The RT template operably linked to the PBS, containing the edit sequence, directs the reverse transcription of the RT template to DNA into the target site. Equilibration between the edited 3′ flap and the unedited 5′ flap, cellular 5′ flap cleavage and ligation, and DNA repair results in stably edited DNA. To optimize base editing, a Cas9 nickase can be used to nick the non-edited strand, thereby directing DNA repair to that strand, using the edited strand as a template. ATTY DKT NO: RENA-002WO Treatment of Cardiovascular Disease In some embodiments, the compositions described herein have an acceptable safety and efficacy profile when administered as a single course, repeat treatment, or combination treatment with other therapeutics. In some embodiments, the compositions described herein are used to induce cellular changes in vitro and / or in vivo, to create permanent changes to the genome by introducing deletions, insertions, or mutations within or near the PCSK9 gene or other DNA sequences that encode regulatory elements of the PCSK9 gene via genome editing, thereby reducing or eliminating expression or function of the PCSK9 gene, for use to treat cardiovascular disease conditions, e.g., dyslipidemia, atherosclerosis, ASCVD, and the like. In some embodiments, the compositions described herein are used to induce cellular changes in vitro and / or in vivo, to create permanent changes to the genome by introducing deletions, insertions, or mutations within or near the ANGPTL3 gene or other DNA sequences that encode regulatory elements of the ANGPTL3 gene via genome editing, thereby reducing or eliminating expression or function of the ANGPTL3 gene, for use to treat cardiovascular disease conditions, e.g., dyslipidemia, atherosclerosis, ASCVD, and the like. In some embodiments, the compositions described herein are used to induce cellular changes in vitro and / or in vivo, to create permanent changes to the genome by introducing deletions, insertions, or mutations within or near the Lp(a) gene or other DNA sequences that encode regulatory elements of the Lp(a) gene via genome editing, thereby reducing or eliminating expression or function of the Lp(a) gene, for use to treat cardiovascular disease conditions, e.g., elevated Lp(a), dyslipidemia, atherosclerosis, ASCVD, and the like. In some embodiments, the compositions described herein are used to induce cellular changes in vitro and / or in vivo, to create permanent changes to the genome by introducing deletions, insertions, or mutations within or near the APOC3 gene or other DNA sequences that encode regulatory elements of the APOC3 gene via genome editing. This approach aims to reduce or eliminate the expression or function of the APOC3 gene, providing potential therapeutic applications for treating cardiovascular disease conditions, e.g., elevated triglycerides, dyslipidemia, atherosclerosis, ASCVD, and related conditions. ATTY DKT NO: RENA-002WO In some embodiments, the compositions described herein are used to induce cellular changes in vitro and / or in vivo, to create permanent changes to the genome by introducing deletions, insertions, or mutations within or near the APOB gene or other DNA sequences that encode regulatory elements of the APOB gene via genome editing, thereby reducing or eliminating expression or function of the APOB gene, for use to treat cardiovascular disease conditions, e.g., dyslipidemia, atherosclerosis, ASCVD, and the like. In some embodiments, the compositions described herein are used to induce cellular changes in vitro and / or in vivo, to create permanent changes to the genome by introducing deletions, insertions, or mutations within or near the PCSK9, ANGPTL3, and Lp(a) genes or other DNA sequences that encode regulatory elements of these genes via genome editing, thereby reducing or eliminating expression or function of the PCSK9, ANGPTL3, and Lp(a) genes, for use to treat cardiovascular disease conditions, e.g., dyslipidemia, atherosclerosis, ASCVD, major adverse cardiovascular events (MACE), and the like. In some embodiments, the compositions described herein are used to induce cellular changes in vitro and / or in vivo, to create permanent changes to the genome by introducing deletions, insertions, or mutations within or near the PCSK9, ANGPTL3, Lp(a), and APOC3 genes or other DNA sequences that encode regulatory elements of these genes via genome editing. This process aims to reduce or eliminate the expression or function of the PCSK9, ANGPTL3, Lp(a), and APOC3 genes, offering potential therapeutic applications for treating cardiovascular disease conditions, e.g., dyslipidemia, atherosclerosis, ASCVD, and related conditions. In some embodiments, the compositions described herein are used to induce cellular changes in vitro and / or in vivo, to create permanent changes to the genome by introducing deletions, insertions, or mutations within or near the PCSK9, ANGPTL3, APOB, Lp(a), and APOC3 genes or other DNA sequences that encode regulatory elements of these genes via genome editing. This process aims to reduce or eliminate the expression or function of the PCSK9, ANGPTL3, APOB, Lp(a), and APOC3 genes, offering potential therapeutic applications for treating cardiovascular disease conditions, e.g., dyslipidemia, atherosclerosis, ASCVD, and related conditions. ATTY DKT NO: RENA-002WO In some embodiments the composition consists of hyperCas12 and crRNA targeting PCSK9, ANGPTL3, and Lp(a). In some embodiments the composition consists of hyperCas12 and crRNA targeting PCSK9 and ANGPTL3. In some embodiments the composition consists of hyperCas12 and crRNA targeting PCSK9 and Lp(a). In some embodiments the composition consists of hyperCas12 and crRNA targeting ANGPTL3 and Lp(a). In some embodiments the composition consists of hyperCas12 and crRNA targeting PCSK9, ANGPTL3, and Lp(a) in any known combination, including having multiple crRNA guides targeting a single gene. For example, the crRNA could consist of a sequence targeting PCSK9, a sequence targeting ANGPTL3, a sequence targeting Lp(a) and a second sequence (either the same sequence included a second time or a completely novel targeting sequence) targeting PCSK9 again. In some embodiments, the use of a multiple guides targeting a single gene, the relative editing can be optimized to allow for greater or less editing of a gene depending on the clinical need. In some embodiments the composition consists of hyperCas12 and crRNA targeting PCSK9, ANGPTL3, Lp(a), and APOC3. In some embodiments the composition consists of hyperCas12 and crRNA targeting PCSK9, ANGPTL3, and APOC3. In some embodiments the composition consists of hyperCas12 and crRNA targeting ANGPTL3, Lp(a), and APOC3. In some embodiments the composition consists of hyperCas12 and crRNA targeting PCSK9, Lp(a), and APOC3. In some embodiments the composition consists of hyperCas12 and crRNA targeting PCSK9, and APOC3. In some embodiments the composition consists of hyperCas12 and crRNA targeting ANGPTL3 and APOC3. In some embodiments the composition consists of hyperCas12 and crRNA targeting Lp(a) and APOC3. In some embodiments the composition consists of hyperCas12 and crRNA targeting PCSK9, ANGPTL3, Lp(a), and APOC3 in any known combination, including having multiple crRNA guides targeting a single gene. In some embodiments, the composition consists of hyperCas12 and crRNA targeting PCSK9, ANGPTL3, Lp(a), APOB, and APOC3. In some embodiments, the composition consists of hyperCas12 and crRNA targeting PCSK9, ANGPTL3, APOB, and APOC3. In some embodiments, the composition consists of hyperCas12 and crRNA targeting PCSK9, ANGPTL3, APOB, and APOC3. In some embodiments, the composition consists of hyperCas12 and crRNA targeting ANGPTL3, Lp(a), APOB, and APOC3. In some embodiments, the composition consists of hyperCas12 and crRNA targeting PCSK9, Lp(a), APOB, and APOC3. In some embodiments, the composition consists of hyperCas12 and crRNA targeting PCSK9, APOB, and APOC3. In some embodiments, the composition consists of hyperCas12 and crRNA ATTY DKT NO: RENA-002WO targeting ANGPTL3, APOB, and APOC3. In some embodiments, the composition consists of hyperCas12 and crRNA targeting Lp(a), APOB, and APOC3. In some embodiments, the composition consists of hyperCas12 and crRNA targeting PCSK9, ANGPTL3, Lp(a), APOB, and APOC3 in any known combination, including having multiple crRNA guides targeting a single gene. In some embodiments the composition consists of hyperCas12 delivered as mRNA along with crRNA. In some embodiments the composition consists of hyperCas12 delivered as plasmid DNA along with crRNA. In some embodiments the crRNA is delivered as a linear sequence without linker sequences. In some embodiments the crRNA is delivered as a linear sequence with linker sequences. Linker sequences refer to sequences designed to maintain crRNA (or guide RNA) structure to improve the likelihood of the Cas protein correctly recognizing and processing. In some embodiments, the linker is the sp1 linker or any of the linkers in the following manuscript (Zhang, X., Wang, X., Lv, J. et al. Engineered circular guide RNAs boost CRISPR / Cas12a- and CRISPR / Cas13d- based DNA and RNA editing. Genome Biol 24, 145 (2023). https: / / doi.org / 10.1186 / s13059-023- 02992-z) In some embodiments the crRNA is delivered as a circular sequence without linker sequences. In some embodiments the crRNA is delivered as a linear sequence with linker sequences, including, but not limited to the linker sequences noted and referenced above. In some embodiments the mRNA and crRNA are delivered as a circular sequence with linker sequences noted and referenced above. In some embodiments the mRNA and crRNA are delivered as a circular sequence without linker sequences. In some embodiments, hyperCas12 is an integral part of a prime editing system comprising circular RNA-mediated prime editors. In some embodiments, the system comprises a nickase- dependent circular RNA prime editor. In some embodiments, the system comprises a nuclease- dependent circular RNA prime editor. In some embodiments, the system comprises a split- nickase-dependent circular RNA prime editor. In some embodiments, the system comprises a split-nuclease-dependent circular RNA prime editor. In some embodiments the circular RNA mediated prime editors possess multiplexing capabilities. In some embodiments, the circular ATTY DKT NO: RENA-002WO RNA mediated prime editors utilize a single promotor. In some embodiments, the circular RNA mediated prime editors utilize multiple promotors. In some embodiments, highly efficient gene-editing of the angiopoietin-like-3 (ANGPTL3) gene are described. In some embodiments, highly efficient gene-editing of the proprotein convertase subtilisin / kexin type 9 (PCSK9) gene are described. In some embodiments, highly efficient gene-editing of the lipoprotein a (Lp(a)) gene are described. In some embodiments, highly efficient gene-editing of the apolipoprotein C-III (APOC3) gene are described. In some embodiments, the location where the gene edit is made is described, including composition and methods directed at editing a gene at an exon, intron, or splice site. In some embodiments, the crRNA targets a regulatory element, for example, an enhancer, promotor or other regulatory element. In some embodiments, the crRNA is cross-reactive for human and chlorocebus sabaeus monkey (for example, the spacer sequence for the crRNA is complementary to a region of the human gene and complementary region to a region of the chlorocebus sabaeus monkey). In some embodiments, the crRNA is cross-reactive for human and chlorocebus sabaeus monkey PCSK9, ANGPTL3, Lp(a), and APOC3 genes or any combination of these genes. As a non- limiting example, in some embodiments the crRNA is cross-reactive for human and chlorocebus sabaeus monkey PCSK9, ANGPTL3, and Lp(a) genes. In another non-limiting example, in some embodiments the crRNA is cross-reactive for human and chlorocebus sabaeus monkey PCSK9 and ANGPTL3 genes. In some embodiments, the crRNA is cross-reactive for human and chlorocebus sabaeus monkey in multiple different areas of the respective gene, for example, exon 1, 2, 3 and so on. In some embodiments, the crRNA is cross-reactive for human and cynomologous monkey (example, the spacer sequence for the crRNA is complementary to a region of the human gene and complementary region to a region of the cynomologous monkey. In some embodiments, compositions comprising CRISPR RNA (crRNA) and base editors that are able to precisely change a single nucleotide and avoid double stranded breaks are described. Compositions and methods of use of those crRNAs and based editors including nucleotide and / or mRNA sequences are contemplated and described herein. ATTY DKT NO: RENA-002WO In some embodiments, the crRNA is a chemically modified crRNA. In certain embodiments, the chemically modified crRNA includes phosphorothioated 2'-O-methyl nucleotides at both the 3' and 5' ends of the crRNA. In some instances, the chemically modified crRNA specifically comprises phosphorothioated 2'-O-methyl nucleotides at the 3' end of the crRNA. Alternatively, in other embodiments, the chemically modified crRNA consists of phosphorothioated 2'-O- methyl nucleotides exclusively at the 5' end of the crRNA. Moreover, in specific cases, the chemically modified crRNA is composed of three phosphorothioated 2'-O-methyl nucleotides at either the 3' end, the 5' end, or a combination of both ends of the crRNA. In some embodiments, the crRNA is a non-chemically modified crRNA. In some embodiments, the cells comprise human hepatocytes. In some embodiments, the cells comprise non-human hepatocytes. In some embodiments, the RNA-guided nuclease and crRNA are preformulated as a ribonucleoprotein particle (RNP) In some embodiments, the nucleic acid therapeutic described herein is delivered via a viral vector, including, but not limited to, an adenovirus vector, lentivirus vector, or HSV vector. In some embodiments, the nucleic acid therapeutic described herein is delivered via a liposome. In some embodiments, the nucleic acid therapeutic described herein is delivered via a lipid nanoparticle (LNP). crRNAs Methods and compositions as described herein may include use of a variety of different crRNA sequences, e.g., which may be present in a guide RNA. Exemplary nucleic acid sequences of crRNAs described herein are provided in Table 2. TABLE 2: Exemplary nucleic acid sequences of crRNAs ATTY DKT NO: RENA-002WO CCGGTGGTCACTCTGTATGCTGG Nucleic acid sequence: PCSK9 – P4 (SEQ ID NO: 8) T T T C C A C C T G T ATTY DKT NO: RENA-002WO TTTTCTACTTACTTTAAGTGAAG Nucleic acid sequence: ANGPTL3 Base Editing (SEQ ID NO: 20) 1A. In some embodiments, the crRNA targets ANGPTL3 with any of the sequences provided in FIG.1B. In some embodiments, the crRNA targets Lp(a) with any of the sequences provided in FIG.1C. In some embodiments, the engineered Cas12a system can have more than one crRNA, and each of the more than one crRNAs has a repeat sequence and a spacer. For instance, the engineered Cas12a system provided herein can have 2, 3, 4, 5, or more crRNAs. In some embodiments, the more than one crRNAs are arranged in tandem, i.e., located immediately adjacent to one another, and configured as a crRNA array. In some embodiments, the crRNA array can have 2-50 crRNAs. In other embodiments, the crRNA array can have 50-100 crRNAs. In some embodiments, the crRNA array can have 100-150 crRNAs. In other embodiments, the crRNA array can have 150-200 crRNAs. However, crRNA arrays containing more than 200 crRNAs are also contemplated by the present disclosure. Each of the one or more crRNAs described herein comprises a repeat sequence and a spacer. The repeat sequence can be a Cas12a repeat sequence. In some embodiments, the repeat sequence is about 8-30 nucleotides long. In some embodiments, the repeat sequence is about 10-25 nucleotides long. In some embodiments, the repeat sequence is about 12-22 nucleotides long. In some embodiments, the repeat sequence is about 14-20 nucleotides long. In some embodiments, the repeat sequence is about 14-18 nucleotides long. The spacer in a crRNA is configured to hybridize to a target nucleic acid. For instance, the spacer in a crRNA can have sequences that are complementary to its target nucleic acid sequence. The complementarity can be partial complementarity or complete (e.g., perfect) complementarity. The terms "complementary" and "complementarity" are used as they are in the art and refer to the natural binding of nucleic acid sequences by base pairing. The complementarity of two polynucleotide strands is achieved by distinct interactions between nucleobases: adenine (A), thymine (T) (uracil (U) in RNA), guanine (G), and cytosine (C). Adenine and guanine are purines, while thymine, cytosine, and uracil are pyrimidines. Both ATTY DKT NO: RENA-002WO types of molecules complement each other and can only base pair with the opposing type of nucleobase by hydrogen bonding. For example, an adenine can only be efficiently paired with thymine (A=T) or uracil (A=U), and guanine can only be efficiently paired with cytosine (G=C). The base complement A=T or A=U shares two hydrogen bonds, while the base pair G=C shares three hydrogen bonds. The two complementary strands are oriented in opposite directions, and they are said to be antiparallel. For another example, the sequence 5'-A-G-T-3' binds to the complementary sequence 3'-T-C-A-5'. The degree of complementarity between two strands may vary from complete (or perfect) complementarity to no complementarity. The degree of complementarity between polynucleotide strands has significant effects on the efficiency and strength of the hybridization between the nucleic acid strands. In some embodiments, the polynucleotide probes provided herein comprise two perfectly complementary strands of polynucleotides. As used herein, the term "perfectly complementary" means that two strands of a double- stranded nucleic acid are complementary to one another at 100% of the bases, with no overhangs on either end of either strand. For example, two polynucleotides are perfectly complementary to one another when both strands are the same length, e.g., 100 bp in length, and each base in one strand is complementary to a corresponding base in the "opposite" strand, such that there are no overhangs on either the 5' or 3' end. In some embodiments, the engineered Cas12a system comprises one or more crRNAs, and each spacer in at least a portion of the one or more crRNAs is configured to hybridize to the same target nucleic acid. In other embodiments, the engineered Cas12a system comprises one or more crRNAs, and each spacer in at least a portion of the one or more crRNAs is configured to hybridize to a different target nucleic acid. In certain embodiments, the engineered Cas12a system comprises one or more crRNAs, and each spacer in all of the one or more crRNAs is configured to hybridize to a different target nucleic acid. The engineered Cas12a system provided herein is capable of binding to one or more target nucleic acids. As used herein, a "target nucleic acid sequence" of an engineered Cas12a system refers to a sequence to which a spacer sequence is designed to have complementarity, where hybridization between a target nucleic acid sequence and a spacer sequence promotes the formation of a CRISPR complex. ATTY DKT NO: RENA-002WO In some embodiments, the target nucleic acid refers to a nucleic acid of interest. For instance, the target nucleic acid can be a nucleic acid being investigated. In some embodiments, the target nucleic acid can be an endogenous gene. The target nucleic acids encompassed by the present disclosure can be RNAs and DNAs. In specific embodiments, the target nucleic acids can be DNAs, in particular, double-stranded DNAs (dsDNAs). Alternatively, the target nucleic acids can be derived from the genomic DNA, mitochondria DNA, chloroplast DNA, or viral DNA in host cells. In some embodiments, the target nucleic acid refers to a genomic site or DNA locus capable of being recognized by and bound to a crRNA provided herein. An enzymatically active crRNA- Cas complex would process such a target site to result in a break at the CRISPR target site. In the case of a deactivated Cas, a crRNA-dCas still recognizes and binds a CRISPR target site without cutting the target nucleic acid (e.g., the target DNA). In some embodiments, the target nucleic acid can be a transcription factor. In some embodiments, the target nucleic acid can be a metabolic enzyme. In other embodiments, the target nucleic acid can be any functional protein. For example, in some embodiments, the target nucleic acid is involved in a pathological pathway, such as, but not limited to, atherosclerotic cardiovascular disease. Non-limiting examples of ASCVD include myocardial infarction, stroke, carotid artery disease, and aortic stenosis. In other embodiments, the target nucleic acid is involved in a biological pathway, such as, but not limited to, aging, cell death, angiogenesis, DNA repair, and stem cell differentiation. In some embodiments, the engineered Cas12a system provided herein can target any number of nucleic acids. In some embodiments, the engineered Cas12a system provided herein can target at least 2-4 different target nucleic acids. In some embodiments, the engineered Cas12a system provided herein can target at least 3 different target nucleic acids. In some embodiments, the engineered Cas12a system provided herein can target at least 5, at least 10, at least 15, at least 20, at least 25, at least 30 different target nucleic acids. In some embodiments, the engineered Cas12a system provided herein can target at least 50 different target nucleic acids. In other embodiments, the engineered Cas12a system provided herein can target at least 100 different target nucleic acids. ATTY DKT NO: RENA-002WO Circular RNA arrays: As used herein, guide RNA (gRNA) also refers to circular guide RNA (cgRNA) unless otherwise noted. A gRNA comprises a polynucleotide sequence complementary to a target sequence (i.e. a targeting sequence). The gRNA hybridizes with the target nucleic acid sequence and directs sequence-specific binding of a CRISPR complex to the target nucleic acid. In some embodiments, an RNA guide has 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% complementarity to a target nucleic acid sequence. The number of distinct gRNA domains or sequences in a cgRNA may vary. In some instances, the number ranges from 1 to 10, such as 1 to 7, e.g., 1 to 5, including 2 to 5. When multiple gRNA domains are present, the domains may be the same or different, and in some instances are different, e.g., where multiplexing is desired. The gRNA domains may target coding or non-coding domains, e.g., transcriptional elements, as desired. In some embodiments, the gRNA is between about 50 nucleotides and 250 nucleotides. In some embodiments, the gRNA is between about 50 nucleotides and 500 nucleotides. In some embodiments, the gRNA is between about 50 nucleotides and 1,000 nucleotides. In some embodiments, the gRNA is about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 nucleotides long. In some embodiments, the gRNA of is between about 50 and 75 nucleotides long. In some embodiments, the gRNA is between about 75 and 100 nucleotides long. In some embodiments, the gRNA is between about 100 and 125 nucleotides long. In some embodiments, the gRNA is between about 125 and 150 nucleotides long. In some embodiments, the gRNA is between about 150 and 175 nucleotides long. In some embodiments, the gRNA is between about 175 