Composition for inducing differentiation into nerve cells or nerve cell regeneration, comprising SQB-DNA origami as active ingredient
SQB-DNA nanostructures using DNA origami technology with growth factor mimicking peptides address the limitations of current nerve injury treatments by enhancing neural cell differentiation and regeneration, achieving improved nerve recovery through precise ligand presentation.
Patent Information
- Application Number
- PCT/KR2025/005940
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-30
- Filing Date
- 2025-04-30
- Publication Date
- 2025-11-06
AI Technical Summary
Current treatments for peripheral nerve injuries are inadequate in achieving complete recovery due to the limitations of mesenchymal stem cells, necessitating complementary strategies that can promote nerve repair and restore motor function.
The development of SQB-DNA nanostructures using DNA origami technology, functionalized with growth factor mimicking peptides such as BDNF, NGF, and VEGF, to precisely control ligand placement and enhance neural cell differentiation and regeneration.
The SQB-DNA nanostructures effectively promote nerve recovery by increasing cell proliferation, migration, and neural marker expression, leading to improved myelination and functional recovery in nerve injury models.
Smart Images

Figure KR2025005940_06112025_PF_FP_ABST
Abstract
Description
A composition for inducing differentiation into neural cells or neural cell regeneration, comprising SQB-DNA origami as an active ingredient
[0001] The present invention provides an SQB-DNA nanostructure manufactured using DNA origami technology for use in differentiation into neural cells, induction of neural cell regeneration, treatment of neural damage, or treatment of neural diseases.
[0002] Damage to the peripheral nervous system (PNS), primarily comprised of neurons, plays a crucial role in transmitting signals between the brain and the body, and can result in loss of motor and sensory functions. Despite significant advances in medical science, developing effective treatment strategies for peripheral nerve injury remains a challenging task. One of the body's natural responses to nerve injury is the recruitment of mesenchymal stem cells (MSCs) to the site of injury, where they differentiate into various cell types and contribute to nerve repair. However, despite their significant regenerative potential, MSCs alone are insufficient to achieve complete recovery, highlighting the need for complementary therapeutic strategies that can promote nerve repair and restore motor function.
[0003] DNA origami technology is a technique for creating a desired structure by folding and fixing a long DNA strand, usually about 7,000 to 8,000 bases, into tens to hundreds of short single-stranded DNA (ssDNA) strands.
[0004] In DNA nanotechnology, the Watson-Crick law of association is used to synthesize DNA strands with a pre-programmed, specific base sequence to create structures of a desired shape. This DNA then self-assembles with other DNA strands with complementary base sequences to form double-stranded DNA. Using the same principle, two double-stranded DNA strands can be linked in parallel through a junction (folded region) called a Holliday junction (or crossover). By connecting multiple double-stranded DNA strands in this way, DNA nanostructures with specific shapes can be created on a two-dimensional plane. Extending this principle spatially allows for the creation of three-dimensional structures with specific lattice structures.
[0005] In DNA origami, a long, single-stranded DNA, typically 7,000 to 8,000 base pairs, is used as the basic framework for constructing the structure. Furthermore, to create nanostructures by connecting specific parts of the scaffold, approximately 200 chemically synthesized, short, single-stranded DNA units, each 20 to 50 base pairs, are used. These DNA units are called staples.
[0006] This DNA origami technology can fabricate complex 2D / 3D nanostructures with high precision, within a few nanometers (nm), that cannot be fabricated using conventional top-down manufacturing techniques. This enables applications such as precisely arranging various nanomaterials or active substances at desired locations. Furthermore, because it utilizes biomolecules, the fabricated nanostructures exhibit excellent biocompatibility.
[0007] The present inventors developed an innovative platform that promotes neural repair by targeting growth factors to damaged neural tissue. They utilized square block (SQB) DNA nanostructures, further functionalizing them for new applications. SQBs possess the ability to precisely control the spatial arrangement of ligands, enabling high-density ligand placement. Therefore, they are expected to serve as a suitable platform for the effective delivery of growth factors.
[0008] The technical problem to be achieved by the present invention is to provide a SQB-DNA nanostructure manufactured using DNA origami technology for use in differentiation into neural cells, induction of neural cell regeneration, treatment of neural damage, and / or treatment of neural diseases.
[0009] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.
[0010] To solve the above problem, the present invention provides a composition for inducing differentiation into neural cells or neural cell regeneration, which contains as an effective ingredient an SQB-DNA nanostructure manufactured using DNA origami technology.
[0011] In addition, the present invention provides a pharmaceutical composition for treating nerve damage or nerve disease, comprising the above-described SQB-DNA nanostructure as an active ingredient.
[0012] In the present invention, the SQB-DNA nanostructure is K 10 -PEG 5k It is coated with .
[0013] As one embodiment of the present invention, the surface of the DNA nanostructure may be labeled with a growth factor mimicking peptide.
[0014] In the present invention, the growth factor mimicking peptide may be conjugated to ssDNA having a sequence capable of complementary binding to a free handle designed on the surface of a DNA nanostructure, thereby providing a peptide-ssDNA conjugate and labeling the surface of the DNA nanostructure.
[0015] As another embodiment of the present invention, the growth factor mimetic peptide may be at least one selected from the group consisting of brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), vascular endothelial growth factor (VEGF), and fibroblast growth factor 2 (FGF2).
[0016] As another embodiment of the present invention, the growth factor mimetic peptides may be of two or more types and may include BDNF and NFG.
[0017] As another embodiment of the present invention, the DNA nanostructure can be labeled with four or more growth factor mimicking peptides, and the growth factor mimicking peptides can be labeled at intervals of 5 to 14 nm on the surface of the DNA nanostructure.
[0018] The DNA nanostructure of the present invention can increase AKT / ERK signaling by activating TrkB and TrkA receptors.
[0019] In another embodiment of the present invention, the nerve damage or nerve disease may be at least one selected from the group consisting of brain damage, brain disease, spinal cord injury, peripheral nerve damage, peripheral nerve disease, and amyotrophic lateral sclerosis, and the brain damage or brain disease may be at least one selected from the group consisting of dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, epilepsy, stroke, apoplexy, ischemic brain disease, and degenerative brain disease.
[0020] The present invention is the first case of achieving nerve recovery through precise ligand presentation using DNA origami nanostructures, and it is expected that SQB will be widely used as a therapeutic drug for various nerve injuries and neurological diseases requiring nerve regeneration through the provision of the present invention.
[0021] Figure 1 is a schematic diagram of the fabrication of a square block (SQB) DNA nanostructure containing a growth factor-mimetic peptide and a drawing showing the results of fabrication:
[0022] (A) Schematic overview of the square block (SQB) DNA origami nanostructure. The SQB is designed with dimensions of 27 × 35 × 22.5 nm and is fabricated by folding a long scaffold DNA with 245 short staple DNA bases through Watson-Crick base pairing.
[0023] (B) Results of 1.5% agarose gel electrophoresis (AGE) analysis confirming successful SQB synthesis before and after PEG precipitation. After PEG precipitation, unreacted excess stapled DNA was removed.
[0024] (C) Schematic overview of the SQB synthesis process containing a growth factor-mimetic peptide. The NHS ester of BCN-NHS reacted with the amine group present at the 5' end of single-stranded DNA (ssDNA), synthesizing a BCN-ssDNA conjugate. The BCN group of the ssDNA then reacted with the azide group of the peptide through a strain-promoted alkyne-azide cycloaddition (SPAAC) reaction to form a peptide-ssDNA conjugate. SQB was synthesized with a complementary strand sequence protruding from its surface, and the peptide was then bound to this strand. Hybridization of the two strands resulted in stable binding of the peptide to the SQB surface.
[0025] (D) Results of 1.5% AGE analysis showing SQB containing BDNF, NGF, FGF2, or VEGF mimetic peptides.
[0026] (E) TEM images of each SQB peptide observed. The scale bar represents 25 nm.
[0027]
[0028] Figure 2 shows the results of confirming the characteristics of SQB and ssDNA bound to growth factor mimetic peptides:
[0029] (A) A negative stain transmission electron microscopy (TEM) image confirmed the SQB structure measuring 27 × 35 × 22.5 nm. The scale bar is 100 nm.
[0030] (B) Synthesis of ssDNA conjugated with various growth factor-mimetic peptides was analyzed by 15% denaturing urea polyacrylamide gel electrophoresis (Urea-PAGE).
[0031] (C) 15% Urea-PAGE analysis of ssDNA conjugated with various growth factor mimic peptides after gel purification.
[0032]
[0033] Figures 3a to 3f show the results of evaluating the stability enhancement and cytotoxicity of SQB and confirming the morphological changes of hMSCs after treatment with SQB containing growth factor-mimetic peptides:
[0034] (Figure 3a) 1.5% agarose gel electrophoresis (AGE) analysis confirmed that K10-PEG5k was successfully coated on the SQB surface.
[0035] (Fig. 3b) The stability of SQB with or without K10-PEG5k coating was evaluated in culture medium containing serum for 7 days. Cultured SQB were collected on days 0, 1, 3, and 7 (D0, D1, D3, and D7) and evaluated using a 1.5% AGE assay. After removing the poly-lysine PEG coating from the SQB, each collected SQB was analyzed on a 1.5% agarose gel at 70 V for 50 min.
[0036] (Fig. 3c) Corresponding to the image of Fig. 3b, the intensity of the band representing SQB was measured using ImageJ software.
[0037] (Fig. 3d) Cell viability of human mesenchymal stem cells (hMSCs) treated with p8634 scaffold and stapled DNA or SQB was evaluated for 1, 2, and 3 days.
[0038] (Figure 3e) Representative differential interference contrast (DIC) images (top) of hMSC morphology on day 5 after functional conjugation of BDNF-, NGF-, FGF2-, and VEGF-mimetic peptides to SQB. DIC images were color-mapped according to orientation angle using the OrientationJ plugin in ImageJ. The colors of the hemispheres represent angles from -90° to 90°. The polar histograms (bottom) quantitatively visualize cell orientation alignment, with the color ranges indicating the relative frequency of cell orientations. Fluorescence microscopy images (middle) of hMSCs treated with specific functional SQBs. Cells were stained for β-tubulin III (Alexa Fluor 488, green) and nuclei (DAPI, blue). The scale bar in each image is 50 μm.
[0039] (Fig. 3f) The degree of morphological alignment was evaluated by the coherency coefficient, where 1 indicates a highly aligned structure and 0 indicates an isotropic arrangement.
[0040]
[0041] Figures 4a to 4i show the results of confirming the effect on hMSC according to the spacing and binding affinity of SQB including growth factor-mimetic BDNF peptide.
[0042] (Figure 4a) Schematic representation of the binding pattern of BDNF-mimetic peptides in SQB, showing changes in peptide spacing and valency.
[0043] (Figures 4b and 4c) 1.5% agarose gel electrophoresis (AGE) images confirmed that BDNF-mimetic peptides with different spacings and binding affinities were successfully bound to SQB.
[0044] (Figures 4d and 4f) Representative differential interference contrast (DIC) images (left) and polar histograms (right) of the directional distributions of hMSCs on day 6, showing hMSC morphology treated with various BDNF spacing and binding conditions. Scale bar is 200 μm.
