Use of cyclo-hispro alone or zinc and cyclo-hispro for inhibiting muscle loss or alleviating muscle function decline caused by Anti-obesity drugs

Abstract

The present invention relates to a use of Cyclo-His Pro (CHP) alone or zinc and Cyclo-His Pro (zinc and CHP, Cycloz) for inhibiting muscle loss or alleviating muscle function decline caused by anti-obesity drugs. More specifically, the present invention provides a pharmaceutical composition and a health functional food composition, which when administered in combination with an anti-obesity drug, exhibit an effect of inhibiting the anti-obesity drug-induced side effect of muscle loss while maintaining a weight loss effect, and exhibit an effect of preventing, alleviating, or treating sarcopenic obesity, and a method for inhibiting muscle loss or alleviating muscle function decline caused by an anti-obesity drug and a method for preventing, alleviating or treating sarcopenic obesity using same.

Description

Use of cyclo-hispro alone or in combination with zinc for the inhibition of muscle loss or improvement of muscle function decline caused by anti-obesity drugs

[0001] This application claims priority to Republic of Korea Patent Application No. 10-2024-0057964, filed April 30, 2024, the entire disclosure of which is incorporated herein by reference.

[0002] The present invention relates to the use of Cyclo-HisPro (CHP) alone or in combination with zinc and Cyclo-HisPro (zinc and CHP, Cycloz) for suppressing muscle loss or improving muscle function decline by an anti-obesity agent, and more specifically, when administered in combination with an anti-obesity agent, the weight loss effect is maintained while the effect of suppressing the side effect of muscle loss by the anti-obesity agent is shown, and a pharmaceutical composition and a health functional food composition having a preventive, ameliorating, or treating effect on sarcopenic obesity are provided, as well as a method for suppressing muscle loss or improving muscle function decline by an anti-obesity agent using the same, and a method for preventing, ameliorating, or treating sarcopenic obesity.

[0003] Obesity is a metabolic imbalance caused by endocrine, genetic, dietary, and social factors, resulting in the accumulation of excess energy as fat. While obesity can cause visible symptoms like shortness of breath and joint pain, its more serious side effects include cardiovascular disease, high blood pressure, sleep apnea, and dyslipidemia. Therefore, the World Health Organization (WHO) considers obesity not simply a risk factor for health, but a disease requiring treatment.

[0004] Meanwhile, the prevalence of sarcopenic obesity, which is a combination of obesity and sarcopenia, has recently increased. Sarcopenic obesity inhibits muscle protein metabolism, leading to a decrease in muscle mass. It also increases insulin resistance, which reduces physical activity and basal metabolic rate, ultimately contributing to increased body fat, creating a vicious cycle. Sarcopenic obesity not only leads to problems such as falls, functional impairment, decreased quality of life, and increased mortality due to decreased muscle mass and muscle function, but also increases the risk of cardiovascular disease and metabolic disorders. However, there is currently no treatment for sarcopenic obesity.

[0005] Furthermore, among representative obesity treatments, glucagon-like peptide-1 (GLP-1) receptor agonists such as semaglutide, liraglutide, and tirzepatide strongly mimic or amplify the action of GLP-1, resulting in weight loss or glycemic control. However, these drugs have been reported to exhibit the side effect of reducing muscle mass along with weight loss, raising concerns that they may increase the risk of sarcopenia, particularly in the elderly.

[0006] Meanwhile, according to patent documents 1 to 3, cyclo-hispro is known to not only exhibit a blood pressure lowering effect, but also a therapeutic effect on fibrosis and respiratory diseases.

[0007] Against this backdrop, the inventors of the present invention confirmed that cyclo-hispro alone or a combination of zinc and cyclo-hispro is effective in treating sarcopenic obesity or suppressing muscle loss caused by anti-obesity agents, and completed the present invention.

[0008] [Prior Art Literature]

[0009] [Patent Document]

[0010] (Patent Document 1) Republic of Korea Publication No. 10-2021-0117986

[0011] (Patent Document 2) Republic of Korea Patent No. 10-2140910

[0012] (Patent Document 3) Republic of Korea Publication No. 10-2024-0032221

[0013] The purpose of the present invention is to provide a composition for inhibiting muscle loss or improving muscle function decline by an anti-obesity agent comprising cyclo-hispro or a combination of zinc and cyclo-hispro as an active ingredient.

[0014] Another object of the present invention is to provide a composition for preventing, improving or treating sarcopenic obesity, comprising cyclo-hispro or a combination of zinc and cyclo-hispro as an active ingredient.

[0015] Another object of the present invention is to provide a composition for preventing, improving or treating sarcopenic obesity, comprising as an active ingredient a combination of an anti-obesity agent and cyclo-hispro, or a combination of an anti-obesity agent, zinc and cyclo-hispro.

[0016] Another object of the present invention is to provide a method for inhibiting muscle loss or improving muscle function decline by an anti-obesity agent using cyclo-hispro or a combination of zinc and cyclo-hispro.

[0017] Another object of the present invention is to provide a method for preventing, improving or treating sarcopenic obesity using cyclo-hispro or a combination of zinc and cyclo-hispro.

[0018] Another object of the present invention is to provide a method for preventing, improving or treating sarcopenic obesity using a combination of an anti-obesity agent and cyclo-hispro, or a combination of an anti-obesity agent, zinc and cyclo-hispro.

[0019] Another object of the present invention is to provide a use of cyclo-hispro or a combination of zinc and cyclo-hispro for the manufacture of a drug or health functional food for inhibiting muscle loss or improving muscle function decline by an obesity treatment agent.

[0020] Another object of the present invention is to provide a use of cyclo-hispro or a combination of zinc and cyclo-hispro for the manufacture of a pharmaceutical or health functional food for preventing, improving or treating sarcopenic obesity.

[0021] In order to solve the above-described problem, the present invention provides a pharmaceutical composition for suppressing muscle loss by an obesity treatment agent, comprising cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient, and a health functional food composition for suppressing muscle loss or improving muscle function decline by an obesity treatment agent, comprising the same active ingredient.

[0022] In addition, the present invention provides a method for inhibiting muscle loss or improving muscle function decline using an anti-obesity agent, comprising a step of administering to a subject in need thereof an effective amount of a composition containing cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient.

[0023] In addition, the present invention provides a composition comprising cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient for use in suppressing muscle loss or improving muscle function decline by an obesity treatment agent.

[0024] Additionally, the present invention provides a use of a composition comprising cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof as an active ingredient for the manufacture of a drug or health functional food for inhibiting muscle loss or improving muscle function decline by an obesity treatment agent.

[0025] In the present invention, the composition may contain zinc or a pharmaceutically or food-wise acceptable salt thereof as an additional effective ingredient.

[0026] In the present invention, the obesity treatment agent may be at least one selected from the group consisting of the following i) to vii):

[0027] i) glucagon-like peptide 1 (GLP-1) receptor agonist;

[0028] ii) GLP-1 / glucose-dependent insulinotropic polypeptide (GIP) receptor dual agonists;

[0029] iii) GLP-1 / glucagon receptor dual agonist;

[0030] iv) GLP-1 / GIP / glucagon receptor triple agonist;

[0031] v) Sodium-Glucose Co-Transport-2 (SGLT-2) inhibitors;

[0032] vi) monoamine reuptake inhibitors; and

[0033] vii) An anorexic signal stimulant selected from the group consisting of melanocortin 4 (MC4R) agonists, leptin analogues and amylin mimetics.