and 200 nucleotides long. In some embodiments, the gRNA is between about 200 and 225 nucleotides long. In some embodiments, the gRNA is between about 225 and 250 nucleotides long. In some embodiments, the gRNA comprises a ligated crRNA and a tracrRNA. Various crRNA and tracrRNA sequences are known in the art, for example those associated with several type II CRISPR-Cas9 systems (e.g., WO2013 / 176772), Cpfl, SaCas, and Cas12, among others. A gRNA can be designed to target any target sequence. Optimal alignment is determined using any algorithm for aligning sequences, including the Needleman-Wunsch algorithm, Smith-Waterman algorithm, Burrows-Wheeler algorithm, ClustlW, ClustlX, BLAST, Novoalign, SOAP, Maq, and ELAND. ATTY DKT NO: RENA-002WO In some embodiments, a gRNA is designed to target to a unique target sequence within the genome of a cell. In some embodiments, a gRNA is designed to lack a PAM sequence. In some embodiments, a gRNA sequence is designed to have optimal secondary structure using a folding algorithm including mFold or Geneious. In some embodiments, expression of gRNAs may be under an inducible promoter, e.g. hormone inducible, tetracycline or doxycycline inducible, arabinose inducible, or light inducible. In some embodiments, the gRNA sequence is a "dead crRNAs," "dead guides," or "dead guide sequences" that can form a complex with a CRISPR-associated protein and bind specific targets without any substantial nuclease activity. In some embodiments, the gRNA is chemically modified in the sugar phosphate backbone or base. In some embodiments, the gRNA has one or more of the following modifications 2'O- methyl, 2'F or locked nucleic acids to improve nuclease resistance or base pairing. In some embodiments, the gRNA may contain modified bases such as 2-thiouridiene or N6- methyladenosine. In some embodiments, the gRNA is conjugated with other oligonucleotides, peptides, proteins, tags, dyes, or polyethylene glycol. In some embodiments, the gRNA includes an aptamer or riboswitch sequence that binds specific target molecules due to their three-dimensional structure. In some embodiments, gRNA has two, three, four or five hairpins. In some embodiments, gRNA includes a transcription termination sequence, which includes a polyT sequences comprising six nucleotides. Various methods for the production of guide RNA can be used, including for example, synthetic methods (e.g., solid phase synthesis “SPS”) and / or enzymatically-derived guide RNA (e.g., using T7 RNA polymerase). Either synthetically-derived or enzymatically- derived guide RNA can be used in the methods to produce cgRNA. Two general approaches relating to the production of cgRNA include: 1) using short DNA splints to pre-organize ends of linear gRNA for ligation by a nick-joining ligase (e.g., T4 RNA ligase 2); and 2) using single-stranded RNA ligase (e.g., T4RNA ligase 1) to join untemplated ends of RNA. In some embodiments, cgRNA is synthesized starting from a linear guide RNA. In some embodiments, linear gRNA is produced by in vitro transcription using T7 RNA polymerase, Syn5 polymerase, VSW3 RNA polymerase, or another RNA polymerase. In some embodiments, linear gRNA is produced by in-cell transcription by RNA Polymerase III (U6) or a modified RNA polymerase III such as U6+27 RNA polymerase III. In some ATTY DKT NO: RENA-002WO embodiments, linear gRNA is produced by in cell transcription by RNA Polymerase I or RNA Polymerase II. A segmented synthetic approach is advantageous in producing linear gRNA because short sections of RNA can be produced with greater purity post-purification compared to full length gRNA. In this approach the 5' acceptor RNA is the smallest RNA fragment (about 30- 50 nts) and can thus be purified to a high level before ligation. The 3'donor RNA is terminated with a phosphate that is required for synthesis and thus only the full-length fragment will be incorporated into the full length product (i.e., truncations are not substrates). The advantages are increased when considering gRNAs that are greater than 100 nts, such as pegRNA or Cas12b guides. The types of enzymatic ligations described herein are very high yielding (>80%) and the oligonucleotide starting material can be separated from ligated product with high selectivity, ensuring that full-length product is very pure. These types of enzymatic ligations are relatively inexpensive and scale well. Other means of linear RNA synthesis, include fully synthetic, and RNA-dependent RNA transcription. Using an enzymatic approach to cyclization, a cgRNA is produced using enzymatic methods. In some embodiments, the method comprises contacting a linear guide RNA comprising a phosphate at the 5'- terminus with a ligating enzyme to bring together a first end and a second end of the guide RNA thus creating a cgRNA. The ligation approach described herein makes use of ligases, a class of enzymes that combine sections of nucleic acids with each other. An advantage of using such ligases is that the resulting linkages between the fragments of RNA are indistinguishable from naturally occurring RNA or DNA. The ligases function on RNA or DNA and perform reactions with high efficiency. Various ligases can be used with the methods described herein. For example, one or more of T4 RNA ligase 1, T4 RNA Ligase 2, RtcB Ligase, Thermo-stable 5'App DNA / RNA Ligase, ElectroLigase, T4 DNA Ligase, T3 DNA Ligase, T7 DNA Ligase, Taq DNA Ligase, SplintR Ligase E. coli DNA Ligase, 9°N DNA Ligase, CircLigase, CircLigase II, DNA Ligase I, DNA Ligase III, and DNA Ligase IV can be used. In some embodiments, T4 RNA ligase 1 is used to ligate the first end and the second end of the guide RNA. In some embodiments, T4 RNA ligase 2 is used for ligating the first end and the second end of the guide RNA. In some embodiments, two or more RNA fragments are ligated using a self- templating approach, followed by cyclization to create a cgRNA. For example, in some embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more RNA fragments are ligated, followed by cyclization to create a cgRNA. In some embodiments, producing a synthetic cgRNA comprises providing two or more RNA fragments; providing an oligonucleotide that has partial complementarity to the two or more RNA fragments, wherein the complementarity of the ATTY DKT NO: RENA-002WO oligonucleotide allows for base pairing with the two or more RNA fragments; and providing a ligase to catalyze ligation between the two or more RNA fragments, thus producing a synthetic circular guide RNA (cgRNA). Various kinds of ligation are possible using this approach, such as ligation within a terminal loop of a hairpin formed between the first RNA and the second RNA. Various ligases are suitable for ligation at the terminal loop of a hairpin formed, such as T4 RNA ligase 1. Another kind of ligation that is possible with this approach is ligation within the duplex formed between the first RNA and the second RNA. Various ligases are suitable for ligating at the duplex formed between the two RNAs, such as T4 RNA ligase 2 and DNA ligases. In some embodiments, the cgRNA comprises a crRNA. In some embodiments, the cgRNA comprises a tracrRNA. In some embodiments, the cgRNA comprises a crRNA and a cgRNA. In some embodiments, a linear guide RNA is first synthesized. In this approach, two or more separate RNAs are ligated together. In some embodiments, a first RNA comprises a trans- activating RNA (tracrRNA), and a second RNA comprises a clustered regularly interspersed short palindromic repeats (CRISPR) RNA (crRNA). In some embodiments, the RNA comprising the tracrRNA sequences are synthesized such that a portion of the tracrRNA contains a phosphate at the 5' terminus. Two forms of ligation are possible with this approach, both of which are found within the stem loop region. The first form of ligation occurs within the terminal loop of the hairpin, which is a natural site of T4 RNA Ligase 1. The second form of ligation occurs within the duplex which is a natural of T4 RNA Ligase 2 and DNA ligases. One of the advantages of this form of ligation is that fragment impurities are readily removable because of the marked differences in elution time between the fused gRNA and the fragment impurities. Circular RNAs are a class of natural or synthetic RNA without 5’ or 3’ ends. Their unique covalently closed structure prevents RNA degradation by exonucleases, giving them comparative biostability in contrast to linear RNA sequences, which tend to be more rapidly degraded. This has potentially utility in conjunction with genome editing therapeutics, including, but not limited to, hyperCas12a or other Cas proteins. In some embodiments, the circular RNA comprises an intron scar from a self-splicing intron. In some embodiments, the intron scar originates from the T4 phage thymidylate synthase, ATTY DKT NO: RENA-002WO Anabaena pre-tRNA, or other self-splicing intron. In some embodiments, the intron scar may have a length of approximately 46 to 66 nucleotides. In some embodiments, the circular RNA does not comprise an intron scar and, rather, is circularized by enzymatic ligation. In some embodiments, the circular RNA comprises one or more linker sequences with low RNA complexity (i.e. minimal RNA secondary structure). In some embodiments, the linker sequences are polyA tracts, polyAC tracts, Sp1 linkers, or a combination of the above. In some embodiments, each linker sequence may have a length of approximately 10 to 70 nucleotides. In some embodiments, the circular RNA comprises one or more CRISPR RNA (crRNA) repeat sequences. In some embodiments, the repeat sequences originate from Lachnospiraceae bacterium Cas12a (LbCas12a) or Acidaminococcus species BV3L6 Cas12a (AsCas12a). In some embodiments, each crRNA repeat sequence may have a length of approximately 20 nucleotides. In some embodiments, the circular RNA comprises one or more crRNA guide sequences which recognize 21-24 bases opposite of a TTTG, TTTC, or TTTA motif in the human genome. In some embodiments, each crRNA guide sequence may have a length of approximately 20 to 25 nucleotides. In some embodiments, the circular RNA comprises, from 5’ to 3' orientation: a) a self-splicing intron scar, b) one or more linker sequences, c) a crRNA repeat sequence, d) one or more crRNA guide sequences separated by crRNA repeat sequences, e) a crRNA repeat sequence, and f) one of more linker sequences. In some embodiments, the circular RNA comprises the previous statement without an intron scar. In some embodiments, the circular RNA further comprises an expression cassette. In some embodiments, this expression cassette comprises an internal ribosome entry site (IRES) followed by a coding sequence of interest. In some embodiments, the coding sequence may encode a therapeutic protein such as a cytokine or a functional fragment thereof. In some embodiments, the coding sequence may encode a transcription factor, an immune checkpoint inhibitor, a chimeric antigen receptor, or a Cas protein. ATTY DKT NO: RENA-002WO In some embodiments, the expression cassette and crRNA array sequences are on the same circular RNA polynucleotide and separated by a spacer sequence. In some embodiments, this crRNA array comprises, from 5’ to 3’ orientation: a) one or more linker sequences, b) a crRNA repeat sequence, c) one or more crRNA guide sequences separated by crRNA repeat sequences, d) a crRNA repeat sequence, and e) one of more linker sequences. In some embodiments, the spacer sequence is a 3’ untranslated region from a human gene. In some embodiments, the spacer sequence may have a length of approximately 20 to 500 nucleotides. In some embodiments, the expression cassette and crRNA array sequences are on separate circular RNA polynucleotides. In some embodiments, the circular RNA is produced through circularization of an RNA polynucleotide that comprises, from 5’ to 3’ orientation: a) a 3' fragment from a self-splicing intron, b) a crRNA array, an expression cassette, or both, and c) a 5' fragment from a self- splicing intron. In some embodiments, the circular RNA is produced through enzymatic ligation of an RNA polynucleotide that comprises only a crRNA array, an expression cassette, or both. In some embodiments, the circular RNA is purified from non-circular RNA by enzymatic digestion, gel purification, high-performance liquid chromatography, or a combination of the above. An exemplary circular crRNA array and its application are illustrated in FIG.2A and described in Example 1. A circular crRNA array may comprise, from 5’ to 3’ orientation: a) an intron scar, b) polyAC tract, c) LbCas12 crRNA repeat, d) crRNA target guide sequence, e) another LbCas12 crRNA repeat, f) another crRNA target guide sequence, g) another LbCas12 crRNA repeat, and h) another polyAC tract. FIG.2B provides another exemplary circular crRNA according to an embodiment of the invention. In some embodiments, a therapeutic comprises a delivery vehicle formulated with a circular RNA encoding hyperCas12 and a circular crRNA array. In some embodiments, a therapeutic comprises a delivery vehicle formulated with an mRNA encoding hyperCas12 and a circular crRNA array. In some embodiments, a therapeutic comprises a delivery vehicle formulated with hyperCas12 protein and a circular crRNA array. In some embodiments, a therapeutic comprises a delivery vehicle formulated with a circular RNA encoding hyperdCas12a with a KRAB repressor domain and including a crRNA assay of targets. In some embodiments, a therapeutic ATTY DKT NO: RENA-002WO comprises a delivery vehicle formulated with a circular RNA encoding hyperdCas12a with a miniaturized VPR activation domain and including a crRNA assay of targets. In some embodiments, a therapeutic comprises a delivery vehicle formulated with a circular RNA encoding hyperdCas12a with a base editor and including a crRNA assay of targets. Circular RNAs, e.g., cgRNAs, as well as methods for making and delivery systems therefore, are further described in WO2022256578, which disclosure is incorporated herein by reference. SEQUENCES T4 phage thymidylate synthase intron scar (SEQ ID NO: 45) CTCAGTAGATGTTTTCTTGGGTCTACCGTTTAATATTGCGTCATAT Anabaena pre-tRNA intron scar (SEQ ID NO: 21) AGACGCTACGGACTTAAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA PolyA tract (SEQ ID NO: 22) AAAAAAAAAAAAAAAAAAAAAAAAA PolyAC tract version 1(SEQ ID NO: 23) AAAAACAAAAAACAAAAAAAACAAAAAAAAAACCAAAAAAACAAAACACA PolyAC tract version 2(SEQ ID NO: 24) AAAAAACAAAAAACAAAAC Sp1 linker version 1(SEQ ID NO: 25) CGCCGGAAACGCAATAGCCGAAAAACAAAAAACAAAAAAACC Sp1 linker version 2(SEQ ID NO: 26) AAAAAACAAAAAACAAAACGGCTATTATGCGTTACCGGCG Sp1 linker version 3(SEQ ID NO: 27) CGCCGGAAACGCAATAGCCGAAAAACAAAAAACAAAAAAAACAAAAAAAAAACCAAAAAAACAAAACACA crRNA repeat (SEQ ID NO: 28)AATTTCTACTAAGTGTAGAT ATTY DKT NO: RENA-002WO Genomic Editing of Non-Coding Sequences, e.g., Transcriptional Elements In some embodiments, any of the compositions described herein can be directed to edit non- coding domains, e.g., transcriptional elements. Transcriptional elements are non-coding regions of a gene but are typically required for gene transcription. Gene transcriptional elements comprise promoters, enhancers, silencers, insulators, transcription factor binding sites, TATA box, CpG islands, splice sites, polyadenylation signals, and terminator sequences. Transcriptional elements can be edited via any of the Cas enzymes described herein, including nuclease active Cas enzymes. In some embodiments, transcriptional elements can be edited via hyperCas12 (SEQ ID 1). In other embodiments, nuclease inactive Cas enzymes can be used to regulate expression of transcriptional elements. Nuclease inactive Cas enzymes can be paired with repressors and activators to effect gene expression changes. In some embodiments, transcriptional elements can be edited via nuclease inactive hyperCas12 (SEQ ID 2). While epigenetic modification can aid in reducing or increasing expression of a gene or multiple genes, the effect tends to be transient. To combat this, Cas repressors and activators need to be permanently expressed in a cell, and this can in some cases lead to negative side effects. Base editing of transcriptional elements is a potential strategy that avoids the risk of nuclease- active double stranded breaks, while simultaneously offering long-lasting genetic modifications via instituting permanent changes to the nucleotide sequence. Base editors yield predictable outcomes and reproducible changes in a gene. In some embodiments, any of the Cas enzymes fused to a deaminase described herein may be utilized to base edit transcriptional regulatory elements. In some embodiments, the engineered Cas12a protein provided herein comprises a sequence that is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity to a sequence set forth in SEQ ID NO 4, and is used to base edit gene transcriptional elements comprising promoters, enhancers, silencers, insulators, transcription factor binding sites, TATA box, CpG islands, splice sites, polyadenylation signals, and terminator sequences. ATTY DKT NO: RENA-002WO In some embodiments, the engineered Cas12a protein provided herein comprises a sequence that is at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity to a sequence set forth in SEQ ID NO: 5, and is used to base edit gene transcriptional elements comprising promoters, enhancers, silencers, insulators, transcription factor binding sites, TATA box, CpG islands, splice sites, polyadenylation signals, and terminator sequences. Because base editing of transcriptional elements may be less likely to result in permanent reduction of activation of a gene, base editing of a transcriptional element may benefit from targeting multiple areas in a single transcriptional element. In some embodiments, multiplex base editing can be used to target single areas in multiple different transcriptional elements. In some embodiments, a base edit target may be targeted in the TATA box and another in a splice site. In some embodiments, a promoter element may be targeted for editing along with an enhancer element. In some embodiments, a promoter element may be targeted for editing along with a silencer element. In some embodiments, a promoter element may be targeted for editing along with an insulator element. In some embodiments, a promoter element may be targeted for editing along with a transcription factor binding site. In some embodiments, a promoter element may be targeted for editing along with a TATA box. In some embodiments, a promoter element may be targeted for editing along with a CpG island. In some embodiments, a promoter element may be targeted for editing along with a splice site. In some embodiments, a promoter element may be targeted for editing along with a polyadenylation signal. In some embodiments, a promoter element may be targeted for editing along with a terminator sequence. In some embodiments, an enhancer element may be targeted for editing along with a silencer element. In some embodiments, an enhancer element may be targeted for editing along with an insulator element. In some embodiments, an enhancer element may be targeted for editing along with a transcription factor binding site. In some embodiments, an enhancer element may be targeted for editing along with a TATA box. In some embodiments, an enhancer element may be targeted for editing along with a CpG island. In some embodiments, an enhancer element may be targeted for editing along with a splice site. In some embodiments, an enhancer element may be targeted for editing along with a polyadenylation signal. In some embodiments, an enhancer element may be targeted for editing along with a terminator sequence. In some embodiments, a silencer element may be targeted for editing along with an insulator element. In some ATTY DKT NO: RENA-002WO embodiments, a silencer element may be targeted for editing along with a transcription factor binding site. In some embodiments, a silencer element may be targeted for editing along with a TATA box. In some embodiments, a silencer element may be targeted for editing along with a CpG island. In some embodiments, a silencer element may be targeted for editing along with a splice site. In some embodiments, a silencer element may be targeted for editing along with a polyadenylation signal. In some embodiments, a silencer element may be targeted for editing along with a terminator sequence. In some embodiments, an insulator element may be targeted for editing along with a transcription factor binding site. In some embodiments, an insulator element may be targeted for editing along with a TATA box. In some embodiments, an insulator element may be targeted for editing along with a CpG island. In some embodiments, an insulator element may be targeted for editing along with a splice site. In some embodiments, an insulator element may be targeted for editing along with a polyadenylation signal. In some embodiments, an insulator element may be targeted for editing along with a terminator sequence. In some embodiments, a transcription factor binding site may be targeted for editing along with a TATA box. In some embodiments, a transcription factor binding site may be targeted for editing along with a CpG island. In some embodiments, a transcription factor binding site may be targeted for editing along with a splice site. In some embodiments, a transcription factor binding site may be targeted for editing along with a polyadenylation signal. In some embodiments, a transcription factor binding site may be targeted for editing along with a terminator sequence. In some embodiments, a TATA box may be targeted for editing along with a CpG island. In some embodiments, a TATA box may be targeted for editing along with a splice site. In some embodiments, a TATA box may be targeted for editing along with a polyadenylation signal. In some embodiments, a TATA box may be targeted for editing along with a terminator sequence. In some embodiments, a CpG island may be targeted for editing along with a splice site. In some embodiments, a CpG island may be targeted for editing along with a polyadenylation signal. In some embodiments, a CpG island may be targeted for editing along with a terminator sequence. In some embodiments, a splice site may be targeted for editing along with a polyadenylation signal. In some embodiments, a splice site may be targeted for editing along with a terminator sequence. In some embodiments, a polyadenylation signal may be targeted for editing along with a terminator sequence. In some embodiments, 3 or more transcriptional elements may be targeted simultaneously via multiplex base editing. In some embodiments, 4 or more transcriptional elements may be ATTY DKT NO: RENA-002WO targeted simultaneously via multiplex base editing. In some embodiments, 5 or more transcriptional elements may be targeted simultaneously via multiplex base editing. In some embodiments, Cas12 editing is envisioned, taking advantage of TTT rich segments in transcriptional elements. In some embodiments, hyperCas12 varients are utilized, taking advantage of TTT rich segments in transcriptional elements. In some embodiments, base editing of transcriptional elements can be used to reduce LDL via silencing of PCSK9. In some embodiments, base editing of transcriptional elements can be used to reduce LDL via silencing of ANGPTL3. In some embodiments, base editing of transcriptional elements can be used to reduce Lp(a) via silencing of Lp(a). In some embodiments, base editing of transcriptional elements can be used to reduce LDL via silencing of APOB. In some embodiments, base editing of transcriptional elements can be used to reduce LDL via silencing of APOC3. In some embodiments, multiplex base editing of a single transcriptional element, targeting 2 or more locations in a single type of transcriptional element, can be used to reduce LDL via silencing of PCSK9. In some embodiments, multiplex base editing of a single transcriptional element, targeting 2 or more locations in a single type of transcriptional element, can be used to reduce LDL via silencing of ANGPTL3. In some embodiments, multiplex base editing of a single transcriptional element, targeting 2 or more locations in a single type of transcriptional element, can be used to reduce Lp(a) via silencing of Lp(a). In some embodiments, multiplex base editing of a single transcriptional element, targeting 2 or more locations in a single type of transcriptional element, can be used to reduce LDL via silencing of APOB. In some embodiments, multiplex base editing of a single transcriptional element, targeting 2 or more locations in a single type of transcriptional element, can be used to reduce cholesterol via silencing of APOC3. In some embodiments, multiplex base editing of one or more transcriptional elements can be used to reduce LDL via silencing of PCSK9. In some embodiments, multiplex base editing of one or more transcriptional elements can be used to reduce LDL via silencing of ANGPTL3. In some embodiments, multiplex base editing of one or more transcriptional elements can be used to reduce Lp(a) via silencing of Lp(a). In some embodiments, multiplex base editing of one or more transcriptional elements can be used to reduce LDL via silencing of APOB. In some ATTY DKT NO: RENA-002WO embodiments, multiplex base editing of one or more transcriptional elements can be used to reduce cholesterol via silencing of APOC3. While the above discussion is provided in part in connection with cardiovascular disease targets, this embodiment of the invention is not so limited. Instead, the embodiment in which non-coding sequences, such as transcriptional elements, are targeted with a multiplex approach, such as employed a cgRNA targeting multiple different locations (e.g., as described above) may be employed to target any combination of non-coding sequences, as well as any combination of non-coding and coding sequences. Compositions and Methods The present disclosure further provides pharmaceutical compositions comprising the engineered Cas12a proteins, guide arrays including crRNA arrays, the nucleic acids, the vectors, or the engineered Cas12a systems described herein. In some embodiments, the pharmaceutical compositions further comprise one or more pharmaceutically acceptable excipients or carriers. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable excipients include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.), or phosphate buffered saline (PBS). In all cases, the composition should be sterile and should be fluid to the extent that it can be administered by syringe. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The excipient can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants, e.g., sodium dodecyl sulfate. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be generally to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. ATTY DKT NO: RENA-002WO Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. In some embodiments, the engineered Cas12a proteins, the nucleic acids, the vectors, or the engineered Cas12a systems of the disclosure can be administered by transfection or infection with nucleic acids encoding them, using methods known in the art, including but not limited to the methods described in McCaffrey et al., Nature (2002) 418:6893, Xia et al., Nature Biotechnol (2002) 20:1006-10, and Putnam, Am J Health Syst Pharm (1996) 53: 151-60, erratum at Am J Health Syst Pharm (1996) 53:325. Provided herein are compositions for ex vivo and in vivo genome editing to create permanent changes to the genome by deleting or mutating the PCSK9 gene or other DNA or RNA sequences that encode regulatory elements of the PCSK9 gene. In some embodiments, compositions comprise hyperCas12 and crRNA to permanently edit within or near the genomic locus of the PCSK9 gene or other sequences that encode regulatory elements of the PCSK9 gene. In some embodiments, the crRNA comprises a single target sequence in the PCSK9 gene or DNA sequences that regulate the PCSK9 gene. In some embodiments, the crRNA comprises the same sequence multiple times, resulting the production of 2 or more copies of the same crRNA (gRNA) inside the cell to increase the efficiency of PCSK9 editing. In some embodiments, the crRNA comprises 2 or more different sequences, resulting the production of 2 or more unique crRNA (gRNA) inside the cell to increase the efficiency of PCSK9 editing. In some embodiments, the crRNA comprises a secondary structure to aid in stability and durability of expression, including utilization of linkers. In some embodiments, the crRNA comprises a secondary structure to aid in stability and durability of expression, including utilization of circular ATTY DKT NO: RENA-002WO RNA. In some embodiments, the hyperCas12 endonuclease and crRNA are delivered to cells in a lipid nanoparticle. In some embodiments, the compositions result in reduced or eliminated expression of the PCSK9 gene following a single treatment. In some embodiments, the compositions result in reduced or eliminated expression of the PCSK9 gene following repeated treatments. Provided herein are compositions for ex vivo and in vivo genome editing to induce permanent alterations in the genome by deleting or mutating the ANGPTL3 gene or other DNA or RNA sequences encoding regulatory elements of the ANGPTL3 gene. In certain embodiments, the compositions comprise hyperCas12 and crRNA designed to enact permanent edits within or near the genomic locus of the ANGPTL3 gene or other sequences regulating the ANGPTL3 gene. The crRNA in specific embodiments includes a single target sequence in the ANGPTL3 gene or DNA sequences governing the ANGPTL3 gene. Alternatively, the crRNA may feature the same sequence multiple times, generating two or more copies of the identical crRNA (gRNA) within the cell to enhance the efficiency of ANGPTL3 editing. In other embodiments, the crRNA may encompass two or more different sequences, producing two or more distinct crRNAs (gRNAs) within the cell to augment the efficiency of ANGPTL3 editing. The crRNA, in various embodiments, is delivered with a secondary structure, utilizing linkers or circular RNA, to enhance stability and durability of expression. The compositions, in some instances, lead to the diminished or abolished expression of the ANGPTL3 gene following a single treatment or repeated treatments. Provided herein are compositions for ex vivo and in vivo genome editing to induce permanent alterations in the genome by deleting or mutating the Lp(a) gene or other DNA or RNA sequences encoding regulatory elements of the Lp(a) gene. In certain embodiments, the compositions comprise hyperCas12 and crRNA designed to enact permanent edits within or near the genomic locus of the Lp(a) gene or other sequences regulating the Lp(a) gene. The crRNA in specific embodiments includes a single target sequence in the Lp(a) gene or DNA sequences governing the Lp(a) gene. Alternatively, the crRNA may feature the same sequence multiple times, generating two or more copies of the identical crRNA (gRNA) within the cell to enhance the efficiency of Lp(a) editing. In other embodiments, the crRNA may encompass two or more different sequences, producing two or more distinct crRNAs (gRNAs) within the cell to augment the efficiency of Lp(a) editing. The crRNA, in various embodiments, is delivered with a secondary structure, utilizing linkers or circular RNA, to enhance stability and durability of ATTY DKT NO: RENA-002WO expression. The compositions, in some instances, lead to the diminished or abolished expression of the Lp(a) gene following a single treatment or repeated treatments. Provided herein are compositions for ex vivo and in vivo genome editing to induce permanent alterations in the genome by deleting or mutating the APOC3 gene or other DNA or RNA sequences encoding regulatory elements of the APOC3 gene. In certain embodiments, the compositions comprise hyperCas12 and crRNA designed to enact permanent edits within or near the genomic locus of the APOC3 gene or other sequences regulating the APOC3 gene. The crRNA in specific embodiments includes a single target sequence in the APOC3 gene or DNA sequences governing the APOC3 gene. Alternatively, the crRNA may feature the same sequence multiple times, generating two or more copies of the identical crRNA (gRNA) within the cell to enhance the efficiency of APOC3 editing. In other embodiments, the crRNA may encompass two or more different sequences, producing two or more distinct crRNAs (gRNAs) within the cell to augment the efficiency of APOC3 editing. The crRNA, in various embodiments, is delivered with a secondary structure, utilizing linkers or circular RNA, to enhance stability and durability of expression. The compositions, in some instances, lead to the diminished or abolished expression of the APOC3 gene following a single treatment or repeated treatments. Provided herein are compositions for ex vivo and in vivo genome editing to induce permanent alterations in the genome by deleting or mutating the APOB gene or other DNA or RNA sequences encoding regulatory elements of the APOB gene. In certain embodiments, the compositions comprise hyperCas12 and crRNA designed to enact permanent edits within or near the genomic locus of the APOB gene or other sequences regulating the APOB gene. The crRNA in specific embodiments includes a single target sequence in the APOB gene or DNA sequences governing the APOB gene. Alternatively, the crRNA may feature the same sequence multiple times, generating two or more copies of the identical crRNA (gRNA) within the cell to enhance the efficiency of APOB editing. In other embodiments, the crRNA may encompass two or more different sequences, producing two or more distinct crRNAs (gRNAs) within the cell to augment the efficiency of APOB editing. The crRNA, in various embodiments, is delivered with a secondary structure, utilizing linkers or circular RNA, to enhance stability and durability of expression. The compositions, in some instances, lead to the diminished or abolished expression of the APOB gene following a single treatment or repeated treatments. ATTY DKT NO: RENA-002WO Provided herein are compositions for ex vivo and in vivo genome editing to induce permanent alterations in the genome by deleting or mutating the PCSK9 and ANGPTL3 genes or other DNA or RNA sequences encoding regulatory elements of the PCSK9 and ANGPTL3 genes. In certain embodiments, the compositions comprise hyperCas12 and crRNA designed to enact permanent edits within or near the genomic loci of the PCSK9 and ANGPTL3 genes or other sequences regulating these genes. The crRNA in specific embodiments includes a single target sequence in the PCSK9 and ANGPTL3 genes or DNA sequences governing these genes. Alternatively, the crRNA may feature the same sequence multiple times, generating two or more copies of the identical crRNA (gRNA) within the cell to enhance the efficiency of editing both PCSK9 and ANGPTL3. In other embodiments, the crRNA may encompass two or more different sequences, producing two or more distinct crRNAs (gRNAs) within the cell to augment the efficiency of editing both PCSK9 and ANGPTL3. The crRNA, in various embodiments, is delivered with a secondary structure, utilizing linkers or circular RNA, to enhance stability and durability of expression. The compositions, in some instances, lead to the diminished or abolished expression of both PCSK9 and ANGPTL3 genes following a single treatment or repeated treatments. Provided herein are compositions for ex vivo and in vivo genome editing to induce permanent alterations in the genome by deleting or mutating the PCSK9, ANGPTL3, and Lp(a) genes or other DNA or RNA sequences encoding regulatory elements of these genes. In certain embodiments, the compositions comprise hyperCas12 and crRNA designed to enact permanent edits within or near the genomic loci of the PCSK9, ANGPTL3, and Lp(a) genes or other sequences regulating these genes. The crRNA in specific embodiments includes a single target sequence in the PCSK9, ANGPTL3, and Lp(a) genes or DNA sequences governing these genes. Alternatively, the crRNA may feature the same sequence multiple times, generating two or more copies of the identical crRNA (gRNA) within the cell to enhance the efficiency of editing PCSK9, ANGPTL3, and Lp(a). In other embodiments, the crRNA may encompass two or more different sequences, producing two or more distinct crRNAs (gRNAs) within the cell to augment the efficiency of editing PCSK9, ANGPTL3, and Lp(a). The crRNA, in various embodiments, is delivered with a secondary structure, utilizing linkers or circular RNA, to enhance stability and durability of expression. The compositions, in some instances, lead to the diminished or abolished expression of PCSK9, ANGPTL3, and Lp(a) genes following a single treatment or repeated treatments. ATTY DKT NO: RENA-002WO Provided herein are compositions for ex vivo and in vivo genome editing to induce permanent alterations in the genome by deleting or mutating the PCSK9, ANGPTL3, Lp(a), and APOC3 genes or other DNA or RNA sequences encoding regulatory elements of these genes. In certain embodiments, the compositions comprise hyperCas12 and crRNA designed to enact permanent edits within or near the genomic loci of the PCSK9, ANGPTL3, Lp(a), and APOC3 genes or other sequences regulating these genes. The crRNA in specific embodiments includes a single target sequence in the PCSK9, ANGPTL3, Lp(a), and APOC3 genes or DNA sequences governing these genes. Alternatively, the crRNA may feature the same sequence multiple times, generating two or more copies of the identical crRNA (gRNA) within the cell to enhance the efficiency of editing PCSK9, ANGPTL3, Lp(a), and APOC3. In other embodiments, the crRNA may encompass two or more different sequences, producing two or more distinct crRNAs (gRNAs) within the cell to augment the efficiency of editing PCSK9, ANGPTL3, Lp(a), and APOC3. The crRNA, in various embodiments, is delivered with a secondary structure, utilizing linkers or circular RNA, to enhance stability and durability of expression. The compositions, in some instances, lead to the diminished or abolished expression of PCSK9, ANGPTL3, Lp(a), and APOC3 genes following a single treatment or repeated treatments. Provided herein are compositions for ex vivo and in vivo genome editing to induce permanent alterations in the genome by deleting or mutating the PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes or other DNA or RNA sequences encoding regulatory elements of these genes. In certain embodiments, the compositions comprise hyperCas12 and crRNA designed to enact permanent edits within or near the genomic loci of the PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes or other sequences regulating these genes. The crRNA in specific embodiments includes a single target sequence in the PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes or DNA sequences governing these genes. Alternatively, the crRNA may feature the same sequence multiple times, generating two or more copies of the identical crRNA (gRNA) within the cell to enhance the efficiency of editing PCSK9, ANGPTL3, Lp(a), APOC3, and APOB. In other embodiments, the crRNA may encompass two or more different sequences, producing two or more distinct crRNAs (gRNAs) within the cell to augment the efficiency of editing PCSK9, ANGPTL3, Lp(a), APOC3, and APOB. The crRNA, in various embodiments, is delivered with a secondary structure, utilizing linkers or circular RNA, to enhance stability and durability of expression. The compositions, in some instances, lead to the diminished or abolished expression of PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes following a single treatment or repeated treatments. ATTY DKT NO: RENA-002WO In some embodiments, compositions are provided for base editing of PCSK9, ANGPTL3, Lp(a), APOB and APOC3 genes or other DNA or RNA sequences encoding regulatory elements of these genes. In certain embodiments, the compositions comprise hyperCas12, base editor and crRNA designed to enact permanent edits within or near the genomic loci of the PCSK9, ANGPTL3, Lp(a), and APOC3 genes or other sequences regulating these genes. Delivery Vehicles LNP, Virus Like Particles, CARTs, AAVs, nucleosome core protein, Lentivirus delivery US20220396548A1 is incorporated herein in its entirety. Guide RNA polynucleotides (RNA or DNA) and / or endonuclease polynucleotide(s) (RNA or DNA) can be delivered by viral or non-viral delivery vehicles known in the art. Alternatively, endonuclease polypeptide(s) can be delivered by viral or non-viral delivery vehicles known in the art, such as electroporation or lipid nanoparticles. In further alternative aspects, the DNA endonuclease can be delivered as one or more polypeptides, either alone or pre-complexed with one or more guide RNAs, or one or more crRNA together. Polynucleotides can be delivered by non-viral delivery vehicles including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, virus like particles, positively charged peptides, small molecule RNA-conjugates, aptamer-RNA chimeras, and RNA-fusion protein complexes. Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, Gene Therapy, 18: 1127-1133 (2011) (which focuses on non-viral delivery vehicles for siRNA that are also useful for delivery of other polynucleotides). For polynucleotides of the invention, the formulation may be selected from any of those taught, for example, in International Application PCT / US2012 / 069610 or in US US20220396548A1. Polynucleotides, such as guide RNA, sgRNA, and mRNA encoding an endonuclease, may be delivered to a cell or a patient by a lipid nanoparticle (LNP). ATTY DKT NO: RENA-002WO In some cases, chemical delivery systems can be used, for example, by using nanomeric complexes, which include compaction of negatively charged nucleic acid by polycationic nanomeric particles, belonging to cationic liposome / micelle or cationic polymers. Cationic lipids used for the delivery method includes, but not limited to monovalent cationic lipids, polyvalent cationic lipids, guanidine containing compounds, cholesterol derivative compounds, cationic polymers, (e.g., poly(ethylenimine), poly-L-lysine, protamine, other cationic polymers), and lipid- polymer hybrid. Microparticle / Nanoparticles. In some embodiments, nucleic acids (e.g., Nuclease coding sequence, cgRNA, etc.) as described herein are delivered by a nanoparticle. One example of a nanoparticle that finds use in the delivery of the subject nucleic acids is a lipid nanoparticle (LNP). Generally, LNPs of the present disclosure may be composed of nucleic acid molecules, one or more ionizable or cationic lipids (or salts thereof), one or more non-ionic or neutral lipids (e.g., a phospholipid), a molecule that prevents aggregation (e.g., PEG or a PEG-lipid conjugate), and optionally a sterol (e.g., cholesterol). LNPs may be made from cationic, anionic, or neutral lipids. Neutral lipids, such as the fusogenic phospholipid DOPE or the membrane component cholesterol, may be included in LNPs as ‘helper lipids’ to enhance transfection activity and nanoparticle stability. For example, lipid nanoparticles may comprise an ionizable amino lipid (e.g., heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate, DLin-MC3- DMA, a phosphatidylcholine (1,2-distearoyl-sn-glycero-3-phosphocholine, DSPC), cholesterol and a coat lipid (polyethylene glycol-dimyristolglycerol, PEG-DMG), for example as disclosed by Tam et al. (2013). Advances in Lipid Nanoparticles for siRNA delivery. Pharmaceuticals 5(3): 498-507. Any lipid or combination of lipids that are known in the art can be used to produce an LNP. Examples of lipids used to produce LNPs are: DOTMA, DOSPA, DOTAP, DMRIE, DC- cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE, and GL67A-DOPE-DMPE-polyethylene glycol (PEG). Examples of cationic lipids are: 98N12-5, C12-200, DLin-KC2-DMA (KC2), DLin- MC3-DMA (MC3), XTC, MD1, and 7C1. Examples of neutral lipids are: DPSC, DPPC, POPC, DOPE, and SM. Examples of PEG-modified lipids are: PEG-DMG, PEG-CerC14, and PEG- CerC20. The lipids can be combined in any number of molar ratios to produce an LNP. In addition, the polynucleotide(s) can be combined with lipid(s) in a wide range of molar ratios to produce an LNP. In some embodiments, a lipid nanoparticle has a mean diameter between about 10 and about 1000 nm. In some embodiments, a lipid nanoparticle has a diameter that is less than 300 nm. In ATTY DKT NO: RENA-002WO some embodiments, a lipid nanoparticle has a diameter between about 10 and about 300 nm. In some embodiments, a lipid nanoparticle has a diameter that is less than 200 nm. In some embodiments, a lipid nanoparticle has a diameter between about 25 and about 200 nm. In some embodiments, a lipid nanoparticle preparation (e.g., composition comprising a plurality of lipid nanoparticles) has a size distribution in which the mean size (e.g., diameter) is about 70 nm to about 200 nm, and more typically the mean size is about 100 nm or less. A LNP refers to any particle having a diameter of less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, a nanoparticle may range in size from 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm. In some aspects, the disclosure provides for a lipid nanoparticle comprising nucleic acids as described herein and an ionizable lipid. The ionizable lipid is typically employed to condense the nucleic acid cargo, e.g., nucleic acids at low pH and to drive membrane association and fusogenicity. Generally, ionizable lipids are lipids comprising at least one amino group that is positively charged or becomes protonated under acidic conditions, for example at pH of 6.5 or lower. Ionizable lipids are also referred to as cationic lipids herein. Exemplary ionizable lipids are described in International PCT patent publications WO2015 / 095340, WO2015 / 199952, WO2018 / 011633, WO2017 / 049245, WO2015 / 061467, WO2012 / 040184, WO2012 / 000104, WO2015 / 074085, WO2016 / 081029, WO2017 / 004143, WO2017 / 075531, WO2017 / 117528, WO2011 / 022460, WO2013 / 148541, WO2013 / 116126, WO2011 / 153120, WO2012 / 044638, WO2012 / 054365, WO2011 / 090965, WO2013 / 016058, WO2012 / 162210, WO2008 / 042973, WO2010 / 129709, WO2010 / 144740, WO2012 / 099755, WO2013 / 049328, WO2013 / 086322, WO2013 / 086373, WO2011 / 071860, WO2009 / 132131, WO2010 / 048536, WO2010 / 088537, WO2010 / 054401, WO2010 / 054406, WO2010 / 054405, WO2010 / 054384, WO2012 / 016184, WO2009 / 086558, WO2010 / 042877, WO2011 / 000106, WO2011 / 000107, WO2005 / 120152, WO2011 / 141705, WO2013 / 126803, WO2006 / 007712, WO2011 / 038160, WO2005 / 121348, WO2011 / 066651, WO2009 / 127060, WO2011 / 141704, WO2006 / 069782, WO2012 / 031043, WO2013 / 006825, WO2013 / 033563, WO2013 / 089151, WO2017 / 099823, WO2015 / 095346, and WO2013 / 086354, and US patent publications US2016 / 0311759, US2015 / 0376115, US2016 / 0151284, US2017 / 0210697, US2015 / 0140070, US2013 / 0178541, US2013 / 0303587, US2015 / 0141678, US2015 / 0239926, US2016 / 0376224, US2017 / 0119904, US2012 / 0149894, US2015 / 0057373, US2013 / 0090372, US2013 / 0274523, US2013 / 0274504, US2013 / 0274504, US2009 / 