[0045] hMSCs were treated three times at two-day intervals, with the following conditions:
[0046] (Fig. 4d) 95 nM SQB-BDNF4.
[0047] (Fig. 4f) 10 nM SQB-BDNF.
[0048] (Figures 4e and 4g) Cellular alignment was quantitatively evaluated by measuring the coherency coefficient value in the DIC images according to each SQB-BDNF interval and binding affinity.
[0049]
[0050] Figure 5 is an SQB image containing BDNF-mimetic peptides with various spacings and binding sites.
[0051] (A) Conjugation ratios of fluorescein isothiocyanate (FITC)-conjugated SQBs with different valencies. To evaluate the correlation between FITC intensity and valency, FITC was conjugated to the indicated BDNF peptide sites on SQB. Fluorescence intensity was quantified using an iBright imager. The inset image shows fluorescence images of wells of a 96-well microplate containing SQB-FITC with various valencies.
[0052] (B) TEM images of SQB-BDNF with different peptide spacings and bonding valencies. Scale bar is 50 nm.
[0053]
[0054] Figures 6a to 6i show the results of confirming TrkB-mediated hMSC activation by SQB including growth factor-mimetic BDNF peptide.
[0055] (Figure 6a) Representative differential interference contrast (DIC, top left) and fluorescence microscopy images (bottom left) showing the morphology and alignment of hMSCs after treatment with SQB-BDNF (38 BDNF-mimetic peptides, spaced 5 nm apart) and SQB + BDNF (10 nM SQB and 380 nM BDNF peptide) on day 6. DIC images were color-mapped according to orientation angle, and fluorescence microscopy images were stained for β-tubulin III (Alexa Fluor 488, green) and nuclei (DAPI, blue) to visualize the neuron-like morphology of hMSCs. Scale bar is 50 μm.
[0056] The polar histogram on the right quantitatively identifies hMSC alignment in each treatment condition, with colors indicating the relative frequency of specific alignment angles. Red indicates the most frequently observed orientation, while blue / purple indicates the least frequently observed orientation.
[0057] (Fig. 6b) Quantitative analysis (coherency coefficient) of hMSC directional distribution after SQB-BDNF and SQB + BDNF treatment.
[0058] (Fig. 6c) CCK-8 assays were performed on days 2, 4, and 6. Cell proliferation of hMSCs treated with SQB, SQB-BDNF, and BDNF peptides increased compared to the untreated group. Statistical method: Two-way ANOVA. Data are expressed as mean ± standard deviation (SD) (n = 4), ****P < 0.0001.
[0059] (Fig. 6d) Representative images of wound healing assays of hMSCs treated with SQB-BDNF for 12 hours. Cell migration of hMSCs treated with SQB-BDNF was enhanced compared to the untreated and SQB groups. Statistical method: one-way ANOVA. Invasion percentages were expressed as the mean ± SD (n = 5). *P < 0.05, **P < 0.01.
[0060] (Figure 6e) Fluorescence microscopy images of hMSCs treated with Cy5.5-labeled SQB-BDNF for 4 hours. Relative fluorescence intensities were quantified using ImageJ software to assess SQB uptake in the presence or absence of BDNF-mimetic peptides. To inhibit the TrkB receptor, hMSCs were co-incubated with SQB and 100 nM BDNF protein. Scale bar is 20 μm.
[0061] (Fig. 6f and g) Western blotting analysis and quantification of AKT and ERK phosphorylation in hMSCs treated with SQB-BDNF for 6 days. Statistical method: one-way ANOVA. Data are expressed as mean ± SD (n = 3). ***P < 0.001, ****P < 0.0001.
[0062] (Fig. 6h) Analysis of NGF protein secretion in hMSCs treated with SQB-BDNF for 6 days (n = 3, biologically independent samples per group). The NGF secretion capacity of hMSCs treated with SQB-BDNF was significantly increased. Statistical method: two-way ANOVA. Data are expressed as mean ± SD (n = 3). *P < 0.05, ***P < 0.001.
[0063] (Fig. 6i) Western blot analysis and quantification of nestin expression in hMSCs exposed to SQB-BDNF for 6 days. Nestin expression in SQB-BDNF-treated hMSCs was significantly increased compared to all other groups. Statistical method: one-way ANOVA. Data are expressed as mean ± SD (n = 3). *P < 0.05, **P < 0.01.
[0064]
[0065] Figure 7 shows the results of analysis of TrkB expression, AKT / ERK signaling, and BDNF / Nestin expression in hMSCs treated with SQB-BDNF.
[0066] (A) Western blot analysis of TrkB and TrkA receptors in hMSCs on day 6. hMSCs were found to express both TrkB and TrkA receptors.
[0067] (B) Western blotting analysis of AKT / ERK signaling in hMSCs treated with SQB-BDNF for 6 days.
[0068] (C) Analysis of NGF protein secretion in hMSCs treated with SQB-BDNF for 2 and 4 days (n = 3, biologically independent samples per group). The NGF secretion capacity of hMSCs treated with SQB-BDNF was significantly increased. Statistical method: Two-way ANOVA. Data are expressed as mean ± standard deviation (SD) (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001.
[0069] (D) Analysis of BDNF protein secretion by hMSCs cultured under the specified treatment conditions (n=3, biologically independent samples per group). No significant difference was observed in BDNF secretion.
[0070] (E) Western blotting analysis of Nestin expression in hMSCs exposed to SQB-BDNF for 6 days.
[0071]
[0072] Figures 8a to 8h show the results of confirming the simultaneous expression of BDNF and NGF mimetic peptides on SQB and their effects on hMSC differentiation.
[0073] (Figure 8a) Schematic overview of SQB with two different ligands bound.
[0074] (Figure 8b) 1.5% agarose gel electrophoresis (AGE) analysis demonstrating the successful synthesis of SQBs with various FITC and Cy5.5 ratios. The ratios of the two fluorescent dyes were varied. (Figure 8c) Relative fluorescence intensities of SQBs conjugated with FITC and Cy5.5 at different ratios. To evaluate the correlation between fluorescence intensity and conjugation ratio, FITC was conjugated to the BDNF mimetic peptide site, and Cy5.5 was conjugated to the NGF mimetic peptide site, respectively. Fluorescence intensities were measured with an iBright imager, and ImageJ was used for quantitative analysis.
[0075] (Fig. 8d) Evaluation of the co-delivery effect through confocal fluorescence images of hMSCs treated with FITC and Cy5.5 dual dye SQB for 4 hours. hMSCs were treated with either the SQB-FITC / Cy5.5 dual-labeled construct or individually labeled SQB. The fluorescence signal of internalized SQB was analyzed by confocal microscopy, and the co-localization of FITC and Cy5.5 signals was quantified using ImageJ. The scale bar is 20 μm.
[0076] (Fig. 8e) 1.5% AGE analysis for SQB with various BDNF:NGF ratios.
[0077] (Fig. 8f) Representative differential interference contrast (DIC) images (left) of hMSCs treated with SQB at various BDNF: / NGF ratios on day 6. hMSCs were treated with 10 nM SQB-BDNF:NGF or 240 nM BDNF:NGF three times at 2-day intervals. Scale bar is 50 μm. Polar histograms of the corresponding directional distributions are shown on the right.
[0078] (Fig. 8g) Quantitative analysis of hMSC orientation using the consistency coefficient calculated using ImageJ. Statistical method: one-way ANOVA. Data are expressed as mean ± standard deviation (SD) (n = 4). *P < 0.05, **P < 0.01, ***P < 0.001.
[0079] (Fig. 8h) Quantitative analysis of nestin expression in hMSCs treated with SQB-BDNF / NGF. Statistical method: one-way ANOVA. Data are expressed as mean ± SD (n = 5). *P < 0.05.
[0080]
[0081] Figure 9 shows the characteristics of SQB that simultaneously expresses two different ligands and the results of confirming protein expression of hMSC according to the SQB-BDNF / NGF combination.
[0082] (A) Successful synthesis of FITC and Cy5.5-ssDNA conjugates was confirmed by 15% urea-polyacrylamide gel electrophoresis (Urea-PAGE) analysis.
[0083] (B) TEM image of SQB containing BDNF and NGF mimetic peptides. Scale bar is 10 μm.
[0084] (C) Western blot analysis of nestin expression in hMSCs treated with SQB-BDNF:NGF variants for 6 days.
[0085]
[0086] Figure 10 shows the results of co-delivery evaluation using confocal fluorescence images of hMSCs treated with FITC and Cy5.5-conjugated SQB for 4 hours. hMSCs were treated with either the SQB-FITC:Cy5.5 dual-labeled construct or individually labeled SQB. The fluorescence signal of internalized SQB was analyzed using a confocal microscope. The scale bar is 20 μm.
[0087] (A) Fluorescence images of cell uptake of SQB labeled with FITC and Cy5.5 at a 12:12 ratio. Cellular uptake of SQB treated with hMSCs for 4 hours was confirmed. Scale bar is 20 μm.
[0088] (B) Fluorescent images of intracellular uptake of SQB individually labeled with FITC and Cy5.5. Cellular uptake of SQB treated with hMSCs for 4 hours was confirmed. Scale bar is 20 μm.
[0089]
[0090] Figure 11 is a schematic overview and functional analysis evaluation results of the sciatic nerve compression model.
[0091] (A) Timeline of sciatic nerve injury induction and sample processing. Nerve injury was induced by crushing 3 mm proximal to the trifurcation, and samples were injected on days 1, 4, and 6 postoperatively in the experimental group.
[0092] Behavioral tests were performed at each time point (0, 3, 7, 14, 21, and 28 days). On the 28th day after surgery, the mice were sacrificed, and the nerve tissue, including the sciatic nerve crush site and distal part, and the gastrocnemius muscle were collected for histological analysis.
[0093] (B) Sciatic function index (SFI) values measured at each time point (0, 3, 7, 14, 21, 28 days) (n = 6, *p < 0.05, ****p < 0.0001).
[0094] (C) Photographs and cross-sectional images of hematoxylin and eosin (H&E) staining of the gastrocnemius muscle on day 28 in each group. Scale bars are 1 mm (top) and 200 μm (bottom).
[0095] (D) Analysis of muscle fiber cross-sectional area on day 28 in each group (n = 5, *p < 0.05).
[0096] (E) Analysis of gastrocnemius muscle weight measured in each group on day 28 (n = 6, **p < 0.01, ****p < 0.0001).
[0097]
[0098] Figures 12a to 12f show the results of histological analysis of the sciatic nerve compression site 28 days after surgery.
[0099] (Fig. 12a) Scanning electron micrograph image of the regenerated sciatic nerve. Scale bar is 5 μm.
[0100] (Fig. 12b) Quantitative analysis of myelin sheath thickness, myelinated nerve fiber diameter, myelin fiber area, number of myelinated axons, and G-ratio (n = 5, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).
[0101] (Fig. 12c) Hematoxylin and eosin (H&E) stained images of nerve cross-sections in each group. Scale bar is 100 μm.