[0034] In the present invention, the GLP-1 receptor agonist may be albiglutide, dulaglutide, exenatide, liraglutide, lixisenatide, or semaglutide, the GLP-1 / GIP receptor dual agonist may be tirzepatide, the GLP-1 / glucagon receptor dual agonist may be oxyntomodulin, the monoamine reuptake inhibitor may be tesofensine, the MC4R agonist may be setmelanotide, the leptin analogue may be metreleptin, and the amylin mimetic may be calcitonin.

[0035] In the present invention, the composition may exhibit one or more effects selected from the group consisting of i) to v):

[0036] i) increase muscle mass; ii) increase muscle strength; iii) increase muscle energy production; iv) promote muscle differentiation and regeneration; and v) maintain muscle mass.

[0037] In the present invention, the composition may not affect the weight loss effect of an obesity treatment agent.

[0038] Additionally, the present invention provides a pharmaceutical composition for preventing or treating sarcopenic obesity, comprising cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient, and a health functional food composition for preventing or improving sarcopenic obesity, comprising the same active ingredient.

[0039] In addition, the present invention provides a method for preventing, improving or treating sarcopenic obesity, comprising administering to a subject in need thereof an effective amount of a composition comprising cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient.

[0040] In addition, the present invention provides a composition comprising cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient for use in the prevention, improvement or treatment of sarcopenic obesity.

[0041] Additionally, the present invention provides the use of a composition comprising cyclo-hispro or a pharmaceutically or food-wise acceptable salt thereof as an active ingredient for the manufacture of a drug or health functional food for preventing, improving or treating sarcopenic obesity.

[0042] In the present invention, the composition may contain zinc or a pharmaceutically or food-wise acceptable salt thereof as an additional effective ingredient.

[0043] In the present invention, the composition may exhibit one or more effects selected from the group consisting of the following i) to v):

[0044] i) increase muscle mass; ii) increase muscle strength; iii) increase muscle energy production; iv) promote muscle differentiation and regeneration; and v) maintain muscle mass.

[0045] Furthermore, the present invention provides a pharmaceutical composition for preventing or treating sarcopenic obesity, comprising an obesity treatment agent and cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient.

[0046] In addition, the present invention provides a method for preventing, improving or treating sarcopenic obesity, comprising administering to a subject in need thereof an effective amount of a composition comprising an anti-obesity agent and cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient.

[0047] In addition, the present invention provides an anti-obesity agent for use in the prevention, improvement or treatment of sarcopenic obesity and a composition comprising cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient.

[0048] Additionally, the present invention provides the use of a composition comprising cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient for the manufacture of a medicament for preventing, improving or treating sarcopenic obesity.

[0049] In the present invention, the pharmaceutical composition may contain zinc or a pharmaceutically acceptable salt thereof as an additional active ingredient.

[0050] The composition according to the present invention can suppress and improve muscle loss and / or muscle function decline, which are side effects of obesity treatment drugs, without having any negative effect on the weight loss effect of obesity treatment drugs, and thus can be used as a medicine, health functional food, etc. for preventing, improving, or treating sarcopenia induced in obese patients as well as sarcopenic obesity.

[0051] Figure 1a shows the experimental design to confirm the effect of co-administration of semaglutide, an anti-obesity drug, and CHP or CycloZ on muscle loss inhibition in obese mice.

[0052] Figure 1b is a graph showing the change in body weight by week following co-administration of semaglutide and CHP or CycloZ in obese mice.

[0053] Figure 1c shows the results of microCT quantification of changes in calf muscle mass by week following co-administration of semaglutide and CHP or CycloZ in obese mice. Each result value is corrected to the control value and presented.

[0054] Figure 1d shows the results of quantitatively assessing the change in the weight of each muscle tissue following co-administration of semaglutide and CHP or CycloZ in obese mice (Student's t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0055] Figure 1e shows changes in gene expression related to mitochondrial biogenesis and function following co-administration of semaglutide and CHP or CycloZ in obese mice (Student's t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0056] Figure 1f shows changes in the expression of genes related to lipid metabolism following co-administration of semaglutide and CHP or CycloZ in obese mice (Student's t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0057] Figure 1g shows the changes in gene expression related to myogenesis and muscle maintenance following co-administration of semaglutide and CHP or CycloZ in obese mice (Student's t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0058] Figure 2a shows the experimental design to confirm the effect of co-administration of semaglutide, an anti-obesity drug, and CHP or CycloZ on inhibition of muscle loss and improvement of muscle function in obese mice.

[0059] Figure 2b is a graph showing the change in body weight by week following co-administration of semaglutide and CHP or CycloZ in obese mice.

[0060] Figure 2c shows the results of grip strength measurement after co-administration of semaglutide and CHP or CycloZ in obesity-induced mice (Student's t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0061] Figure 2d shows the results of the limb hanging test after co-administration of semaglutide and CHP or CycloZ in obese mice (Student's t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0062] Figure 2e shows the results of sensorimotor function evaluation after co-administration of semaglutide and CHP or CycloZ in obesity-induced mice (Student's t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0063] Figure 2f shows the results of quantitative microCT analysis of changes in calf muscle mass following co-administration of semaglutide and CHP or CycloZ in obese mice. Each result value is expressed after correction to the control group value (Student's t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0064] Figure 2g shows the results of quantitatively assessing the change in the weight of each muscle tissue following co-administration of semaglutide and CHP or CycloZ in obese mice (Student's t-test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0065] Hereinafter, the present invention will be described in more detail.

[0066] All technical terms used in this invention, unless otherwise defined, have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of the present invention.

[0067] As described above, the present invention experimentally verified that when cyclo-hispro alone or a combination of zinc and cyclo-hispro is administered in combination with an anti-obesity agent, the weight loss effect is maintained in obese patients showing muscle loss, but the effect of suppressing muscle loss and improving muscle function decline is shown.

[0068] Accordingly, the first aspect of the present invention relates to a composition for inhibiting muscle loss or improving muscle function decline by an obesity treatment agent comprising cyclo-hispro or a salt thereof as an active ingredient, and a method for inhibiting muscle loss or improving muscle function using the same.

[0069] Specifically, the composition may be a pharmaceutical composition for inhibiting muscle loss by an anti-obesity agent comprising, consisting essentially of, or consisting of cyclo-hispro or a pharmaceutically acceptable salt thereof; and a health functional food composition for inhibiting muscle loss or improving muscle function decline by an anti-obesity agent comprising, consisting essentially of, or consisting of cyclo-hispro or a pharmaceutically acceptable salt thereof.

[0070] In this specification, the term "cyclo-hisPro (CHP)" refers to a naturally occurring circular dipeptide composed of histidine-proline, a metabolite of thyrotropin-releasing hormone (TRH), or a physiologically active dipeptide that is synthesized in the body through TRH metabolism and de novo, and is widely distributed throughout the brain, spinal cord, and gastrointestinal tract.

[0071] In the composition of the present invention, the CHP may be synthesized or commercially available. Furthermore, it may be purified from substances containing CHP, such as prostate extracts and soybean hydrolysates.

[0072] The term "purified" is used to indicate that the CHP is in a more concentrated form than its natural source, such as prostate extract. Purified components can be concentrated from their natural sources or obtained through chemical synthesis.

[0073] In the composition of the present invention, the CHP refers to anhydrous CHP, amorphous CHP, crystalline CHP, CHP hydrate, or a combination thereof.