0023673, US2012 / 0128760, US2010 / 0324120, US2014 / 0200257, US2015 / 0203446, US2018 / 0005363, US2014 / 0308304, US2013 / 0338210, US2012 / 0101148, US2012 / 0027796, ATTY DKT NO: RENA-002WO US2012 / 0058144, US2013 / 0323269, US2011 / 0117125, US2011 / 0256175, US2012 / 0202871, US2011 / 0076335, US2006 / 0083780, US2013 / 0123338, US2015 / 0064242, US2006 / 0051405, US2013 / 0065939, US2006 / 0008910, US2003 / 0022649, US2010 / 0130588, U52013 / 0116307, US2010 / 0062967, US2013 / 0202684, US2014 / 0141070, US2014 / 0255472, US2014 / 0039032, US2018 / 0028664, U52016 / 0317458, and US2013 / 0195920. Various LNP formulations known in the art can be used to deliver nucleic acids as described herein. For example, various LNP formulations and delivery methods using lipid nanoparticles are described in U.S. Pat. Nos.9,404,127, 9,006,4179,518,272, and US Patent Application No. 63 / 415,229. Such particles can be prepared by high energy mixing of ethanolic lipids with aqueous nucleic acids at low pH which protonates the ionizable lipid and provides favorable energetics for nucleic acids / lipid association and nucleation of particles. The particles can be further stabilized through aqueous dilution and removal of the organic solvent. The particles can be concentrated to the desired level. Another example of a nanoparticle that finds use in the delivery of the subject nucleic acids is a metal nanoparticle. In some embodiments, nucleic acids as described herein are delivered by a gold nanoparticle. Generally, a nucleic acid can be covalently bound to a gold nanoparticle or non-covalently bound to a gold nanoparticle (e.g., bound by a charge-charge interaction), for example as described by Ding et al. (2014). Gold Nanoparticles for Nucleic Acid Delivery. Mol. Ther.22(6); 1075-1083. In some embodiments, gold nanoparticle-nucleic acid conjugates are produced using methods described, for example, in U.S. Pat. No.6,812,334. In some embodiments, nucleic acids described herein can be readily formulated in high concentrations of chitosan-nucleic acid polyplex compositions and administered orally in DNA enteric coated pills described in U.S. Pat. Nos.8,846,102; 9,404,088; and 9,850,323, each of which is incorporated herein by its entirety. Exosomes. In some embodiments, nucleic acids as described herein are delivered by being packaged in an exosome. Exosomes are small membrane vesicles of endocytic origin that are released into the extracellular environment following fusion of multivesicular bodies with the plasma membrane. Their surface consists of a lipid bilayer from the donor cell's cell membrane, they contain cytosol from the cell that produced the exosome, and exhibit membrane proteins from the parental cell on the surface. Exosomes are produced by various cell types including ATTY DKT NO: RENA-002WO epithelial cells, B and T lymphocytes, mast cells (MC) as well as dendritic cells (DC). Some embodiments, exosomes with a diameter between 10 nm and 1 µm, between 20 nm and 500 nm, between 30 nm and 250 nm, between 50 nm and 100 nm are envisioned for use. Exosomes can be isolated for a delivery to target cells using either their donor cells or by introducing specific nucleic acids into them. Various approaches known in the art can be used to produce exosomes containing capsid-free AAV vectors of the present invention. Conjugates. In some embodiments, nucleic acids as described herein as disclosed herein are conjugated (e.g., covalently bound to an agent that increases cellular uptake. An "agent that increases cellular uptake" is a molecule that facilitates transport of a nucleic acid across a lipid membrane. For example, a nucleic acid can be conjugated to a lipophilic compound (e.g., cholesterol, tocopherol, etc.), a cell penetrating peptide (CPP) (e.g., penetratin, TAT, Syn1B, etc.), and polyamines (e.g., spermine). Further examples of agents that increase cellular uptake are disclosed, for example, in Winkler (2013). Oligonucleotide conjugates for therapeutic applications. Ther. Deliv.4(7); 791-809. In some embodiments, nucleic acids as described herein as disclosed herein are conjugated to a polymer (e.g., a polymeric molecule) or a folate molecule (e.g., folic acid molecule). Generally, delivery of nucleic acids conjugated to polymers is known in the art, for example as described in WO2000 / 34343 and WO2008 / 022309. In some embodiments, nucleic acids as disclosed herein are conjugated to a poly(amide) polymer, for example as described by U.S. Pat. No.8,987,377. In some embodiments, a nucleic acid described by the disclosure is conjugated to a folic acid molecule as described in U.S. Pat. No.8,507,455. In some embodiments, nucleic acids as described herein as disclosed herein are conjugated to a carbohydrate, for example as described in U.S. Pat. No.8,450,467. Nanocapsules. Alternatively, nanocapsule formulations of nucleic acids can be used. Nanocapsules can generally entrap substances in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 µm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl- cyanoacrylate nanoparticles that meet these requirements are contemplated for use. Liposomes. Nucleic acids as described herein can be added to liposomes for delivery to a cell or target organ in a subject. Liposomes are vesicles that possess at least one lipid bilayer and ATTY DKT NO: RENA-002WO an aqueous core. Liposomes are typical used as carriers for drug / therapeutic delivery in the context of pharmaceutical development. They work by fusing with a cellular membrane and repositioning its lipid structure to deliver a drug or active pharmaceutical ingredient (API). Liposome compositions for such delivery are composed of phospholipids, especially compounds having a phosphatidylcholine group, however these compositions may also include other lipids. The formation and use of liposomes is generally known to those of skill in the art. Liposomes have been developed with improved serum stability and circulation half-times (U.S. Pat. No. 5,741,516). Further, various methods of liposome and liposome like preparations as potential drug carriers have been described (U.S. Pat. Nos.5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587). As stated previously, the site-directed polypeptide and genome-targeting nucleic acid can each be administered separately to a cell or a patient. On the other hand, the site-directed polypeptide can be pre-complexed with one or more guide RNAs, or one or more crRNA together. The pre-complexed material can then be administered to a cell or a patient. Such pre- complexed material is known as a ribonucleoprotein particle (RNP). RNA is capable of forming specific interactions with RNA or DNA. While this property is exploited in many biological processes, it also comes with the risk of promiscuous interactions in a nucleic acid-rich cellular environment. One solution to this problem is the formation of ribonucleoprotein particles (RNPs), in which the RNA is pre-complexed with an endonuclease. Another benefit of the RNP is protection of the RNA from degradation. The endonuclease in the RNP can be modified or unmodified. Likewise, the gRNA, crRNA, tracrRNA, or sgRNA can be modified or unmodified. Numerous modifications are known in the art and can be used. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9 gene can each be separately formulated into lipid nanoparticles, or all co-formulated into one lipid nanoparticle. ATTY DKT NO: RENA-002WO In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the ANGPTL3 gene can each be separately formulated into lipid nanoparticles, or all co- formulated into one lipid nanoparticle. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the Lp(a) gene can each be separately formulated into lipid nanoparticles, or all co-formulated into one lipid nanoparticle. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the APOB gene can each be separately formulated into lipid nanoparticles, or all co-formulated into one lipid nanoparticle. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the APOC3 gene can each be separately formulated into lipid nanoparticles, or all co-formulated into one lipid nanoparticle. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9 and ANGPTL3 genes can each be separately formulated into lipid nanoparticles, or all co-formulated into one lipid nanoparticle. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9, ANGPTL3, and Lp(a) genes can each be separately formulated into lipid nanoparticles, or all co-formulated into one lipid nanoparticle. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9, ANGPTL3, Lp(a), and APOC3 genes can each be separately formulated into lipid nanoparticles, or all co-formulated into one lipid nanoparticle. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9, ANGPTL3, Lp(a), APOB, and APOC3 genes can each be separately formulated into lipid nanoparticles, or all co-formulated into one lipid nanoparticle. ATTY DKT NO: RENA-002WO The endonuclease and sgRNA can be generally combined in a 1:1 molar ratio. Alternatively, the endonuclease, crRNA, and tracrRNA can be generally combined in a 1:1:1 molar ratio. However, a wide range of molar ratios can be used to produce an RNP. Viral, including AAV delivery: A recombinant adeno-associated virus (AAV) vector can be used for delivery. Techniques to produce rAAV particles, in which an AAV genome to be packaged that includes the polynucleotide to be delivered, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV typically requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be from any AAV serotype for which recombinant virus can be derived, and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes described herein. Production of pseudotyped rAAV is disclosed in, for example, international patent application publication number WO 01 / 83692. AAV particles packaging polynucleotides encoding compositions of the invention, e.g., endonucleases, donor sequences, or RNA guide molecules, of the present invention may comprise or be derived from any natural or recombinant AAV serotype. According to the present invention, the AAV particles may utilize or be based on a serotype selected from any of the following serotypes, and variants thereof including but not limited to: - AAV1, AAV10, AAV106.1 / hu.37, AAV11, AAV114.3 / hu.40, AAV12, AAV127.2 / hu.41, AAV127.5 / hu,42, AAV128.1 / hu.43, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV16.12 / hu.11, AAV16.3, AAV16.8. / hu.10, AAV161.10 / hu.60, AAV161.6 / hu.61, AAV1-7 / rh.48, AAV1-8 / rh.49, AAV2, AAV2.5T, AAV2- 15 / rh.62, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV2-3 / rh.61, AAV24.1, AAV2-4 / rh.50, AAV2-5 / rh.51, AAV27.3, AAV29.3 / bb.1, AAV29.5 / bb.2, AAV2G9, AAV- 2-pre-miRNA-101, AAV3, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-11 / rh.53, AAV3-3, AAV33.12 / hu.17, AAV33.4 / hu.15, AAV33.8 / hu.16, AAV3-9 / rh.52, AAV3a, AAV3b, AAV4, AAV4-19 / rh.55, AAV42.12, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV4-4, AAV44.1, AAV44.2, AAV44.5, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV4-8 / r11.64, AAV4-8 / rh.64, ATTY DKT NO: RENA-002WO AAV4-9 / rh.54, AAV5, AAV52.1 / hu.20, AAV52 / hu.19, AAV5-22 / rh.58, AAV5-3 / rh.57, AAV54.1 / hu.21, AAV54.2 / hu.22, AAV54.4R / hu.27, AAV54.5 / hu.23, AAV54.7 / hu.24, AAV58.2 / hu.25, AAV6, AAV6.1, AAV6.1.2, AAV6.2, AAV7, AAV7.2, AAV7.3 / hu.7, AAV8, AAV- 8b, AAV-8h, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAVA3.3, AAVA3.4, AAVA3.5, AAVA3.7, AAV-b, AAVC1, AAVC2, AAVC5, AAVCh.5, AAVCh.5R1, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVCy.5R1, AAVCy.5R2, AAVCy.5R3, AAVCy.5R4, AAVcy.6, AAV-DJU, AAV-DJ8, AAVF3, AAVF5, AAV-h, AAVH-1 / hu.1, AAVH2, AAVH-5 / hu.3, AAVH6, AAVhE1.1, AAVhER1.14, AAVhEr1.16, AAVhEr1.18, AAVhER1.23, AAVhEr1.35, AAVhEr1.36, AAVhEr1.5, AAVhEr1.7, AAVhEr1.8, AAV hEr2.16, AAVhEr2.29, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhEr2.4, AAVhEr3.1, AAVhu.1, AAVhu.10, AAVhu.11, AAVhu.11, AAVhu.12, AAVhu.13, AAVhu.14 / 9, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.19, AAVhu.2, AAVhu.20, AAVhu.21, AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.3, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39, AAVhu.4, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44, AAVhu.44R1, AAVhu.44R2, AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47, AAVhu.48, AAVhu.48R1, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.5, AAVhu.51, AAVhu.52, AAVhu.53, AAVhu.54, AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.6, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.7, AAVhu.8, AAVhu.9, AAVhu.t 19, AAVLG-10 / rh.40, AAVLG-4 / rh.38, AAVLG-9 / hu.39, AAVLG-9 / hu.39, AAV-LK01, AAV-LK02, AAVLK03, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK17, AAV-LK18, AAV-LK19, AAVN721-8 / rh.43, AAV- PAEC, AAV-PAEC11, AAV-PAEC12, AAV-PAEC2, ANV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAVpi.1, AAVpi.2, AAVpi.3, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.2, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.2R, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.43, AAVrh.44, AAVrh.45, AAVrh.46, AAVrh.47, AAVrh.48, AA.Vrh.48, AAVrh.48.1, AA.Vrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.50, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.55, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.59, AAVrh.60, AAVrh.61, AAVrh.62, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.65, AAVrh.67, AAVrh.68, AAVrh.69, AAVrh.70, AAVrh.72, AAVrh.73, AAVrh.74, AAVrh.8, AAVrh.8R, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, BAAV, BNP61 AAV, BNP62 AAV, BNP63 AAV, bovine AAV, caprine AAV, ATTY DKT NO: RENA-002WO Japanese AAV 10, true type AAV (ttAAV), UPENN AAV 10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, AAV7m8, capsid R100, and / or AAV SM 10-8. In some aspects, the AAV serotype may be, or have, a mutation in the AAV9 sequence as described by N Pulicherla et al. (Molecular Therapy 19(6):1070-1078 (2011)), such as but not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84. In some aspects, the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 6,156,303, such as, but not limited to, AAV3B (SEQ ID NO: 1 and 10 of U.S. Pat. No. 6,156,303), AAV6 (SEQ ID NO: 2, 7 and 11 of U.S. Pat. No.6,156,303), AAV2 (SEQ ID NO: 3 and 8 of U.S. Pat. No.6,156,303), AAV3A (SEQ ID NO: 4 and 9, of U.S. Pat. No.6,156,303), or derivatives thereof. In some aspects, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV- DJ8), as described by Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008)). The amino acid sequence of AAVDJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described as SEQ ID NO: 1 in U.S. Pat. No.7,588,772 may comprise two mutations: (1) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (2) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, may comprise three mutations: (1) K406R where lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg), (2) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln), and (3) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). In some embodiments, the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015121501, such as, but not limited to, true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015121501), “UPenn AAV10” (SEQ ID NO: 8 of WO2015121501), “Japanese AAV10” (SEQ ID NO: 9 of WO2015121501), or variants thereof. ATTY DKT NO: RENA-002WO According to the present invention, AAV capsid serotype selection or use may be from a variety of species. In one embodiment, the AAV may be an avian AAV (AAAV). The AAAV serotype may be, or have, a sequence as described in U.S. Pat. No.9,238,800; such as, but not limited to, AAAV (SEQ ID NO: 1, 2, 4, 6, 8, 10, 12, and 14 of U.S. Pat. No.9,238,800), or variants thereof. In one embodiment, the AAV may be a bovine AAV (BAAV). The BAAV serotype may be, or have, a sequence as described in U.S. Pat. No.9,193,769, such as, but not limited to, BAAV (SEQ ID NO: 1 and 6 of U.S. Pat. No.9,193,769), or variants thereof. The BAAV serotype may be or have a sequence as described in U.S. Pat. No.7,427,396, such as, but not limited to, BAAV (SEQ ID NO: 5 and 6 of U.S. Pat. No.7,427,396), or variants thereof. In one embodiment, the AAV may be a caprine AAV. The caprine AAV serotype may be, or have, a sequence as described in U.S. Pat. No.7,427,396, such as, but not limited to, caprine AAV (SEQ ID NO: 3 of U.S. Pat. No.7,427,396), or variants thereof. In other embodiments, the AAV may be engineered as a hybrid AAV from two or more parental serotypes. In one embodiment, the AAV may be AAV2G9 which comprises sequences from AAV2 and AAV9. The AAV2G9 AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017005. In one embodiment, the AAV may be a serotype generated by the AAV9 capsid library with mutations in amino acids 390-627 (VP1 numbering) as described by Pulicherla et al. (Molecular Therapy 19(6):1070-1078 (2011)). The serotype and corresponding nucleotide and amino acid substitutions may be, but are not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T, W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV935 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV941 (A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T, A1737G; N562H, K567N), AAV9.45 ATTY DKT NO: RENA-002WO (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), AAV9.47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1301A, A1405C, C1664T, G1811T; R134Q, S469R, A555V, C1604V), AAV9.54 (C1531A, T1609A, L511I, L537M), AAV9.55 (T1605A; F535L), AAV9.58 (C1475T, C1579A; T492I, H527N), AAV.59 (T1336C; Y446H), AAV9.61 (A1493T; N498I), AAV9.64 (C1531A, A1617T; L511I), AAV9.65 (C1335T, T1530C, C1568A, A523D), AAV9.68 (C1510A; P504T), AAV9.80 (G1441A; G481R), AAV9.83 (C1402A, A1500T; P468T, E500D), AAV9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806C; L439R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L) and AAV9.95 (T1605A; F535L). In one embodiment, the AAV may be a serotype comprising at least one AAV capsid CD8+ T- cell epitope. As a non-limiting example, the serotype may be AAV1, AAV2, or AAV8. In one example, the AAV may be a variant, such as PHP.A or PHP.B as described in Deverman.2016. Nature Biotechnology.34(2): 204-209. In one example, the AAV may be a serotype selected from any of those found in Table 3. In one example, the AAV may be encoded by a sequence, fragment, or variant as disclosed in Table 3. General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mol. Cell. Biol.5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al. (1989, J. Virol., 63:3822-3828); U.S. Pat. No. 5,173,414; WO95 / 13365 and corresponding U.S. Pat. No.5,658,776; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al. (1995) Vaccine 13:1244-1250; Paul et al. (1993) Human Gene Therapy ATTY DKT NO: RENA-002WO 4:609-615; Clark et al. (1996) Gene Therapy 3:1124-1132; U.S. Pat. No.5,786,211; U.S. Pat. No.5,871,982; and U.S. Pat. No.6,258,595. AAV vector serotypes can be matched to target cell types. For example, the following exemplary cell types can be transduced by the indicated AAV serotypes among others (Table 3). Table 3: AAV – Tissue / Cell Types and AAV Serotypes Liver AAV3, AAV5, AAV8, AAV9 Skeletal Muscle AAV1, AAV7, AAV6, AAV8, AAV9 In addition to adeno-associated viral vectors, other viral vectors can be used. Such viral vectors include, but are not limited to, lentivirus, alphavirus, enterovirus, pestivirus, baculovirus, herpesvirus, Epstein Barr virus, papovavirus, poxvirus, vaccinia virus, and herpes simplex virus. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9 gene can each be separately formulated into AAVs, or all co-formulated into one AAV. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the ANGPTL3 gene can each be separately formulated into AAVs, or all co-formulated into one AAV. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the Lp(a) gene can each be separately formulated into AAVs, or all co-formulated into one AAV. ATTY DKT NO: RENA-002WO In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the APOB gene can each be separately formulated into AAVs, or all co-formulated into one AAV. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the APOC3 gene can each be separately formulated into AAVs, or all co-formulated into one AAV. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9 and ANGPTL3 genes can each be separately formulated into AAVs, or all co- formulated into one AAV. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9, ANGPTL3, and Lp(a) genes can each be separately formulated into AAVs, or all co-formulated into one AAV. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9, ANGPTL3, Lp(a), and APOC3 genes can each be separately formulated into AAVs, or all co-formulated into one AAV. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9, ANGPTL3, Lp(a), APOB, and APOC3 genes can each be separately formulated into AAVs, or all co-formulated into one AAV. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9 gene can each be separately formulated into replication deficient HSV-1 viruses, or all co-formulated into one replication deficient HSV-1 virus. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the ANGPTL3 gene can each be separately formulated into replication deficient HSV-1 viruses, or all co-formulated into one replication deficient HSV-1 virus. ATTY DKT NO: RENA-002WO In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the Lp(a) gene can each be separately formulated into replication deficient HSV-1 viruses, or all co-formulated into one replication deficient HSV-1 virus. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the APOB gene can each be separately formulated into replication deficient HSV-1 viruses, or all co-formulated into one replication deficient HSV-1 virus. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the APOC3 gene can each be separately formulated into replication deficient HSV-1 viruses, or all co-formulated into one replication deficient HSV-1 virus. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9 and ANGPTL3 genes can each be separately formulated into replication deficient HSV-1 viruses, or all co-formulated into one replication deficient HSV-1 virus. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9, ANGPTL3, and Lp(a) genes can each be separately formulated into replication deficient HSV-1 viruses, or all co-formulated into one replication deficient HSV-1 virus. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9, ANGPTL3, Lp(a), and APOC3 genes can each be separately formulated into replication deficient HSV-1 viruses, or all co-formulated into one replication deficient HSV-1 virus. In some embodiments, HyperCas12 mRNA and crRNA targeting one, two, three, or more loci in the PCSK9, ANGPTL3, Lp(a), APOB, and APOC3 genes can each be separately formulated into replication deficient HSV-1 viruses, or all co-formulated into one replication deficient HSV-1 virus.Options are available to deliver the hyperCas12 nuclease as a DNA plasmid, as mRNA, or as a protein. The guide RNA can be expressed from the same DNA or can also be delivered as an RNA including mRNA. The RNA can be chemically modified to alter or improve its half-life or decrease the likelihood or degree of immune response. The endonuclease protein can be complexed with the crRNA or gRNA prior to delivery. Viral vectors allow efficient delivery; split versions of Cas12 and smaller orthologs of Cas12 can be packaged in AAV. A range of non- ATTY DKT NO: RENA-002WO viral delivery methods also exist that can deliver each of these components, or non-viral and viral methods can be employed in tandem. For example, nanoparticles can be used to deliver the protein and guide RNA, while AAV can be used to deliver a donor DNA. Cell penetrating complexes: US10961263, US201962800406P, PCT / US2020 / 016281, US201662367555, US2018 / 62758487, and US 2018 / 0028688 are incorporated in their entirety and for all purposes. In a first aspect, there is provided a cell-penetrating complex including a nucleic acid non- covalently bound to a cationic amphipathic polymer, the cationic amphipathic polymer including a pH-sensitive immolation domain. In some embodiments, one or more counter ions (e.g., anions) may also be present as countercharges to the positive charges in the cationic amphipathic polymer. In some embodiments, the nucleic acid is non-covalently bound to the cationic amphipathic polymer. In some embodiments, the nucleic acid is ionically bound to the cationic amphipathic polymer. In some embodiments, the cell penetrating complex includes a plurality of optionally different nucleic acids (e.g.1 to 10 additional nucleic acids, 1 to 5 additional nucleic acids, 1 to 5 additional nucleic acids, 2 additional nucleic acids or 1 additional nucleic acid). In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is mRNA. In some embodiments, the nucleic acid is DNA. In some embodiments, the nucleic acid is pDNA. In some embodiments, the nucleic acid is CRISPR and guide RNA, including, but not limited to crRNA. In some embodiments, the CART is used to deliver therapeutics including but not limited to nucleic acids. In some embodiments, a ratio between the number of cations in the cationic amphipathic polymer molecules and the number of anions on the nucleic acid molecules present in a cell- penetrating complex can be about 1:1, about 5:1, about 10:1, about 20:1, about 25:1, about 30:1, about 40:1, about 50:1, about 60:1, about 70:1, about 80:1, about 90:1, about 102:1, about 103:1, about 104:1, about 105:1, about 106:1, about 107:1, about 108:1, about 109:1, about 1010:1, or more or any intervening ranges of the foregoing. In other embodiments, a ratio between the number of anions on the nucleic acid molecules and the number of cations on the cationic amphipathic polymer molecules present in a cell-penetrating complex can be about 1:1, about 5:1, about 10:1, about 20:1, about 15:1, about 30:1, about 40:1, about 50:1, about 60:1, about 70:1, about 80:1, about 90:1, about 10:1, about 102:1, about 103:1, about 104:1, about 105:1, ATTY DKT NO: RENA-002WO about 106:1, about 107:1, about 108:1, about 109:1 about 1010:1, or more or any intervening ranges of the foregoing. In some preferred embodiments, this ratio is approximately 10 cationic charges on the amphipathic polymer molecule to 1 negative charge on the nucleic acid. Other embodiments can have 5 cationic charges on the amphipathic polymer molecule to 1 negative charge on the nucleic acid or 20 cationic charges on the amphipathic polymer molecule to 1 negative charge on the nucleic acid. In some embodiments, a ratio between the number of nucleic acid molecules and the number of cationic amphipathic polymer molecules present in a cell-penetrating complex can be about 1:1, about 10:1, about 102:1, about 103:1, about 104:1, about 105:1, about 106:1, about 107:1, about 108:1, about 109:1, about 1010:1, or more or any intervening ranges of the foregoing. In other embodiments, a ratio between the number of cationic amphipathic polymer molecules and the number of nucleic acid molecules present in a cell-penetrating complex can be about 1:1, about 10:1, about 102:1, about 103:1, about 104:1, about 105:1, about 106:1, about 107:1, about 108:1, about 109:1, about 1010:1, or more or any intervening ranges of the foregoing. In some embodiments, the cationic amphipathic polymer may be a cationic charge altering releasable transporter (CART). In some embodiments, the CART may include an oligomeric chain containing a series of cationic sequences that undergo a pH-sensitive change in charge from cationic to neutral or cationic to anionic. In some embodiments, the cationic amphipathic polymer has a pH-sensitive immolation domain and a lipophilic polymer domain. In some embodiments, the lipophilic polymer domain may facilitate cell permeation, cell delivery and / or transport across cell membrane. In some embodiments, the lipophilic polymer domain may be substantially insoluble in water (e.g., less than about 0.0005 mg / mL to about 10 mg / mL soluble in water). In some embodiments, the lipophilic polymer domain may facilitate aggregation of the cationic amphipathic polymers into nanoparticles. In some embodiments, such nanoparticles may have an average longest dimension of about 50 nm to about 500 nm. In some embodiments, the lipophilic polymer domain may facilitate endosome fusion of the remnants of the cationic amphipathic polymer subsequent to entry and immolation within the endosome. In some embodiments, the cell- penetrating complexes of the present disclosure protect the nucleic acid cargo from degradation. The term “nucleic acid cargo” or the like refers, in the usual and customary sense, ATTY DKT NO: RENA-002WO to a species desired for transport into a cell by the cell-penetrating complex disclosed herein, and embodiments thereof. In some embodiments of the cell-penetrating complex, the pH-sensitive immolation domain includes a first nucleophilic moiety and a first electrophilic moiety, wherein the first nucleophilic moiety is reactive with the first electrophilic moiety within a pH range and is not substantially reactive with the electrophilic moiety outside that pH range (e.g., pH about 1-5, pH about 5-7 or pH about 7-10). In some embodiments, the pH range within which the first nucleophilic moiety is most reactive with the first electrophilic moiety is: pH 1-3, pH 2-4, pH 3-5, pH 4-6, pH 5-7, pH 6- 8, pH 7-9, or pH 8-10. A nucleophilic moiety is used in accordance with its plain ordinary meaning in chemistry and refers to a moiety (e.g., functional group) capable of donating electrons. In some embodiments, the pH range within which the first nucleophilic moiety is most reactive with the first electrophilic moiety is pH 1-3. In some embodiments, the pH range within which the first nucleophilic moiety is most reactive with the first electrophilic moiety is pH 2-4. In some embodiments, the pH range within which the first nucleophilic moiety is most reactive with the first electrophilic moiety is pH 3-5. In some embodiments, the pH range within which the first nucleophilic moiety is most reactive with the first electrophilic moiety is pH 4-6. In some embodiments, the pH range within which the first nucleophilic moiety is most reactive with the first electrophilic moiety is pH 5-7. In some embodiments, the pH range within which the first nucleophilic moiety is most reactive with the first electrophilic moiety is pH 6-8. In some embodiments, the pH range within which the first nucleophilic moiety is most reactive with the first electrophilic moiety is pH 7-9. In some embodiments, the pH range within which the first nucleophilic moiety is most reactive with the first electrophilic moiety is pH 8-10. In some embodiments, the pH is 1. In some embodiments, the pH is 2. In some embodiments, the pH is 3. In some embodiments, the pH is 4. In some embodiments, the pH is 5. In some embodiments, the pH is 6. In some embodiments, the pH is 7. In some embodiments, the pH is 8. In some embodiments, the pH is 9. In some embodiments, the pH is 10. In some embodiments, the pH is about 1. In some embodiments, the pH is about 2. In some embodiments, the pH is about 3. In some embodiments, the pH is about 4. In some embodiments, the pH is about 5. In some embodiments, the pH is about 6. In some embodiments, the pH is about 7. In some embodiments, the pH is about 8. In some embodiments, the pH is about 9. In some embodiments, the pH is about 10. ATTY DKT NO: RENA-002WO In some embodiments, the first nucleophilic moiety is substantially protonated at low pH (e.g., pH about 1 to about 5). In some embodiments, the first nucleophilic moiety is substantially protonated in the range pH 5-7. In some embodiments, the first nucleophilic moiety is cationic. In some embodiments, the first nucleophilic moiety includes a cationic nitrogen (e.g. a cationic amine). In some embodiments, the first nucleophilic moiety can be attached to a pH-labile protecting group. The term “pH-labile protecting group” or the like refers, in the usual and customary sense, to a chemical moiety capable of protecting another functionality to which it is attached, and which protecting group can be cleaved or otherwise inactivated as a protecting group under certain pH conditions (e.g., such as decreasing the pH). In one embodiment, the pH-labile protecting group is —CO2-t-Bu, a group removed under acidic conditions (e.g., pH below 7). Additional nucleophile protecting groups could also include those that are cleaved by light, heat, nucleophile, and bases. In some embodiments, provided herewith is a method of transfecting a nucleic acid into a cell. The method can involve contacting a cell with a cell-penetrating complex. In some embodiments, the method can cause gene-edition in the cell. In some embodiments, the gene- edition can encompass genome-edition or genome editing which is a type of genetic engineering in which DNA is inserted, deleted or replaced in the genome of a living organism using an isolated or engineered nuclease system. In certain embodiments, the method disclosed herein can be used to deliver a genetic tool or system that can cause gene-edition in the transfected cells. Some non-limiting examples of a genetic tool or system for gene-edition include a CRISPR-Cas system and transposon systems. In some embodiments, a nucleic acid (i.e. the cargo nucleic acid) transfected by the transfection method according to some embodiments can have one or more vectors having a first nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes with a target sequence in the genome of the cell and a second nucleotide sequence encoding a Cas9 protein or any other Cas protein, including, but not limited to Cas12a or hyperCas12a. In certain embodiments, the first and second nucleotide sequence can be located on the same or different vectors. In certain embodiments, the CRISPR system can perform gene editing. In certain embodiments, the CRISPR system can perform gene repression. In certain embodiments, the CRISPR system can perform gene activation. In certain embodiments, the CRISPR system can perform base ATTY DKT NO: RENA-002WO editing. In certain embodiments, the CRISPR system can perform prime editing. In some embodiments, the CRISPR system comprises hyperCas12 or hyperdCas12. In some embodiments, a CRISPR / Cas system is preferentially delivered as mRNA. In some embodiments, the Cas enzyme is delivered as mRNA via a CART vector, and the sgRNA is delivered in trans fashion in a separate CART vector. In some embodiments, the Cas mRNA and sgRNA are delivered in cis fashion, i.e., delivered together in a single CART vector. In some embodiments, the CRISPR / Cas system is delivered in a single CART vector as a ribonucleoprotein (RNP) complex. In some embodiments, a cargo nucleic acid transfected by the transfection method according to certain embodiments can have a CRISPR RNA (crRNA). In some embodiments, this crRNA can be in the same vector of the first nucleotide sequence encoding a CRISPR-Cas system. In some embodiments, a cargo nucleic acid transfected by the transfection method according to certain embodiments can have a transactivating RNA (tracrRNA). In some embodiments, this tracrRNA can be in the same vector of the second nucleotide sequence encoding a Cas9, Cas12, hyperCas12a or Cas13 protein. In some embodiments, the Cas9, Cas12, hyperCas12a, or Cas13 protein utilized in the transfection method according to some embodiments can be codon optimized for expression in the transfected cell. In some embodiments, a nucleic acid (i.e. the cargo nucleic acid) transfected by the transfection method according to some embodiments can have one or more vectors having a first nucleotide sequence encoding a transposase and a second nucleotide sequence having a nucleic acid sequence of a gene of interest flanked by a transposase recognition site. In some embodiments, the first and second nucleotide sequences can be located on the same or different vectors. A transposable element (or transposon) generally refers to a DNA sequence that can change its position within a genome, sometimes creating or reversing mutations and altering the cell's genetic composition and genome size. Transposase generally refers to an enzyme that can bind to a transposon and catalyze the movement of the transposon to another part of the genome by, e.g. a cut and paste mechanism or a replicative transposition mechanism. Introduction of transposase and a gene of interest flanked by a transposase recognition site in cells can induce insertion of the gene of interest into a cellular genome. According to some embodiments, the ATTY DKT NO: RENA-002WO method and composition according to certain embodiments herewith can deliver or transfect a nucleic acid encoding a transposase and a gene of interest to induce gene-edition in the transfected cells. In some embodiments, the transposase used in the transfection method according to some embodiments can recognize and excise a genomic sequence. In some other embodiments, the nucleic acid sequence of the gene of interest that is transfected via the transfection method can be integrated into a genome of the transfected cell. In some embodiments, the gene-editing done via the transfection method according to some embodiments can cause one or more of the following: a DNA deletion, a gene disruption, a DNA insertion, a DNA inversion, a point mutation, a DNA replacement, a knock-in, and a knock- down. In some embodiments, a cationic amphipathic polymer or a cell-penetrating complex can be formulated into a composition that can be used to transfect nucleic acid into cells. In some embodiments, a cationic amphipathic polymer or a cell-penetrating complex can be formulated into a composition that can be used to transfect nucleic acid into specifically targeted cells. These compositions that are capable of transfecting nucleic acid into cells are referred to as transfection compositions at least in some embodiments. In some embodiments, a cargo nucleic acid that can be bound to a cationic amphipathic polymer and form a cell-penetrating complex can be a messenger RNA (mRNA), small interference RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), guide RNA (gRNA), CRISPR RNA (crRNA), transactivating RNA (tracrRNA), circular RNA, DNA, plasmid DNA (pDNA), minicircle DNA, genomic DNA (gNDA). The transfection composition that has a cationic amphipathic polymer but not a cargo nucleic acid can be formulated with the cargo nucleic acid, e.g. contacting (or mixing) the cationic amphipathic polymer and the nucleic acid before transfection. In some embodiments, the transfection of using the composition and method disclosed herein can change one or more cellular properties. In some examples, the transfection can result in changing a gene expression profile in the transfected cells, e.g. reducing or increasing the expression of one or more gene products (e.g. RNA or peptide). In some other examples, the transfection can result in changing a genome structure, e.g. gene-editing via transfecting components of CRISPR / Cas12 system or a transposon system. In some other examples, the ATTY DKT NO: RENA-002WO transfection can result in modulating the activity of a cellular pathway. Therefore, in some of such examples, the transfection can result in induction of stem cells. In some other examples, the composition can deliver or (transfect) a cargo nucleic acid that has a therapeutic effect such that the transfection can treat and / or prevent a disease or condition. In some embodiments, the composition delivering (or transfecting) therapeutic cargo nucleic acids can induce an immune response in a subject that was administered with the composition. As apparent from the foregoing, depending on the cargo nucleic acid and the functionality thereof, the compositions according to the present disclosures, including a composition having a cationic amphipathic polymer or a cell-penetrating complex can be used to provide a variety of results in the transfected cells or the administered subject. In some embodiments, compositions having a cationic amphipathic polymer or a cell- penetrating complex can be used for a therapeutic purpose. In some embodiments, a therapeutic purpose encompasses a prophylactic purpose (a purpose of preventing a disease or condition from occurring) and a treatment purpose (a purpose of treating an existing disease or condition). When the composition has a cationic amphipathic polymer but not a cargo nucleic acid, the cargo nucleic acid, which can exhibit a therapeutic effect, can be non-covalently bound to the cationic amphipathic polymer, before administration to a subject. In some embodiments, pharmaceutical compositions can have a cell-penetrating complex, which has a nucleic acid non-covalently bound to a cationic amphipathic polymer, as an active ingredient and further contain pharmaceutically acceptable excipients or additives depending on the route of administration. Formulation of the pharmaceutical compositions of the present disclosure can vary according to the route of administration selected (e.g., solution, emulsion). In some embodiments, the composition can include a cryoprotectant agent. Non-limiting examples of cryoprotectant agents include a glycol (e.g., ethylene glycol, propylene glycol, and glycerol), dimethyl sulfoxide (DMSO), formamide, sucrose, trehalose, dextrose, and any combinations thereof. In some embodiments, the formulation is a controlled release formulation. The term “controlled release formulation” includes sustained release and time-release formulations. Controlled release formulations are well-known in the art. These include excipients that allow for sustained, ATTY DKT NO: RENA-002WO periodic, pulse, or delayed release of the composition. Controlled release formulations include, without limitation, embedding of the composition into a matrix; enteric coatings; micro- encapsulation; gels and hydrogels; implants; and any other formulation that allows for controlled release of a composition. In one embodiment is provided a kit of parts having a cell-penetrating complex or composition thereof. In some embodiments is provided a kit of parts having a cationic amphipathic polymer that is not bound to a nucleic acid or composition thereof. The kit can further contain a document or an instruction that describes a protocol for making a cell-penetrating complex using a cationic amphipathic polymer and a cargo nucleic acid. In some embodiments, the cargo nucleic acid may first be complexed with a polypeptide. The document or instruction of the kit can also describe a protocol for administering the composition to a subject in need thereof. The dosage and frequency (single or multiple doses) administered to a subject can vary depending upon a variety of factors, for example, whether the subject suffers from another disease, its route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated, kind of concurrent treatment, complications from the disease being treated or other health-related problems. Other therapeutic regimens or agents can be used in conjunction with the methods and compositions described herein including embodiments thereof. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the ability of those skilled in the art. Utilizing the teachings provided herein, an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient. This planning should involve the careful choice of active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent. In some embodiments, the subject is a mammal, for example a human, a non-human primate, a murine (i.e., mouse and rat), a canine, a feline, or an equine. In one embodiment, the subject is a human. Augmented Targeted Nuclear Delivery of CRISPR Therapeutics ATTY DKT NO: RENA-002WO To exert their therapeutic effect, the CRISPR / Cas systems must be delivered to the nucleus. Nuclear delivery presents a unique challenge for nucleic acid therapeutics. To overcome this challenge, the CRISPR / Cas systems described herein can employ nuclear localization signals (NLS). NLS are generally short peptides that act as a signal fragment that mediates the transport of proteins from the cytoplasm into the nucleus. This NLS-dependent protein recognition, a process necessary for cargo proteins to pass the nuclear envelope through the nuclear pore complex, is facilitated by members of the importin superfamily. In the case of the therapeutic described herein, the CART vector delivers mRNA into the cytoplasm of target cells with high efficiency. Upon pH change experienced in the cytoplasm, the CART vector releases its target mRNA, which is subsequently translated to protein via ribosomes. For the translated protein, in this case, Cas enzymes, to have their therapeutic effect, they must be transported across the double layer nuclear envelope into the nucleus where they can begin the gene editing process. A nuclear localization signal (NLS) was first identified through the analysis of mutants of simian virus 40 (SV40), whose NLS is composed of seven amino acids, Pro-Lys-Lys- Lys-Arg-Lys-Val (PKKKRKV). In some preferred embodiments, the NLS is the SV40 NLS. In other preferred embodiments, the NLS is the c-Myc NLS. In some embodiments, more than 1 NLS may be incorporated. In some embodiments, 1 to 10 NLS may be incorporated. In some embodiments, 2 NLS may be incorporated. In some embodiments, 3 NLS may be incorporated. In some embodiments, 4 NLS may be incorporated. In some embodiments, a NLS can be present on either the N-terminus or C-terminus of the Cas protein. In some embodiments, 1 a NLS can be present on both the N-terminus and the C-terminus of the Cas protein. In some embodiments, 1 to 10 NLS can be present on both the N-terminus and the C-terminus of the Cas protein. In one embodiment, the 3xNLS-NLP-cMyc-cMyc framework can be applied to hyperCas12. In some embodiments, the nuclear internalization signal or a nuclear import machinery binding domain is a modified nuclear internalization signal or a nuclear import machinery binding domain in that the nuclear internalization signal or a nuclear import machinery binding domain includes one or more modified amino acids. These domains may be derived from human proteins or other organisms. A partial list of nuclear localization signals can be found in the NLSdb, a database that includes over 2000 nuclear localization signals, all of which are incorporated herein by reference (https: / / rostlab.org / services / nlsdb / ). An additional list of NLS can be found in Table 4. Additional NLS that can be used with any CRISPR / Cas system are found in Supplementary Table S1 and Supplementary Table S2 in the following article (Kevin ATTY DKT NO: RENA-002WO Luk, Pengpeng Liu, Jing Zeng et al. Optimization of NLS composition improves CRISPR- Cas12a editing rates in human primary cells. published on bioRxiv. Accessed April 29, 2022). Table 4: Non limiting list of nuclear localization signals. Category Source Sequence Transport receptors Importin α / β1 nuclear localiza tion signals (cNLS) Non- Importin classica β l nuclear localiza tion signals (ncNLS) ATTY DKT NO: RENA-002WO Category Source Sequence Transport receptors c NLS RARα RKVIK(SEQ ID NO: 44)