[0102] (Fig. 12d) Immunofluorescence staining (IF) image of a cross-section of a nerve. Staining includes β-tubulin III (β-tubulin Ⅲ, neuronal cells, green), S-100 (Schwann cells, red), and DAPI (nuclei, blue). Scale bar: 50 μm.
[0103] (Fig. 12e) Quantitative analysis of β-tubulin III expression (n = 4, *p < 0.05, **p < 0.01, ****p < 0.0001).
[0104] (Fig. 12f) Quantitative analysis of S-100 expression (n = 4, *p < 0.05, **p < 0.01, ****p < 0.0001).
[0105]
[0106] Figure 13 shows the results of histological analysis of the sciatic nerve compression site 28 days after surgery.
[0107] (A) Hematoxylin and eosin (H&E) stained images of longitudinal sections of nerves in each group. Scale bar is 100 μm.
[0108] (B) Immunofluorescence staining (IF) image of a nerve cross-section, including β-tubulin III (β-tubulin Ⅲ, neuronal cells, green), S-100 (Schwann cells, red), and DAPI (nuclei, blue) staining. Scale bar is 100 μm.
[0109] (C) Quantitative analysis of β-tubulin III expression (n = 4, *p < 0.05, **p < 0.01, ****p < 0.0001).
[0110] (D) Quantitative analysis of S-100 expression (n = 4, *p < 0.05, **p < 0.01, ****p < 0.0001).
[0111]
[0112] Figure 14 shows the results of immunofluorescence analysis of macrophage polarization at the sciatic nerve compression site 28 days after surgery.
[0113] (A) Immunofluorescence staining (IF) image of a longitudinal section of a nerve, including CD206 (M2 macrophages, green), CD68 (pan-macrophages, red), and DAPI (nuclei, blue) staining. Scale bar: 50 μm.
[0114] (B) Quantitative analysis of CD68+ cell expression (n = 4, ****p < 0.0001).
[0115] (C) Quantitative analysis of CD68CD206 cell (CD68+CD206- cells) expression (n = 4, ****p < 0.0001).
[0116]
[0117] Figures 15a to 15i show the results of confirming the effect of SQB-DNA nanostructures on hMSCs (human mesenchymal stem cells):
[0118] (Fig. 15a to Fig. 15e) Results of confirming the morphological changes of hMSCs according to SQB-DNA nanostructure treatment
[0119] (Fig. 15f) Results of confirming the cell viability of hMSCs treated with SQB-DNA nanostructures at various concentrations
[0120] (Fig. 15g) Cell proliferation of hMSCs treated with SQB-DNA nanostructures at various concentrations was evaluated using the CCK-8 assay after 24 hours.
[0121] (Fig. 15h) Analysis of cell mobility of hMSCs treated with SQB-DNA nanostructures at various concentrations after 12 hours using wound healing assay
[0122] (Figure 15i) Western blotting confirmed an increase in the expression level of nestin, a neural progenitor cell marker, in hMSCs treated with SQB-DNA nanostructures at various concentrations.
[0123] The present inventors sought to utilize SQB DNA nanostructures fabricated using DNA origami technology to develop drugs to promote nerve regeneration. Previous attempts have been made to label DNA nanostructures with active substances and use them for disease treatment. However, to utilize them for nerve regeneration, they must maintain long-term stability in vivo, but DNA nanostructures are vulnerable to enzymatic degradation, preventing their use in nerve regeneration. The present inventors have developed K 10 -PEG 5k SQB DNA nanostructures with significantly increased serum stability were fabricated by coating.
[0124] Recent studies have increasingly highlighted the importance of growth factors, which promote neural recovery by regulating the proliferation, migration, and differentiation of neural stem cells. Among these, the neurotrophins nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) have emerged as key factors regulating neuronal growth and survival. Furthermore, other proteins, such as vascular endothelial growth factor (VEGF) and fibroblast growth factor 2 (FGF2), are also known to play important roles in neuronal function and recovery within the nervous system. These growth factors exert their therapeutic effects through specific ligand-receptor interactions. The dimeric structure of the neurotrophin, stabilized by hydrophobic interactions, allows simultaneous binding to two tropomyosin receptor kinase receptors, forming a stable ligand-receptor complex with a constant interreceptor distance of approximately 6 nm. The spatial arrangement of this ligand-receptor complex plays a crucial role in promoting receptor dimer formation and subsequent signal transduction. These results demonstrate the importance of spatially controlled ligand presentation to optimize receptor activation, which may ultimately be a promising strategy for enhancing the neuroregenerative effects of neurotrophin-based strategies.
[0125] Here, we designed functionalized SQB DNA nanostructures to precisely spatially distribute growth factor-mimetic peptides, including brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), fibroblast growth factor 2 (FGF2), and vascular endothelial growth factor (VEGF). Among various configurations, SQBs with 38 BDNF-mimetic peptides spaced 5 nm apart significantly enhanced cell proliferation, migration, and neural marker protein expression in human mesenchymal stem cells (hMSCs). To further demonstrate the modularity of DNA nanostructures, we designed SQBs that simultaneously presented BDNF and NGF at various ratios and confirmed the simultaneous presentation of both ligands. Precise stoichiometric control and efficient simultaneous delivery at the single-cell level were verified using fluorescent model ligands, FITC and Cy5.5, demonstrating that SQBs are a programmable platform at the single-nanostructure level. Furthermore, the present inventors confirmed in vivo experiments using a sciatic nerve injury model that SQB-BDNF treatment promoted functional recovery, reduced muscle atrophy, and improved myelination and axonal integrity. SQB-BDNF treatment significantly increased the thickness of the myelin sheath and the density of myelinated fibers, and G-ratio analysis confirmed that remyelination occurred.
[0126] From the results of the above experiments, the inventors suggest that SQB-BDNF is a useful biomaterial for neuroregenerative applications. This invention represents the first example of achieving nerve recovery through precise ligand presentation using DNA origami nanostructures. It is anticipated that the invention will lead to the widespread use of SQB as a therapeutic agent for various nerve injuries and neurological diseases requiring nerve regeneration.
[0127] Accordingly, the present invention provides the above-described DNA nanostructure for use in differentiation or regeneration of nerve cells, treatment of nerve damage or nerve disease.
[0128] In the present invention, the DNA nanostructure is a square block (SQB) shaped structure manufactured using DNA origami technology. In this specification, the DNA nanostructure may be used interchangeably with the terms SQB-DNA nanostructure, DNA origami, or DNA structure, and may be simply expressed as SQB. In addition, in this specification, the term SQB-GF is used to indicate the type of growth factor labeled on the DNA nanostructure.
[0129] In the present invention, a growth factor mimetic peptide refers to a growth factor containing an azide group at the N-terminus. In the present invention, the growth factor is not limited as long as it is an active peptide that has the effect of inducing differentiation of mesenchymal stem cells into neural cells, neural regeneration, or neural recovery. Non-limiting examples of the growth factor include BDNF, NGF, FGF2, and VEGF.
[0130] In the present invention, a growth factor-mimetic peptide is used in the form of a conjugate conjugated to an ssDNA (antihandle) having a sequence capable of complementary binding to a free handle present in a DNA nanostructure in order to label the DNA nanostructure. In the present specification, the conjugate of the growth factor-mimetic peptide and ssDNA is referred to as a peptide-ssDNA conjugate or GF-ssDNA.
[0131] In the present invention, the peptide-ssDNA conjugate was prepared by inducing an amide bond between ssDNA with an amine group substituted at the 5' end and BCN-NHS to synthesize BCN-ssDNA, and then inducing a strain-promoted alkyne-azide cycloaddition (SPAAC) reaction between the BCN-ssDNA and a growth factor containing an azide group at the N-terminus.
[0132] In the present invention, a DNA nanostructure labeling a growth factor mimicking peptide can be produced by mixing a DNA nanostructure having a designed free handle with the above-described GF-ssDNA and inducing complementary binding between the free handle and the GF-ssDNA.
[0133] In the present invention, the DNA nanostructure can be labeled with two or more growth factor-mimetic peptides, and at this time, the growth factor-mimetic peptides can be labeled on the DNA nanostructure by forming complexes with ssDNAs of different sequences. In this case, the spatial distribution, such as the ratio, number, and arrangement of the growth factor-mimetic peptides labeled on the surface of the DNA nanostructure, can be precisely controlled at the nanometer level through the design of the free handle.
[0134] In the present invention, the arrangement of growth factor-mimetic peptides labeled on the surface of a DNA nanostructure can be controlled through the design of a free handle.
[0135] The DNA nanostructure of the present invention is K 10 -PEG5k It may be coated with to improve serum stability.
[0136] The DNA nanostructure of the present invention can be provided by being included in a composition for the purpose of differentiation or regeneration of neural cells.
[0137] Additionally, the DNA nanostructure of the present invention can be provided by being included in a composition for the purpose of treating nerve damage or neurological disease.
[0138] The present invention is susceptible to various modifications and embodiments. Specific embodiments are illustrated in the drawings and described in detail in the following detailed description. However, this is not intended to limit the present invention to specific embodiments, but rather to encompass all modifications, equivalents, and alternatives falling within the spirit and technical scope of the present invention. In describing the present invention, detailed descriptions of related known technologies will be omitted if they are deemed to obscure the gist of the present invention.
[0139]
[0140] [Experimental Method]
[0141] 1. Materials
[0142] Oligonucleotide staples were synthesized by IDT (IA, USA). The growth factor-mimicking peptides brain-derived neurotrophic factor (BDNF) (cyclized with D-proline), nerve growth factor (NGF), vascular endothelial growth factor (VEGF), and fibroblast growth factor 2 (FGF2) were synthesized by Beadtech (Incheon, South Korea). The sequences of each peptide are shown in Table 1.
[0143] Growth factor mimetic peptide sequence SEQ ID BDNFN3-cyclo(pKKKR)-OH2NGFN3-SSSHPIFHRGEFSV-OH3FGF2KLTWQELYQLKYKGI4VEGFYRSRKYSSWYVALKR5
[0144] (1R,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyl N-succinimidyl carbonate (BCN-NHS, #1426827-79-3), Triton X-114 (Triton X-114, #9036-19-5), and polyethylene glycol (PEG)-8000 were purchased from Sigma Aldrich (MO, USA).
[0145] 10x TE buffer and bovine serum albumin (BSA) were purchased from Biosesang (Gyeonggi-do, South Korea), and DNase I was purchased from New England Biolabs (MA, USA). SYBR™ Gold Nucleic Acid Gel Stain (S11494) was supplied by Thermo Fisher Scientific (MA, USA).
[0146] Antibodies used included mouse anti-human GAPDH antibody (#ab8245), rabbit anti-human β-tubulin III antibody (#ab18207), and rabbit anti-human nestin antibody (#ab105389), all purchased from Abcam (Cambridge, UK). In addition, the Human Beta Nerve Growth Factor ELISA Kit (NGFB, #ab99986) was also obtained from Abcam. Goat anti-mouse HRP-conjugated antibody (#1705047) and goat anti-rabbit HRP-conjugated antibody (#1705046) were purchased from Bio-Rad (CA, USA).