[0074] In the present invention, the composition may include zinc or a salt thereof as an additional active ingredient. That is, the composition may comprise, consist essentially of, or consist of CHP or a pharmaceutically or food-wise acceptable salt thereof and zinc or a pharmaceutically or food-wise acceptable salt thereof.

[0075] In this specification, the combination of zinc or a salt thereof and CHP or a salt thereof is also referred to as "CycloZ", and zinc or a salt thereof and CHP or a salt thereof may be included in the composition of the present invention in the form of a single complex or as individual components. Accordingly, zinc or a salt thereof and CHP may be administered in the form of a single complex or as individual components, administered simultaneously, separately, or sequentially.

[0076] In the present invention, the zinc salt may be a pharmaceutically or food-wise acceptable zinc salt. For example, the zinc salt may be a zinc ion, zinc metal, or a zinc salt selected from the group consisting of zinc chloride, zinc acetate, zinc gluconate, zinc stearate, zinc sulfate, zinc oxide, zinc picolinate, zinc orotate, and zinc citrate, but is not limited thereto.

[0077] In the present invention, the weight ratio of zinc:CHP may be 1 to 10:1 to 5, preferably 1 to 5:1 to 2, but is not limited thereto. In the present invention, the weight ratio for zinc is based on the zinc element component, and may represent, for example, the amount of zinc cations or the amount of zinc component in a zinc salt.

[0078] In the present invention, the obesity treatment agent may be at least one selected from the group consisting of the following i) to vii):

[0079] An anorexia signal stimulant selected from the group consisting of i) glucagon-like peptide 1 (GLP-1) receptor agonists; ii) GLP-1 / glucose-dependent insulinotropic polypeptide (GIP) receptor dual agonists; iii) GLP-1 / glucagon receptor dual agonists; iv) GLP-1 / GIP / glucagon receptor triple agonists; v) sodium-glucose co-transport-2 (SGLT-2) inhibitors; vi) monoamine reuptake inhibitors; and vii) melanocortin 4 (MC4R) agonists, leptin analogues, and amylin mimetics.

[0080] According to one embodiment of the present invention, the GLP-1 receptor agonist may be albiglutide, dulaglutide, exenatide, liraglutide, lixisenatide, or semaglutide, the GLP-1 / GIP receptor dual agonist may be tirzepatide, the GLP-1 / glucagon receptor dual agonist may be oxyntomodulin, the monoamine reuptake inhibitor may be tesofensine, the MC4R agonist may be setmelanotide, the leptin analogue may be metreleptin, and the amylin mimetic may be calcitonin.

[0081] In a specific embodiment of the present invention, in order to evaluate whether CHP or CycloZ has a therapeutic effect on muscle loss caused by an anti-obesity agent, as shown in Fig. 1a, CHP or CycloZ was administered together with semaglutide, a representative anti-obesity agent, to mice in which obesity was induced, and changes in the body weight and muscle mass of the mice were observed. Referring to the results of Figs. 1b to 1d, the mice in the group administered only semaglutide showed a weight loss effect compared to the mice in the control group administered only distilled water after obesity induction (Fig. 1b), but it was confirmed that muscle mass was also reduced (Figs. 1c and 1d). However, the mice in the group administered CHP or CycloZ together with semaglutide maintained the weight loss effect (Fig. 1b), and the muscle mass loss was significantly suppressed compared to the mice in the group administered only semaglutide (Figs. 1c and 1d), confirming that CHP or CycloZ can effectively suppress muscle loss caused by an anti-obesity agent.

[0082] Therefore, the composition according to the present invention can be effectively used to suppress muscle loss, a side effect of an anti-obesity agent, without having any negative effect on the weight loss effect of the anti-obesity agent.

[0083] PGC-1α is a key factor in regulating energy metabolism in muscle. It regulates fatty acid oxidation and increases energy production by promoting mitochondrial biogenesis. Furthermore, PGC-1α is known to activate transcription factors such as NRF1 and TFAM, which influence mitochondrial proliferation, energy homeostasis, and respiration. Other genes known to be involved in mitochondrial biogenesis include Err-α, Tf1bm, and Tf2bm.

[0084] Accordingly, in a specific embodiment of the present invention, in order to evaluate whether CHP or CycloZ has an improving effect on muscle loss and muscle function decline caused by an obesity treatment agent, as shown in Fig. 1a, CHP or CycloZ was administered together with semaglutide, a representative obesity treatment agent, to mice in which obesity was induced, and then the expression levels of PGC-1α, NRF1, TFAM, Err-α, Tf1bm, and Tf2bm genes were confirmed. Referring to the results of Fig. 1e, the expression levels of the six genes in the group administered CHP or CycloZ together with semaglutide increased compared to the group administered only semaglutide. Therefore, CHP or a composition containing zinc and CHP can be effectively used to improve muscle function decline by helping muscle energy production by increasing the expression of mitochondrial-mediated energy metabolism regulators.

[0085] Acox1, mCAD, and LPL are genes related to lipid metabolism, and their decreased expression or activity in muscles can reduce the ability to produce energy using fatty acids, thereby promoting muscle protein breakdown.

[0086] Accordingly, in a specific embodiment of the present invention, in order to evaluate whether CHP or CycloZ has an improving effect on muscle loss and muscle function decline caused by an obesity treatment agent, as shown in Fig. 1a, CHP or CycloZ was administered together with semaglutide, a representative obesity treatment agent, to mice in which obesity was induced, and then the expression levels of Acox1, mCAD, and LPL genes were confirmed. Referring to the results in Fig. 1f, the expression levels of the three genes increased in the group of mice administered CHP or CycloZ together with semaglutide compared to the group of mice administered only semaglutide. Therefore, CHP or a composition containing zinc and CHP can suppress the breakdown of muscle proteins by activating the breakdown or oxidation of fatty acids to smoothly supply an external energy source to the muscles, and thus can be effectively used to improve muscle function decline.

[0087] Myogenin, MRF4, MyoD, Myh-2, and Myh-4 are genes involved in muscle development and maintenance, and decreased expression or activity of these genes can lead to decreased muscle differentiation, muscle regeneration, and muscle maintenance, and may result in muscle fiber loss.

[0088] Accordingly, in a specific embodiment of the present invention, in order to evaluate whether CHP or CycloZ has an improving effect on muscle loss and muscle function decline caused by an obesity treatment agent, as shown in Fig. 1a, CHP or CycloZ was administered together with semaglutide, a representative obesity treatment agent, to mice in which obesity was induced, and then the expression levels of Myogenin, MRF4, MyoD, Myh-2, and Myh-4 genes were confirmed. Referring to the results of Fig. 1g, the expression levels of the five genes in the group administered CHP or CycloZ together with semaglutide increased compared to the group administered only semaglutide. Therefore, CHP or a composition containing zinc and CHP can be effectively used to activate muscle differentiation, muscle regeneration, and muscle maintenance by increasing the expression of the five genes, and to inhibit muscle fiber loss, thereby inhibiting muscle loss and improving muscle function decline.

[0089] Accordingly, the composition according to the present invention can exhibit one or more effects selected from the group consisting of the following i) to v): i) increasing muscle mass; ii) increasing muscle strength; iii) increasing muscle energy production; iv) promoting muscle differentiation and regeneration; and v) maintaining muscle.