[0033] In some embodiments, the present disclosure provides for the use of engineered polypeptides including a NLS where one or more amino acids of the engineered polypeptide is a modified amino acid, optionally where the modification includes at least one of: (i) phosphorylation; (ii) sulfation; (iii) glycosylation; (iv) prenylation; (v) methylation; (vi) sialylation; (vii) lipidation and / or lipoylation; (viii) acetylation; (ix) hydroxylation; (x) palmitoylation; (xi) mannosylation; (xii) myristoylation; (xiii) fucosylation; (xiv) pegylation; and / or (xv) any combination thereof. In various embodiments, one or more amino acids of an engineered polypeptide of the present disclosure is pegylated, acetylated, methylated, glycosylated, phosphorylated, sumoylated, amidated, lipidated, prenylated, lipoylated, alkylated, acylated, glycated, nitrosylated, sulfated, carbamylated, carbonylated, neddylated, biotinylated, or ribosylated. ATTY DKT NO: RENA-002WO CART Vectors for Plasmid DNA Delivery The manuscript “Functional DNA delivery enabled by lipid-modified charge-altering releasable transporters (CARTs). Biomacromolecules.201819(7): 2812-2824 is incorporated in its entirety and for all purposes. In an embodiment, a CART is designed to deliver plasmid DNA (pDNA) for gene therapy. In some embodiments, the CART is designed to deliver pDNA and the specific CART:pDNA ratio is about 25:1. In some embodiments the CART:pDNA ratio is about 10:1. In some embodiments the CART:pDNA ratio is about 5:1. In some embodiments the CART is O11A9 (6a). In other embodiments, the CART is L7.5A8. Codon optimization can be achieved with any method known in the art. Codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression of a gene in target or host cells of interest, e.g., human retinal cells, by replacing at least one codon (e.g., about or more than 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, 100 or more codons) of a native sequence with codons that are used more frequently or are most frequently used in the host cell while maintaining the native amino acid sequence. Codon usage tables are readily available, including for examples, GenScript Codon Usage Frequency Table Tool at http: / / www.genscript.com / tools / codon-frequency-table; Codon Usage Database at http: / / www.kazusa.or.jp / codon / ; and Nakamura, Y., et al. "Codon usage tabulated from the international DNA sequence databases: status for the year 2000" Nucl. Acids Res.28:292 (2000). In some embodiments, the plasmid comprises a promoter selected from cytomegalovirus (CMV) promoter, human CMV (hCMV) promotor, Rous sarcoma virus (RSV) promoter, MMT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter and opsin promoter. In some embodiments, aflibercept is delivered as mRNA. In some embodiments, several CART vectors may be generated to allow selection of the most optimal composition and promoter for use with the aflibercept transgene. Pharmaceutical Excipients and Formulations: In addition to the active agent or agents, a given active agent composition includes a pharmaceutically acceptable delivery vehicle, e.g., a pharmaceutically acceptable aqueous ATTY DKT NO: RENA-002WO vehicle. For pharmaceutically acceptable aqueous vehicles, in addition to water, the aqueous delivery vehicle may include a number of different components, including but not limited to: salts, buffers, preservatives, solubility enhancers, viscosity modulators, colorants, etc. Suitable aqueous vehicles include sterile distilled or purified water, isotonic solutions such as isotonic sodium chloride or boric acid solutions, phosphate buffered saline (PBS), propylene glycol and butylene glycol. Other suitable vehicular constituents include phenylmercuric nitrate, sodium sulfate, sodium sulfite, sodium phosphate and monosodium phosphate. Additional examples of other suitable vehicle ingredients include alcohols, fats and oils, polymers, surfactants, fatty acids, viscosity modifiers, emulsifiers and stabilizers, antimicrobial agents, pH adjusting agents. The viscosity of a given active agent composition may vary. In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the internal compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. Sterile solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation are vacuum drying and freeze- drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. ATTY DKT NO: RENA-002WO In one embodiment, active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No.4,522,811. The pharmaceutical compositions of the subject disclosure encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal comprising a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bio-equivalents. Pharmaceutical compositions of the present invention comprise, but are not limited to, reconstituted homogenous solutions, lyophilized, freeze dried, or vacuum dried powder, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that comprise, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. In some embodiments, pharmaceutical compositions disclosed herein are supplied as a suspension. In some embodiments, a suspension is a solution. In some embodiments, the suspension is refrigerated. In some embodiments, method of treatment or prevention of an eye disease or condition as disclosed herein comprises warming the refrigerated suspension to room temperature and / or agitating the suspension to ensure even distribution before administering to a patient. In some embodiments, the suspension is diluted before administering to a patient. In some embodiments, such pharmaceutical composition comprises a surfactant, salt, a stabilizer, or any combination thereof. In some embodiments, a suspension containing the pharmaceutical composition is supplied as a pre-filled syringe. In some embodiments, a suspension containing the pharmaceutical composition is supplied as an intravenous infusion bag or infusion vial. ATTY DKT NO: RENA-002WO In some embodiments, a suspension or a reconstituted form of the lyophilized pharmaceutical composition comprising any nucleic acid therapeutic as disclosed herein has a volume of about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 μL. In some embodiments, a suspension or a reconstituted form of the lyophilized pharmaceutical composition comprising any gene nucleic acid therapeutic therapy as disclosed herein has a volume of about 10 mL, 20 mL, 30 mL, 40 mL, 50 mL, 60 mL, 70 mL, 80 mL, 90 mL, 100 mL, 200 mL, 300 mL, 400 mL, 500 mL, 600 mL, 700 mL, 800 mL, 900 mL, or 1000 mL. In some embodiments, the suspension of the pharmaceutical composition comprising any of the nucleic acid therapeutics as disclosed herein has a volume of between 1 to 5 mL, between1 to 2 mL, between 3 to 10 mL, between 5-15mL, between 10-20mL, between 10- 30 mL, between 20-250 mL, between 10 to 500 mL, between 10 to 1000 mL, or between 10 to 5000 mL. In other embodiments, the volume is no more than 2 liters. In some embodiments, pharmaceutical compositions disclosed herein are designed, engineered, or adapted for administration to a primate (e.g., non-human primate and human subjects) via intravenous or subcutaneous injection. In some embodiments, a pharmaceutical composition comprising CART vectors comprising a nucleic acid sequence that encodes any Cas enzyme or combination of Cas enzymes and crRNAs described herein is formulated for intravenous injection intoa subject. In some embodiments, a pharmaceutical composition comprising LNP vectors comprising a nucleic acid sequence that encodes any Cas enzyme or combination of Cas enzymes and crRNAs described herein is formulated for intravenous injection intoa subject. In some embodiments, the pharmaceutical composition is formulated to or reconstituted to a concentration that allows for intravenous injection of a volume not more than about 1000 ml or not more than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 mL. In some embodiments, a unit dose of the pharmaceutical composition comprises a volume not more than about or not more than 2, 2.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 mL. In some embodiments, methods of treatment disclosed herein comprises injection of a volume of about 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150 μL of a solution comprising a vector and a nucleic acid sequence that encodes a Cas enzyme and a cgRNA. ATTY DKT NO: RENA-002WO In some embodiments, pharmaceutical compositions useful for the present disclosure can be packaged in a kit to facilitate application of the present disclosure. In some aspects, the present method provides for a kit comprising a recombinant nucleic acid (e.g., LNP or CART comprising the nucleic acid sequence or combination of nucleic acids) of the disclosure. In some aspects, the present method provides for a kit comprising a lyophilized form of an LNP or CART of the disclosure and a solution for reconstituting the LNP or CART before administration to a patient. In some embodiments, a kit comprises: a CART vector provided herein, and instructions to administer to a subject in a therapeutically effective amount. In some aspects, the kit comprises pharmaceutically acceptable salts or solutions for administering the CART vector solution. Optionally, the kit can further comprise instructions for suitable operational parameters in the form of a label or a separate insert. For example, the kit may have standard instructions informing a physician or laboratory technician to prepare a unit dose of CART and / or to reconstitute the lyophilized compositions. In some embodiments, optionally, the kit further comprises a device for administration, such as a syringe, filter needle, extension tubing, cannula, injector, electronic injecting device, or a small gauge cannula for systemic administration. In some embodiments, a kit comprises: an LNP vector provided herein, and instructions to administer to an eye or retinal cells of a subject in a therapeutically effective amount. In some aspects, the kit comprises pharmaceutically acceptable salts or solutions for administering the LNP vector solution. Optionally, the kit can further comprise instructions for suitable operational parameters in the form of a label or a separate insert. For example, the kit may have standard instructions informing a physician or laboratory technician to prepare a unit dose of LNP and / or to reconstitute the lyophilized compositions. In some embodiments, optionally, the kit further comprises a device for administration, such as a syringe, filter needle, extension tubing, cannula, suprachoroidal injector, electronic injecting device, or subretinal injector such as a small gauge cannula for subretinal systemic administration. In some embodiments, the pharmaceutical composition is provided as a suspension or solution or refrigerated suspension or solution. In some embodiments, the suspension or solution or refrigerated suspension or solution is provided in a kit, which can include a syringe or a buffer for dilution. In some embodiments, the suspension or solution or refrigerated suspension or solution is provided as a pre-filled glass or plastic syringe. ATTY DKT NO: RENA-002WO In some embodiments, the pharmaceutical composition is provided as a suspension or solution or frozen suspension or solution. In some embodiments, the suspension or solution or frozen suspension or solution is provided in a kit, which can include a syringe or a buffer for dilution. In some embodiments, the suspension or solution or frozen suspension or solution is provided as a pre-filled glass or plastic syringe. Dosing In some embodiments, the dosage and frequency administered to a subject can vary depending upon a variety of factors, for example, whether the subject suffers from another disease, its route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated, kind of concurrent treatment, complications from the disease being treated or other health-related problems. Other therapeutic regimens or agents can be used in conjunction with the methods and compositions described herein including embodiments thereof. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the ability of those skilled in the art. In some embodiments, any of the therapeutic compositions described herein can be administered one time, with a therapeutic effect that lasts at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months, at least 1 year, over more than 1 year, over 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more years. In some embodiments, the total number of doses administered of a gene therapy comprising a nucleic acid sequence or multiple nucleic acid sequences that encodes hyperCas12 and crRNA, functional fragment(s), or mutant(s) or variant(s) thereof, is not more than 1 unit dose in at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 1 year, at least 15 months, at least 1.5 years, at least 2 years, at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years, at least 10 years, at least 20 years, at least 30 years, at least 40 years, at least 50, years, at least 60 years, at least 70 years, at least 80 years, at least 90 years, at least 100 years. In some embodiments, administration of a therapy comprising a nucleic acid sequence or multiple nucleic acid sequences that encodes the hyperCas12 and crRNA, functional fragment(s), or mutant(s) or variant(s) thereof, is only one time or once in the lifetime of a patient. In some embodiments, administration of a therapy comprising a nucleic acid sequence or multiple nucleic acid sequences that encodes the ATTY DKT NO: RENA-002WO hyperCas12 and crRNA, functional fragment(s), or mutant(s) or variant(s) thereof, is given 2 times in the lifetime of a patient. In some embodiments, administration of a therapy comprising a nucleic acid sequence or multiple nucleic acid sequences that encodes the hyperCas12 and crRNA, functional fragment(s), or mutant(s) or variant(s) thereof, is given 3 or more times in the lifetime of a patient. In other embodiments, the therapeutic compositions described herein, due to their relative lack of immunogenicity, can be dosed multiple times, including multiple times daily, once daily, bi- weekly, weekly, monthly, bi-monthly, or on an as-needed treatment schedule. In some embodiments the therapeutic compositions may be given several times over a relatively short period of time (ie, a loading dose 1-3 weeks or over 1 to 4 months) and then result in long-term protein expression with or without additional doses on an as needed basis. In some embodiments, the therapeutic compositions described herein can be dosed on a treat-and- extend basis. In some embodiments, therapeutic compositions described herein can have their dosing schedule titrated based on analysis of protein assessment or cholesterol assessment following an initial dose or series of doses. As a non-limiting example, the level of LDL protein can be sampled at any time point (hours, days, weeks, months, years) following dosing. Based on the concentration of LDL present, a therapeutic treatment decision can be made regarding whether or not to re-dose the patient and with which dose and treatment frequency. For example, a low LDL reading could prompt the decision to give 1 or 2 additional doses of the therapeutic composition described herein. In some embodiments, a composition can be administered in a dose (or an amount) of about 0.01 mg / kg, about 0.025 mg / kg, about 0.05 mg / kg, about 0.075 mg / kg, about 0.1 mg / kg, about 0.125 mg / kg, about 0.15 mg / kg, about 0.175 mg / kg, about 0.2 mg / kg, about 0.225 mg / kg, about 0.25 mg / kg, about 0.275 mg / kg, about 0.3 mg / kg, about 0.325 mg / kg, about 0.35 mg / kg, about 0.375 mg / kg, about 0.4 mg / kg, about 0.425 mg / kg, about 0.45 mg / kg, about 0.475 mg / kg, about 0.5 mg / kg, about 0.525 mg / kg, about 0.55 mg / kg, about 0.575 mg / kg, about 0.6 mg / kg, about 0.625 mg / kg, about 0.65 mg / kg, about 0.675 mg / kg, about 0.7 mg / kg, about 0.725 mg / kg, about 0.75 mg / kg, about 0.775 mg / kg, about 0.8 mg / kg, about 0.825 mg / kg, about 0.85 mg / kg, about 0.875 mg / kg, about 0.9 mg / kg, about 0.925 mg / kg, about 0.95 mg / kg, about 0.975 mg / kg, about 1.0 mg / kg, about 1.025 mg / kg, about 1.05 mg / kg, about 1.075 mg / kg, about 1.1 mg / kg, about 1.125 mg / kg, about 1.15 mg / kg, about 1.175 mg / kg, about 1.2 mg / kg, about 1.225 mg / kg, about 1.25 mg / kg, about 1.275 mg / kg, about 1.3 mg / kg, about 1.325 mg / kg, about 1.35 mg / kg, about ATTY DKT NO: RENA-002WO 1.375 mg / kg, about 1.4 mg / kg, about 1.425 mg / kg, about 1.45 mg / kg, about 1.475 mg / kg, about 1.5 mg / kg, about 1.525 mg / kg, about 1.55 mg / kg, about 1.575 mg / kg, about 1.6 mg / kg, about 1.625 mg / kg, about 1.65 mg / kg, about 1.675 mg / kg, about 1.7 mg / kg, about 1.725 mg / kg, about 1.75 mg / kg, about 1.775 mg / kg, about 1.8 mg / kg, about 1.825 mg / kg, about 1.85 mg / kg, about 1.875 mg / kg, about 1.9 mg / kg, about 1.925 mg / kg, about 1.95 mg / kg, about 1.975 mg / kg, about 2.0 mg / kg, about 2.025 mg / kg, about 2.05 mg / kg, about 2.075 mg / kg, about 2.1 mg / kg, about 2.125 mg / kg, about 2.15 mg / kg, about 2.175 mg / kg, about 2.2 mg / kg, about 2.225 mg / kg, about 2.25 mg / kg, about 2.275 mg / kg, about 2.3 mg / kg, about 2.325 mg / kg, about 2.35 mg / kg, about 2.375 mg / kg, about 2.4 mg / kg, about 2.425 mg / kg, about 2.45 mg / kg, about 2.475 mg / kg, about 2.5 mg / kg, about 2.525 mg / kg, about 2.55 mg / kg, about 2.575 mg / kg, about 2.6 mg / kg, about 2.625 mg / kg, about 2.65 mg / kg, about 2.675 mg / kg, about 2.7 mg / kg, about 2.725 mg / kg, about 2.75 mg / kg, about 2.775 mg / kg, about 2.8 mg / kg, about 2.825 mg / kg, about 2.85 mg / kg, about 2.875 mg / kg, about 2.9 mg / kg, about 2.925 mg / kg, about 2.95 mg / kg, about 2.975 mg / kg, about 3.0 mg / kg. The weight herein can be a weight of a LNP or a weight of a composition or pharmaceutical formulation thereof, including the nucleic acid, further comprising mRNA and crRNA or another