[0147] The following antibodies and reagents were obtained from Cell Signaling Technology (MA, USA): rabbit anti-human AKT antibody, rabbit anti-human phosphorylated AKT antibody, rabbit anti-human ERK1 / 2 antibody, rabbit anti-phosphorylated ERK1 / 2 antibody, protease / phosphatase inhibitor cocktail (100X, #5872S).
[0148] Methoxy-PEG-block-poly(L-lysine hydrochloride), K10-PEG5K, was purchased from Alamanda Polymers (AL, USA). Cell culture reagents included human mesenchymal stem cells (hMSC, PT-2501) and MSCGM™ Mesenchymal Stem Cell Growth Medium Kit (MSCGM TM Mesenchymal Stem Cell Growth Medium Bullet Kit TM , PT-3001) were purchased from Lonza (Basel, Switzerland). Cell Counting Kit-8 (CCK-8) was purchased from Dojindo (Japan). TEM grid (TEM grid, CF200-CU) was purchased from Electron Microscopy Sciences (PA, USA). Skim milk was purchased from Difco (MI, USA).
[0149]
[0150] 2. Preparation of SQB DNA nanostructures
[0151] M13-derived scaffold p8634 was prepared according to the method described in our previous study (Nat Nanotechnol, 19 (2024) 1055-1065) and the full nucleotide sequence is provided in SEQ ID NO: 1. Endotoxin from the scaffold was removed using 2% Triton X-114.
[0152] The purified scaffold was mixed with a 5-fold excess of staple strands containing handle sequences for subsequent conjugation of a mimicking peptide or dye. The mixture was heated at 80°C for 15 min to denature the DNA strands, and then annealed from 50°C to 40°C for 10 min 48 s at a rate of 0.1°C per 10 min in TE-Mg2+ buffer (10 mM Tris, 1 mM EDTA, 12 mM MgCl2).
[0153] Excess staple strands were removed using PEG precipitation, and successful synthesis of SQB was confirmed by agarose gel electrophoresis (AGE) and transmission electron microscopy (TEM) analysis.
[0154]
[0155] 3. PEG precipitation of SQB and ligand-bound SQB
[0156] To remove excess staple strands or ligand, SQB and ligand-conjugated SQB were purified via PEG precipitation.
[0157] DNA origami samples in 1× TE buffer (10 mM Tris, 1 mM EDTA) were mixed with 20% (w / v) PEG-8000 containing 510 mM NaCl at a 1:1 (v / v) ratio. The resulting mixture, adjusted to a final MgCl2 concentration of 10 mM, was reacted at room temperature for 30 min.
[0158] The above mixture was centrifuged at 16,000 × g for 25 minutes at room temperature, and 90% of the supernatant was carefully removed. After an additional centrifugation at 16,000 × g for 2 minutes, the remaining supernatant was removed, and the resulting pellet was resuspended in 1× TE buffer containing 10 mM MgCl2.
[0159] The concentrations of purified SQB and SQB-ligand conjugates were measured using a NanoDrop spectrophotometer.
[0160]
[0161] 4. Preparation and characterization of growth factor-mimetic peptide-DNA oligo conjugates
[0162] Single-stranded DNA (ssDNA) with an amine group at the 5' end was used for ligand binding. Each ssDNA was conjugated with a different growth factor-mimicking peptide, the sequences of which are listed in Table 1.
[0163] Growth factor mimetic peptide ssDNA sequence Sequence number BDNF (brain-derived neurotrophic factor) GCTGGTTAGAGAATGAGAGTCG6 NGF (nerve growth factor) AGTGATGTGAGACCATGTGAG7 FGF2 (fibroblast growth factor 2) GGGAGTAGCATCGTAATTAGG8 VEGF (vascular endothelial growth factor) TTCTAGGGTTAAAAGGGGACG9
[0164] To conjugate ssDNA with BCN groups, an NH2-N-hydroxysuccinimide esterification reaction was performed. ssDNA was reacted with BCN-NHS at a 1:10 molar ratio and shaken overnight at 600 rpm at room temperature. The solution was then stored in a freezer for 1 hour, after which the precipitated ssDNA was recovered by centrifugation.
[0165] For conjugation of growth factor-mimicking peptides, purified BCN-ssDNA was treated with a growth factor-mimicking peptide containing an N-terminal azide group via a strain-promoted alkyne-azide cycloaddition (SPAAC) reaction. The reaction was carried out overnight at room temperature at 600 rpm, with a molar ratio of 1:10.
[0166] GF-ssDNA complexes were purified using ethanol precipitation and analyzed using agarose gel electrophoresis (AGE) and urea-polyacrylamide gel electrophoresis (urea-PAGE).
[0167]
[0168] 5. Preparation of SQB containing growth factor-mimetic peptides
[0169] To conjugate growth factor-mimicking peptides to DNA origami, SQB was annealed with GF-ssDNA at a concentration five times higher than the designed handle location.
[0170] The above mixture was heated to 50°C to anneal the GF to the SQB, and then slowly cooled to 40°C at a rate of 0.1°C per 10 minutes and 48 seconds.
[0171] Unreacted peptides were removed using PEG precipitation, and the synthesis of GF-bound SQB was confirmed through agarose gel electrophoresis (AGE) and transmission electron microscopy (TEM) analysis.
[0172]
[0173] 6. Gel electrophoresis
[0174] The synthesis and purity of BCN-ssDNA conjugates and growth factor-mimetic peptide-ssDNA conjugates were analyzed using agarose gel electrophoresis (AGE) and urea-polyacrylamide gel electrophoresis (urea-PAGE).
[0175] For PAGE analysis, a 15% (w / v) denaturing urea polyacrylamide gel was run in TBE buffer at 100 V for 100 min. Oligonucleotides in the PAGE gel were purified using SYBR TM Gold dye (SYBR TM Gold dye) and was stained using the iBrightTM imaging system (iBright TM It was visualized using a imaging system.
[0176] SQB and peptide-conjugated SQB were evaluated by agarose gel electrophoresis (AGE) analysis at 70 V for 50 min on a 1.5% (w / v) agarose gel in TBE buffer containing 10 mM MgCl2.
[0177]
[0178] 7. Transmission electron microscope (TEM) analysis
[0179] The shape and size of SQB and peptide-conjugated SQB were confirmed by negative-stain transmission electron microscopy (TEM) analysis using a Tecnai microscope. The samples were prepared in TE-Mg containing 10 mM MgCl₂. 2+ The gel slices were diluted to a concentration of 4 nM in the buffer. To ensure the structural integrity of the SQB and peptide-bound SQB, gel slices matching the corresponding samples were extracted and processed. The gel slices were placed in 1.5 mL Eppendorf tubes and centrifuged at 4,000 × g for 1 min at 4°C. The bottom of the tube was then cut off, inverted, placed in a spin column, and centrifuged for an additional 3 min under the same conditions. The concentrations of the extracted SQB and peptide-bound SQB were adjusted to 2 nM, and 4 μL of the sample was applied to a TEM grid and reacted for 4 min. After removing the excess solution, 4 μL of 2% uranyl acetate staining solution was applied to the grid and treated for 1 min. The staining solution was then removed, and the grid was dried overnight before imaging.
[0180]
[0181] 8. Stability Evaluation of SQB
[0182] To evaluate the stability of SQB, bare SQB and K 10 -PEG 5kCoated SQB (K10-PEG5k-coated SQB) was cultured in cell culture media containing serum at 37°C for 7 days. After culture, 5 mM ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) and 10% β-mercaptoethanol were added to inactivate nuclease activity, and then the cells were further cultured at 37°C for 30 min. K 10 -PEG 5k To remove the coating, 100-fold excess of chondroitin sulfate relative to the number of amines was added to the coated SQB. The Mg of the solution 2+ After adjusting the concentration to 10 mM, the reaction was performed at 37°C for 1 hour.
[0183] The stability of SQB was confirmed through agarose gel electrophoresis (AGE) analysis.
[0184]
[0185]
[0186] Before conducting cell and animal experiments, SQB was K-treated with or without growth factor-mimicking peptide. 10 -PEG 5k The stability against enzymatic degradation was improved by coating with K 10 -PEG 5k SQB was mixed in a 1:1 ratio of nitrogen (N) in amine and phosphorus (P) in DNA (N:P ratio). The mixture was reacted at room temperature for 1 hour.
[0187]
[0188] 10. Analysis of cell morphology and consistency coefficient
[0189] Human mesenchymal stem cells (hMSCs) were cultured at 37°C in a humidified atmosphere containing 5% CO2, in mesenchymal stem cell basal media supplemented with mesenchymal cell growth supplement, L-glutamine, and gentamicin sulfate-amphotericin (GA-1000).
[0190] hMSCs were seeded at 5 × 10 in a 12-well plate. 3 Cells were seeded at a density of 10 cells / cm² and cultured overnight. The medium was then replaced every two days, and each sample was treated three times. Morphological changes in the cells were observed using an EVOS fluorescence microscope.
[0191] To precisely visualize cell morphology, β-tubulin III staining was performed. After washing twice with warm phosphate-buffered saline (PBS), cells were fixed in 4% paraformaldehyde for 15 minutes and then washed again with PBS. Blocking and permeabilization were performed in a mixture of 3% (w / v) BSA and 0.3% (w / v) Triton-X in PBS at room temperature for 1 hour.
[0192] Cells were then incubated overnight at 4°C in blocking buffer containing rabbit anti-human β-tubulin III antibody. After two PBS washes, Alexa Fluor 488-labeled goat anti-rabbit antibody was applied. Nuclei were stained with Hoechst dye for 20 min, and fluorescence images were captured using an EVOS fluorescence microscope.
[0193] To evaluate the morphological alignment of hMSCs, analysis was performed using the OrientationJ plugin in ImageJ. After converting the 4× magnification image to 16-bit (gray-scale), a Gaussian filter (σ = 0.5) was applied to reduce noise. The local orientation of the hMSC structure was extracted based on the integrity gradient of the image and analyzed using the OrientationJ plugin. The analysis conditions were set to an energy threshold of 2 and a minimum coherence level of 20%.
[0194] The distribution of cell alignment angles was visualized in the form of a polar histogram, with the relative frequency of each angle normalized to the maximum value within the group and expressed as a value between 0 and 1. A sharp peak in the histogram indicates a predominance of alignment in a particular direction, while a broad, uniform distribution indicates a low degree of alignment.
[0195] Quantitative evaluation of alignment was performed through the coherency coefficient (C), which was calculated from at least three independent fields for each sample and the average value was calculated to ensure statistical reliability. The coherency coefficient C is defined as the difference of the tensor eigenvalues divided by the sum, and is calculated according to the formula C = (λmax - λmin) / (λmax + λmin), where λmax represents the largest eigenvalue and λmin represents the smallest eigenvalue.
[0196]
[0197] 11. Cell proliferation assay (CCK-8 assay)
[0198] For proliferation assay, human mesenchymal stem cells (hMSCs) were seeded at 5 × 10 in a 96-well microplate. 3 After seeding at a density of 10 cells / cm², the cells were cultured overnight. The cells were treated three times with various samples, changing the medium every two days. The degree of proliferation was measured using CCK-8 (Cell Counting Kit-8). After 48 hours of treatment, the medium was removed, and the cells were incubated with CCK-8 solution at 37°C for 1 hour and 20 minutes. The absorbance was measured at 450 nm using a microplate reader (VERSAmax). TM ; Molecular Devices Corp., CA, US) was used for measurement.
