Means, methods and kits for the cyclization of peptides with bifunctional scaffolds

A one-pot cyclization method using a bifunctional scaffold with Cys and Gly residues forms imidazolidinone-fused cyclic peptides, addressing the limitations of existing methods by enhancing peptide diversity and stability for drug discovery.

WO2025230420A1PCT designated stage Publication Date: 2025-11-06UNIVERSITY OF GRONINGEN
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/NL2025/050210
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-03
Filing Date
2025-05-02
Publication Date
2025-11-06

AI Technical Summary

Technical Problem

Existing methods for cyclizing peptides on bacteriophages using bi-functional scaffolds are cumbersome, require toxic reagents, and result in a large 'chemical scar', limiting their applicability and diversity in drug discovery.

Method used

A one-pot cyclization method using a bifunctional scaffold with specific amino acid residues (Cys and Gly) and defined functionalities, forming an imidazolidinone-fused cyclic peptide under mild conditions, compatible with biological display platforms.

Benefits of technology

The method allows for efficient, high-yielding cyclization of peptides with minimal chemical scar, enhancing diversity and stability, suitable for high-throughput drug discovery without toxic reagents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000006_0001
    Figure IMGF000006_0001
  • Figure IMGF000006_0002
    Figure IMGF000006_0002
  • Figure IMGF000009_0001
    Figure IMGF000009_0001
Patent Text Reader

Abstract

The invention relates to peptide cyclization, a peptide compound having a cyclic portion, and the development of peptide-based drugs. Provided is a method for providing a cyclic peptide, or a peptide compound having a cyclic portion, comprising reacting a linear peptide comprising an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys, wherein NH2 indicates the N-terminus of the peptide; Xaa is any natural or non-natural amino acid residue and n is 2 to 15; with a bifunctional synthetic scaffold comprising a first functionality HC(O)–(CH2)x – and a second functionality – (CH2)y-LG, wherein x is 1 to 5, y is 1 to 5, preferably 1 to 3; LG is an electrophilic leaving group or a cysteine-reactive electrophile, preferably a halogen atom, more preferably Br, under conditions allowing for the formation of an imidazolidinone-fused macrocyclic peptide (MP).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] P136398PC00 Title: Means, methods and kits for the cyclization of peptides with bifunctional scaffolds. The invention relates to peptide cyclization, a peptide compound having a cyclic portion, and the development of peptide-based drugs. Among others, it relates to means, methods and kits for the cyclization of linear peptides displayed on replicative entities, such as bacteriophages, using synthetic scaffolds. It also relates to bifunctional cyclization scaffolds, cyclic peptides and libraries comprising the same displayed on replicative entities, such as bacteriophages. Macrocyclic peptides (MPs) have positioned themselves as privileged structures in drug discovery efforts, as they can modulate protein-protein interactions, which are targets considered to be ‘undruggable’ by small-molecule therapeutics.[1]Peptide therapeutics have been in use for several decades, and the market for these drugs has grown significantly over the past 10 years.[2]Moreover, two-thirds of the >60 FDA and EMA-approved peptide therapeutics are MPs. Compared to their linear counterparts, MPs have several advantages, including a higher binding affinity and specificity, as well as an increased resistance against (protease) degradation. Small (<15 amino acids) peptides typically also elicit a low immune response. The use of biological selection platforms, such as bacteriophage display, can greatly speed-up the peptide lead discovery process as they allow for the facile production of vast peptide libraries (108-1013library members) and circumvent the laborious task of evaluating peptides one by one.[3]As a result, chemical strategies to synthesize MPs that are compatible with biological selection platforms are highly sought after. So far, various strategies for the cyclization of peptides on bacteriophages have been described.[4]These include disulfide formation,[5]incorporation of non- canonical amino acids,[6]the use of symmetrical crosslinkers,[7]and more recently, the use of bi-functional scaffolds.[8]This last strategy is of particular interest. It uses two orthogonal types of reactivity for canonical amino acids and results in the programmed cyclization of peptides with asymmetric scaffolds, thus avoiding the formation of regio-isomers when a single type of reactivity is employed. Effectively, only this last strategy allows for the formation of hybrid MPs akin to the potent naturally- occurring MPs that feature asymmetric cyclization units in their structures. The selective production of MPs that feature diverse asymmetric molecular scaffolds necessitates the selective and orthogonal modification of two functional groups in a given peptide. Moreover, the cyclization should ideally proceed under mild and (bio)compatible conditions to be applicable in high-throughput MP library generation methods (e.g. display technologies). Such approaches typically combine the fast modification of a uniquely- reactive cysteine side chain with biorthogonal chemistry that selectively targets an N-terminal cysteine (see scheme 1). For example, the groups of Wu, Nitsche, Gao and Liu all capitalized on the bio-orthogonal nitrile- aminothiol (NAT) click reaction, which involves the condensation between 1,2-aminothiols (e.g. N-terminal cysteine) and electrophilic nitriles.[9-13]

[0002] Scheme 1: Phage-compatible bi-functional synthetic scaffolds featuring orthogonal reactive handles. Regioselective macrocyclization is enabled by modification of cysteine and an N- terminal cysteine residue using electrophilic nitriles, or an N- terminal amine to condense with an aryl (top) or alkyl (bottom) aldehyde functionality. Originally pioneered for protein modification by Rao et al.

[0014] , various nitrile- containing scaffolds have since been employed for peptide macrocyclization. Displaying good kinetics (k2: ∼10 M−1s−1), bifunctional small molecules featuring electrophilic nitriles have successfully been applied in bacteriophage display and mRNA display, eliciting MP-binders against (model) protein targets.[9,12-13,15-16]Unfortunately, the cyclization produces MPs that contain a (relatively) large “chemical scar” (=aromatic thiazoline), and, thus far, only a limited chemical diversity in the bifunctional scaffolds has been explored. To minimize the ‘chemical scar’ of the cyclization and alleviate the constraints on requiring an N-terminal cysteine (e.g. Wu 2021)