nucleic acid construct. When injected intravenously at an effective amount, an effective amount can show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 85%, 90%, 95%, or at least 100%. Efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 0.01 fold, 0.05 fold, 0.1 fold, 0.2 fold, 0.3 fold, 0.4 fold, 0.5 fold, 0.75 fold, 1-fold, 1.2-fold, 1.5-fold, 2-fold, 3-fold, 5-fold, 10-fold, 100-fold, 1,000-fold or more effect over a control. The exact dose and formulation can depend on the purpose of the treatment and can be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols.1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Remington: The Science and Practice of Pharmacy, 20th Edition, Gennaro, Editor (2003), and Pickar, Dosage Calculations (1999)). In some aspects, the dosing results in drug levels in the liver of a human subject of about 0.1 µg / ml, 0.2 µg / ml, 0.5 µg / ml, 1 µg / ml, 2 µg / ml, 3 µg / ml, 4 µg / ml, 5 µg / ml, 6 µg / ml, 7 µg / ml, 8 µg / ml, 9 µg / ml, 10 µg / ml, 15 µg / ml, 20 µg / ml, 30 µg / ml, 40 µg / ml, 50 µg / ml, 100 µg / ml, 200 µg / ml, 0.025 mg / ml, 0.05 mg / ml, 0.5 mg / ml, 1 mg / ml, 1.5 mg / ml 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 5.0 mg / ml, 10 mg / ml, and 100 mg / ml. In some embodiments, drug ATTY DKT NO: RENA-002WO "levels" may refer to any quantity or relative quantity of drug product. In some embodiments, the drug product level may represent the amount of multiple drug products or components of drug products that are delivered together. In some cases, the level may be measured as a concentration (e.g. pM, nM, uM etc.), a molality (e.g. m), as a mass (e.g. pg, ug, ng etc.) or any suitable measurement. In some cases, a unitless measurement may indicate a level. Method of use: Provided herein are methods for editing the PCSK9 gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single-strand breaks (SSB) or double-strand breaks (DSB) within or near the PCSK9 gene or PCSK9 regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the PCSK9 gene, thereby reducing or eliminating the function of the PCSK9 gene. In some embodiments, one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12), along with one or more crRNA(s) are delivered to a cell with a base editor to introduce single-base substitutions in the PCSK9 gene, resulting in reduced or eliminated function of the PCSK9 gene. In some embodiments, a crRNA targeting more than one location on the PCSK9 genetic locus is also introduced into the cell. In some embodiments, a crRNA targeting the same PCSK9 genetic locus 2-50 times is introduced into the cell along with a DNA endonuclease. In some embodiments, a crRNA targeting different PCSK9 genetic loci 2-50 times is also introduced into the cell along with a DNA endonuclease. Provided herein are methods for editing the ANGPTL3 gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single- strand breaks (SSB) or double-strand breaks (DSB) within or near the ANGPTL3 gene or ANGPTL3 regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the ANGPTL3 gene, thereby reducing or eliminating the function of the ANGPTL3 gene. In some embodiments, one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12), along with one or more crRNA(s), are delivered to a cell with a base editor to introduce single-base substitutions in the ANGPTL3 gene, resulting in reduced or eliminated function of the ANGPTL3 gene. In some embodiments, a crRNA targeting more than one location on the ANGPTL3 genetic locus is also introduced into the cell. In some embodiments, a crRNA targeting the same ANGPTL3 genetic ATTY DKT NO: RENA-002WO locus 2-50 times is introduced into the cell along with a DNA endonuclease. In some embodiments, a crRNA targeting different ANGPTL3 genetic loci 2-50 times is also introduced into the cell along with a DNA endonuclease. Provided herein are methods for editing the Lp(a) gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single-strand breaks (SSB) or double-strand breaks (DSB) within or near the Lp(a) gene or Lp(a) regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the Lp(a) gene, thereby reducing or eliminating the function of the Lp(a) gene. In some embodiments, one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12), along with one or more crRNA(s), are delivered to a cell with a base editor to introduce single-base substitutions in the Lp(a) gene, resulting in reduced or eliminated function of the Lp(a) gene. In some embodiments, a crRNA targeting more than one location on the Lp(a) genetic locus is also introduced into the cell. In some embodiments, a crRNA targeting the same Lp(a) genetic locus 2-50 times is introduced into the cell along with a DNA endonuclease. In some embodiments, a crRNA targeting different Lp(a) genetic loci 2-50 times is introduced into the cell along with a DNA endonuclease. Provided herein are methods for editing the APOC3 gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (e.g., hyperCas12) along with one or more crRNA(s) to cause one or more single-strand breaks (SSB) or double-strand breaks (DSB) within or near the APOC3 gene or APOC3 regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the APOC3 gene, thereby reducing or eliminating the function of the APOC3 gene. In some embodiments, one or more deoxyribonucleic acid (DNA) endonucleases (e.g., hyperCas12), along with one or more crRNA(s), are delivered to a cell with a base editor to introduce single-base substitutions in the APOC3 gene, resulting in reduced or eliminated function of the APOC3 gene. In some embodiments, a crRNA targeting more than one location on the APOC3 genetic locus is also introduced into the cell. In some embodiments, a crRNA targeting the same APOC3 genetic locus 2-50 times is introduced into the cell along with a DNA endonuclease. In some embodiments, a crRNA targeting different APOC3 genetic loci 2-50 times is introduced into the cell along with a DNA endonuclease. ATTY DKT NO: RENA-002WO Provided herein are methods for editing the APOB gene in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (e.g., hyperCas12) along with one or more crRNA(s) to cause one or more single-strand breaks (SSB) or double-strand breaks (DSB) within or near the APOB gene or APOB regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near the APOB gene, thereby reducing or eliminating the function of the APOB gene. In some embodiments, one or more deoxyribonucleic acid (DNA) endonucleases (e.g., hyperCas12), along with one or more crRNA(s), are delivered to a cell with a base editor to introduce single-base substitutions in the APOB gene, resulting in reduced or eliminated function of the APOB gene. In some embodiments, a crRNA targeting more than one location on the APOB genetic locus is also introduced into the cell. In some embodiments, a crRNA targeting the same APOB genetic locus 2-50 times is introduced into the cell along with a DNA endonuclease. In some embodiments, a crRNA targeting different APOB genetic loci 2-50 times is introduced into the cell along with a DNA endonuclease. Provided herein are methods for editing the PCSK9, ANGPTL3, and Lp(a) genes in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single-strand breaks (SSB) or double-strand breaks (DSB) within or near the PCSK9, ANGPTL3, and Lp(a) genes or their regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near these genes, thereby reducing or eliminating their respective functions. In some embodiments, one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12), along with one or more crRNA(s), are delivered to a cell with a base editor to introduce single-base substitutions in the PCSK9, ANGPTL3, and Lp(a) genes, resulting in reduced or eliminated function of these genes. In some embodiments, a crRNA targeting more than one location on the genetic loci of PCSK9, ANGPTL3, and Lp(a) is also introduced into the cell. In some embodiments, a crRNA targeting the same genetic loci of PCSK9, ANGPTL3, and Lp(a) genes 2-50 times is introduced into the cell along with a DNA endonuclease. In some embodiments, a crRNA targeting different genetic loci of PCSK9, ANGPTL3, and Lp(a) genes 2-50 times is introduced into the cell along with a DNA endonuclease. ATTY DKT NO: RENA-002WO Provided herein are methods for editing the PCSK9, ANGPTL3, Lp(a), and APOC3 genes in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single-strand breaks (SSB) or double-strand breaks (DSB) within or near the PCSK9, ANGPTL3, Lp(a), and APOC3 genes or their regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near these genes, thereby reducing or eliminating their respective functions. In some embodiments, one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12), along with one or more crRNA(s), are delivered to a cell with a base editor to introduce single-base substitutions in the PCSK9, ANGPTL3, Lp(a), and APOC3 genes, resulting in reduced or eliminated function of these genes. In some embodiments, a crRNA targeting more than one location on the genetic loci of PCSK9, ANGPTL3, Lp(a), and APOC3 is also introduced into the cell. In some embodiments, a crRNA targeting the same genetic loci of PCSK9, ANGPTL3, Lp(a), and APOC3 genes 2-50 times is introduced into the cell along with a DNA endonuclease. In some embodiments, a crRNA targeting different genetic loci of PCSK9, ANGPTL3, Lp(a), and APOC3 genes 2-50 times is introduced into the cell along with a DNA endonuclease. Provided herein are methods for editing the PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes in a cell by genome editing comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12) along with one or more crRNA(s) to cause one or more single-strand breaks (SSB) or double-strand breaks (DSB) within or near the PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes or their regulatory elements that result in one or more permanent deletions, insertions, or mutations of at least one nucleotide within or near these genes, thereby reducing or eliminating their respective functions. In some embodiments, one or more deoxyribonucleic acid (DNA) endonucleases (ex, hyperCas12), along with one or more crRNA(s), are delivered to a cell with a base editor to introduce single- base substitutions in the PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes, resulting in reduced or eliminated function of these genes. In some embodiments, a crRNA targeting more than one location on the genetic loci of PCSK9, ANGPTL3, Lp(a), APOC3, and APOB is also introduced into the cell. In some embodiments, a crRNA targeting the same genetic loci of PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes 2-50 times is introduced into the cell along with a DNA endonuclease. In some embodiments, a crRNA targeting different genetic loci of PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes 2-50 times is introduced into the cell along with a DNA endonuclease. ATTY DKT NO: RENA-002WO In some embodiments, the present disclosure provides a method that includes administering a composition of the present disclosure including an LNP vector and at least one a nucleic acid therapeutic or protein therapeutic to a cell, tissue, or subject. In some embodiments, one or more amino acids of the engineered therapeutic is an acetylated amino acid. In some embodiments, the acetylated amino acid is a lysine amino acid. In some embodiments, the acetylated amino acid is present in a linker domain or targeting domain. In some embodiments, the composition is delivered to CNS neurons. The following examples are offered by way of illustration and not by way of limitation. EXPERIMENTAL The invention will be more fully understood by reference to the following examples, which provide illustrative non-limiting aspects of the disclosure. The examples describe the use of the CRISPR system as an illustrative genome editing technique to create defined therapeutic genomic deletions, insertions, or replacements, termed "genomic modifications" herein, in the PCSK9, ANGPTL3, Lp(a), APOC3, and APOB genes that lead to permanent deletion or mutation of these genes, reducing or eliminating the respective protein activities. Introduction of the defined therapeutic modifications represents a novel therapeutic strategy for the potential amelioration of Dyslipidemias, as described and illustrated herein. Example 1 CRISPR / Cas12 Target Sites for the PCSK9 Gene Regions of the PCSK9 gene are scanned for target sites. Each area is scanned for a protospacer adjacent motif (PAM) having the sequence TTTG. gRNA 23 bp spacer sequences corresponding to the PAM are then identified, e.g., as shown in Table 2 and FIGS.1A-1B. CRISPR / Cas12 Target Sites for the ANGPTL3 Gene ATTY DKT NO: RENA-002WO Regions of the ANGPTL3 gene are scanned for target sites. Each area is scanned for a protospacer adjacent motif (PAM) having the sequence TTTG. gRNA 23 bp spacer sequences corresponding to the PAM are then identified, e.g.,as shown in Table 2 and FIGS.1C-1E. CRISPR / Cas12 Target Sites for the Lp(a) Gene Regions of the Lp(a) gene are scanned for target sites. Each area is scanned for a protospacer adjacent motif (PAM) having the sequence TTTG. gRNA 23 bp spacer sequences corresponding to the PAM are then identified, e.g., as shown in Table 2 and FIGS.1F-1H. Bioinformatics Analysis of the Guide Strands Candidate guides are then screened and selected in a single process or multi-step process that involves both theoretical binding and experimentally assessed activity at both on and off-target sites. By way of illustration, candidate guides having sequences that match a particular on- target site, such as a site within the PCSK9 gene, with adjacent PAM can be assessed for their potential to cleave at off-target sites having similar sequences, using one or more of a variety of bioinformatics tools available for assessing off-target binding, as described and illustrated in more detail below, in order to assess the likelihood of effects at chromosomal positions other than those intended. Prior to beginning in vitro testing, extensive in silico development work was performed in an effort to reduce the chance of deleterious off target edits. Candidates predicted to have relatively lower potential for off-target activity can then be assessed experimentally to measure their on-target activity, and then off-target activities at various sites. Preferred guides have sufficiently high on-target activity to achieve desired levels of gene editing at the selected locus, and relatively lower off-target activity to reduce the likelihood of alterations at other chromosomal loci. The ratio of on-target to off-target activity is often referred to as the “specificity” of a guide. For initial screening of predicted off-target activities, there are a number of bioinformatics tools known and publicly available that can be used to predict the most likely off-target sites; and since binding to target sites in the CRISPR / Cas12 nuclease system is driven by Watson-Crick base pairing between complementary sequences, the degree of dissimilarity (and therefore ATTY DKT NO: RENA-002WO reduced potential for off-target binding) is essentially related to primary sequence differences: mismatches and bulges, i.e. bases that are changed to a non-complementary base, and insertions or deletions of bases in the potential off-target site relative to the target site. An exemplary bioinformatics tool called COSMID (CRISPR Off-target Sites with Mismatches, Insertions and Deletions) (available on the web at crispr.bme.gatech.edu) compiles such similarities. Other bioinformatics tools include, but are not limited to, autoCOSMID, CCTop, CRISPICK and Cas-OFF FINDER. Bioinformatics are used to minimize off-target cleavage in order to reduce the detrimental effects of mutations and chromosomal rearrangements. Studies on CRISPR / Cas12 systems suggested the possibility of high off-target activity due to nonspecific hybridization of the guide strand to DNA sequences with base pair mismatches and / or bulges, particularly at positions distal from the PAM region. Therefore, it is important to have a bioinformatics tool that can identify potential off-target sites that have insertions and / or deletions between the RNA guide strand and genomic sequences, in addition to base-pair mismatches. Cas-OFF FINDER was used to identify target sequences with low predicted off target editing sites. Additional bioinformatics pipelines are employed that weigh the estimated on- and / or off-target activity of gRNA targeting sites in a region. Other features that may be used to predict activity include information about the cell type in question, DNA accessibility, chromatin state, transcription factor binding sites, transcription factor binding data, and other CHIP-seq data. Additional factors are weighed that predict editing efficiency, such as relative positions and directions of pairs of gRNAs, local sequence features and micro-homologies. Guides were selected for testing based on high predicted on target editing with minimal off target editing. Testing of Preferred Guides in Primary Human Hepatocytes Primary human hepatocytes (BioIVT) were added to collagen-coated tissue culture plates in a 24-well plate, with each well containing approximately 350,000 cells. Cells were incubated at 37C in 5% CO2 in INVITROGRO culture plating medium (Z99029). TORPEDO antibiotic mix (Z99000) was added. After 2-4 hours, the cells were washed with CP medium to remove cells that did not attach or died during the attachment phase and new CP medium (Z99029) was added to the wells. Cells were then transfected with an mRNA and gRNA (TABLE 5). ATTY DKT NO: RENA-002WO Transfection was performed using Lipofectamine MessengerMAX in OptiMEM. For each well, RNA was diluted in OptiMEM. Diluted mRNA was added to each tube of diluted MessengerMAX Reagent in a 1:1 ratio. Cells were harvested approximately 4 days after transfection. Genomic DNA was collected with the DNeasy Blood and Tissue Kit (QIAGEN), and PCR was performe...