[0199]
[0200] 12. Cell migration analysis
[0201] Cell migration was assessed using a wound-healing assay. Human mesenchymal stem cells (hMSCs) were seeded at 90% confluence in 12-well plates and cultured overnight. The following day, serum-free medium was replaced and cultured overnight. The cell layer was scratched and washed with warm PBS. Cells were then treated with each sample for 12 hours. Images were captured using an EVOS fluorescence microscope at 0 and 12 hours.
[0202]
[0203] 13. Western blotting
[0204] For Western blotting analysis, human mesenchymal stem cells (hMSCs) were seeded at 5 × 10 in a 6-well plate. 3Cells were seeded at a density of 10 cells / cm² and cultured overnight. Cells were treated three times with various samples, with the medium replaced every two days. On day 6, treated hMSCs were lysed using radioimmunoprecipitation assay (RIPA) buffer and a phosphatase / protease inhibitor cocktail. Intracellular protein concentration was measured using the bicinchoninic acid (BCA) assay. The collected proteins were separated on 8% (w / v) SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skim milk for 1 h and 30 min at room temperature (RT) and then incubated overnight with primary antibodies at 4°C.
[0205] The primary antibodies used were rabbit anti-human AKT antibody (1:1000 dilution), rabbit anti-human phosphorylated AKT antibody (1:500 dilution), rabbit anti-human ERK antibody (1:1000 dilution), rabbit anti-phosphorylated ERK antibody (1:500 dilution), mouse anti-human TrkB antibody (1:100 dilution), rabbit anti-human phosphorylated TrkB antibody (1:500 dilution), rabbit anti-human nestin antibody (1:500 dilution), rabbit anti-human β-tubulin III antibody (1:1000 dilution), and mouse anti-human GAPDH antibody (1:1000 dilution). After washing, the blocks were incubated with HRP-linked goat anti-mouse or goat anti-rabbit secondary antibodies for 1 h at room temperature. Protein expression levels were determined by chemiluminescence detection (iBright TM ) was used to visualize the results, and the relative levels were analyzed using ImageJ based on GAPDH.
[0206]
[0207] 14. ELISA analysis
[0208] To measure NGF (nerve growth factor) secretion, hMSC (human mesenchymal stem cells) were seeded at 5 × 10 in a 6-well plate. 3Cells were seeded at a density of 10 cells / cm² and cultured overnight. Cells were treated three times with various samples, and the medium was changed every two days. On the second day, the supernatant was collected and analyzed using an NGF-specific ELISA kit. First, NGF standard solutions (0, 6.86, 20.58, 61.73, 185.2, 555.6, 1667, and 5000 pg / mL) and the collected supernatant were dispensed into each well and incubated overnight at 4°C. Afterwards, the wells were washed four times, and biotinylated anti-NGFB detection antibody was added and incubated for 1 hour at room temperature with gentle shaking. After washing again, HRP-conjugated streptavidin was added and incubated for 45 minutes at room temperature. Finally, TMB substrate was added and incubated for 30 minutes at room temperature in the dark. The reaction was terminated by adding a stop solution, and the absorbance was measured at 450 nm. The measured value was used to calculate the concentration based on the NGF standard curve.
[0209]
[0210] 15. Preparation of the sciatic nerve crush model
[0211] All experiments were conducted in compliance with relevant laws and institutional guidelines of the Institutional Animal Care and Use Committee (IACUC) of the Korea Institute of Science and Technology (KIST), and the experiment received IACUC approval (KIST-IACUC-2022-014-5).
[0212] C57BL / 6 male mice (8 weeks old, DBL) were used for nerve crush injury experiments. To prepare the sciatic nerve crush model, the right thigh was shaved and disinfected with povidone iodine to prevent infection. Sciatic nerve crush was performed using No. 5 hemostatic forceps 3 mm proximal to the trifurcation. After a mid-thigh skin incision, the underlying muscles were separated to expose the sciatic nerve, which was then compressed twice with forceps for 30 seconds each, with a 10-second interval. The skin around the crush site was sutured, and the injection site was marked with 3-0 nylon thread (Duksan General Science, Seoul, Korea).
[0213] The control group (sham group) did not undergo surgery. The mice were randomly divided into five groups of eight mice each. The groups consisted of the normal control group (sham group), the injured group, the SQB group, the BDNF peptide group, and the SQB-BDNF group.
[0214] SQB, SQB-BDNF, or BDNF was injected into the biceps femoris space at the injured site on days 1, 4, and 6 postoperatively, respectively.
[0215]
[0216] 16. Functional Recovery Test
[0217] For functional recovery analysis, sciatic functional index (SFI), gastrocnemius muscle tissue density, and G-ratio were calculated.
[0218] To measure SFI values, the hind paws of mice were dipped in stamp ink and allowed to pass through a straight acrylic corridor covered with white paper at each measurement time point (0, 3, 7, 14, 21, and 28 days). The footprints were recorded on the paper, and the SFI values were calculated using Equation 1.
[0219] [Formula 1]
[0220]
[0221] E is the experimental foot, N is the normal foot, and the number of experimental groups is 6 (n=6).
[0222] On the 28th day after surgery, the mice were euthanized using CO₂, and the gastrocnemius muscle and sciatic nerve were removed. After isolating the gastrocnemius muscle, its weight was measured, and the gastrocnemius muscle density was analyzed by calculating the ratio of the total tissue area to the total tissue area using ImageJ. The distal part of the injured nerve was collected, fixed in 4% paraformaldehyde at 4°C, and then post-fixed in 2% osmium tetroxide for 3 hours. The samples were then embedded in Spurr resin and ultrathin sections were prepared. Cross-sections were stained with 2% uranyl acetate for 10 minutes and then with Reynolds' lead citrate for 5 minutes. Cross-sectional images of neural tissue were captured in random fields using a scanning electron microscope (SEM; Teneo Volume Scope, FEI, Hillsboro, OR) and a digital camera (ES500W, GATAN, Warrendale, PA).
[0223] Using SEM images, myelin sheath thickness, myelinated nerve fiber diameter, and myelin fiber area were measured using ImageJ, and the G-ratio was calculated as the ratio of fiber area to axon area.
[0224]
[0225] 17. Histological evaluation
[0226] Nerve tissues collected from the sciatic nerve crush site and distal part, and gastrocnemius muscle, were fixed in 4% paraformaldehyde (PFA) and 10% formaldehyde solutions, respectively, for at least 1 day. Each sample was immersed in 10% sucrose for 1 h, 20% sucrose for 1 h, and 30% sucrose for 24 h, and then embedded in frozen section compound (FSC, Leica Biosystems, Germany) for 24 h. The FSC-embedded samples were frozen in liquid nitrogen. To obtain cross-sections of the gastrocnemius muscle and distal nerve tissue, the samples were aligned perpendicular to the ground before freezing. Nerve tissues containing the sciatic nerve compression site were frozen after being positioned parallel to the ground to obtain longitudinal sections. Muscle and nerve samples were sectioned at 10 μm and 6 μm thickness, respectively, using a cryotome (ThermoFisher, USA).
[0227] Sectioned samples were stained with hematoxylin and eosin (H&E) to assess nerve regeneration and gastrocnemius muscle density. Samples were thawed at room temperature (RT) for 30 minutes, rinsed in running water for 10 minutes, and then treated in hematoxylin solution for 10 minutes, followed by an additional rinse in running tap water for 1 minute. After immersion in 1% acid ethanol two to three times, they were rinsed again in running water for 1 minute. Subsequently, they were stained in eosin solution for 6 minutes. After staining, the samples were dehydrated in progressively increasing ethanol concentrations (80%, 95%, and 100%) for 2 min each, and then finally treated in xylene for 10 min. The stained sections were mounted on coverslips using mounting solution (Richard-Allan Scientific, Kalamazoo, MI, USA) and observed under a Nikon Eclipse TE2000-U microscope.
[0228] For immunofluorescence staining, the sectioned samples were permeabilized in PBS containing 0.3% Triton X-100 for 5 minutes to promote antibody penetration. To block non-specific binding, they were incubated in 4% bovine serum albumin (BSA) for 1 hour at 4°C. To assess nerve regeneration, the samples were stained with primary antibodies, β-tubulin III (β-tubulin III, 1:100 in 1% BSA, a neuronal marker) and S-100 (S-100, 1:100 in 1% BSA, a Schwann cell marker), and incubated overnight at 4°C.
[0229] After incubation, the samples were washed twice in DPBS and then incubated with secondary antibodies, Alexa Fluor 488-conjugated anti-mouse IgG and Alexa Fluor 594-conjugated anti-rabbit IgG, each diluted 1:1000 in 1% BSA at room temperature for 2 h. The samples were then washed and counterstained with antifade mounting medium containing 4′,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. The samples were observed under a confocal laser scanning microscope (LSM700, Carl Zeiss, Tokyo, Japan).
[0230] To assess macrophage activity in longitudinal sections of the sciatic nerve, CD68 (1:100 in 1% BSA, a pan-macrophage marker) and CD206 (1:100 in 1% BSA, an M2 marker) staining were performed. Because CD68 and CD206 antibodies were pre-conjugated with Alexa Fluor 594 and Alexa Fluor 488, respectively, the same procedure as for β-tubulin III and S-100 staining was followed, but the secondary antibody incubation step was omitted. After counterstaining with DAPI, the samples were observed under a confocal laser scanning microscope.
[0231]
[0232] 18. Analysis of changes in neuronal morphology and signaling pathway activation in human mesenchymal stem cells (hMSCs) treated with SQB
[0233] hMSCs were cultured at 37°C in a humidified environment containing 5% CO₂. They were seeded at a density of 5×10³ cells / cm² in 12-well plates and cultured overnight. Subsequently, SQB DNA nanostructures were treated three times at two-day intervals. After treatment, cell morphological changes were observed, and cell alignment was assessed using β-tubulin III staining and the ImageJ OrientationJ plugin. Furthermore, to analyze the activation of signaling pathways related to nerve regeneration, 6-well plates were seeded with SQB under the same conditions, and the phosphorylation of AKT and ERK signaling proteins was assessed by Western blotting. Cell proliferation and migration were evaluated using the CCK-8 assay and wound healing assay, respectively. The expression of nestin, a neural progenitor cell marker, was further confirmed by Western blotting and immunofluorescence staining.
[0234]
[0235] 19. Statistical Analysis
[0236] Quantitative data were analyzed using GraphPad Prism software, and results were expressed as mean ± standard deviation (SD). Student's t-test was used for comparisons between two groups, and one-way or two-way analysis of variance (ANOVA) was used for comparisons of three or more groups. Tukey's or Sidak's post hoc test was performed as indicated in each figure legend. Statistical significance was indicated as follows: P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
[0237]
[0238] [Experimental Results]
[0239] 1. Design and fabrication of functionalized SQB DNA nanostructures for neural recovery.