[0090] In a specific embodiment of the present invention, in order to evaluate whether CHP or CycloZ has an improving effect on muscle loss and muscle function decline caused by obesity treatment drugs, as shown in Fig. 2a, CHP or CycloZ was administered together with semaglutide, a representative obesity treatment drug, to mice in which obesity was induced, and then grip strength was measured, a limb hanging test, and a sensorimotor function evaluation were performed to evaluate the effect of CHP or zinc and CHP on improving exercise performance. Referring to the results of Figs. 2b, 2f, and 2g, the mice in the group administered only semaglutide showed a weight loss effect compared to the mice in the control group administered only distilled water after obesity induction (Fig. 2b), but it was confirmed that muscle mass also decreased along with this effect (Figs. 2f and 2g). However, the group of mice administered CHP or CycloZ together with semaglutide maintained the weight loss effect (Fig. 2b) and significantly suppressed muscle mass loss compared to the group administered only semaglutide (Figs. 2f and 2g), confirming that CHP or CycloZ can effectively suppress muscle loss caused by obesity treatment agents. In addition, referring to the results of Figs. 2c to 2f, the group of mice administered CHP or CycloZ together with semaglutide showed increased maximal muscle strength (Fig. 2c) and hanging time (Fig. 2d) and improved sensorimotor function (Fig. 2e) compared to the group administered only semaglutide, confirming the effects of enhancing muscle strength, motor coordination, tolerance to muscle fatigue, and sense of balance. Therefore, CHP or a composition comprising zinc and CHP can be effectively used to improve muscle function decline caused by obesity treatment agents.

[0091] In addition, the composition according to the present invention can be administered to an individual suffering from both obesity and sarcopenia, for example, an obese individual suffering from sarcopenia as a side effect of taking an anti-obesity agent, for the purpose of suppressing muscle loss and / or improving muscle function decline. Accordingly, a method for suppressing muscle loss or improving muscle function decline by an anti-obesity agent is provided, comprising the step of administering the composition according to the present invention to an individual who is planning to take an anti-obesity agent, an individual who is taking an anti-obesity agent, or an individual who has taken an anti-obesity agent.

[0092] Furthermore, the present invention provides a use of the composition for the manufacture of a drug or health functional food for suppressing muscle loss or improving muscle function decline by an obesity treatment agent.

[0093] Since the description of the method and use of the present invention is the same as the description of the above composition, a duplicate description thereof will be omitted.

[0094] The term "exercise performance capacity" in the present invention refers to the ability to perform physical movements performed in daily life or sports quickly, strongly, for a long time, and skillfully. Exercise performance capacity is defined by factors such as muscle strength, balance, motor coordination, agility, and endurance. Furthermore, the enhancement of exercise performance capacity in the present invention is considered a beneficial physiological effect even in individuals engaged in everyday physical activities not related to exercise.

[0095] The term "muscle fatigue" in the present invention refers to a state in which the ability to perform physical activity is temporarily reduced after intense exercise or prolonged exercise, and is accompanied by a decrease in muscle contractility, etc. Muscle fatigue may manifest as symptoms such as fatigue, decreased endurance, decreased power, or lethargy.

[0096] The term "endurance" in the present invention is defined as resistance to fatigue. This refers to resistance to fatigue that occurs during submaximal (before maximal effort) sustained exercise or intense exercise. Endurance exercise typically lasts 30 minutes or longer. Specifically, exercise lasting 4-5 hours or longer is also referred to as ultra-endurance exercise. Furthermore, the enhancement of endurance is considered a beneficial physiological function for performing exercises that are not time-limited (e.g., recreational running, walking, swimming, cycling, gymnastic training, etc.).

[0097] The second aspect of the present invention relates to a composition for preventing, improving or treating sarcopenic obesity, comprising CHP (cyclo-hispro) or a salt thereof as an active ingredient.

[0098] Specifically, the composition may be a pharmaceutical composition for preventing or treating sarcopenic obesity by an anti-obesity agent comprising, consisting essentially of, or consisting of CHP or a pharmaceutically acceptable salt thereof; and a health functional food composition for preventing or improving sarcopenic obesity comprising, consisting essentially of, or consisting of CHP or a food-based acceptable salt thereof.

[0099] In the present invention, the composition may include zinc or a salt thereof as an additional active ingredient. That is, the composition may comprise, consist essentially of, or consist of CHP or a pharmaceutically or food-wise acceptable salt thereof and zinc or a pharmaceutically or food-wise acceptable salt thereof. The composition and effects of the active ingredients included in the composition are the same as those described in the first aspect, and therefore, description thereof is omitted.

[0100] In the present invention, sarcopenic obesity refers to a condition in which sarcopenia and obesity are combined, and symptoms are shown in which the amount of body fat increases on the surface while the amount of body muscle decreases, and as fat accumulation in muscle tissue increases, damage to muscle cells and tissues increases and muscle functionality decreases.

[0101] In the present invention, the sarcopenic obesity may be caused by, but is not limited to, aging, lack of exercise, malnutrition, taking an anti-obesity drug (especially, taking it for a long time), etc.

[0102] The composition comprising CHP or zinc and CHP according to the present invention exhibits the effects of i) increasing muscle mass; ii) increasing muscle strength; iii) increasing muscle energy production; iv) promoting muscle differentiation and regeneration; and v) maintaining muscle, and therefore can be used for the purpose of inhibiting muscle loss and improving muscle function in sarcopenic obese patients.

[0103] When the composition according to the present invention is used in combination with an anti-obesity agent, the weight loss effect of the anti-obesity agent is maintained, while the muscle loss inhibition and muscle function improvement effects of the composition according to the present invention are simultaneously exhibited, so that sarcopenia and obesity can be treated in combination.

[0104] Additionally, the composition according to the present invention can be administered to a subject suffering from sarcopenic obesity for the purpose of suppressing muscle loss and / or improving muscle function decline. Accordingly, a method for preventing, improving, or treating sarcopenic obesity is provided, comprising administering a composition according to the present invention to a subject suffering from sarcopenic obesity.

[0105] Furthermore, the present invention provides a use of the composition for the manufacture of a pharmaceutical or health functional food for preventing, improving or treating sarcopenic obesity.

[0106] Since the description of the method and use of the present invention is the same as the description of the above composition, a duplicate description thereof will be omitted.

[0107] The third aspect of the present invention relates to a pharmaceutical composition for preventing or treating sarcopenic obesity, comprising an anti-obesity agent and CHP (cyclo-hispro) or a pharmaceutically acceptable salt thereof as an active ingredient.

[0108] Specifically, the pharmaceutical composition comprises, consists essentially of, or may consist of an anti-obesity agent and CHP or a pharmaceutically acceptable salt thereof.

[0109] In the present invention, the pharmaceutical composition may include zinc or a pharmaceutically acceptable salt thereof as an additional active ingredient. That is, the pharmaceutical composition may comprise, consist essentially of, or consist of the obesity treatment agent, CHP or a pharmaceutically acceptable salt thereof, and zinc or a pharmaceutically acceptable salt thereof. The composition and effects of the active ingredients included in the pharmaceutical composition are the same as those described in the first aspect, and therefore, description thereof is omitted.

[0110] In addition, the pharmaceutical composition according to the present invention can be administered to a subject for the purpose of preventing, improving, or treating obesity and sarcopenia. Accordingly, a method for preventing, improving, or treating sarcopenic obesity is provided, comprising a step of administering a composition according to the present invention to a subject. The subject may be, for example, a subject likely to develop sarcopenic obesity or a subject who has developed sarcopenic obesity, and the subject likely to develop sarcopenic obesity may be a subject suffering from sarcopenia who is likely to develop obesity or a subject suffering from obesity who is likely to develop sarcopenia.