[0017] , we recently reported a phage-compatible cyclization strategy using bi- functional scaffolds that feature a good leaving group and an aromatic aldehyde (Scheme 1).[8]In the cyclization, the scaffold alkylates a unique cysteine residue in the peptide, bringing the aldehyde moiety in close proximity to the N-terminal amine. Their subsequent condensation results in the (transient) formation of an iminium ion, which can be selectively reduced to a stable amine linkage in presence of NaBH3CN. This 2-step procedure minimizes the introduced chemical scar. Cyclization reactions proceeded smoothly with different bi-functional scaffolds and permitted the identification of tight MP binders (Kd ~70 nM) for a model target by bacteriophage display. However, this strategy is not particularly attractive for wider application in non-expert labs, as it proceeds slowly, requires several changes of buffer, and the addition of multiple batches of a toxic reagent (NaBH3CN) over consecutive days. Recognizing the strength of cyclizing peptides on bacteriophages or other genetic replicative particles, the present inventors sought to maximize user-friendliness of their previous approach. In particular, they sought to develop an improved peptide cyclization protocol that can proceed in a one- pot fashion, obviates the need for toxic reagents and requiring from the user solely the addition of the desired scaffold to a prepared peptide library. Moreover, the protocol should ideally result in the formation of MPs that have a minimal chemical scar. Still further, to display a great diversification potential, the reactive handles present in the bifunctional scaffolds should be compatible with functional groups found in complex molecules and the installation of these handles should be based on established chemical methods, using readily available starting materials. It was found by serendipity that at least some of these goals can be achieved via a novel cyclization strategy that relies on the combination of a unique bi- functional scaffold and the presence of two selected amino acid residues in the linear target peptide: (i) a unique cysteine (Cys) residue at least four residues away from the N-terminus and (ii) a glycine (Gly) residue in the second position of the linear peptide precursor. The synthetic bi-functional scaffold contains an alkyl moiety comprising an electrophilic leaving group, such as a benzyl bromide / bromo-acetamide, and an aliphatic or aromatic aldehyde reactive group. The cyclization reaction is thought to proceed as follows: (i) the Cys residue is alkylated via a nucleophilic substitution of the alkyl-bromide species (SN2), followed by (ii) the transiently-formed electrophilic iminium ion between the aldehyde on the scaffold and the peptide’s N-terminal amine (proximity-driven) being trapped via a nucleophilic attack by the amidic nitrogen of the Gly residue in the second position, resulting in the formation of a so-called imidazolidinone structure. An exemplary depiction of the cyclization reaction is shown in Scheme 2. Scheme 2. A one-pot, head-to-side-chain peptide cyclization strategy gives rise to an imidazolidinone-fused macrocyclic peptide. Following cysteine alkylation, the transiently-formed iminium ion is trapped intramolecularly by the amidic nitrogen. R indicates the side-chain of the N-terminal amino acid of the linear peptide, which can be any amino acid side chain, preferably alanine, i.e. R is -CH3. Accordingly, in one aspect the invention discloses a method for providing a cyclic peptide, or a peptide compound having a cyclic portion, comprising reacting a linear peptide comprising an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys wherein NH2indicates the N-terminus of the peptide; Xaa is any natural or non-natural amino acid residue; n is 2 to 15; with a bifunctional synthetic scaffold comprising a first functionality HC(O)–(CH2)x– and a second functionality – (CH2)y-LG, wherein x is 0 to 5, y is 1 to 5, preferably 1 to 3; LG is an electrophilic leaving group, preferably a halogen atom, more preferably Br,under conditions allowing for the formation of an imidazolidinone-fusedcyclic peptide or cyclic peptide portion. In particular, the invention provides a method for providing a cyclic peptide, or a peptide compound having a cyclic portion, comprising reacting a linear peptide comprising an amino acid sequence of the formula NH2-Xaa1-Gly- (Xaa)n-Cys wherein NH2indicates the N-terminus of the peptide; Xaa is any natural or non-natural amino acid residue; n is 2 to 15; with a bifunctional synthetic scaffold comprising a first functionality HC(O)–(CH2)x– and a second functionality – (CH2)y-LG, wherein x is 1 to 5, y is 1 to 5, preferably 1 to 3; LG is an electrophilic leaving group, preferably a halogen atom, more preferably Br, or a cysteine-reactive electrophile,under conditions allowing for the formation of an imidazolidinone-fused cyclic peptide or cyclic peptide portion. The invention herewith provides a selective, preferably one-pot, cyclization method that makes use of the programmed modification of a unique cysteine thiol, a nearby N-terminal amine, and the amidic nitrogen of a glycine residue in the second position from the N-terminal residue of the target polypeptide. The minimal functional group requirements of the bifunctional scaffold for use in the present invention can be readily installed via established chemical methods. This allows for a great diversification potential of MPs in drug-discovery campaigns as asymmetric scaffolds of varying levels of complexity may be incorporated yielding peptides with not only additional potential interactions for binding and increased conformational diversity, but also improved pharmacokinetic properties. Due to its simplicity, the strategy is readily be applicable for MP discovery campaigns in academia and industry. As is exemplified herein below, the novel strategy is suitably used to selectively access imidazolidinone-fused MPs from linear model peptides of varying length and diverse amino acid composition. The resulting MPs proved stable over a wide physiological pH range and displayed greatly improved serum stability when compared to their linear counterparts. Furthermore, the one-pot strategy is readily applicable to cyclizing a linear model peptide appended to a replicative entity, such as a bacteriophage. As such, the invention provides a combinatorial approach where libraries of scaffolds are interfaced with biological display platforms to achieve a bio- chemical fine-tuning of structures akin to how the evolutionary algorithm has yielded potent macrocyclic peptides that feature diverse of non-peptidic modifications. To access such natural-product-like MPs already in the discovery step should alleviate challenges encountered in the subsequent, extensive medicinal chemistry efforts that are currently required to improve the pharmacological properties of MPs and make them fit for clinical use. Target Peptides The cyclization method of the invention is applicable to a wide variety of linear target peptides of varying length and diverse amino acid composition, provided that it comprises or consists of an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys, wherein NH2indicates the N-terminus of the peptide; Xaa is any natural or non-natural amino acid residue; and n is 2 to 15. The testing of a series of model peptides differing in the number and / or nature of the residues between the N-terminal Xaa1-Gly and the Cys residue revealed that all peptides underwent efficient macrocyclization. The imidazolidinone motif could be identified over a wide range of ring sizes and amino acid sequences. The absence of appreciable levels of side product formation indicates compatibility of the cyclization reaction with diverse amino acid side chains, including lysine residues, which feature amines in their side chains. The N-terminal residue Xaa1can be any amino acid. Suitably, it is any amino acid that can be accessed as N-terminal residue in bacteriophage display. Preferably, Xaa1is Ala or Pro, more preferably the N-terminal residue Xaa1 is Ala. Hence, in one aspect the method comprises cyclization of a linear peptide comprising or consisting of an amino acid sequence of the formula NH2-Ala-Gly-(Xaa)n-Cys. The stretch of amino acids in between the ‘’cyclization residues’’ Gly and Cys of the target peptide is indicated by (Xaa)n, wherein n is 2 to 15. The length of the stretch can be in a range wherein n has a lower limit selected from 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 and an upper limit independently selected up to 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, and 5. Preferably, n is 2 to 10, more preferably 2 to 8, 3 to 8, 3 to 7 or 4 to 7. Each Xaa is independently selected from the group consisting of natural and non-natural amino acid residues. Natural amino acids include those commonly found in naturally occurring proteins. Non-natural amino acid residues refer to entities that can be installed by genetic-code expansion strategies, such as the use of auxotropic host strains or stop-codon In some embodiments, non- natural amino acids are selected from the group consisting of modified phenylalanine, tyrosine, lysine, and tryptophan residues or methionine analogs, such as azidohomoalanine, homoproparglyglycine, In some aspects, one or more non-natural amino acid(s) are used that offer additional bio- orthogonal handles (e.g. azides, alkynes, cyclooctyne) for further modification by well-established reactions or moieties that can make hydrophobic, ionic, and / or hydrogen-bonding interactions with a target of interest (e.g. aromatic amines or alcohols, or halogen atoms). In a preferred aspect, (Xaa)n comprises or consists of amino acids selected from D- and L- stereoisomers of the amino acids commonly found in naturally occurring proteins. In one aspect, it comprises or consists of D- amino acids. In another aspect, it comprises or consists of L-amino acids. In yet another aspect, it comprises or consists of both L- and D- amino acids. For example, one or more Xaa residues are selected from the group consisting of: alanine, arginine, aspartic acid, glutamine, glutamic acid, glycine, proline, serine, leucine, cysteine, valine, lysine, methionine, tryptophan, phenylalanine, arginine, tyrosine, threonine, isoleucine, histidine, lysine and asparagine. However, in order to avoid or minimize unwanted reactions with the scaffold, it is preferred that that the linear peptide contains a single Cys residue, i.e. that Xaa is any other amino acid than Cys. Therefore, in one embodiment the linear peptide comprises or consists of an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys wherein Xaa is any natural or non-natural amino acid residue other than Cys. As will be appreciated by one skilled in the art, a method as herein disclosed is advantageously used for cyclization of linear target peptides of any source or origin. In one aspect, the linear peptide is a recombinantly produced polypeptide. The process for producing a recombinant polypeptide generally involves production of the polypeptide in a host cell and purification of the polypeptide. Production generally involves culturing a prokaryotic or eukaryotic host cell under conditions suitable for the host cell to produce a recombinant polypeptide. This can affect the methods used to isolate and purify the product, as recombinant polypeptides can be produced at various locations within the host cell. After the recombinant polypeptide is produced, intact host cells and cell debris are separated from the cell culture medium in a process called "cell harvesting". For example, separating host cells from cell culture medium by centrifugation or filtration to provide a clarification fluid containing recombinant polypeptides and other impurities, which may be referred to as "cell culture supernatant". Examples of impurities that can be found in clarified cell culture supernatants include host cell proteins (HCPs), nucleic acids, endotoxins, viruses, protein variants, and protein aggregates. Alternatively, the target peptide is a synthetic peptide, for instance a peptide obtained by peptide synthesis using methods known in the art. These include three methodologies, namely, classical solution peptide synthesis (CSPS), solid-phase peptide synthesis (SPPS), and liquid-phase peptide synthesis (LPPS). In SPPS, an amino acid or peptide is bound, usually via the C-terminus, to a solid support. New amino acids are added to the bound amino acid or peptide via coupling reactions. Due to the possibility of unintended reactions, protection groups are typically used. The broad utility of solid phase peptide synthesis has been demonstrated by the commercial success of automated solid phase peptide synthesizers. Liquid-phase peptide synthesis is a hybrid method that combines the advantages of solution-phase and solid-phase chemistry. The LPPS approach is particularly suited for the synthesis of short peptides (up to 20 amino acids) for purity-sensitive applications. In a preferred embodiment, a method of the invention comprises the cyclization of a linear peptide which is produced or displayed on the surface of a replicative entity. For example, use is made of display technologies that allow for selecting or screening cyclic peptide binders. These include phage display, bacterial display, yeast display, ribosome display, mRNA display, DNA display, display on mammalian cells, spore display, viral display, or protein-DNA binding-based display. Alternatively, a display form such as a microbead display may be used. Suitably, the peptide is displayed on the surface of a replicative genetic particle, preferably on the surface of a bacteriophage particle, a yeast cell or a bacterial particle. Bacterial display is typically based on producing recombinant proteins fused to sorting signals that direct their incorporation on the cell surface. Phage display is typically based on producing recombinant proteins or peptides fused to a phage coat protein. In one embodiment, the target peptide is appended onto a phage- coat protein, for example phage gene 3 protein (g3p) or a functional fragment thereof. As is shown herein below, it was found that the conditions employed during the cyclization reaction do not negatively impact the life cycle of bacteriophages. Synthetic scaffold The cyclization method as herein disclosed relies on two unique residues (Gly and Cys) and an N-terminal amine in the target peptide, which each react with a defined functionality (reactive group) of a novel type of bifunctional cyclization scaffold. Thus, the invention also provides a bifunctional scaffold and the use of a bifunctional scaffold in the manufacture of a MP. A bifunctional synthetic scaffold according to the invention is characterized, among others, by comprising a first functionality HC(O)-(CH2)x – and a second functionality –(CH2)y-LG on a scaffold core. The first functionality comprises an aldehyde which participates in the formation of a covalent bond with the target peptide via a so-called imidazolidinone structure. The aldehyde moiety is connected directly to the scaffold core via an aliphatic linker (CH2)x wherein x is 1 to 5. It is only after the initial cysteine modification when the aldehyde and the N-terminus are brought in close enough proximity that they can react. To be able to form the imidazolidinone, a certain flexibility in the peptide chain is desirable. This is why an aliphatic aldehyde forms a stable imidazolidinone, whereas in case of a scaffold comprising an aromatic aldehyde, the imidazolidinone is reversibly formed (see Fig.3). In addition, glycine is the most flexible amino-acid and as a result, its amidic nitrogen is suited to attack the transiently-formed iminium ion to generate the imidazolidinone- fused cyclic peptide. As is shown herein below, a cyclization reaction involving an aliphatic aldehyde gives rise to the irreversible formation of an imidazolidinone-fused MP, presumably due to an increased reactivity of an aliphatic aldehyde when compared to an aromatic aldehyde. Therefore, it is advantageous to use a scaffold comprising an aliphatic aldehyde that is connected via an aliphatic