[0240] SQB was assembled using a long single-stranded p8634 DNA scaffold and a short single-stranded DNA staple through thermal annealing in a 12 mM magnesium chloride environment for 18 h. Watson-Crick base pairing between the scaffold and the staple allowed SQB to form a precise 3D structure with dimensions of 27 × 35 × 22.5 nm (Fig. 1A). Excess staples were then removed by polyethylene glycol (PEG) purification. Agarose gel electrophoresis (AGE) confirmed the successful fabrication of SQB (Fig. 1B), with the SQB band shifting lower in line 3 than lines 1 and 2 containing the p8634 scaffold. After purification, it was confirmed that excess staples were removed (Figure 1, B, line 4). Furthermore, transmission electron microscopy (TEM) analysis confirmed the uniform morphology and designed size of the purified SQB (Figure 2, A). These results demonstrated the successful synthesis of SQB for subsequent growth factor functionalization.
[0241] To functionalize SQB, we designed it to promote nerve recovery by combining it with growth factors. The growth factor-mimicking peptides, consisting of BDNF, NGF, FGF2, and / or VEGF, are small in size, highly stable, and easily bind, enabling precise control of valency and spacing in SQB while minimizing steric hindrance.
[0242] These growth factor-mimicking peptides were combined with single-stranded DNA (ssDNA) to form growth factor-mimicking peptide-ssDNA (GF-ssDNA), which was synthesized via strain-promoted alkyne-azide cycloaddition (SPAAC) click chemistry (Figure 1C). First, a bicyclo[6.1.0]nonyne (BCN) group was added to amine-terminated ssDNA (NH2-ssDNA) via an N-hydroxysuccinimide (NHS) ester bond to generate BCN-substituted ssDNA (BCN-ssDNA). Meanwhile, growth factor-mimicking peptides were prepared by introducing an N-terminal azide group. Finally, GF-ssDNA was synthesized by reacting BCN-ssDNA with an azide growth factor mimic peptide (azido-GF).
[0243] These four growth factor-mimetic peptides (BDNF, NGF, FGF2, and VEGF) were designed to conjugate to different single-stranded DNA sequences (ssDNA) to enable precise multiplexing in SQB. The ssDNA sequences are provided in Table 1. Successful conjugation was confirmed by urea polyacrylamide gel electrophoresis (urea-PAGE) (Fig. 2B), and the GF-ssDNA band migrated slower than NH2-ssDNA and BCN-ssDNA, which appears to be due to increased molecular weight and structural modification. After removing unreacted ssDNA through gel purification, hybridization was performed (Fig. 2C).
[0244] Subsequently, the designed SQB complementary single-stranded DNA and GF-ssDNA were linked through Watson-Crick base pairing to precisely control the spatial arrangement of the growth factors (Fig. 1C). Successful functionalization and arrangement of these peptides in SQB was confirmed through AGE and TEM analyses (Fig. 1D and E). The SQB-GF band was naive. The migration rate was slower, indicating successful GF binding. TEM analysis also revealed that all SQB-GFs maintained a uniform square block structure. These results demonstrate the successful fabrication of functionalized SQBs for growth factor delivery, and their effects on human mesenchymal stem cells (hMSCs) were subsequently evaluated.
[0245]
[0246] 2. Improvement of serum stability and cytotoxicity evaluation of SQB
[0247] 2-1. K 10 -PEG 5k Increased serum stability of SQB confirmed by coating
[0248] Before investigating the effects of SQB on human mesenchymal stem cells (hMSCs) for neural recovery, the structural stability of SQB was first evaluated in a physiological environment. DNA nanostructures are inherently susceptible to enzymatic degradation, which can pose challenges in biomedical applications. To address this, SQB was synthesized using poly-lysine PEG polymer (K 10 -PEG 5k) was coated to improve stability. The coating was achieved through electrostatic interaction between positively charged lysine residues and negatively charged DNA backbone. Successful coating was confirmed through agarose gel electrophoresis (AGE) analysis, and the coated SQB showed a significant decrease in mobility due to surface charge neutralization (Fig. 3a).
[0249] To remove the poly-lysine PEG polymer coating, SQB was treated with chondroitin sulfate, which restored the mobility of SQB in AGE. Chondroitin sulfate is a negatively charged sulfated glycosaminoglycan that electrostatically interacts with the positively charged poly-lysine PEG polymer, detaching it from the SQB surface and effectively removing it.
[0250] To assess serum stability, coated SQBs were cultured in cell culture media containing serum for up to 7 days. After removal of the polymer coating by applying chondroitin sulfate treatment at specific time points, AGE analysis was performed to assess the structural integrity of the SQBs (Fig. 3b). As a result, uncoated SQBs degraded rapidly, whereas coated SQBs maintained their structural stability. After 3 days, the band intensity of coated SQBs was maintained at more than 80%, and after 7 days, approximately 60% of the original band intensity was maintained. In contrast, uncoated SQBs degraded rapidly, and no detectable band was present after 7 days (Fig. 3c). In all subsequent cell and animal experiments, K was added to ensure stability. 10 -PEG 5k Coated SQB was used.
[0251] 2-2. Confirmation of serum safety of SQB
[0252] Before conducting functional cell studies, the biocompatibility of SQB with hMSCs was evaluated. The cytotoxicity of SQB was assessed using a cell counting kit-8 (CCK-8) assay (Fig. 3d). hMSCs were co-cultured with SQB or a scaffold-staple mixture and observed for 3 days. The experimental results showed no significant cytotoxicity compared to untreated cells, confirming the suitability of SQB for further biological applications.
[0253]
[0254] 3. Induction of neural differentiation of hMSCs using functionalized SQB
[0255] Inducing neuronal differentiation of stem cells recruited to damaged neural tissue is a crucial step in neural regeneration. A key advantage of functionalized SQB lies in its flexibility to incorporate various growth factor-mimicking peptides. To evaluate this flexibility and investigate its effect on hMSC activation, human mesenchymal stem cells (MSCs) were treated with SQB functionalized with BDNF, NGF, FGF2, and VEGF-mimicking peptides (10 nM SQB, corresponding to a growth factor-mimicking peptide concentration of 380 nM).
[0256] Neuronal differentiation of hMSCs was assessed based on morphological changes. Morphological changes were analyzed on day 5 using differential interference contrast (DIC) microscopy and β-tubulin III staining (Fig. 3e).
[0257] Analysis of DIC images revealed that cells treated with growth factor-mimetic peptide alone maintained an undifferentiated morphology, remaining broad and flat. This morphology was similar to that of the non-treated control group. In contrast, groups treated with SQB alone or functionalized SQB showed a significant increase in morphological changes indicative of neuronal differentiation, with cells appearing elongated and aligned. These changes are characteristic structures suggestive of neuronal differentiation. β-tubulin III staining also revealed similar structural changes, further supporting the notion that SQB-based treatment affected cell alignment and morphological organization.
[0258] Furthermore, to analyze morphological changes, the OrientationJ plugin of ImageJ was utilized to quantify the orientation and isotropic value of a specific region of interest. The quantitative orientation data of the DIC images were visualized as an orientation distribution, which generated a polar histogram representing the relative frequency of specific angles. In addition, the morphological changes were evaluated by calculating the coherency coefficient to evaluate the degree of morphological alignment, where 1 indicates high orientation and 0 indicates an isotropic arrangement (Fig. 3f).
[0259] Directional distribution analysis revealed that hMSCs treated with functionalized SQB exhibited highly directional and aligned morphologies. The polar histogram showed a narrow range of high frequencies at specific angles, indicating dominant cell alignment (Fig. 3e). In contrast, the untreated group and the SQB-only group exhibited a wide range of directional distributions. The coherency coefficients of the group treated with functionalized SQB were as follows:
[0260] - SQB-BDNF: 0.6694 ± 0.020
[0261] - SQB-NGF: 0.6688 ± 0.024
[0262] - SQB-FGF2: 0.6734 ± 0.022
[0263] - SQB-VEGF: 0.6699 ± 0.019
[0264] These values were higher than those in the untreated group (0.6362 ± 0.015) or the individual growth factor-mimetic peptide-treated groups (BDNF: 0.6397 ± 0.016; NGF: 0.6360 ± 0.017; FGF2: 0.6397 ± 0.017; VEGF: 0.6414 ± 0.016) (Fig. 3f). These increased values indicate an aligned structure formed as the cells undergo neuronal differentiation.
[0265] These findings highlight SQB as a powerful platform for integrating various growth factor-mimetic peptides to promote neuronal differentiation. In subsequent experiments, BDNF-mimetic peptides were used as proof-of-concept.
[0266]
[0267] 4. Optimization of BDNF spacing and binding affinity of SQB for neuronal differentiation
[0268] Based on the observation that SQBs containing growth factor-mimicking peptides promoted neuronal differentiation of hMSCs, the effects of the spatial arrangement and density of brain-derived neurotrophic factor (BDNF) on the differentiation process were further investigated. BDNF is known to promote dimerization of the tropomyosin receptor kinase B (TrkB) receptor, and bringing the two receptors into close proximity, approximately 6 nm apart, is considered an important factor for effective receptor binding and activation.
[0269] To mimic the binding arrangement of TrkB receptors and BDNF, BDNF-mimetic peptides were arranged at specific locations on the SQB surface with various spacings (from 5 nm to 14 nm) and binding valencies (from 4 to 38 peptides) (Fig. 4a). Before conjugating the BDNF-mimetic peptides, the ligand binding efficiency was first evaluated using fluorescein isothiocyanate (FITC)-conjugated ssDNA. FITC-conjugated ssDNA bound to SQB in the same manner as the BDNF-mimetic peptides, and the binding valencies were adjusted from 4 to 38. Relative fluorescence intensity measurements confirmed a proportional relationship between the FITC binding valency and fluorescence intensity, demonstrating that ligand binding was efficiently and precisely controlled (Fig. 5A). These results validated the effectiveness of the binding strategy and confirmed that the desired ligand density could be stably achieved on SQB.
[0270] Agarose gel electrophoresis (AGE) analysis confirmed that various peptide spacings did not significantly affect the band shift of SQB-BDNF (Fig. 4b). However, significant band shifts occurred when BDNF-mimetic peptides were arranged in groups of 18 or more, suggesting potential structural changes. BDNF-mimetic peptides are cyclic sequences composed of arginine-lysine-lysine-alanine-D-proline, which can induce self-assembly through hydrogen bonding between amide bonds. This self-assembly likely induces stacking of SQBs, resulting in the mobility shift observed in the AGE analysis (Fig. 4c). However, transmission electron microscopy (TEM) analysis revealed no significant differences in the SQB structure across all peptide spacings and bonding valencies (Fig. 5B), suggesting that the stacking effect did not influence the overall morphological changes.
[0271] To evaluate the effect of BDNF spacing on hMSC differentiation, microscopic observation and directional distribution analysis were performed after 6 days of co-culture with SQB-BDNF (Fig. 4d, 4f). Untreated hMSCs exhibited a broad and flat morphology, with a broad directional distribution and no distinct alignment. Similarly, the SQB-only and BDNF-mimetic peptide-only treatment groups exhibited dispersed directional patterns, indicating a minimal effect on cell alignment. In contrast, the SQB-BDNF-treated group exhibited a relatively aligned cell morphology, suggesting that the provision of spatially arranged BDNF influenced cell differentiation.