[0111] Furthermore, the present invention provides a use of the composition for the manufacture of a pharmaceutical or health functional food for preventing, improving or treating sarcopenic obesity.

[0112] Since the description of the method and use of the present invention is the same as the description of the above composition, a duplicate description thereof will be omitted.

[0113] The term "prevention" used in the present invention means any act of inhibiting or delaying the onset of muscle loss and / or muscle function decline caused by an obesity treatment agent by administering a composition according to the present invention, or any act of inhibiting or delaying the onset of sarcopenic obesity by administering a composition according to the present invention.

[0114] The term "improvement" as used in the present invention means any action that at least reduces a parameter related to the condition being treated, for example, the severity of a symptom.

[0115] The term "treatment" as used in the present invention means any action by which symptoms of muscle loss and / or muscle dysfunction caused by an obesity treatment agent are improved or beneficially changed by administration of a composition according to the present invention.

[0116] In the present invention, the term "pharmaceutically acceptable" means physiologically acceptable and does not typically cause an allergic reaction or similar reaction when administered to a human, and the salt is preferably an acid salt formed by a pharmaceutically acceptable free acid.

[0117] The pharmaceutically acceptable salt may be an acid addition salt formed using an organic acid or an inorganic acid, wherein the organic acid includes, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, malic acid, maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, glucuronic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, dichloroacetic acid, aminooxy acetic acid, benzenesulfonic acid, p-toluenesulfonic acid or methanesulfonic acid. The inorganic acid includes, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid or boric acid. The acid addition salt may preferably be in the form of a hydrochloride or an acetate salt, and more preferably in the form of a hydrochloride salt.

[0118] In addition, other possible salt forms include gabapentin salt, gabapentin salt, pregabalin salt, nicotinate salt, adipate salt, hemimalonate salt, cysteine ​​salt, acetylcysteine ​​salt, methionine salt, arginine salt, lysine salt, ornithine salt, or aspartate salt, etc.

[0119] In addition, the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may further include, for example, carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Carriers for parenteral administration may include water, suitable oils, saline solutions, aqueous glucose, and glycols, and the like. In addition, stabilizers and preservatives may further be included. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol. Other pharmaceutically acceptable carriers may be referred to those described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

[0120] The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal administration.

[0121] The pharmaceutical composition of the present invention may be formulated as a preparation for oral administration or parenteral administration according to the administration route as described above. When formulated, it may be prepared using one or more buffers (e.g., saline or PBS), carbohydrates (e.g., glucose, mannose, sucrose, or dextran, etc.), antioxidants, bacteriostats, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, or surfactants, diluents, or excipients.

[0122] Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, capsules, etc., and these solid preparations can be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose, or gelatin. For example, a tablet or sugar-coated tablet can be obtained by mixing an active ingredient with a solid excipient, then grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.

[0123] In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to the commonly used simple diluents, such as water or liquid paraffin, various excipients may be included, such as wetting agents, sweeteners, flavoring agents, or preservatives.

[0124] Additionally, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrating agent in some cases, and anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included.

[0125] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of injections, transdermal administration agents, and nasal inhalants together with a suitable parenteral carrier according to methods known in the art. In the case of injections, they must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the above injection from microbial contamination, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal, may be additionally included. In addition, the above injection may, in most cases, additionally include an isotonic agent, such as sugar or sodium chloride.

[0126] Transdermal administration agents include ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. "Transdermal administration" as used herein refers to topically administering a pharmaceutical composition to the skin, thereby delivering an effective amount of the active ingredient contained in the pharmaceutical composition into the skin.

[0127] For inhalation administration, the compounds used according to the present invention may conveniently be delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or another suitable gas. For pressurized aerosols, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in the well-known prescription book of pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).

[0128] The pharmaceutical composition of the present invention can provide a desirable effect of inhibiting muscle loss, improving muscle function decline, and / or preventing, improving, or treating sarcopenic obesity when it contains an effective amount of CHP or a pharmaceutically acceptable salt thereof, or zinc or a pharmaceutically acceptable salt thereof and CHP or a pharmaceutically acceptable salt thereof. As used herein, the term "effective amount" refers to an amount that exhibits a greater response than a negative control, and preferably refers to an amount sufficient to inhibit muscle loss, improve muscle function decline, and / or prevent, improve, or treat sarcopenic obesity. The pharmaceutical composition of the present invention may contain 0.01 to 99.9% of CHP or a pharmaceutically acceptable salt thereof, or zinc or a pharmaceutically acceptable salt thereof and CHP or a pharmaceutically acceptable salt thereof, and the remainder may be comprised of a pharmaceutically acceptable carrier. The effective amount of CHP or a pharmaceutically acceptable salt thereof, or zinc or a pharmaceutically acceptable salt thereof, and CHP or a pharmaceutically acceptable salt thereof included in the pharmaceutical composition of the present invention will vary depending on the form in which the composition is manufactured, etc.

[0129] The total effective amount of the pharmaceutical composition of the present invention can be administered to a patient as a single dose, or can be administered by a fractionated treatment protocol in which multiple doses are administered over a long period of time. The pharmaceutical composition of the present invention can vary the content of the active ingredient depending on the patient's condition. For example, the pharmaceutical composition of the present invention can be administered once or several times in an amount of preferably 0.001 to 100 mg, more preferably 0.01 to 10 mg per kg of body weight per day, based on CHP or a pharmaceutically acceptable salt thereof, or zinc or a pharmaceutically acceptable salt thereof and CHP or a pharmaceutically acceptable salt thereof. However, since the dosage of the above-mentioned effective ingredient is determined as an effective dosage for a patient by considering various factors such as the route of administration and number of treatments of the pharmaceutical composition as well as the patient's age, weight, health condition, sex, severity of disease, diet, and excretion rate, taking these into consideration, a person having ordinary skill in the art will be able to determine an appropriate effective dosage for the above-mentioned effective ingredient according to a specific use for the effect of inhibiting muscle loss, improving muscle function decline, and / or preventing, improving, or treating sarcopenic obesity. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route, and administration method as long as it exhibits the effect of the present invention.

[0130] The optimal dosage and dosing interval for each individual active ingredient will depend on the nature and severity of the condition being treated, the dosage form, route, and site of administration, as well as the age and health of the specific patient being treated. Those skilled in the art will recognize that the physician will ultimately determine the appropriate dosage to be used. These doses may be repeated as frequently as appropriate. If adverse effects occur, the dosage and frequency may be modified or reduced according to routine clinical practice.

[0131] The above-mentioned effective ingredient may be administered via any conventional route as long as it can reach the target tissue. The effective ingredient of the composition according to the present invention may be administered intraperitoneally, intravenously, subcutaneously, intradermally, or orally, depending on the intended purpose, but is not limited thereto. Furthermore, the effective ingredient may be administered via any device capable of transporting it to the target cell.

[0132] In the present invention, the term "food-wise acceptable" means physiologically acceptable and does not typically cause an allergic reaction or similar reaction when ingested by humans, and the salt is preferably an acid salt formed by a food-wise acceptable free acid.

[0133] In the present invention, preferred examples of “food-based acceptable salt” may include the types of “pharmaceutically acceptable salt” described above.

[0134] In the present invention, the term “health functional food” includes both the meanings of “functional food” and “health food.”