linker (CH2)x wherein x is 1 to 5, more preferably 1 to 3, to an aliphatic or (hetero)aromatic scaffold core. A scaffold of the invention comprises a second functionality – (CH2)y-LG wherein y is 1 to 5, preferably 1 to 3, and wherein LG is an electrophilicleaving group or a cysteine-reactive electrophile. In some embodiments, thesecond functionality of the scaffold comprises –NH-C(O)-(CH2)x-LG, preferably –NH-C(O)-CH2-Br. In one aspect, LG is an electrophilic leaving group. Useful electrophilic leaving groups include Cl−, Br−, I−, −OTs, −OMs, −OTf. In one aspect, LG is a halogen such as Cl, Br and I. Preferably, LG is a halogen, such as Cl, Br or I, more preferably LG is Br. In another aspect, LG is a cysteine-reactive electrophile. Cysteine-reactive electrophiles are well known and widely used in chemical biology and drug discovery. Under defined reaction conditions they preferentially target the thiol (-SH) group of cysteine residues in proteins. These electrophiles are designed to react specifically with cysteine by forming a covalent bond. Examples include compounds with Michael acceptor groups, α- Halocarbonyls and benzylic halides, electrophilic sulfonates, vinyl and alkynyl reagents and electron deficient aryl-halides. Each of these reacts through different chemical mechanisms, but they all undergo nucleophilic attack from the cysteine thiol. Preferably, the LG moiety in a scaffold of the present invention comprises a cysteine-reactive group selected from those listed below. In a specific aspect, LG is a vinyl group, preferably a maleimide. Cysteine alkylation via nucleophilic substitution ^α-Halocarbonyls and benzylic halides, e.g. Iodo-, chloro-, or bromoacetamides, Benzyl iodides, -chlorides, or -bromides ^electrophilic sulfonates, e.g. Mesyl- or tosylatesCysteine alkylation via addition to electrophilic double- or triple bonds ^Vinyl and alkynyl reagents^ Michael Acceptors, e.g. Maleimide derivatives, aryl sulfones, vinylsulfones, and related α,β-unsaturated systems ^Other cysteine-reactive electrophiles, e.g. 2-cyanobenzothiazole,chlorooximes Cysteine alkylation via nucleophilic aromatic substitution ^Electron deficient aryl-halides, e.g. 2,4-difluoro-6-hydroxy-1,3,5-benzenetricarbonitrile, decafluoro-diphenylsulfone, hexafluorobenzene and related perfluoroaromatic species It is demonstrated herein below that high-yielding cyclizations were obtained using a set of asymmetric scaffolds ranging with diverse complexity, ranging from a minimal lynchpin bromoacetaldehyde scaffold to an intermediate aliphatic aldehyde featuring an aromatic core moiety to a large thymidine-based scaffold (Scheme 3). These findings indicate that, other than the two defined functionalities, the overall scaffold structure can have highly-variable structural features and overall complexity. Scheme 3. Representative bifunctional cyclization scaffolds ordered by increasing molecular complexity. In one aspect, the first and second functionality are directly connected (fused) to each other by way of an aliphatic moiety - (CH2)x+y - wherein x and y are as defined herein above. In one aspect, the aliphatic moiety connecting the first and second functionality is -(CH2)1-6. For example, peptide cyclization can be achieved using a scaffold of the formula HC(O)-(CH2)z-LG wherein z is 1 to 6, preferably 1 to 5, more preferably 1 to 3, and LG is an electrophilic leaving group. Preferably, LG is a halogen atom, more preferably Br. In one embodiment, the scaffold is HC(O)-(CH2)2-Br, preferably HC(O)-(CH2)-Br (bromoacetaldehyde; herein also referred to asscaffold 3). Alternatively, peptide cyclization is achieved using a scaffoldcomprising a linear alkane, preferably of the formula HC(O)-(CH2)z-LG wherein z is 1 to 6, more preferably 1 to 5, more preferably 1 to 3, and LG is a cysteine-reactive electrophile. In another aspect, the first and second functionality are connected to a core moiety, where the core merely features the functionalities and does not participate in the cyclization reaction. The chemical structure of the scaffold core carrying the two distinct functionalities is not critical as long as its size and optional other functional groups tolerate and allow for the bifunctional reactive handles to react with the designated amino acid residues of the target peptide. For example, the core can have a molecular weight ranging from about 10 to about 1000 g / mol (Da), or about 20 to about 800 Da, or about 15 to about 200 Da, or about 100 to about 600 Da, or about 300 to about 800 Da. A scaffold core can be a small molecule or a macromolecular structure. The core may be composed of organic, inorganic or organic and inorganic components. In one aspect, the scaffold is a small organic molecule as for example a linear alkane. For example, the scaffold core is of the formula - (CH2)z- wherein z is 1 to 6, preferably 1 to 5, more preferably 1 to 3. Other suitable scaffold cores include a branched alkane, a cyclic alkane, a polycyclic alkane, a heterocyclic alkane, an aromatic or heteroaromatic compound, which offer the advantage of being less flexible (i.e. more rigid). Suitably, the scaffold comprises a benzylic group. Exemplary preferred cores consist of or comprise a mono- or a polycyclic (hetero)aromatic structure. In one embodiment, the core consists of or comprises one or more 5- or 6-membered (hetero)aromatic ring structure(s), preferably selected from the group consisting of optionally substituted benzene, pyrimidine, triazoles, pyridine, indole, furan, thiophene, imidazole,and oxazole. In some cases, the core consists of one 5- or 6-membered(hetero)aromatic ring structure, preferably selected from the group consisting of optionally substituted benzene, pyrimidine, triazoles, pyridine, indole, furan, thiophene, imidazole, and oxazole. In a specific aspect, the synthetic bifunctional scaffold is selected from the group consisting of 1-4, preferably wherein the scaffold is 1, 2 or 4 (see Scheme 3). Cyclization Reaction conditions In a method as herein disclosed, the linear target peptide and synthetic bifunctional scaffold are contacted under conditions allowing for theformation of an imidazolidinone-fused cyclic peptide. Preferably, thereaction conditions (time / temperature / pH) ensure that (i) the electrophilic leaving group (LG) on the scaffold is highly selective for cysteine modification and (ii) the aliphatic aldehyde does not react excessively with other nucleophilic side chains (i.e. lysines). Moreover, it is preferred that the cyclization conditions are compatible with proteins and / or replicative genetic particles such as bacteriophages.This is readily achieved by reacting the polypeptide and the synthetic scaffold together at pH 6-9, preferably about pH 7-9, in an aqueous buffer (e.g. HEPES) which optionally comprises a suitable co-solvent to solubilize the scaffold. The reaction can proceed from around pH 6 but is most selective and fast at around pH 8. Hence, in one embodiment the invention provides a method for providing a cyclic peptide, or a peptide compound having a cyclic portion, wherein a linear peptide comprising an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys is reacted with a bifunctional synthetic scaffold in an aqueous buffer, preferably an aqueous buffer in the range of pH 6 to 9, more preferably pH 7 to 9. The aqueous buffer may comprise a suitable co-solvent to solubilize the scaffold. Preferably, the co-solvent is present in an amount of up to 30vol%, up to 25vol%, up to 20vol%, up to 15vol%, up to 10vol%, up to 8vol%, up to 5vol%. Exemplary ranges include 1-30 vol%, preferably 5-25 vol%, such as 5- 15vol%, 5-20vol%, 10-25vol%, 10-20vol%. Preferred co-solvents include acetonitrile, dimethyl sulfoxide, N,N- dimethylformamide, methanol, ethanol, or t-butanol. In one embodiment, the aqueous buffer comprises acetonitrile, preferably 5-30 vol% acetonitrile, more preferably 10-20 vol% acetonitrile. Optionally, a non-toxic reducing agent such as TCEP (tris(2-carboxyethyl)phosphine) is present in the reaction mixture to increase the yield by reducing any oxidized starting peptide. Other useful disulfide reducing agents include other phosphine- based reducing agents, which do not react rapidly with the LG. Thiol-based reducing agents, such as beta-mercaptoethanol (BME) or dithiothreitol (DTT) need to be removed before performing the cyclization reaction. In one aspect, the cyclization reaction conditions are compatible with the life cycle of bacteriophages. Phages are generally stable in mildly acidic to neutral conditions, with most doing best in a pH range between about 6.5 and 8.0. As is shown herein below, neither the addition of scaffold at pH 8 nor the use of co-solvent, in particular acetonitrile, had a significant impact on phage infectivity. In terms of salt concentrations, phages show high stability in environments that mimic physiological conditions. Sodium chloride concentrations between 50 and 150 mM are typical, and magnesium and calcium ions, often around 1 to 10 mM, are not only tolerated but can actually be required for proper phage adsorption to their bacterial hosts. Phages are generally not compatible with DMAP or similar organic bases at the concentrations typically used in chemical synthesis. Preferably, a method of the invention does not involve the use of hazardous (reducing) reagents such as sodium cyanoborohydride or an organic base such as DMAP. Typically, the reaction is allowed to proceed at room temperature. The reaction can be conducted for 1 to 72 hours. It was observed that overnight incubations are mostly sufficient for a quantitative conversion from a linear to a cyclic peptide. The molar ratio range of the target peptide to scaffold in a cyclization reaction can vary depending on specific circumstances. For example, cyclizations performed on synthetic peptides can proceed very well in a molar ratio of 1: 1.5-2, whereas for cyclization on proteins or bacteriophages the scaffold may be used in a much larger molar excess. In some embodiments, the concentration of the scaffold is at least about 100 μM, preferably in the range of 100 μM – 2 mM, and in excess of the target peptide concentration. Cyclized Peptides, complexes and libraries thereof The invention also provides an imidazolidinone-fused cyclic peptide structure or cyclized peptide obtainable by a method according to the invention. In one embodiment, the cyclic peptide structure or cyclized peptide comprises or consists of the formula: wherein is a linear alkane, a mono- or a polycyclic (hetero)aromatic core; indicates a peptide consisting of 2 to 15 amino acid residues Xaa ((Xaa)2-15), wherein Xaa is any natural or non-natural amino acid residue; and wherein R is the side-chain of any natural (genetically-encodable) amino acid, preferably the side-chain of Ala or Pro, more preferably wherein R is -CH3. A further embodiment relates to a replicative entity displaying an imidazolidinone-fused macrocyclic peptide as herein disclosed, which is characterized by a synthetic scaffold being attached to a polypeptide via the peptide’s Cys residue and via an imidazolidinone-moiety formed from the N- terminal amine and the amidic nitrogen of a Gly residue. Exemplary replicative entities include those conventionally used in display technologies that allow for selecting or screening cyclic peptide binders. These include bacteriophages, bacteria, yeast, mammalian cells, spores, viruses, ribosomes, and mRNA. Alternatively, they entity is a microbead. Such a replicative entity displaying an imidazolidinone-fused cyclic peptide is advantageously obtained by contacting a replicative entity comprising a polypeptide chain comprising an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys wherein Xaa is any natural or non- natural amino acid residue and n is 2 to 15; with a bifunctional synthetic scaffold as defined herein above, thereby attaching said scaffold to said polypeptide via the peptide’s Cys residue and an imidazolidinone-moiety. Preferably, the imidazolidinone-fused cyclic peptide is displayed on the surface of a replicative genetic particle, more preferably on the surface of a bacteriophage particle, a yeast cell or a bacterial particle. Suitably, the peptide is appended onto a bacteriophage-coat protein, for example phage gene 3 protein (g3p) or a functional fragment thereof. Therefore, in one embodiment the invention provides a complex comprising a replicative particle comprising(i) a polypeptide comprising an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys, wherein NH2indicates the N-terminus of the polypeptide, wherein Xaa is any natural or non- natural amino acid residue and n is 2 to 15; (ii) a nucleic acid encoding the polypeptide of (i); and (iii) a synthetic scaffold attached to said polypeptide via the peptide’s Cys residue and an imidazolidinone-moiety. Peptide library A target polypeptide of interest is suitably genetically encoded. This offers the advantage of enhanced diversity together with ease of handling. An example is a replicable genetic display package (rgdp) library such as a bacteriophage display library. Suitably, the polypeptides of interest are genetically encoded in a phage display library. Another example of a genetically encoded polypeptide library is an mRNA display library. In one aspect, the invention provides a (genetically encoded) polypeptide library comprising at least two complexes comprising a replicative particle, each complex comprising (i) a polypeptide comprising an amino acid sequence of the formula NH2- Xaa1-Gly-(Xaa)n-Cys, wherein NH2indicates the N-terminus of the polypeptide; Xaa is any natural or non-natural amino acid residue and n is 2 to 15; (ii) a nucleic acid encoding the polypeptide of (i); (iii) a synthetic scaffold attached to said polypeptide, and wherein the at least two complexes differ in the (Xaa)n amino acid sequence. Thus, suitably the complex of the invention comprises a replicable genetic display package (rgdp) such as a phage particle. In these embodiments, suitably the nucleic acid is comprised by the phage genome. In these embodiments, suitably the polypeptide is appended to the phage coat. In some embodiments, the invention may be used to produce a genetically encoded combinatorial library of polypeptides which are generated by translating a number of nucleic acids into corresponding polypeptides and cyclization of the polypeptides by reacting them with a bifunctional synthetic scaffold as herein disclosed. The genetically encoded combinatorial library of polypeptides may be generated by phage display, yeast display, ribosome display, bacterial display or mRNA display. It was surprisingly found that the head-to-side-chain cyclization strategy of the present invention (involving the bifunctional asymmetric scaffolds and the conditions employed during the cyclization) are compatible with the life cycle of bacteriophages. Suitably, the genetically encoded combinatoriallibrary of polypeptides is generated by phage display. In a specificembodiment, the invention provides a bacteriophage particle or bacteriophage library displaying an imidazolidinone-fused cyclic peptide as herein disclosed. In phage display embodiments, suitably the polypeptides are displayed on bacteriophages according to established techniques such as described below. Most suitably such display is accomplished by fusion of the target nucleic acid sequence of the polypeptide of interest to an engineered gene permitting the external display of the polypeptide of interest; suitably said engineered gene comprises an engineered gene 9 (p9 or gene IX), gene 8 (gene VIII), gene 7 (p7 or gene VII), gene 6 (p6 or gene VI) or gene 3 (p3 or gene III) of the phage. These proteins offer the advantage that they contain fewer or no cysteines that can react with scaffold compounds and thus avoid side product formation. For p6, it is advantageous to mutate cysteine 84 to serine. The cysteines in p7 and p9 are most likely buried and therefore may not necessarily need to be mutated to remove them. p8 offers the advantage that it does not contain a cysteine residue. An engineered version of p3, which does not feature any solvent-exposed cysteine has been created in prior state-of-the-art.