[0272] Among these, SQB-BDNF with a 5 nm spacing induced the most pronounced cell alignment, and showed a high frequency and dominant directionality in the polar histogram. Analysis of the coherency coefficient showed that SQB-BDNF with a 5 nm spacing recorded the highest value (0.6662 ± 0.016) (Fig. 4e). On the other hand, the coherency coefficient decreased as the spacing increased (14 nm: 0.6406 ± 0.019), suggesting a decrease in the cell alignment and differentiation effect. Interestingly, the 5 nm spacing is very similar to the native dimerization state of BDNF-bound TrkB receptor (~6 nm), highlighting its important role in promoting receptor binding and activation. In contrast, a wider spacing such as 14 nm was not optimized for receptor activation and resulted in a decrease in the alignment and differentiation potential of hMSCs.
[0273] To further evaluate the effect of BDNF binding affinity on hMSC differentiation, hMSCs were treated with 10 nM concentration of SQB-BDNF functionalized with 4, 8, 18, and 38 BDNF-mimetic peptides, respectively, while maintaining a 5 nm gap. No significant differences were observed between SQB-BDNF4 and SQB-BDNF8, or between SQB-BDNF18 and SQB-BDNF38. However, when SQB-BDNF4 and SQB-BDNF38 were compared, SQB functionalized with 38 BDNF-mimetic peptides induced a statistically significant increase in the coherence coefficient (C) (SQB-BDNF4: 0.6531 ± 0.027; SQB-BDNF38: 0.6985 ± 0.033).
[0274] In particular, the differentiation data of SQB (SQB-BDNF4), which presents four BDNF-mimetic peptides spaced 5 nm apart, indicate the importance of the minimum BDNF-mimetic peptide concentration for inducing hMSC activation. At high concentrations (380 nM, Figures 4d, 4e), SQB-BDNF4 induced a pronounced cell sorting response, whereas at low concentrations (40 nM, Figures 4f, 4g), the differentiation effect was minimal.
[0275] These results demonstrate that the spatial arrangement and density of BDNF play a key role in regulating cell alignment in neural differentiation of hMSCs, highlighting the importance of precisely controlled BDNF presentation to optimize cell differentiation outcomes.
[0276]
[0277] 5. Activation of TrkB signaling through SQB-BDNF and neuronal differentiation of hMSCs.
[0278] To investigate the effects of SQB-BDNF on TrkB signaling and neuronal differentiation of hMSCs, we selected SQB, which was characterized by a BDNF-mimicking peptide with a 5 nm spacing and 38 valency, which was previously shown to optimally promote neuronal differentiation. To evaluate the effects of SQB-BDNF on hMSC differentiation, we analyzed key cellular responses associated with neuronal differentiation.
[0279] First, we observed morphological changes and cell migration to confirm that SQB-BDNF induced an elongated and aligned morphology, a characteristic of neuronal differentiation. Furthermore, we assessed whether SQB-BDNF enters hMSCs via TrkB-mediated endocytosis, examining essential steps for receptor activation. Furthermore, we investigated the PI3K / AKT and MAPK / ERK pathways to determine whether signaling pathways important for neuronal survival and differentiation were activated.
[0280] To assess whether SQB-BDNF-treated hMSCs acquire neuronal-supportive properties, neurotrophic factor secretion was measured. Finally, differentiation into the neuronal lineage was confirmed by analyzing the expression of the neuronal markers Nestin and β-tubulin III.
[0281]
[0282] 5-1. Role of SQB-BDNF immobilized BDNF-mimetic peptide
[0283] To assess the importance of BDNF-mimetic peptide immobilized on SQB, hMSCs were treated with 10 nM SQB-BDNF, 380 nM free BDNF peptide, or a mixture of unbound SQB and free BDNF peptide (SQB + BDNF).
[0284] Interestingly, SQB + BDNF-treated hMSCs did not exhibit morphological characteristics suggestive of neuronal differentiation (Fig. 6a). In contrast, SQB-BDNF induced an elongated morphology, and coherency coefficient analysis revealed a dominant directionality, indicating that immobilized BDNF peptide promoted neuronal differentiation more effectively than dissolved BDNF (Fig. 6b). This highlights the important role of spatial organization of BDNF in optimizing receptor activation and differentiation.
[0285]
[0286] 5-2. SQB-BDNF promotes hMSC proliferation and migration
[0287] SQB-BDNF significantly enhanced hMSC proliferation, increasing cell number by up to 20% compared to the non-treated group (Fig. 6c). In contrast, no significant difference in proliferation was observed between the SQB alone and BDNF peptide alone treatment groups.
[0288] Furthermore, hMSC migration significantly increased in the SQB-BDNF-treated group, showing a significant difference compared to the untreated group and the SQB-only treatment group (Fig. 6d). These results suggest that SQB-BDNF may promote the migration of neural precursor cells to the site of injury, a functional property important for neurogenesis and tissue regeneration.
[0289]
[0290] 5-3. TrkB receptor interaction and signal transduction activation of SQB-BDNF
[0291] To confirm whether SQB-BDNF is transduced into cells through TrkB-mediated endocytosis, a key step in signal transduction, we first confirmed the expression of TrkB receptor in hMSCs (Fig. 7A).
[0292] Fluorescence imaging using Cy5.5-labeled SQB revealed a strong intracellular fluorescence signal in SQB-BDNF-treated hMSCs, with a fluorescence intensity that was approximately 70% higher than that in the SQB-only group (Fig. 6e). In contrast, no Cy5.5 signal was detected in the untreated group, and only minimal uptake was observed in the SQB-treated group.
[0293] Interestingly, co-treatment with BDNF protein, a ligand of the TrkB receptor, at a concentration of 100 nM significantly reduced the influx of SQB-BDNF, indicating that SQB-BDNF is primarily transported into cells via TrkB-mediated endocytosis.
[0294] In addition, compared to the untreated group, Western blot analysis confirmed that the PI3K / AKT and MAPK / ERK pathways, which are downstream signaling systems of the TrkB receptor, were activated in hMSCs by SQB-BDNF (Figs. 6f, 6g).
[0295]
[0296] 5-4. Secretion of neurotrophic factors and expression of neuronal markers by SQB-BDNF
[0297] SQB-BDNF-treated hMSCs showed increased nerve growth factor (NGF) secretion, but no significant change in BDNF secretion (Fig. 6h, C and D in Fig. 7). After 6 days of co-culture with SQB-BDNF, NGF secretion increased to approximately 400 pg / mL, which plays an important role in neuronal survival, axon growth, and synapse formation.
[0298] To further evaluate the ability of SQB-BDNF to induce neural differentiation, we analyzed the expression of Nestin, a major marker of neural progenitors, and β-tubulin III, a marker of mature neuron differentiation. The results showed that Nestin expression was significantly increased in hMSCs treated with SQB-BDNF, supporting that these cells were induced to differentiate into the neural lineage (6i, Fig. 7E). Nestin is a major marker of neural progenitors and plays an essential role in microtubule formation in mature neurons, confirming that SQB-BDNF induces neural lineage differentiation.
[0299]
[0300] The results of this study demonstrate that SQB containing a BDNF-mimetic peptide promotes hMSC proliferation, migration, and neural progenitor differentiation, potentially contributing to neural repair. These results highlight the critical role of ligand spatial arrangement in regulating neurogenesis and differentiation, and may contribute to optimizing bioengineering platforms for neurological applications.
[0301]
[0302] 6. Promotion of hMSC differentiation through dual delivery of BDNF and NGF in SQB.
[0303] 6-1. Optimization of growth factor combinations and spatial arrangements using SQB
[0304] A key advantage of DNA nanostructures is the ability to precisely control the valency, spatial arrangement, and combination ratio of various ligands. Leveraging these properties, in this study, we designed SQBs presenting different ligands in defined ratios (24:0, 18:6, 12:12, 8:16, and 0:24) to simulate dual ligand presentation (Fig. 8a). To verify the controllability of dual ligand presentation at the individual nanostructure level, prior to introducing BDNF and NGF-mimetic peptides, model experiments using the fluorophores FITC and Cy5.5 were performed. Urea-PAGE analysis confirmed direct binding to SQBs via different complementary ssDNAs in a manner identical to that of the BDNF-mimetic peptide (Fig. 9a).
[0305] To verify the dual ligand display, the relative introduction efficiency was quantified using dye-conjugated ssDNA. The fluorescence signals of SQB labeled with preset FITC:Cy5.5 ratios were quantitatively analyzed based on the agarose gel electrophoresis results, and it was confirmed that the intensity of each fluorophore increased proportionally to the number of introduced ligands (Fig. 8b and Fig. 8c). A strong linear correlation was observed between the introduction ratios of FITC and Cy5.5 and the measured fluorescence intensities (R 2 = 0.9854 for FITC, R 2 = 0.9973 for Cy5.5), demonstrating that dual labeling was achieved precisely and programmably at a single SQB level.
[0306] 6-2. Verification of hMSC intra-co-transfer using SQB
[0307] To verify whether two ligands can be co-delivered into a single cell through the same SQB, hMSCs were cultured with dual-labeled SQB (SQB-FITC:Cy5.5 12:12) or a mixture of single-labeled SQB (SQB-FITC 24:0 + SQB-Cy5.5 0:24) for 4 h, and then confocal microscopy analysis was performed (Fig. 8d and Fig. 10).
[0308] In the SQB treatment group containing FITC and Cy5.5 in a 12:12 ratio, a strong co-localized signal of the two fluorophores was observed within the cytoplasm, and a linear correlation (r = 0.66, P = 0.0022) was observed between the intensities of FITC and Cy5.5.
[0309] In contrast, when FITC(24:0) or Cy5.5(0:24)-conjugated SQBs were mixed and treated, the co-localization signal was relatively reduced, and showed a low linear correlation that was not statistically significant (r = -0.088, P = 0.7211). In most cells, only a single fluorescent signal was observed, suggesting that the two ligands were delivered to different cells separately. These results demonstrated that simultaneous delivery of the two ligands into the same cell can be effectively achieved only when they are simultaneously loaded onto a single SQB.
[0310] 6-3. Evaluation of the Biological Effects of hMSCs Co-delivered with BDNF and NGF
[0311] To assess the biological significance of dual ligand delivery, BDNF and NGF-mimetic peptides were simultaneously introduced into SQB at various ratios (24:0, 18:6, 12:12, and 0:24). Each peptide was conjugated to the SQB using two complementary single-stranded DNAs (ssDNAs). This allowed for independent positioning of the BDNF and NGF-mimetic peptides. SQBs containing BDNF-mimetic peptides exhibited a band shift with decreased mobility, and the migration rate increased with increasing NGF-mimetic peptide ratio (Fig. 8e). Transmission electron microscopy (TEM) analysis confirmed that all peptide combinations maintained the structural integrity of the SQB (Fig. 9B).