[0135] In the present invention, the term "functional food" is the same as food for special health use (FoSHU), and refers to a food with high medical and therapeutic effects that is processed to efficiently exhibit a bioregulatory function in addition to providing nutrition.

[0136] In the present invention, the term "health food" refers to a food that has a more active health maintenance or promotion effect than regular food, and "health supplement food" refers to a food for health supplement purposes. In some cases, the terms "functional food," "health food," and "health supplement food" may be used interchangeably. The aforementioned food may be manufactured in various forms, such as tablets, capsules, powders, granules, liquids, and pills.

[0137] As a specific example of such functional foods, processed foods can be manufactured by using the composition to improve the storage properties of agricultural, livestock or marine products while simultaneously modifying them to preserve their characteristics.

[0138] The health functional food composition of the present invention can also be manufactured in the form of a nutritional supplement, a food additive, etc., and is intended for human consumption.

[0139] The above type of food composition can be manufactured in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruits, bottled fruits, jams, marmalades, etc.), fish, meats and processed foods thereof (e.g., ham, sausages, corned beef, etc.), breads and noodles (e.g., udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, taffy, dairy products (e.g., butter, cheese, etc.), edible plant oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (e.g., soybean paste, soy sauce, sauces, etc.), etc., which can be manufactured by adding CHP or a food-scientifically acceptable salt thereof.

[0140] In addition, nutritional supplements may be manufactured by adding CHP or a food-related acceptable salt thereof to capsules, tablets, pills, etc., but are not limited thereto.

[0141] In addition, the health functional food is not limited thereto, but for example, the active ingredient can be manufactured in the form of tea, juice, and drink, and consumed by liquefying, granulating, encapsulating, and powdering so that it can be consumed (health drink). In addition, in order to use the active ingredient in the form of a food additive, it can be manufactured and used in the form of a powder or concentrate. In addition, the active ingredient can be manufactured in the form of a composition by mixing it with other known active ingredients known to be effective in inhibiting muscle loss, improving muscle function decline, and / or preventing, improving, or treating sarcopenic obesity.

[0142] When the food composition of the present invention is used as a health beverage composition, the health beverage composition may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional beverages. The natural carbohydrates described above may be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol. The sweetener may be a natural sweetener such as thaumatin and stevia extract; or a synthetic sweetener such as saccharin and aspartame. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g, per 100 mL of the composition of the present invention.

[0143] CHP or a food-scientifically acceptable salt thereof, or zinc or a food-scientifically acceptable salt thereof and CHP or a food-scientifically acceptable salt thereof may be contained as an effective ingredient of a food composition for inhibiting muscle loss, improving muscle function decline, and / or preventing or improving sarcopenic obesity, and the amount thereof is an amount effective to obtain the above effect, and is preferably, for example, 0.01 to 100 wt% based on the total weight of the entire composition, but is not particularly limited thereto.

[0144] In addition to the above, the health functional food of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, or carbonating agents. In addition, the health functional food of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, or vegetable drinks. These ingredients may be used independently or in mixtures. The proportion of these additives is not particularly important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

[0145] In the present invention, the term "subject" includes, but is not limited to, any animal (e.g., human, horse, pig, rabbit, dog, sheep, goat, non-human primate, cow, cat, guinea pig, or rodent). This term does not indicate a specific age or gender. Therefore, it is intended to include female / female or male / male, adult / adult and newborn subjects, as well as fetuses. A patient refers to a subject suffering from a disease or disorder. The term patient includes human and veterinary subjects.

[0146] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0147] [Example 1]

[0148] Confirmation of the muscle loss suppression effect of CHP or CycloZ in weight loss

[0149] 1-1. Preparation of experimental animals and administered drugs

[0150] Four-week-old male C57BL6 / J mice were purchased from Daehan Biolink. They were reared under constant conditions (temperature: 22±2℃, relative humidity: 55±10%, circadian rhythm: 12 h). After one week of adaptation by feeding Purina rat chow, obesity was induced with a high-fat diet (12492) containing 60% fat from Research Diet for 16 weeks. The high-fat chow was replaced with fresh chow every 3–4 days, and distilled water was used as drinking water. CHP used in the examples below was purchased from Angene, zinc gluconate from Captek Softgel International, and semaglutide from Angene.

[0151] 1-2. Drug administration schedule and weight measurement

[0152] As shown in Fig. 1a, after inducing obesity with a high-fat diet for 16 weeks, the mice were randomly divided into groups with the same average body weight (Table 1). As shown in Table 1, the drug, semaglutide 60 μg / kg, an obesity treatment, was injected subcutaneously daily in experimental groups 1 to 3, and distilled water, CHP 35 mg / kg, or CycloZ 15 mg / kg (based on CHP and elemental zinc content) was administered orally. CycloZ in experimental group 3 was a mixture of zinc gluconate and CHP in a 2:1 weight ratio (based on elemental zinc) to provide a total dose of 15 mg / kg.

[0153] Group setting and drug administration Group Injection drug (sc) Oral drug Regular diet feeding group (Chow) Distilled water Control group (CTRL) Distilled water Experimental group 1 (Sema) Semaglutide 60 μg / kg Distilled water Experimental group 2 (Sema+CHP) CHP 35 mg / kg Experimental group 3 (Sema+CycloZ) CycloZ 15 mg / kg

[0154] Body weight was measured weekly during the experimental period. As shown in Figure 1b, body weight decreased rapidly in the experimental groups compared to the control group, and no significant difference in body weight was observed between the drug-administered groups (Experimental Groups 1-3).

[0155] 1-3. Confirmation of the effect of CHP or CycloZ administration on muscle loss inhibition

[0156] At 3 and 6 weeks after drug administration, images were taken of the area below the ribs using an Inveon® Multi-Modality micro PET / SPECT / CT scanner from Siemens. Calf muscle volume was measured using Inveon Acquisition Workplace Software at an intensity threshold of 300 to 450, corresponding to muscle, and then compared with the control group after correction. Statistical significance was analyzed using the t-test statistical method with experimental group 1 (Semaglutide) (**p<0.01, ****p<0.0001).

[0157] As a result, as shown in Fig. 1c, at 3 weeks after drug administration, the obesity treatment drug semaglutide showed a 19.2% decrease in muscle mass, while CHP and CycloZ showed only 11.1% and 7.9% decrease in muscle mass, respectively. In other words, it was confirmed that CHP and CycloZ inhibited the muscle loss caused by semaglutide by 8.1% and 11.3%, respectively. In addition, as shown in Fig. 1c, at 6 weeks after drug administration, the obesity treatment drug semaglutide showed a 23.3% decrease in muscle mass, while CHP and CycloZ showed only 10.0% and 8.4% decrease in muscle mass, respectively. In other words, it was confirmed that CHP and CycloZ inhibited the muscle loss caused by semaglutide by 13.3% and 14.9%, respectively. Through this, it was confirmed that CHP and CycloZ help maintain muscle mass by suppressing the muscle wasting side effect caused by semaglutide.

[0158] 1-4. Confirmation of changes in the weight of each muscle tissue following CHP or CycloZ administration

[0159] Seven weeks after drug administration, the mice were euthanized, and the gastrocnemius, tibialis anterior (TA), soleus, extensor digitorum longus (EDL), and quadriceps muscles were isolated. The weights of each muscle tissue were measured and compared. As shown in Fig. 1d, it was confirmed that the muscle mass loss induced by semiglutide was suppressed by CHP and CycloZ, thereby alleviating the muscle wasting side effect induced by semaglutide.