[0020] Thus, more suitably said engineered gene comprises an engineered gene 8 (gene VIII), gene 6 (gene VI) or gene 3 (gene III) of the phage. Preferably, phage display comprises the fusion of a target peptide of interest to an (optionally) engineered gene 3 protein. This fusion may be accomplished by any suitable technique known in the art such as by manipulation of the nucleic acid encoding the phage gene III protein to change the codons encoding cysteine to codon(s) encoding other amino acid(s), and by inserting a nucleic acid sequence encoding the target polypeptide into the gene III coding sequence in-frame, so that it is displayed as a gene III fusion protein on the outside of the bacteriophage particle. In a specific embodiment, the target peptide is appended to the N- terminus of the soluble D1D2-domains of a cysteine-free phage-coat protein III. For example, the library is a combinatorial library of random (e.g.3- 15mer, such as 8-mer, 10-mer, 12-mer, 13-mer) peptides. Suitably, the random peptides are fused to a phage coat protein, such as the minor coat protein (pIII) of the M13 phage. In a preferred embodiment, the genetically-encoded polypeptides of the invention are generated by translating a nucleic acid and linking the generated polypeptide to a replicative particle. The linkage of phenotype with the genotype allows propagating or decoding the encoded ligand repertoires. Techniques to link the polypeptide to its polynucleotide code are well known in the art. They include bacteriophage display, ribosome display, mRNA display, yeast display, bacterial display, and others. Encoded polypeptide repertoires comprising up to 1013individual members have been generated with said methods. The number of individual ligands that can be generated according to the invention outperforms clearly the number of individual molecules that are generally assayed in conventional screens. In a preferred embodiment, bacteriophage display is used to establish the phenotype-genotype link between a replicative particle and the genetically-encode polypeptides of the invention. Bacteriophage display is a method in which the gene of a polypeptide is fused to the gene of a phage coat protein. When bacteriophages are produced in a bacterial cell, the polypeptide is produced as a fusion of the coat protein. Upon assembly of a phage particle the polypeptide is displayed on the surface of the bacteriophage. By contacting a bacteriophage repertoire displaying different peptides with an immobilized antigen, some bacteriophages remain bound to the antigen while others are removed by washing. The binding bacteriophages can be eluted and propagated. The DNA encoding for the polypeptide of selected bacteriophages can be recovered and sequenced to identify the sequence of binding polypeptides. Bacteriophage display can be used to encode more than 1010individual polypeptides. A favorable aspect of bacteriophage display is that the gene-encoding, single-stranded DNA is packed in the bacteriophage coat and thus may protect the DNA from reaction with the bifunctional synthetic scaffolds. Preferably, a polypeptide library of the invention is displayed on phage as a gene 3 protein fusion. Each phage particle has about 3 to 5 copies of said phage coat protein. As a result of the display of multiple copies of the modified polypeptide, ligands with nanomolar affinities (strong binders) can be isolated in phage selections. Alternatively, phagemids are used to reduce the number of polypeptides per phage to avoid avidity effects and select ligands with higher affinities (low nanomolar affinities). Applications and Screening methods As will be appreciated by one skilled in the art, the present invention is advantageously used for the discovery of molecules that are useful in the fields of biology, biotechnology and pharmaceutical sciences. In particular, the present invention relates to methods for the generation of (peptide) drugs, drug leads, or biosensors. The invention therefore also relates to the use of MPs, complexes, libraries and / or synthetic scaffolds herein disclosed in drug discovery applications, for example in screening / selection methods or in commercial kits for performing such methods. For example, a complex of a replicative entity and a displayed cyclic peptide of the invention is suitably used in (peptide) drugdiscovery. As such, we envision a combinatorial approach where libraries ofMPs cyclized with diverse bifunctional scaffolds are interfaced with biological display platforms to achieve the bio-chemical fine-tuning of structures akin to how the evolutionary algorithm has yielded potent macrocyclic peptides that feature a diverse set of non-peptidic modifications. To access such natural-product-like MPs already in the discovery step should alleviate challenges encountered in the subsequent, extensive medicinal chemistry efforts that are currently required to improve the pharmacological properties of MPs and make them fit for clinical use. Hence, in one embodiment the invention provides a method for identifying a complex which is capable of binding to a (protein) target of interest, the method comprising (i) providing a complex as defined herein above; (ii) contacting said complex with the (protein) target of interest, and (iii) selecting those complexes which bind said (protein) target. This screening method suitably involves the use of a library of replicative entities, each displaying a distinct MP or cyclized peptide portion. Such a selection method may be conducted in any suitable format. Suitably, the (protein) target is immobilized. The complex is then contacted with the immobilized (protein) target and non-binding or weakly-binding complex(es) are then washed away. In this manner, those complexes which bind the immobilized (protein) target with the highest affinity are enriched or selected. In one embodiment, it is possible that the complexes may be recovered by release of the complex bound to the (protein) target i.e. releasing or eluting the complex-(protein-)target moiety. However, suitably the complexes are recovered by elution (separation) from the immobilized (protein) target. In this embodiment, the eluted complexes are no longer bound to the ligand after the elution step. In another aspect, the invention relates to a method as described above further comprising determining the sequence of the nucleic acid of said complex. In another aspect, the invention relates to a method as described above further comprising the step of manufacturing a quantity of the complex isolated as capable of binding to said (protein) target. In this embodiment the polypeptide-scaffold moiety may be advantageously synthesized in the absence of nucleic acid. The present invention provides further methods for contacting the genetically encoded compound libraries with a (protein) target and for identifying ligands binding to said (protein) target. The genetically encoded compound libraries are assayed by either screening or selection procedures. In a screening procedure, individual members of the library can be assayed. Multiple copies of an individual member of the library are for example incubated with a (protein) target. The (protein) target can be immobilized before or after contacting the members of the library and unbound members are removed by washing. Bound ligands are for example detected in an enzyme linked immunosorbent assay (ELISA). The target may be any type of molecule, such as a protein, a DNA, an RNA or a polysaccharide. The protein can be a receptor, an enzyme, a hormone, a cytokine or a viral protein. In a selection procedure, multiple members of the encoded compound library are typically contacted with a target. The target is immobilized before or after contacting the members of the library and unbound members are removed by washing steps. The genes encoding bound ligands are sequenced. Selected ligands are alternatively propagated to perform further selection rounds. In one embodiment of the invention, the compound libraries are encoded by bacteriophage display and selections are performed by biopanning. Kit-of-parts Also described herein are kits and systems for use in practicing the selection methods, where the kits typically include elements for making the (genetic) replicative particle displaying a cyclized peptide e.g., a bifunctional synthetic scaffold as herein disclosed, a construct comprising a vector that includes a restriction endonuclease site for custom insertion of candidate peptide sequences, means for ligand / target immobilization, and the like. In one embodiment, the invention provides a kit-of-parts comprising one or more bifunctional scaffolds as herein defined, that can be used to cyclize a linear phage-displayed peptides on phage. In one aspect, the kit comprises a bifunctional scaffold comprising a first functionality HC(O)–(CH2)x – and a second functionality – (CH2)y-LG, wherein x is 1 to 5, y is 1 to 5, preferably 1 to 3; LG is an electrophilic leaving group or a cysteine-reactive electrophile. For example, the kit comprises a scaffold wherein LG is an electrophilic leaving group. As another example, the kit comprises a scaffold wherein LG is a cysteine-reactive electrophile, preferably a vinyl, more preferably a maleimide. In some cases, the kit comprises a bifunctional scaffold wherein the second functionality comprises – NH-C(O)-(CH2)x-LG, preferably – NH-C(O)-CH2- Br. In one aspect, the kit comprises a bifunctional scaffold of the general formula wherein is a linear alkane, a mono- or a polycyclic (hetero)aromatic core, preferably wherein the mono- or polycyclic (hetero)aromatic core consists of or comprises one or more 5- or 6-membered (hetero)aromatic ring structure(s), preferably selected from an optionally substituted benzene, pyrimidine, triazoles, pyridine, indole, furan, thiophene, imidazole, or oxazole. In one embodiment, the invention provides a kit comprising a scaffold of the formula HC(O)-(CH2)z-LG wherein z is 1 to 6, preferably 1 to 5, more preferably 1 to 3. In a specific aspect, a kit comprises a bifunctional scaffold selected from the group consisting of scaffolds 1-4, preferably scaffolds 1-3, depicted by the following structures Alternatively or additionally, the kit may comprise a (ready to use) phage library