Claims

ATTY DKT NO: RENA-002WO What is claimed is:

1. A method of editing one or more cardiovascular disease implicated genomic regions of a cell, the method comprising: introducing into the cell: a HyperCas12 nuclease or nucleic acid encoding the same; and a gRNA comprising two or more targeting sequences; to edit the one or more cardiovascular disease implicated genomic regions of the cell.

2. The method according to Claim 1, wherein the two or more targeting sequences have the same sequence.

3. The method according to Claim 1, wherein the two or more targeting sequences have different sequences.

4. The method according to Claim 3, wherein the method is a method of editing two or more cardiovascular disease implicated genomic regions of the cell.

5. The method according to any of the preceding claims, wherein the gRNA is a linear gRNA.

6. The method according to any of Claims 1 to 4, wherein the gRNA is a circular gRNA.

7. The method according to Claim 6, wherein the circular gRNA lacks an IRES sequence.

8. The method according to any of Claims 1 to 7, wherein a nucleic acid encoding the HyperCas12 nuclease is introduced into the cell.ATTY DKT NO: RENA-002WO 9. The method according to Claim 8, wherein the nucleic acid comprises an mRNA.

10. The method according to any of the preceding claims, wherein the HyperCas12 nuclease is a HyperCAS12A nuclease.

11. The method according to Claim 9, wherein the HyperCas12A nuclease comprises an amino acid sequence that has 95% or greater identify to SEQ ID NO:

1.

12. The method according to any of the preceding claims, wherein the HyperCas12 comprises a fusion protein.

13. The method according to Claim 12, wherein the fusion protein comprises a HyperCas12 domain fused to a deaminase domain.

14. The method according to Claim 13, wherein the deaminase domain comprises an adenine deaminase that provides for an A-T to G-C nucleobase alteration.

15. The method according to any of Claims 12 to 14, wherein the HyperCas12 is nuclease inactive.

16. The method according to Claim 14, wherein HyperCas12 comprises hyperCas12 ABE encoded by SEQ ID NO:

04.

17. The method according to any of Claims 12 to 15, wherein the HyperCas12 comprises nickase activity.

18. The method according to Claim 17, wherein the HyperCas 12 comprises HyperCas12 ABE nickase mutation encoded by SEQ ID NO:

05.

19. The method according to Claim 12, wherein the fusion protein comprises a HyperCas12 domain fused to a reverse transcriptase domain.ATTY DKT NO: RENA-002WO 20. The method according to any of the preceding claims, wherein the one or more cardiovascular disease implicated genomic regions comprise one or more genes implicated in cardiovascular disease.

21. The method according to Claim 20, wherein the one or more genes are selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3, APOB and combinations thereof.

22. The method according to Claim 21, wherein the method is a method of editing a single gene selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.

23. The method according to Claim 21, wherein the method is a method of editing two or more genes selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.

24. The method according to Claim 21, wherein the method is a method of editing three or more genes selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.

25. The method according to Claim 21, wherein the method is a method of editing four or more genes selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.

26. The method according to Claim 21, wherein the method is a method of editing PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.

27. The method according to any of the preceding claims, wherein the cell is in vitro.

28. The method according to any of Claims 1 to 26, wherein the cell is in vivo.ATTY DKT NO: RENA-002WO 29. The method according to Claim 28, wherein the method comprises administering the HyperCas12 nuclease or nucleic acid encoding the same in combination with the gRNA to an organism comprising the cell.

30. The method according to Claim 29, wherein the organism is a mammal.

31. The method according to Claim 30, wherein the mammal is a human.

32. The method according to any of Claims 28 to 31, wherein the method comprises sequentially administering the HyperCas12 nuclease or nucleic acid encoding the same and the gRNA to the organism.

33. The method according to any of Claims 28 to 31, wherein the method comprises simultaneously administering the HyperCas12 nuclease or nucleic acid encoding the same and the gRNA to the organism.

34. The method according to Claim 33, wherein the HyperCas12 nuclease or nucleic acid encoding the same and the gRNA are administered to the organism in a single composition.

35. The method according to any of Claims 28 to 34, wherein the method is a method of treating the organism for a cardiovascular disease.

36. The method according to Claim 35, wherein the cardiovascular disease comprises atherosclerosis.

37. A composition comprising: a nucleic acid encoding a HyperCas12 nuclease; and a gRNA comprising two or more targeting sequences for one or more cardiovascular disease implicated genomic regions of a cell.ATTY DKT NO: RENA-002WO 38. The composition according to Claim 37, wherein the two or more targeting sequences have the same sequence.

39. The composition according to Claim 37, wherein the two or more targeting sequences have different sequences.

40. The composition according to any of Claims 37 to 39, wherein the gRNA is a linear gRNA.

41. The composition according to any of Claims 37 to 39, wherein the gRNA is a circular gRNA.

42. The composition according to Claim 41, wherein the circular gRNA lacks an IRES sequence.

43. The composition according to any of Claims 37 to 42, wherein the nucleic acid comprises a mRNA.

44. The composition according to any of Claims 37 to 43, where the HyperCas12 nuclease is a HyperCAS12A nuclease.

45. The composition according to Claim 44, wherein the HyperCas12A nuclease comprises an amino acid sequence that has 95% or greater identify to SEQ ID NO:

1.

46. The composition according to any of Claims 37 to 45, wherein the HyperCas12 comprises a fusion protein.

47. The composition according to Claim 46, wherein the fusion protein comprises a HyperCas12 domain fused to a deaminase domain.ATTY DKT NO: RENA-002WO 48. The composition according to Claim 47, wherein the deaminase domain comprises an adenine deaminase that provides for an A-T to G-C nucleobase alteration.

49. The composition according to any of Claims 46 to 48, wherein the HyperCas12 is nuclease inactive.

50. The composition according to Claim 49, wherein HyperCas12 comprises hyperCas12 ABE encoded by SEQ ID NO:

04.

51. The composition according to any of Claims 46 to 48, wherein the HyperCas12 comprises nickase activity.

52. The composition according to Claim 51, wherein the HyperCas 12 comprises HyperCas12 ABE nickase mutation encoded by SEQ ID NO:

05.

53. The composition according to Claim 46, wherein the fusion protein comprises a HyperCas12 domain fused to a reverse transcriptase domain.

54. The composition according to any of Claims 37 to 53, wherein the one or more cardiovascular disease implicated genomic regions comprise one or more genes implicated in cardiovascular disease.

55. The composition according to Claim 54, wherein the one or more genes are selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3, APOB and combinations thereof.

56. The composition according to Claim 54, wherein the gRNA comprises a targeting sequence for a single gene selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.ATTY DKT NO: RENA-002WO 57. The composition according to Claim 54, wherein the gRNA comprises targeting sequences for two or more genes selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.

58. The composition according to Claim 54, wherein the gRNA comprises targeting sequences for three or more genes selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.

59. The composition according to Claim 54, wherein the gRNA comprises targeting sequences for four or more genes selected from the group consisting of PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.

60. The composition according to Claim 54, wherein the gRNA comprises targeting sequences for PCSK9, ANGPTL3, Lp(a), APOC3 and APOB.

61. The composition according to any of Claims 37 to 54, wherein the nucleic acid encoding a HyperCas12 nuclease and gRNA comprising are present in a lipid nanoparticle.

62. A method of editing one or more non-coding genomic regions of a cell, the method comprising: introducing into the cell: a HyperCas12 nuclease or nucleic acid encoding the same; and a gRNA comprising two or more targeting sequences; to edit the one or more non-coding genomic regions of the cell.

63. The method according to Claim 62, wherein the two or more targeting sequences have the same sequence.

64. The method according to Claim 62, wherein the two or more targeting sequences have different sequences.ATTY DKT NO: RENA-002WO 65. The method according to Claim 64, wherein the method is a method of editing two or more non-coding regions of the cell.

66. The method according to any of Claims 62 to 65, wherein the gRNA is a linear gRNA.

67. The method according to any of Claims 62 to 65, wherein the gRNA is a circular gRNA.

68. The method according to Claim 67, wherein the circular gRNA lacks an IRES sequence.

69. The method according to any of Claims 62 to 68, wherein a nucleic acid encoding the HyperCas12 nuclease is introduced into the cell.

70. The method according to Claim 69, wherein the nucleic acid comprises an mRNA.

71. The method according to any of Claims 62-70, wherein the HyperCas12 nuclease is a HyperCAS12A nuclease.

72. The method according to Claim 71, wherein the HyperCas12A nuclease comprises an amino acid sequence that has 95% or greater identify to SEQ ID NO:

1.

73. The method according to any of Claims 62-72, wherein the HyperCas12 comprises a fusion protein.

74. The method according to Claim 73, wherein the fusion protein comprises a HyperCas12 domain fused to a deaminase domain.ATTY DKT NO: RENA-002WO 75. The method according to Claim 74, wherein the deaminase domain comprises an adenine deaminase that provides for an A-T to G-C nucleobase alteration.

76. The method according to any of Claims 73 to 75, wherein the HyperCas12 is nuclease inactive.

77. The method according to Claim 76, wherein HyperCas12 comprises hyperCas12 ABE encoded by SEQ ID NO:

04.

78. The method according to any of Claims 73 to 75, wherein the HyperCas12 comprises nickase activity.

79. The method according to Claim 78, wherein the HyperCas 12 comprises HyperCas12 ABE nickase mutation encoded by SEQ ID NO:

05.

80. The method according to Claim 73, wherein the fusion protein comprises a HyperCas12 domain fused to a reverse transcriptase domain.

81. The method according to any of Claims 62 to 80, wherein the one or more non- coding regions comprise one or more transcriptional elements.

82. The method according to any of Claims 62 to 81, wherein the cell is in vitro.

83. The method according to any of Claims 62 to 81, wherein the cell is in vivo.

84. The method according to Claim 83, wherein the method comprises administering the HyperCas12 nuclease or nucleic acid encoding the same in combination with the gRNA to an organism comprising the cell.

85. The method according to Claim 84, wherein the organism is a mammal.ATTY DKT NO: RENA-002WO 86. The method according to Claim 85, wherein the mammal is a human.

87. The method according to any of Claims 84 to 86, wherein the method comprises sequentially administering the HyperCas12 nuclease or nucleic acid encoding the same and the gRNA to the organism.

88. The method according to any of Claims 84 to 86, wherein the method comprises simultaneously administering the HyperCas12 nuclease or nucleic acid encoding the same and the gRNA to the organism.

89. The method according to Claim 88, wherein the HyperCas12 nuclease or nucleic acid encoding the same and the gRNA are administered to the organism in a single composition.

90. A composition comprising: a nucleic acid encoding a HyperCas12 nuclease; and a gRNA comprising two or more targeting sequences for one or more non-coding genomic regions of a cell.

91. The composition according to Claim 90, wherein the two or more targeting sequences have the same sequence.

92. The composition according to Claim 90, wherein the two or more targeting sequences have different sequences.

93. The composition according to any of Claims 90 to 92, wherein the gRNA is a linear gRNA.

94. The composition according to any of Claims 90 to 93, wherein the gRNA is a circular gRNA.ATTY DKT NO: RENA-002WO 95. The composition according to Claim 94, wherein the circular gRNA lacks an IRES sequence.

96. The composition according to any of Claims 90 to 95, wherein the nucleic acid comprises a mRNA.

97. The composition according to any of Claims 90 to 96, where the HyperCas12 nuclease is a HyperCAS12A nuclease.

98. The composition according to Claim 97, wherein the HyperCas12A nuclease comprises an amino acid sequence that has 95% or greater identify to SEQ ID NO:

1.

99. The composition according to any of Claims 90 to 98, wherein the HyperCas12 comprises a fusion protein.

100. The composition according to Claim 99, wherein the fusion protein comprises a HyperCas12 domain fused to a deaminase domain.

101. The composition according to Claim 100, wherein the deaminase domain comprises an adenine deaminase that provides for an A-T to G-C nucleobase alteration.

102. The composition according to any of Claims 99 to 101, wherein the HyperCas12 is nuclease inactive.

103. The composition according to Claim 102, wherein HyperCas12 comprises hyperCas12 ABE encoded by SEQ ID NO:

04.

104. The composition according to any of Claims 99 to 103, wherein the HyperCas12 comprises nickase activity.ATTY DKT NO: RENA-002WO 105. The composition according to Claim 104, wherein the HyperCas 12 comprises HyperCas12 ABE nickase mutation encoded by SEQ ID NO:

05.

106. The composition according to Claim 99, wherein the fusion protein comprises a HyperCas12 domain fused to a reverse transcriptase domain.

107. The composition according to any of Claims 90 to 106, wherein the one or more non-coding regions comprise one or more transcriptional elements.

108. The composition according to any of Claims 90 to 107, wherein the nucleic acid encoding a HyperCas12 nuclease and gRNA comprising are present in a lipid nanoparticle.

Images