[0160] 1-5. Measurement of changes in muscle gene expression following CHP or CycloZ administration

[0161] Muscle tissue was extracted with NucleoZOL (MACHEREY-NAGEL) according to the manufacturer's total RNA isolation protocol, and 1 μg of RNA was subjected to reverse transcription polymerase chain reaction (RT-PCR) to synthesize cDNA using ReverTra Ace qPCR RT Master Mix (Toyobo). The synthesized cDNA was subjected to real-time PCR using primer sets for the following genes: PGC-1α, TFAM, NRF1, ERR-α, TF1BM, and TF2BM, which are known to be related to mitochondrial biogenesis and function; Acox1, mCAD, and LPL, which are known to be related to lipid metabolism; and Myogenin, MRF4, MyoD, Myh-2, and Myh-4, which are known to be involved in muscle development and maintenance. The expression levels were quantified and analyzed by SYBR Green Realtime PCR. Each gene expression value was corrected by dividing it by the expression value of the housekeeping gene, β-actin or Hprt. Each primer set was synthesized by Bioneer, and the base sequence information is shown in Table 2.

[0162] 유전자 정방향 (5'-3')서열번호역방향 (5'-3')서열번호Pgc-1αAAGGACTCTGAGAACACTTG1CAACTGACCCAAACACTTTAC2TfamCGGACCTCTAAGATCTAACTAC3CTACCTTTCCCATTCCCTTC4Nrf1CCTCAGCCTCCATCTTCT5GACCTTACAACCAAGCAACT6Err-αCAGGAGGCAGACACTGAT7CGGATTAAGCAGCAGCAA8Tfb1mGGCTGAGAGACTTGTAGCCACT9AGGTGCACCACTCCTACATCAA10Tfb2mTTTGGCAAGTGGCCTGTGAC11ACTGATTCCCCGTGCTTTGACT12Acox1ACACTAACATATCAACAAGAGGAG13CATTGCCAGGAAGACCAG14mCADTAGACGAAGCCACGAAGTA15GAGCCTAGCGAGTTCAAC16LPLAATAAGAAGGTCAATAGAATTACTGG17AATCAGCGTCATCAGGAG18MyogeninCTCCTAAGTCCCAGTCCAT19TCTAAGCAACCCTCCATCT20Mrf4GCGCGAAAGGAGGAGACTAA21CAGTCTCTGGTTGGGGTTGG22MyoDTATGGAGCTTCTATCGCCGC23GTCGTCTGCTGTCTCAAAGGA24Myh-2GGAGGCTGAGGAACAATCCAA25GGACAGCCTTACTCTTCGCT26Myh-4GGAGGCTGAGGAACAATCCA27CTCCTGTCACCTCTCAACAGAA28β-actinGGGAAGGTGACAGCATTG29ATGAAGTATTAAGGCGGAAGATT30HprtAAATGTCAGTTGCTGCGTCC31TCTACCAGAGGGTAGGCTGG32

[0163] As shown in Fig. 1e, the expression of genes related to mitochondrial biogenesis and function, genes related to lipid metabolism, and genes involved in muscle development and maintenance was confirmed to increase in mice administered CHP or CycloZ compared to mice administered only semaglutide. These results confirmed that CHP and CycloZ help maintain muscle mass by suppressing and improving the side effects of semaglutide-induced muscle loss and decreased muscle function.

[0164] [Example 2]

[0165] Confirmation of the effect of CHP or CycloZ on improving muscle function following weight loss

[0166] 2-1. Drug administration schedule and weight measurement

[0167] Mice were grouped and drug administered in the same manner as in Example 1-2 (Fig. 2a). The body weights of each group were measured weekly during the experimental period. As shown in Fig. 2b, body weights in the experimental groups decreased rapidly compared to the control group, and no significant differences in body weight were observed between the drug-administered groups (Experimental Groups 1-3).

[0168] 2-2. Grip strength test

[0169] To measure changes in muscle strength due to CHP or CycloZ, a grip strength test was performed 4 weeks after drug administration as follows. The mice were held by the tail and had to grasp the grid of the grip strength test apparatus. The maximum grip strength of the forepaws and hind paws when the tail was pulled backward was measured using a grip strength meter (Bioseb). Grip strength was measured repeatedly three times, and the average value was corrected for body weight and used. As a result of the experiment, as confirmed in Fig. 2c, the grip strength of the mice in the control group and the group administered only semaglutide significantly decreased compared to the mice in the group fed a normal diet. However, the grip strength of the mice in the group administered CHP or CycloZ together with semaglutide significantly increased compared to the mice in the group administered only semaglutide.

[0170] 2-3. Four-limb-wire hanging test

[0171] The limb hanging test is a muscle function measurement method that comprehensively measures muscle strength, coordination, and fatigue tolerance in rodents. It is a method for measuring continuous muscle function in mice against body weight. Mice were placed on a 10x10 cm wire grid and carefully turned over to measure the time it took for them to fall to the floor. The height to the floor was set to 40 cm, and cushioning was placed on the surface where the mouse fell to prevent shock from falling. The longest hanging time among two measurements was recorded. As shown in Figure 2d, the hanging time of mice in the control group and the semaglutide-only group was significantly reduced compared to mice fed a normal diet. However, the hanging time of mice in the groups administered CHP or CycloZ together with semaglutide was significantly increased compared to mice administered semaglutide-only.

[0172] These results confirmed that CHP and CycloZ were effective in increasing limb muscle strength and exercise endurance.

[0173] 2-4. Sensorimotor function assessment (Rota-rod test)

[0174] Sensorimotor function assessment is a method to measure motor coordination and balance in animals. Mice were placed on a rotating cylinder of a rotarod (Harvard Apparatus) that rotated at 4 rpm. The speed was steadily increased to 40 rpm over 5 minutes, and the time until they lost their balance and fell to the floor was measured. The experiment was conducted three times per day for a total of three days, and the average value of the three measurements was used. As shown in Figure 2e, the mice in the control group and the group administered only semaglutide showed significantly reduced sensorimotor function compared to the group fed a normal diet. However, the mice in the group administered CHP or CycloZ together with semaglutide showed significantly improved sensorimotor function compared to the group administered only semaglutide.

[0175] From the above results, it can be reasonably predicted that administration of CHP or CycloZ will have the effect of significantly improving muscle strength, motor coordination, tolerance to muscle fatigue, and sense of balance in obese patients with muscle loss and / or decreased muscle function.

[0176] 2-5. Confirmation of the effect of CHP or CycloZ administration on muscle loss inhibition

[0177] Three weeks after drug administration, the changes in calf muscle mass of each group of mice were confirmed using the same method as in Examples 1-3. As a result, as shown in Fig. 2f, semaglutide showed a 6.211% decrease in muscle mass, while CHP and CycloZ restored muscle mass, showing muscle mass increases of 1.023% and 1.700%, respectively. In other words, it was confirmed that CHP and CycloZ not only suppressed the muscle loss caused by semaglutide, but also induced muscle mass increase through muscle mass recovery.

[0178] 2-6. Confirmation of changes in the weight of each muscle tissue following CHP or CycloZ administration

[0179] Five weeks after drug administration, the mice were euthanized, and the hindlimb muscles (total hindlimb muscles), gastrocnemius, tibialis anterior (TA), soleus, extensor digitorum longus (EDL), and quadriceps were isolated. The weights of each muscle tissue were measured and compared. As shown in Fig. 2g, it was confirmed that the muscle mass loss induced by semiglutide was suppressed by CHP and CycloZ, thereby alleviating the muscle wasting side effect induced by semaglutide.