displaying linear peptides comprising an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys, wherein NH2 indicates the N-terminus of the peptide; Xaa is any natural or non-natural amino acid residue and n is 2 to 15. For example, the library is a combinatorial library of random (e.g. 5-15mer, such as 5-12mer, 5-10mer, 5-8mer) linear peptides, which are optionally fused to a minor coat protein (pIII) of the M13 phage. In one embodiment, the kit comprises a phage display library of linear peptides fused to an engineered gene 9, gene 8, gene 7, gene 6 or gene 3 of a bacteriophage. For example, the linear peptides may be fused to the N- terminus of the soluble D1D2-domains of a cysteine-free phage-coat protein III (pIII). The kit may furthermore contain reagents to perform biopanning with target ligands e.g. using 96-well microtiter plates or similar solid phases. Other optional kit components include an instruction manual, magnetic or agarose beads for target immobilization, a glycerol stock of an E. coli strain capable of producing phages, such as TG1, sequencing primer for validation of selected clones (e.g. in an amount sufficient for 50-100 sequencing reactions), phage selection buffer, elution buffer and neutralization buffer. The kit may comprise an (aqueous) reaction buffer to dissolve both scaffold and phage displayed linear peptide library allowing for the formation of a cyclic peptide complex displayed on the phage. In one aspect, the invention provides a phage display peptide library kit comprising a phage library, protein reagents for a control reaction and sequencing primer stocks. The peptide may be followed by a short spacer (e.g. Gly-Gly-Gly-Ser) and then the (engineered) pIII sequence. The library may consist of approximately 109members obtained by electroporation of suitable E. coli strains to yield approximately 100 copies of each sequence in 10 µl of the supplied bacteriophages. The kit components are typically present in a suitable storage medium, e.g., buffered solution, typically in a suitable container. In addition to the above components, the kit may further include instructions for practicing the methods described herein. These instructions may be present in the kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc. Yet another means would be a computer readable medium, e.g., diskette, CD, etc., on which the information has been recorded. Yet another means that may be present is a website address which may be used via the internet to access the information at a website. Any convenient means may be present in the kits. LEGEND TO THE FIGURES Figure 1. A one-pot, head-to-side-chain peptide cyclization strategy gives rise to a model MP with high selectivity. A: Schematic representation of the proposed two-step, head-to-side-chain cyclization strategy. Cyclic peptides are obtained via (1) the alkylation of a unique cysteine residue and the subsequent intramolecular trapping of a transiently formed iminium ion by the amidic nitrogen of the second amino acid (glycine). B: Reaction conditions and representative examples of UPLC-MS chromatograms of synthetic peptide AG-M4 (left) and the crude reaction mixture that was obtained following the modification and cyclization with aliphatic aldehyde- containing scaffold 1. UV absorbance spectra at 280 nm are depicted with masses found for the highlighted, major species inserted. Figure 2. HMBC analysis confirms the imidazolidinone connectivity of the produced cyclic peptide. The coupling signals between the highlighted carbon signals at ~70 ppm and ~177 ppm allow the full characterization of the imidazolidinone motif. Carbon spectra correspond to DEPT (top) and C13 (bottom) measurements. Figure 3. Only peptide with a glycine residue in the second position cyclized with the aliphatic-aldehyde containing scaffold (1) gives quantitative conversion to the imidazolidinone-fused MP. UPLC-MS UV chromatograms of crude peptides H2N-AGNEKHYCWA (AGR5) and H2N- AVNEKHYCWA (AVR5) reacted with 1 and 4-(bromomethyl)benzaldehyde at the start of the reaction (t0) and after 18 h (t1). Reactions were subsequently acidified, split and incubated for 2 days at low pH (pH 2 or pH 5.5) in buffer or in the presence of 50 mM NaBH3CN (red.). Four possible peptide species are identified for each reaction: linear starting peptide (—), linear peptide modified on cysteine with the scaffold (∆), imidazolidinone- fused cyclic peptide (○), and reduced secondary amine-fused cyclic peptide (□). Figure 4. One-pot head-to-side-chain cyclization proceeds with diverse peptides and bifunctional scaffold 1. UPLC-MS chromatograms of crude reaction mixtures obtained for AGR2-AGR8 following cyclization with scaffolds 1 and subsequent acidification to pH 5.5 for 18 h. All formed MPs were stable except for AGR7 and AGR3 which partly reverted back to the open form (-). UV chromatograms (280 nm) are depicted with masses found for the major species inserted. Figure 5. One-pot head-to-side-chain cyclization proceeds with diverse peptides and bifunctional scaffolds 2-4. UPLC-MS chromatograms of crude reaction mixtures obtained for AGR2-AGR8 following cyclization with scaffolds 2-4 and subsequent acidification to pH 5.5 for 18 h. All formed MPs were stable except for AGR7 and AGR3 which partly reverted back to the open form (-). UV chromatograms (280 nm) are depicted with masses found for the major species inserted. Figure 6. Serum stability of an imidazolidinone-fused MP is better than its linear counterpart. Aliquots of the peptides incubated in serum or PBS buffer at 37°C were taken at different time points, worked-up and analyzed by HPLC. Fraction of intact peptide was calculated at each time point using the ratio with acetaminophen as internal standard. Half-life times in serum were determined to be 9 min. for linear AGR5 and 348 min. for cyclic AGR5. Figure 7. Head-to-side chain cyclization of peptides appended onto a phage- coat protein. a: Schematic representation of the soluble D1D2-domain of the fd bacteriophage. In this work a peptide featuring a unique cysteine residue followed by the recognition site for the TEV protease was installed. Figure 8. Phage compatibility with bi-functional cyclization scaffolds 1-3. Phage titers measured as colony forming units (CFUs) when subjecting bacteriophages produced from E. coli TG1 cells to the one-pot cyclization reaction. Using scaffold 1 (100 μM) with various concentrations of acetonitrile as co-solvent (a) or scaffolds 2-3 in increasing concentration (with 10 vol% ACN). It was observed that the bifunctional cyclization scaffolds (up to 100 μM) and acetonitrile (at least up to 20 vol%) have a negligible effect on the life-cycle of bacteriophages and give rise to comparable phage titers as those obtained after phage isolation and TCEP reduction in buffer prior to addition of scaffolds. EXPERIMENTAL SECTION Chemicals were used without further purification unless otherwise noted. All chemicals used in organic synthesis were purchased from SigmaAldrich,FluoroChem, or TCI Europe. ChemMatrix® Rink amide resin waspurchased from SigmaAldrich. Solid-phase reaction vessels (syringes with filter) were purchased from Torviq. Fmoc-protected amino acids, trifluoro acetic acid (TFA) and OxymaPure® were purchased from ChemImpex Inc. Solvents for solid phase peptide synthesis (dichloromethane (DCM), dimethylformamide (DMF), and piperidine) were purchased from Biosolve. Analytical thin‐layer chromatography was carried out on pre‐coated silica gel on aluminum sheets (Merck TLC Silica gel 60 / Kieselguhr F254), columns were performed using silica‐P flash silica gel from Silicycle (0.040‐ 0.063 mm 230400 mesh).1H-NMR and13C-NMR spectra were recorded on a Bruker 400 MHz in CDCl3or DMSO-d6.1D and 2D NMR spectra of peptides were performed in DMSO-d6 or mixtures of DMSO-d6 with CD3CN and recorded on a Bruker 600 MHz spectrometer. Spectra were recorded either at 25 ℃ or at 16 ℃. HSQC, TOCSY, and NOESY (600 ms mixing time) spectra were performed. Analytical UPLC-MS analysis was performed on an Acquity UPLC system (Waters) coupled to a quadrupole / time-of-flight (QToF) mass spectrometer (Waters) equipped with a PDA detector. The peptides were separated on a Xbridge HSS T3 C18; 150 × 2.1 mm, 1.7 μm (Waters) column operated at 40°C. The eluent system employed was a combination of A (0.1% formic acid in water) and B (0.1% formic acid in acetonitrile) at a flow rate of 0.3 mL / min. For general analysis, the gradient varied linearly from 5 to 75% B (v / v) from 1.7-9 min., 60 to 95% B from 9-9.5 min., kept at 95% B from 9.5- 10.5 min., returning to 5% B in 1.5 min., re-equilibration to 5% B from 12-15 min. For separation of diastereomers, the gradient varied linearly from 5 to 45% B (v / v) from 2-33 min., 45 to 95% B from 33-34 min., kept at 95% B from 34-35 min., returning to 5% B in 1 min., re-equilibration to 5% B from 36-40 min. Protein samples were separated on an Acquity BEH C4; 150 × 2.1 mm, 1.7 μm (Waters) column operated at 40°C. The gradient varied linearly from 15 to 70% B (v / v) from 2-9 min., 70 to 95% B from 9-10 min., kept at 95% B from 10-11.5 min., returning to 15% B in 1 min., re- equilibration to 15% B from 12-15 min. The sample injection volume was 3 μL. Mass spectra were obtained in the ESI-positive ion mode over a mass range between 500 to 1,500 Da at resolution >20,000 FWHM. Peptide samples were diluted to 200 μM and protein samples were diluted to 10 μM prior to analysis. Obtained charge density spectra were deconvoluted using the MagTran software.