[0312] To evaluate the effects of dual growth factor delivery on hMSC differentiation, hMSCs were treated with SQB containing BDNF and NGF-mimetic peptides. First, expression of the NGF and BDNF receptors, TrkA and TrkB, was confirmed, verifying that the peptides contained in SQB could activate each receptor (Fig. 7A).
[0313] Morphological analysis revealed that hMSCs in the SQB treatment group containing BDNF and NGF-mimetic peptides exhibited more elongated and neuron-like morphology, and a significant differentiation effect was observed compared to the peptide treatment group alone (Fig. 8f). Polar histogram analysis confirmed that SQB containing mimetic peptides promoted dominant oriented alignment, with an increase in relative frequency in a specific angular range (Fig. 8f).
[0314] Quantitative directional analysis results showed that the SQB treatment groups containing BDNF and NGF (18 / 6 and 12 / 12 ratios) showed high coherency coefficients (0.559 and 0.573), which were higher than the coherency coefficient (0.531) of the BDNF-only treated SQB (24 / 0) (Fig. 8g).
[0315] Furthermore, co-delivery of BDNF and NGF-mimetic peptides using SQB most effectively increased Nestin expression, with expression levels 17% higher than those in the growth factor-treated group alone (Fig. 8h, Fig. 9C). These results suggest that co-delivery of BDNF and NGF-mimetic peptides can promote neuronal differentiation more effectively than single peptide delivery.
[0316] These results demonstrate that DNA nanostructures can precisely control growth factor-mimetic peptides and effectively promote hMSC differentiation through the provision of multiple ligands.
[0317]
[0318] 7. Functional recovery and nerve regeneration through SQB-BDNF treatment
[0319] 7-1. Sciatic nerve damage
[0320] Peripheral nerve injury can disrupt nerve conduction, leading to severe functional impairment and muscle atrophy. In this study, we analyzed functional recovery and muscle atrophy in a sciatic nerve crush injury model to evaluate the therapeutic effects of SQB-BDNF on nerve recovery.
[0321] 7-2. Evaluation of functional recovery through SQB-BDNF treatment
[0322] Functional recovery was monitored at 0, 3, 7, 14, 21, and 28 days postoperatively using the toe-spreading sciatic function index (SFI). Additionally, gastrocnemius muscle weight and density were measured 28 days later to assess muscle preservation (Fig. 11A).
[0323] Before surgery, mice in all experimental groups showed normal motor function. (B in Fig. 11), after injury, the SFI value decreased rapidly to below -100 on the 7th day regardless of treatment, indicating severe motor impairment. However, functional recovery was observed in the SQB-BDNF treatment group on the 14th day, and the SFI value improved to -30.68 ± 6.54. This was a higher value than the injury group (-46.77 ± 19.74) and the BDNF alone treatment group (-38.30 ± 3.76). On the 21st day, the SQB-BDNF treatment group showed a tendency to show a faster functional recovery rate, but the difference was not statistically significant.
[0324] 7-3. Reduction of muscle atrophy and contribution to nerve recovery through SQB-BDNF treatment
[0325] To evaluate muscle atrophy, a representative feature of sciatic nerve damage, the weight and fiber area of the gastrocnemius muscle were analyzed (C in Figure 11).
[0326] The gastrocnemius muscle isolated from the injured group exhibited significant shrinkage compared to the normal control group. Furthermore, hematoxylin and eosin (H&E) staining of muscle tissue revealed severe atrophy in the injured group, whereas the SQB-BDNF-treated group preserved muscle fiber structure and exhibited a decrease in extracellular space.
[0327] Cross-sectional analysis results showed that the muscle fiber area in the SQB-BDNF treatment group was significantly increased by 49.66 ± 2.39% compared to the injured group (36.17 ± 9.40%) (Fig. 11D). In addition, the muscle weight (113.08 ± 1.91 mg) of the SQB-BDNF treatment group was significantly increased compared to the injured group (89.52 ± 7.24 mg), and showed a similar level to the SQB only group (112.47 ± 1.90 mg) and the BDNF only group (103.15 ± 1.55 mg) (Fig. 10E).
[0328] These results suggest that SQB-BDNF may effectively preserve muscle integrity after sciatic nerve injury and contribute to functional recovery.
[0329] 7-4. Promoting nerve regeneration through SQB-BDNF treatment
[0330] To more closely evaluate nerve regeneration, we analyzed structural and molecular changes in the distal nerve. Histological examination was performed, focusing particularly on remyelination, axonal integrity, and the inflammatory response.
[0331] Scanning electron microscopy (SEM) analysis of distal nerve cross-sections showed that the SQB-BDNF-treated group had a thicker myelin sheath (1.10 ± 0.05 μm) and a larger myelinated nerve fiber diameter (7.53 ± 0.24 μm) compared to the injured group (Figs. 12a and 12b). These values were improved compared to the injured group (0.76 ± 0.04 μm and 6.41 ± 0.34 μm, respectively).
[0332] These features contribute to improved signal transmission and play an important role in reducing internal resistance and enhancing insulation.
[0333] In addition, the SQB-BDNF-treated group showed improved demyelination, as evidenced by increased myelin fiber area (43.51 ± 3.68%) and myelinated axon density. The G-ratio (0.69 ± 0.01) was closer to the optimal range (0.6–0.7) (Fig. 12b), indicating that nerve recovery was more smooth than in the injured group (0.75 ± 0.02).
[0334] H&E staining results showed that more densely packed and connected nerve fibers were observed in the SQB-BDNF treatment group (Fig. 12c), and immunofluorescent staining results showed that the expression of β-tubulin, a neural marker, and S-100, a Schwann cell marker, increased, indicating that axonal regeneration and Schwann cell activity were promoted (Fig. 12d to 12f).
[0335] 7-5. Promotes nerve regeneration by creating an anti-inflammatory environment.
[0336] Histological analysis of longitudinal-sectioned distal nerves revealed a consistent pattern of nerve regeneration in the SQB-BDNF treatment group (Fig. 14A).
[0337] In addition, to quantitatively evaluate the inflammatory response, immunofluorescence staining for CD68 (a universal macrophage marker, red) and CD206 (a M2 macrophage marker, green) was performed. CD68 expression indicates the presence of macrophages and reflects inflammatory activity, whereas CD206 expression represents M2 macrophages associated with anti-inflammatory responses and tissue regeneration. There was no significant difference in CD68 and CD206 expression between the SQB-BDNF treatment group and the sham group, but the nerve crush injury group showed a significantly higher inflammatory response. Under inflammatory conditions, CD68+ / CD206 cells represent pro-inflammatory M1 macrophages. In particular, crush injury significantly increased the influx of CD68+ / CD206 cells, whereas the number of these M1 macrophages decreased to the level of the sham group in the SQB, SQB-BDNF, and BDNF treatment groups. This means that SQB does not induce a foreign substance-derived immune response, and no serious inflammatory response was observed.
[0338] Additionally, the increased expression of M2 macrophages in the SQB-BDNF-treated group suggests that a regenerative response was induced, supporting the potential application of SQB-BDNF as a therapeutic agent for peripheral nerve recovery.
[0339]
[0340] The enhanced recovery observed in the SQB-BDNF treatment group suggests a synergistic effect of precisely delivering BDNF-mimetic peptides to promote nerve regeneration and functional recovery.
[0341] These results suggest that SQB-BDNF may be a promising therapeutic candidate for peripheral nerve repair by promoting functional recovery and muscle preservation after sciatic nerve injury.
[0342]
[0343] 8. Neural cell-type differentiation of human mesenchymal stem cells (hMSCs) induced by SQB
[0344] hMSCs treated with SQB DNA nanostructures exhibited neuron-like morphology (Fig. 15a), and the cells were observed to be long and thin and aligned in a specific direction (Figs. 15b to 15e).
[0345] Additionally, SQB treatment significantly increased the activation of AKT and ERK signaling pathways, which are known to promote stem cell survival, proliferation, and differentiation into neural cells (Fig. 15f).
[0346] The SQB treatment group showed significantly increased cell proliferation (Fig. 15g) and mobility (Fig. 15h) compared to the control group.
[0347] Additionally, we confirmed that the expression of nestin, a neural progenitor cell marker, increased, demonstrating that the SQB DNA nanostructure effectively contributes to the early stage of stem cell differentiation into neural lineage cells (Fig. 15i).
[0348] From the above, it was found that the SQB DNA nanostructure promotes neural regeneration by inducing neural differentiation of human mesenchymal stem cells (hMSCs), activation of AKT / ERK signaling, increased cell proliferation and mobility, and expression of a neural progenitor cell marker (nestin) independently of growth factors.
[0349]
[0350] Although the embodiments described above have been described with limited drawings, those skilled in the art will appreciate that various technical modifications and variations can be applied based on the above. For example, appropriate results can still be achieved even if the described techniques are performed in a different order than described, and / or components of the described systems, structures, devices, circuits, etc. are combined or combined in a different manner than described, or are replaced or substituted with other components or equivalents.
[0351] Therefore, other implementations, other embodiments, and equivalents to the claims also fall within the scope of the claims described below.
Claims
1. A pharmaceutical composition for the treatment of differentiation or regeneration of nerve cells, nerve damage or nerve disease, containing a DNA nanostructure as an active ingredient, The above DNA nanostructure is in the shape of a square block, The above DNA nanostructure is K 10 -PEG 5k A pharmaceutical composition coated with .
2. In paragraph 1, The surface of the above DNA nanostructure is labeled with a growth factor-mimetic peptide, The above growth factor mimetic peptide is provided as a peptide-ssDNA conjugate linked to single-stranded DNA (ssDNA), A pharmaceutical composition wherein the ssDNA of the peptide-ssDNA conjugate complementarily binds to a sequence protruding from the surface of the DNA nanostructure.
3. In paragraph 2, A pharmaceutical composition, wherein the growth factor mimic peptide is at least one selected from the group consisting of brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), vascular endothelial growth factor (VEGF), and fibroblast growth factor 2 (FGF2).
4. In paragraph 2, The above growth factor mimicking peptide is labeled at least four times on the surface of the DNA nanostructure, A pharmaceutical composition wherein the growth factor mimicking peptide is labeled at intervals of 5 to 14 nm on the surface of the DNA nanostructure.
5. In paragraph 3, A pharmaceutical composition comprising the growth factor mimetic peptides BDNF and NGF simultaneously.
6. In paragraph 1, A pharmaceutical composition wherein the composition interacts with TrkB to increase AKT / ERK signaling, which is a TrkB downstream signaling pathway.
7. In paragraph 1, A pharmaceutical composition, wherein the nerve damage or nerve disease is at least one selected from the group consisting of brain damage, brain disease, spinal cord injury, peripheral nerve damage, peripheral nerve disease, and amyotrophic lateral sclerosis.
8. In paragraph 7, A pharmaceutical composition, wherein the brain damage or brain disease is at least one selected from the group consisting of dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, epilepsy, stroke, apoplexy, ischemic brain disease, and degenerative brain disease.
Citation Information
Patent Citations
DNA nanostructure-based vaccines
US20220305119A1
DNA nanostructure-based vaccines
WO2020247724A1
DNA barrel nanostructure vaccines
WO2024077214A1