[0180] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A pharmaceutical composition for suppressing muscle loss by an obesity treatment agent, comprising cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient.

2. A pharmaceutical composition for suppressing muscle loss by an obesity treatment agent, comprising zinc or a pharmaceutically acceptable salt thereof as an additional active ingredient in the first paragraph.

3. In the first paragraph, the anti-obesity agent is at least one selected from the group consisting of the following i) to vii), a pharmaceutical composition for inhibiting muscle loss by an anti-obesity agent: i) glucagon-like peptide 1 (GLP-1) receptor agonist; ii) GLP-1 / glucose-dependent insulinotropic polypeptide (GIP) receptor dual agonists; iii) GLP-1 / glucagon receptor dual agonist; iv) GLP-1 / GIP / glucagon receptor triple agonist; v) Sodium-Glucose Co-Transport-2 (SGLT-2) inhibitors; vi) monoamine reuptake inhibitors; and vii) An anorexic signal stimulant selected from the group consisting of melanocortin 4 (MC4R) agonists, leptin analogues and amylin mimetics.

4. In paragraph 3, The above GLP-1 receptor agonist is albiglutide, dulaglutide, exenatide, liraglutide, lixisenatide or semaglutide, The above GLP-1 / GIP receptor dual agonist is Tirzepatide, The above GLP-1 / glucagon receptor dual agonist is oxyntomodulin, The above monoamine reuptake inhibitor is Tesofensine, The above MC4R agonist is setmelanotide, The above leptin analogue is metreleptin, A pharmaceutical composition for inhibiting muscle loss by an obesity treatment agent, wherein the amylin mimetic is calcitonin.

5. A pharmaceutical composition for inhibiting muscle loss by an obesity treatment agent, wherein the pharmaceutical composition exhibits at least one effect selected from the group consisting of the following i) to v): i) increase muscle mass; ii) increase muscle strength; iii) increase muscle energy production; iv) promote muscle differentiation and regeneration; and v) maintain muscle mass.

6. A pharmaceutical composition for suppressing muscle loss by an anti-obesity agent, wherein the composition in paragraph 1 does not affect the weight loss effect by an anti-obesity agent.

7. A health functional food composition for suppressing muscle loss or improving muscle function decline by an obesity treatment agent, comprising cyclo-hispro or a food-related acceptable salt thereof as an active ingredient.

8. A health functional food composition for suppressing muscle loss or improving muscle function decline by an obesity treatment agent, comprising zinc or a food-based acceptable salt thereof as an additional effective ingredient in paragraph 7.

9. In paragraph 7, the obesity treatment agent is at least one selected from the group consisting of the following i) to vii), a health functional food composition for suppressing muscle loss or improving muscle function decline by an obesity treatment agent: i) glucagon-like peptide 1 (GLP-1) receptor agonist; ii) GLP-1 / glucose-dependent insulinotropic polypeptide (GIP) receptor dual agonists; iii) GLP-1 / glucagon receptor dual agonist; iv) GLP-1 / GIP / glucagon receptor triple agonist; v) Sodium-Glucose Co-Transport-2 (SGLT-2) inhibitors; vi) monoamine reuptake inhibitors; and vii) An anorexic signal stimulant selected from the group consisting of melanocortin 4 (MC4R) agonists, leptin analogues and amylin mimetics.

10. In paragraph 9, The above GLP-1 receptor agonist is albiglutide, dulaglutide, exenatide, liraglutide, lixisenatide or semaglutide, The above GLP-1 / GIP receptor dual agonist is Tirzepatide, The above GLP-1 / glucagon receptor dual agonist is oxyntomodulin, The above monoamine reuptake inhibitor is Tesofensine, The above MC4R agonist is setmelanotide, The above leptin analogue is metreleptin, The above amylin mimetic is a health functional food composition for inhibiting muscle loss or improving muscle function decline by an obesity treatment agent, which is calcitonin.

11. A health functional food composition for inhibiting muscle loss or improving muscle function decline by an obesity treatment agent, which exhibits at least one effect selected from the group consisting of the following i) to v) in the 7th paragraph: i) increase muscle mass; ii) increase muscle strength; iii) increase muscle energy production; iv) promote muscle differentiation and regeneration; and v) maintain muscle mass.

12. In paragraph 7, the composition is a health functional food composition for suppressing muscle loss or improving muscle function decline by an anti-obesity agent, which does not affect the weight loss effect by an anti-obesity agent.

13. A pharmaceutical composition for preventing or treating sarcopenic obesity, comprising cyclo-hispro or a pharmaceutically acceptable salt thereof as an active ingredient.

14. A pharmaceutical composition for preventing or treating sarcopenic obesity, comprising zinc or a pharmaceutically acceptable salt thereof as an additional active ingredient in claim 13.

15. A pharmaceutical composition for preventing or treating sarcopenic obesity, which exhibits at least one effect selected from the group consisting of the following i) to v): i) increase muscle mass; ii) increase muscle strength; iii) increase muscle energy production; iv) promote muscle differentiation and regeneration; and v) maintain muscle mass.

16. A health functional food composition for preventing or improving sarcopenic obesity, comprising cyclo-hispro or a food-related acceptable salt thereof as an active ingredient.

17. A health functional food composition for preventing or improving sarcopenic obesity, comprising zinc or a food-wise acceptable salt thereof as an additional effective ingredient in Article 16.

18. A health functional food composition for preventing or improving sarcopenic obesity, which exhibits at least one effect selected from the group consisting of the following i) to v): i) increase muscle mass; ii) increase muscle strength; iii) increase muscle energy production; iv) promote muscle differentiation and regeneration; and v) maintain muscle mass.

19. Cyclo-hispro or a pharmaceutically acceptable salt thereof; and A pharmaceutical composition for preventing or treating sarcopenic obesity, comprising an obesity treatment agent as an active ingredient.

20. A pharmaceutical composition for preventing or treating sarcopenic obesity, comprising zinc or a pharmaceutically acceptable salt thereof as an additional active ingredient in claim 19.

21. A method for suppressing muscle loss or improving muscle function decline using an obesity treatment agent, comprising administering the pharmaceutical composition of claim 1 or 2 to a subject in need thereof.

22. A method for suppressing muscle loss or improving muscle function decline by an obesity treatment agent, wherein the subject is a subject who is planning to take an obesity treatment agent, a subject who is taking an obesity treatment agent, or a subject who has taken an obesity treatment agent.

23. A method for preventing, improving or treating sarcopenic obesity, comprising administering the pharmaceutical composition of claim 13 or 14 to a subject in need thereof.

24. A method for preventing, improving or treating sarcopenic obesity, comprising administering the pharmaceutical composition of claim 19 or 20 to a subject in need thereof.

25. Use of the pharmaceutical composition of claim 1 or 2 or the health functional food composition of claim 7 or 8 for the manufacture of a drug or health functional food for suppressing muscle loss or improving muscle function decline by an obesity treatment agent.

26. Use of the pharmaceutical composition of claim 13 or 14 or the health functional food composition of claim 16 or 17 for the manufacture of a drug or health functional food for preventing, improving or treating sarcopenic obesity.

27. Use of the pharmaceutical composition of claim 19 or 20 for the manufacture of a medicament for preventing, improving or treating sarcopenic obesity.

Images