[1]Reverse‐phase HPLC was performed on a Shimadzu HPLC system equipped with LC‐20AD solvent chromatographs, a DGU‐20A3 degasser unit, a SIL‐20A autosampler, an SPD‐M20A PDA detector, a CTO‐ 20A column oven operating at 40 °C, a CBM‐20A system controller and a FRC‐10A fraction collector. Preparative HPLC was performed using a Luna® Omega PS C18 prep column (21.2 x 250 mm, particle size 5 μm), using a flow of 20 mL / min. Eluents used were 0.1 % FA in ACN (solvent A) and 0.1 % FA in ddH2O (solvent B), using a gradient of 5% A to 30% A (5-15 min.) to 95% A (15-16 min.) remaining at 95% A (16-18 min.), returning to 5% A (18-20 min.) and re-equilibrating for 5 min. at 5% A (total runtime 25 minutes). Peptides were dissolved in 70 / 30 DMSO / 0.1% FA MQ and up to 1200 μL was injected per purification run. Plasmid pET21b(+), bearing the ampicillin resistance gene was purchased from Novagen®. Escherichia coli strain NEB10-beta (New England Biolabs) was used for cloning and Primers were synthesized by Eurofins MWG Operon (Germany). Plasmid and PCR Purification Kits were obtained from QIAGEN (Germany) and DNA sequencing carried out by Eurofins (Germany). Phusion polymerase, T4 ligase, and NdeI and XhoI were purchased from New England Biolabs. Ni-NTA resin (Ni SepharoseTM 6 Fast Flow) from GE Healthcare Life Sciences (Germany). Concentrations of DNA and protein solutions were determined based on the absorption at 260 nm or 280 nm on a Thermo Scientific Nanodrop 2000 UV-Vis spectrophotometer. Theoretical molecular weights of proteins were calculated using the Expasy ProtParam tool (http: / / web.expasy.org. / protparam / ). Cellular density (OD600) was measured on an Ultrospec 10 Cell Density Meter (Biochrom). E. coli TG1 cells (Agilent) were used for working with bacteriophages. Phage vectors fdg3p0ss21 and fd0D1D2’ were kindly provided by Prof. Christian Heinis (LPPT group, EPFL Lausanne), with permission from Prof. F.X. Schmid. Buffers and solutions: PEG / NaCl: 20% PEG-6000 (w / v), 2.5 M NaCl (Sigma Aldrich) stored at 4 °C; reaction buffer: 20 mM HEPES, 5 mM EDTA, pH 8.0; reduction buffer: 50 mM MES, pH 6 (pH adjusted with NaOH and HCl; the buffers were degassed by applying a vacuum and stirring with a magnet for 3 h prior to use). Reagents: tris(2- carboxyethyl)phosphine (TCEP), 20 mM stock in H2O (stored at 4 °C for up to 1 month, aliquots at -20 °C for up to 2 years); bifunctional scaffold, 50 mM stock in acetonitrile (prepared fresh).1. Chemical synthesis: S1: Compound S1 was synthesized by adapting a previously described procedure.[2]4-Aminophenethyl alcohol (1.00 g, 7.29 mmol), TBDMS-Cl (1.10 g, 7.29 mmol), and imidazole (993 mg, 14.6 mmol), were dissolved in anhydrous DMF (10 mL) and subsequently stirred for 1 h at room temperature. Next, water (40 mL) was added and the product extracted with EtOAc (3 x 80 mL). The combined organic layers were washed with saturated NaHCO3 (aq.), water, and brine, and dried over MgSO4. The solvent was evaporated and the residue purified by silica column chromatography (20-30% EtOAc in heptane) to obtain TBDMS ether S1 as a pale-yellow oil (1.47 g, 80% yield).1H-NMR (400 MHz, DMSO-d6) δ 6.84 (d, J = 8.2 Hz, 2H), 6.47 (d, J = 8.3 Hz, 2H), 4.82 (s, 2H), 3.65 (t, J = 7.1 Hz, 2H), 2.55 (t, J = 7.1 Hz, 2H), 0.84 (s, 9H), -0.04 (s, 6H).13C-NMR (101 MHz, DMSO-d6) δ 146.71, 129.36, 125.63, 113.80, 64.46, 38.23, 25.83, 17.96, -5.36. HRMS (ESI-TOF) m / z 252.1779 (252.1778 calc. for C14H25NOSi, [M+H]+). S2: Based on a procedure by Toshima et al.[2], 2,6-Lutidine (1.25 mL, 10.74 mmol) and bromoacetyl bromide (0.62 mL, 7.56 mmol) were added dropwise to TBDMS protected 4-Aminophenethyl alcohol (compound S1, 1g, 3.98 mmol) in dry DCM (15 mL) under N2 atmosphere at 4 °C. After stirring for 1 h, the reaction was quenched with 1 M aqueous HCl (10 mL). DCM was removed by rotary evaporation, and MeOH (20 mL) was added. The reaction was stirred for 30 minutes to allow for the complete removal of the TBDMS protecting group. Excess MeOH was removed under vacuum and the resulting water phase was extracted with EtOAc (3 x 50 mL). Combined organic phases were washed with water and brine. The organic phase was dried over MgSO4and solvent was subsequently removed under vacuum. The remaining solid was washed with ice-cold DCM (3 x 3 mL). This crude product was purified by silica column chromatography (20-50% EtOAc / heptane) to yield bromo acetamide S2 as orange solid (883 mg, 88% yield).1H-NMR (400 MHz, DMSO-d6) δ 10.29 (s, 1H), 7.47 (d, J = 8.5 Hz, 2H), 7.16 (d, J = 8.4 Hz, 2H), 4.61 (s, 1H), 4.01 (s, 2H), 3.56 (t, J = 6.6 Hz, 2H), 2.67 (t, J = 7.1 Hz, 2H).13C-NMR (101 MHz, DMSO-d6) δ 164.54, 136.52, 135.06, 129.20, 119.15, 62.18, 38.46, 30.45. HRMS (ESI-TOF) m / z 258.0126 and 260.0102 (258.0124 and 260.0104 calc. for C10H12BrNO2, [M+H]+). 1: Aliphatic aldehyde-containing bi-functional scaffold 1 was obtained by adapting literature procedures.[3]Dess-Martin periodinane (903 mg, 2.13 mmol) was added to a solution of bromo-acetamide compound S2 (500 mg, 1.94 mmol) in acetonitrile (10 mL) and DCM (10 mL) under N2atmosphere at room temperature. The resulting solution was stirred for one hour. The formed precipitate was filtered and washed with acetonitrile. The filtrate was then concentrated and purified by silica column chromatography without further work-up (15-60% EtOAc in heptane). Due to insufficient purity, another column was run (2-4% MeOH in DCM) to give 1 as yellowsolid (136 mg, 27% yield). 1H-NMR (400 MHz, DMSO-d6) δ 10.38 (s, 1H),9.66 (t, J = 1.9 Hz, 1H), 7.56 (d, J = 8.5 Hz, 2H), 7.20 (d, J = 8.5 Hz, 2H), 4.03 (s, 2H), 3.72 (d, J = 1.9 Hz, 2H).13C-NMR (101 MHz, DMSO-d6) δ 200.50, 164.74, 137.44, 130.16, 128.14, 119.44, 48.97, 30.40. HRMS (ESI- TOF) m / z 255.9968 and 256.9946 (255.9968 and 257.9947 calc. for C10H10BrNO2, [M+H]+). S3: For the synthesis of TBDMS-protected thymidine S3 a similar procedure was followed as for compound S1.3′-Azido-3′-deoxythymidine (980 mg, 3.67 mmol) was dissolved in dry DMF (8 mL). To this solution was added imidazole (998 mg, 14.7 mmol) and TBDMS-Cl (829 mg, 5.50 mmol). The reaction was stirred until TLC indicated completion (2 h). It was decided to perform the next substitution without further purification. S4: To the solution of crude S3 in dry DMF, bromoacetaldehyde diethyl acetal (1.12 mL, 7.32 mmol) and potassium carbonate (1.01 g, 7.34 mmol) were added. No product had formed after 1 h, and it was decided to add cesium carbonate (3 g, 9.21 mmol). When still no product had formed after another 2 h, it was decided to add another equivalent of the diethyl acetal and potassium iodide (183 mg, 1.10 mmol) and 18-Crown-6 (194 mg, 0.734 mmol) as catalysts. After 2 h a very faint spot became visible on TLC. It was decided to add another 1.5 equivalents of the diethyl acetal and another equivalent of cesium carbonate and heat the reaction to 40 °C overnight. The next day, TLC indicated the formation of a new product, but still starting material remaining. Another 0.5 equivalent of cesium carbonate was added and the reaction was heated to 50 °C for another 3 days. The faint spot had become pronounced on TLC by the third day. Some starting material still remained but it was decided to work-up the reaction. Water was added (70 mL) and extracted with EtOAc (3 x 80 mL). Combined organic phases were washed with 50 mL water + 2 mL brine and once with 50 mL brine. Crude reaction product (5.77 g) was purified by column chromatography (0-1% MeOH in DCM). Pure S4 was obtained as transparent oil (824 mg, 45% yield over 2 steps).1H-NMR (400 MHz, DMSO-d6) δ 7.54 (d, J = 1.2 Hz, 1H), 6.12 (t, J = 6.4 Hz, 1H), 4.76 (t, J = 5.7 Hz, 1H), 4.45 – 4.35 (m, 1H), 3.89 (dd, J = 11.8, 4.7 Hz, 3H), 3.85 – 3.75 (m, 2H), 3.61 (dq, J = 9.7, 7.0 Hz, 2H), 3.46 – 3.35 (m, 2H), 2.36 (td, J = 6.4, 3.1 Hz, 2H), 1.83 (d, J = 1.2 Hz, 3H), 1.03 (t, J = 7.0 Hz, 6H), 0.88 (s, 9H), 0.08 (d, J = 1.9 Hz, 6H).13C-NMR (101 MHz, DMSO-d6) δ 162.55, 150.38, 134.59, 108.60, 98.22, 84.59, 83.61, 62.54, 61.54, 61.43, 60.16, 36.27, 25.76, 18.01, 15.18, 12.87, -5.48. HRMS (ESI-TOF) m / z 520.2554 (520.2562 calc. for C22H39N5O6SiNa+, [M+Na]+). S5: Propargyl bromo-acetamide was prepared as described for S2 and was isolated as light brown solid (1.54 g, 97% yield) by running a silica plug with DCM.1H-NMR (400 MHz, Chloroform-d) δ 6.66 (s, 1H), 4.09 (dd, J = 5.3, 2.6 Hz, 2H), 3.90 (s, 2H), 2.28 (t, J = 2.6 Hz, 1H).13C-NMR (101 MHz, Chloroform-d) δ 165.22, 78.63, 72.40, 30.11, 28.82. HRMS (ESI-TOF) m / z 175.9705 and 177.9685 (175.9705 and 177.9685 calc. for C5H6BrNO, [M+H]+). S6: Thymidine S4 (100 mg, 0.201 mmol) and alkyne S5 (70.7 mg, 0.402 mmol) were dissolved in DCM (1.5 mL). Copper sulfate (10 mg, 0.040 mmol) and sodium ascorbate (16 mg, 0.080 mmol) were added in water (total 0.8 mL). Ethanol (3 mL) was added and the reaction was heated to 45 °C overnight. The product was purified by column chromatography (0-5% MeOH in DCM) to yield the thymidine scaffold S6 as transparent oil that solidified in the fridge (135 mg, 100%).1H-NMR (400 MHz, DMSO-d6) δ 8.80 (t, J = 5.6 Hz, 1H), 8.16 (s, 1H), 7.66 (s, 1H), 6.42 (t, J = 6.5 Hz, 1H), 5.35 (dt, J = 8.5, 5.6 Hz, 1H), 4.78 (t, J = 5.7 Hz, 1H), 4.35 (d, J = 5.6 Hz, 2H), 4.32 – 4.26 (m, 1H), 3.92 (d, J = 5.9 Hz, 2H), 3.91 – 3.83 (m, 3H), 3.80 (dd, J = 11.5, 3.9 Hz, 1H), 3.68 – 3.57 (m, 2H), 3.45 – 3.37 (m, 2H), 2.78 (dt, J = 13.1, 6.5 Hz, 1H), 2.63 (ddd, J = 14.3, 9.0, 6.5 Hz, 1H), 1.88 (s, 3H), 1.04 (t, J = 7.0 Hz, 6H), 0.86 (s, 9H), 0.05 (s, 6H).13C-NMR (151 MHz, DMSO-d6) δ 165.94, 162.59, 150.42, 144.46, 134.81, 122.65, 108.70, 98.25, 85.13, 83.97, 62.61, 61.58, 61.47, 59.20, 54.92, 42.26, 37.33, 34.67, 29.30, 25.75, 17.98, 15.20, 12.88, -5.49. HRMS (ESI-TOF) m / z 673.2370 and 675.2351 (673.2375 and 675.2355 calc. for C27H45BrN6O7Si, [M+H]+). 2: Protected thymidine S6 was dissolved in 2M HCl in a mixture of water:acetonitrile:D2O (4:5:1) and stirred overnight. The next day, crude1H- NMR analysis showed quantitative formation of EtOH and thus successful acetal deprotection. TBDMS deprotection was harder to pinpoint by NMR due to the comparable shifts for TBDMS-OR and TBDMS-OH. The crude deprotected thymidine-based scaffold was used in peptide cyclization reactions directly without further isolation. UPLC-MS analysis of the peptide products confirmed also correct deprotection of the TBDMS group. 3: Bromo acetaldehyde, scaffold 3, was synthesized according to literature procedures with minor adaptations [REF Li Markus 2010]. To a solution of bromoacetaldehyde diethyl acetal (1.00 g, 5.07 mmol) in DCM (15 mL) was added TFA (3.90 mL, 50.7 mmol). The reaction was stirred for 6 h at room temperature. Water (10 mL) was added and the reaction was extracted another 2 times with DCM (2 x 15 mL). The combined organic layers were washed with brine and dried over MgSO4. Solvent was evaporated as much as possible on the rotovap while keeping the pressure >650 mmHg. NMR analysis was performed which showed quantitative formation of product. In addition, it demonstrated that not all DCM could be removed in this way and likely product was already lost during evaporation as well. Upon storage in the freezer under argon the product proved to not be stable. For peptide cyclization reactions, it was therefore decided to employ the deprotection conditions of scaffold 2 and to then use the obtained scaffold 1 directly without further purification.1H-NMR (400 MHz, DMSO-d6) δ 9.43 (td, J = 1.8, 0.7 Hz, 1H), 4.28 (dd, J = 1.8, 0.7 Hz, 2H).13C-NMR (101 MHz, DMSO-d6) δ 193.46, 37.08. S7: Maleimide S7 was prepared by adapting a procedure of Cocuzza (1989) [REF].4-Aminophenethyl alcohol (655 mg, 4.78 mmol) was dissolved in DMF (8 mL) and 3-(Maleimido)propionic acid NHS ester (1.11 g, 4.15 mmol) was added. The reaction was heated to 50 °C overnight. The next day, water was added (20 mL) and the reaction was extracted with EtOAc (3 x 40 mL). Combined organic layers were washed with brine, dried over Na2SO4 and the solvent was evaporated under vacuum. The product was purified by silica column chromatography (60-100% EtOAc in Heptane) to give S7 as white solid (766 mg, 64% yield).1H-NMR (400 MHz, DMSO-d6) δ 9.89 (s, 1H), 7.41 (d, J = 8.2 Hz, 2H), 7.11 (d, J = 8.2 Hz, 2H), 7.02 (s, 2H), 4.59 (t, J = 5.1 Hz, 1H), 3.70 (t, J = 7.1 Hz, 2H), 3.55 (q, J = 6.7 Hz, 2H), 2.65 (t, J = 7.1 Hz, 2H), 2.55 (t, J = 7.1 Hz, 2H).13C-NMR (101 MHz, DMSO-d6) δ 217.70, 170.77, 168.23, 136.89, 134.59, 128.95, 119.21, 62.24, 38.46, 35.01, 33.93. 4: Maleimide bi-functional scaffold 4 was synthesized following the procedure for scaffold 1. The product was purified by silica column chromatography (50-80% EtOAc in Heptane) to obtain 4 as white solid (250 mg, 84% yield).1H-NMR (400 MHz, DMSO-d6) δ 9.98 (s, 1H), 9.65 (t, J = 2.0 Hz, 1H), 7.50 (d, J = 8.5 Hz, 2H), 7.15 (d, J = 8.5 Hz, 2H), 7.02 (s, 2H), 3.75 – 3.67 (m, 4H), 2.57 (t, J = 7.1 Hz, 2H).13C-NMR (101 MHz, DMSO-d6) δ 200.51, 170.77, 168.44, 137.84, 134.59, 129.92, 127.39, 119.48, 48.98, 35.04, 33.89. HRMS (ESI-TOF) m / z 309.0845 (309.0846 calc. for C15H14N2O4Na+, [M+Na]+). S8: Coniferyl aldehyde (121 mg, 0.679 mmol) and NaHCO3 (84 mg, 2.83 mmol) in dry DCM (2.5 mL) were cooled to 0 °C on wet ice. Bromo-acetyl bromide (0.089 mL, 1.02 mmol) was dissolved in 1 mL of dry DCM and this solution was added dropwise to the reaction, followed by the dropwise addition of 2,6-Lutidine (0.236 mL, 2.04 mmol). After 15 min. of stirring on ice, another equivalent of bromoacetyl bromide (0.059 mL, 0.679 mmol) was added dropwise in 1 mL of dry DCM. The reaction was stirred for 15 min. at 0 °C, after which the ice bath was removed and the reaction was allowed to warm to room temperature and stir for 30 min. Without further work-up, the crude product was dry loaded using celite and purified by silica column chromatography (0-3% MeOH in DCM). Bi-functional scaffold S8 was obtained as dark green oil (87 mg, 43% yield).1H-NMR (600 MHz, Chloroform-d) δ 9.71 (d, J = 7.6 Hz, 1H), 7.45 (d, J = 16.0 Hz, 1H), 7.22 – 7.15 (m, 2H), 7.14 (d, J = 8.2 Hz, 1H), 6.68 (dd, J = 15.9, 7.6 Hz, 1H), 4.10 (s, 2H), 3.89 (s, 3H).13C-NMR (151 MHz, Chloroform-d) δ 193.68, 165.15, 151.86, 151.55, 141.84, 133.58, 129.11, 123.22, 121.97, 111.69, 56.23, 25.14. UPLC-MS 298.990 & 300.952 (calc 298.9919 & 301.0075 for C12H11BrO4H+).2. Solid phase peptide synthesisLoading of Rink amide resin (coupling of Fmoc-Ala-OH: Rink amide (resin loading = 0.4-0.6 mmol / g, 0.6 mmol / g was used as 1 eq.) was swollen in dry DMF for 1 h and the resin subsequently washed with DCM (3 x 10 mL) and DMF (3 x 10 mL). Fmoc-Ala-OH (4.5 eq.) was pre-activated in DMF (final concentration 0.3 M) upon the addition of OxymaPure® (5 eq.) and DIC (10 eq.). The pre-activated alanine was transferred to the resin, and the mixture was agitated (bubbling by N2stream) for 2 hours. After that, the mixture was drained and a new batch of pre-activated Fmoc-Ala-OH was added. The resulting mixture was agitated for 3 hours, before the resin was drained and washed with DMF (3 x 10 mL), DCM (3 x 10 mL), and DMF (5 x 10 mL). All remaining, unreacted amine groups were capped by adding a solution of acetic anhydride / pyridine (3:2) to the resin. After agitating the mixture for 30 minutes, the resin was washed with DMF (4 x 10 mL), DCM (2 x 10 mL), DMF (3 x 10 mL), and DCM (5 x 10 mL). The resin was then dried under vacuum and stored at -20 °C until further use. A small sample (~5 mg) of the dried resin was removed to determine the loading efficiency. For this, the resin was first swollen for 30 minutes in 800 μL of DMF, after which 200 μL of piperidine was added. The mixture was vortexed to ensure good mixing and left in a tabletop shaker (room temperature, 300 rpm) for 15 min. The sample was taken from the shaker and an aliquot of the supernatant (100 μL) was diluted to 10 mL with 20% piperidine in DMF and the concentration of the piperidine-fulvene adduct (λ = 301 nm, ε = 7800 M cm−1) was determined using a spectrophotometer. The loading of the resin was determined using the following formula L = A301 / (78 x M) with L being the resin loading, A301the absorbance at 301 nm, and M the weight of the sample. The loadings obtained ranged from 0.30-0.36 mmol / g.Iterative peptide synthesis: Peptides were typically synthesized on a0.05-0.1 mmol scale. After an initial washing step (3 x 5 mL DMF) peptides were assembled following a cycle of deprotection and coupling steps.Deprotection: The resin was treated with 20% piperidine / DMF (6 mL, 1 x2 min., 2 x 8 min.) and washed with DMF (3 x 6 mL), DCM (2 x 6 mL), and DMF (3 x 6 mL). An aliquot at the end of every deprotection was taken and the absorption at 301 nm measured on the NanoDrop™ to ensure complete deprotection. Following the deprotection of the N-terminal amino acid, the resin was washed with DMF (2 x 6 mL) and DCM (5 x 6 mL) and subsequently dried under vacuum. Coupling: Fmoc-protected amino acid (3 eq.) was pre-activated for 2 minutes in DMF (final concentration 0.5 M) following the addition of OxymaPure® (3 eq.) and DIC (6 eq.). The solution was transferred to the resin and the resulting mixture was agitated (bubbling N2 through the syringe) for 90 minutes at room temperature. Subsequently, the resin was drained and washed with DMF (5 x 6 mL).Cleavage and peptide isolation: A cleavage cocktail containingTFA / TIS / EDT / water (90:3:5:2 v / v / v / v, 10 mL) was added to the dried resin and incubated at room temperature for 4 hours. Subsequently, the resulting mixture was filtered, the filtrate was collected and the resin washed with TFA (2 x 3 mL). By blowing a constant stream of N2 over the solution the filtrate was concentrated to ~0.5 mL. Peptides were then precipitated by the addition of ice-cold diethyl-ether (35 mL) and subsequently pelleted by centrifugation (3,000 rpm). The supernatant was carefully removed by decantation and the precipitate washed twice with ice-cold ether (20 mL) to remove organic impurities. Residual ether was removed by blowing a constant stream of N2over the sample and the residue subsequently dissolved in 0.1% TFA (aq.) and freeze-dried. Peptides obtained from this procedure were used without any further purification in cyclization experiments. AG-R2: AGWKCA (22 mg) AG-R3: AGRNWCA (28 mg) AG-R4: AGNKDWCA (35 mg) AG-M4: AGSSGGCWA (90 mg) AV-M4: AVSSGGCWA (75 mg) AGR5: AGNEKHYCWA (120 mg) AVR5: AVNEKHYCWA (131 mg) AG-R6: AGHWRENSCA (38 mg) PG-R6: PGHWRENSCA (27 mg) AG-R7: AGEKQVWSHCA (52 mg) AG-R8: AGVKNWEYSRCA (60 mg) were obtained as white solids following lyophilization with a total average crude yield of 65%. Resin was split by eye at different coupling steps for further individual synthesis of the peptides. No reliable individual yields can be given.3. Peptide cyclization reactionsDeprotection of acetal-protected scaffolds to obtain cyclization handles 2 and 3: Protected Thymidine S6 (4.3 mg, 6.41 μmol) or bromoacetaldehyde diethyl acetal (46 mg, 233 μmol) were dissolved in 1 mL 2M HCl in 50 / 50 acetonitrile / water. The reactions were left to stir at room temperature overnight. Next, a fraction of the S6 reaction (694 μL) was basified with 2M NaOH (aq.) to pH 8, resulting in a dilution to 3.08 mM 3 in 25% acetonitrile in water. In parallel, 100 μL of the solution containing deprotected 2 was basified and subsequently diluted to 10 mM in 75% acetonitrile in water. Cyclization reactions of model peptides with cyclization moieties 1- 4: Crude lyophilized peptide (12.5 μL of a 20 mM stock solution in 0.1% TFA), ddH2O (up to 0.5 mL total volume), acetonitrile (up to 20% final volume), TCEP (37.5 μL of a 4 mM stock in ddH2O), and bifunctional scaffold 1, 2 or 4 (50 μL of 10 mM stock solution in acetonitrile) or scaffold 3 (162 μL of 3.08 mM stock solution in 25% acetonitrile) were added sequentially to HEPES buffer (250 μL, 200 mM, pH 8). The resulting solutions were incubated at 20 °C without stirring for 8 hours or until UPLC-MS analysis indicated >95% conversion to the modified peptide. Cyclization for full 1D and 2D-NMR spectroscopy characterization of purified peptides: Crude, lyophilized peptide AGR5 or AG-M4 (1 eq., 12-15 mg, ±8 μmol), 2.36 mL acetonitrile, cyclization unit 1 (1.05 eq., 8.4 μmol) 0.84 mL of a 10 mM stock solution in acetonitrile, and ddH2O (up to 16 mL total volume) were added to HEPES buffer (8 mL, 100 mM, pH 8). The resulting solutions were incubated at 20 °C overnight. UPLC-MS analysis indicated full conversion to the cyclic peptide product and the reaction mixtures were lyophilized. The resulting, crude cyclic peptides were then purified by HPLC-prep and lyophilized. Purified cyclic peptides were dissolved in 200 μL DMSO-d6 and transferred to a Shigemi NMR tube for measurement.4. Molecular BiologyThe gene encoding for the fusion protein pep-TEV-D1D2 was obtained via the following two steps: (1) construction of AGSSGGC-D1D2 and its insertion into pET21b(+); and (2) insertion of the TEV cleavage site to obtain AGSSGGC-TEV-D1D2. Construction of pET21b(+)-D1D2 and pET21b(+)-AGSSGGC-D1D2: The gene encoding for the disulfide-free D1D2 domains as well as AGSSGGC-D1D2 were amplified from fdg3p0ss21[5]using the primers NdeI_D1D2_fw or NdeI_pep_D1D2_fw and XhoI_D1D2_rv (see Table 1), which also installed appropriate restriction enzyme sites for restriction digest using the following PCR protocol: (1) initial denaturation 98 ˚C for 1 min, (2) 30 cycles of denaturation at 98 ˚C for 10 s, annealing at 54 ˚C for 30 s and extension at 72 ˚C for 30 s; (3) a final extension at 72 ˚C for 10 min.Table 1: PCR Primer ListName Sequence 5’ ^ 3’XhoI_D1D2 GTGGTGCTCGAGAGCATTGACAGGAGGTTGAGG _rv NdeI_D1D2 GGAATTCCATATGGCTGAAACTGTTGAAAGT _fw NdeI_pept- GGAATTCCATATGGCTGGTAGCAGTGGCGGTTGCGCTGAAAC D1D2_fw TGTTGAAAGTAG TEV_fw1 AAGTGGCGAGCCCGATCTTEV_fw2 GAAAACCTGTACTTCCAGTCGGCTGAAACTGTTGAAAGTAGTTTAGC TEV_rv1 CGACTGGAAGTACAGGTTTTCGCAACCGCCACTGCTACCTEV_rv2 GTGGTGCTCGAGAGCATTGACSuccessful amplification as well as the size of the PCR products was verified by agarose gel (1%). The remaining template was removed by DpnI digestion at 37 ˚C for 16 hours. Following PCR purification, the resulting constructs were cloned into pET21b(+) following standard restriction enzyme cloning procedures (NdeI and XhoI). Ligation mixtures were transformed into chemically-competed E. coli NEB10β cells and successful transformants identified after overnight incubation on selective LB agar plates containing ampicillin. Single colonies were picked and the identity of the inserts confirmed by Sanger sequencing to give the plasmids pET21b(+)- D1D2 and pET21b(+)-AGSSGGC-D1D2. Construction of pET21b(+)-AGSSGGC-TEV-D1D2: The TEV cleavage site in the AGSSGGC-D1D2 gene was installed by overlap extension PCR combining fragments obtained following PCR amplification of pET21b(+)- AGSSGGC-D1D2 with the primer pairs TEV_fw1 / rv1 and TEV_fw2 / rv2 (see Table 1). The two fragments were joined using TEV_fw1 and TEV_rv2 using the following touchdown PCR protocol: (1) initial denaturation 98 ˚C for 2 min, (2) 16 cycles of denaturation at 98 ˚C for 10 s, annealing at 64-56 ˚C for 30 s and extension at 72 ˚C for 30 s; (3) 14 cycles of denaturation at 98 ˚C for 10 s, annealing at 56 ˚C for 30 s and extension at 72 ˚C for 30 s; (4) final extension at 72 ˚C for 5 min. The resulting construct AGSSGGC-TEV-D1D2 was inserted into pET21b(+) and transformed into chemically-competent E.coli NEB10β cells as described before. The identity of the insert in the resulting pET21b(+)AGSSGGC-TEV-D1D2 was confirmed by sequencing. Protein production and purification: Flasks containing 500 mL LB- medium with 100 μg / mL ampicillin were inoculated with 2.5 mL of a densely grown overnight culture of E. coli BL21(DE3) cells harboring plasmids pET21b(+)-D1D2 or pET21b(+)-AGSSGGC-TEV-D1D2. Cells were incubated at 37 °C while shaking (135 rpm) until an OD600 of 0.4 – 0.6 was reached (approx.4 h). At this stage, gene expression was induced by addition of isopropyl β-D-1-thiogalactopyranoside (IPTG, final concentration 1 mM) and incubation was continued for 16 hours at 30 °C. Cells were harvested by centrifugation (6,000 rpm, JLA10.500 Beckman, 20 min, 4 °C) and the supernatant discarded. The cell pellet was resuspended in 20 mL washing buffer (50 mM NaH2PO4, 150 mM NaCl, pH 7.5) containing 1 mg / mL egg white lysozyme and a tablet of protease inhibitor cocktail (cOmpleteTMMini, Roche). Cell suspension was subsequently lysed by sonication (70% (200 W) for 10 min, 15 sec on, 10 sec off). The lysed cells were centrifuged to remove cell debris (12,000 rpm, JA-17.5, 60 min., 4 °C), the cleared lysate was purified by Ni-NTA chromatography (GE Healthcare) according to the supplier’s specifications. His-tagged D1D2 variants were eluted with elution buffer (50 mM NaH2PO4, 150 mM NaCl, 250 mM imidazole, pH 7.5). Protein containing fractions, as judged by SDS-PAGE, were pooled and concentrated using filtration tubes with a cut-off of 15 kDa (4,000 rpm, JLA-17.5, 60 min, 4 °C). Phosphate buffer (50 mM NaH2PO4, 150 mM NaCl, pH 7.5) was repeatedly added to remove the imidazole. Protein aliquots (±1 mL) were stored at 4 °C or -20 °C until further use. Concentrations were determined by measuring the absorbance at 280 nm on a NanoDrop 2000 (Thermoscientific) spectrophotometer with calculated extinction coefficients (49,850 M-1cm-1for D1D2 and TEV-D1D2). Yields were 137 mg for D1D2 and 35 mg AGSSGGC-TEV-D1D2, per liter culture. Protein cyclization & TEV cleavage Cyclization of AGSSGGC-TEV-D1D2 with cyclization moieties 1-3: TCEP (18.8 μL from a 4 mM stock in ddH2O), and ddH2O (80.3 μL) was added to 52 μL of a solution containing D1D2 or AGSSGGC-TEV-D1D2 (116 μM stock solution in 50 mM NaH2PO4, 150 mM NaCl, pH 7.5). The resulting reaction was incubated at 30 °C for 30 min to allow for reduction of any disulfides formed during protein production. The sample buffer was exchanged to HEPES buffered saline (50 mM HEPES, 1.5 mM Na2HPO4, 140 mM NaCl, pH 8) using PD SpinTrap G-25 (Cytiva, 0.6 mL of Sephadex™ G-25 resin). At this point an aliquot of the sample was removed for UPLC-MS analysis. Next, cyclization units 1-3 (30 μL from a 3 mM stock solution in acetonitrile) were added to 150 μL of a solution containing reduced protein samples. After 1 h at r.t., UPLC-MS analysis confirmed complete modification for AGSSGGC-TEV-D1D2, after which the modified proteins were eluted over a new PD SpinTrap G-25 column to remove residual linker. The reactions with scaffold 1 and 2 were incubated overnight at 8 °C. The reaction with scaffold 3 was incubated for 3 days at 8 °C. UPLC-MS analysis was performed to determine the conversion to cyclized pep-TEV-D1D2. TEV cleavage of AGSSGGC-TEV-D1D2 after cyclization: Protein samples were desalted into 50 mM HEPES, 0.5 mM EDTA, pH 8. TEV protease (1 μL, NEB) was added to 50 μL of cyclized protein sample obtained from the procedure described above. The reaction mixture was incubated at 30 °C for 3 h before an additional 1 μL aliquot of TEV protease was added. The resulting reaction mixtures were incubated at 4 °C overnight and subjected to UPLC-MS analysis the next day.5. Phage production and infectivity studiesProduction of fd_A(X)6C-D1D2 phages: Flasks containing 500 mL 2xYT- medium with 30 μg / mL chloramphenicol were inoculated to an OD6000.1 with 0.5 mL of 25% glycerol E. coli TG1 cells harboring the fd_A(X)6C-D1D2 plasmids and incubated overnight at 30 °C at 135 rpm. The cultures were subsequently centrifuged (6,000 rpm, JLA10.500 Beckman, 20 min, 4 °C) and the phage-containing supernatant was decanted to new centrifuges bottles. A solution of ice-cold PEG-NaCl solution (125 mL, 20% PEG-6000 (w / v), 2.5 M NaCl) was added to the supernatant, inverting the tube a few times to ensure proper mixing, and the resulting mixture incubated on ice for 30 min. Precipitated phages were pelleted by centrifugation (16,800 x g, JLA-9.1000 Beckman, 50 min, 4 °C). The supernatant was carefully decanted and the centrifuge bottle placed upside down on a filter paper for 2 min to remove all residual liquid. The phage pellet was then resuspended in 10 mL degassed reaction buffer (20 mM HEPES containing 5 mM EDTA at pH 8.0) and the mixture was transferred into a 50 mL Greiner tube. Remaining cell / phage debris was removed by centrifugation (4000 rpm, Eppendorf A-4-62, 15 min, 4 °C) and the supernatant carefully transferred into a new 50 mL Greiner tube. TCEP (final concentration 1 mM) was added to the PEG-purified phages and the resulting reaction mixture was incubated at 42 °C for 1 h. TCEP was removed by addition of 2.5 mL PEG / NaCl and incubation on ice for 20 min to precipitate the phages. Next, phages were pelleted by centrifugation (4000 rpm, Eppendorf A-4-62, 15 min, 4 °C). TCEP-containing supernatant was discarded and the phages were redissolved in 5 mL reaction buffer. At this point a ‘TCEP reduction’ aliquot was taken and stored at 4 °C for infectivity studies (see below). Acetonitrile tolerance of phages: A total of 15 mL of TCEP-reduced phages were obtained by starting with 3 x 500 mL cultures and following the protocol above. Three samples were prepared, each containing 4 mL of TCEP reduced phages, 0.25 / 0.5 / 1 mL of acetonitrile, and reaction buffer (up to 5 mL total volume). The phages were kept in the fridge at 8 °C for 3 days and 50 μL aliquots were taken for infectivity studies. Cyclization on phages with scaffold 1: Bifunctional scaffold 1 (0.5 mL of 1 mM stock solution in acetonitrile) was added to 4.5 mL of the phage sample obtained after TCEP reduction and the resulting reaction mixture was incubated at 30 °C for 1 h. Phages were precipitated by addition of 1.5 mL of PEG / NaCl and incubation on wet ice for 20 min. Next, they were pelleted by centrifugation (4000 rpm, Eppendorf A-4-62, 15 min, 4 °C), the supernatant was discarded, and the phage pellet was re-dissolved in reaction buffer and stored in the fridge at 8 °C for 3 days. Cyclization on phages with scaffolds 2-3: From the 5 mL TCEP sample, 7 samples of 1 mL total volume were prepared containing each 325 μL TCEP-reduced phages, bifunctional scaffold 2 or 3 up to 0 / 100 / 250 / 500 μM final concentration (0-0.5 mL of 1 mM stock solutions in 20% acetonitrile in reaction buffer), acetonitrile (up to 10% final volume), and reaction buffer (175-675 μL). The resulting reaction mixtures were incubated at 30 °C for 1 h. Phages were precipitated by addition of 250 μL PEG / NaCl and incubation on wet ice for 15 min. They were pelleted using a tabletop centrifuge (12,100 x g, Eppendorf F-45-12-11, 10 min.) and redissolved in 1 mL reaction buffer. At this point, a 50 μL ‘scaffold-modification’ aliquot was taken of each of the 6 samples that were modified with various scaffold concentrations and one ‘control’ 50 μL aliquot was taken of the no scaffold buffer sample. All aliquots were stored at 4 °C for infectivity studies. Infectivity studies: Stored 50 µL aliquots of the ‘TCEP reduced’, ‘scaffold modified’, ‘acetonitrile’, and ‘no scaffold control’ samples were used to determine the phage infectivity after different handling steps. For each sample, seven 10-fold dilutions in 2xYT were prepared. Aliquots (20 µL) of samples corresponding to 10-4, 10-5, 10-6, and 10-7dilutions were added to 180 µL of E. coli TG1 cells growing in the mid-log phase (OD600~0.4). Phages in the samples were allowed to infect cells at 37 °C at 135 rpm. for 90 min. An aliquot (50 µL) of each dilution was then plated onto 2xYT / chloramphenicol agar plates and incubated overnight at 37 °C. The next day, colonies on the plates were counted and the number of infectious phages was calculated by adjusting for the corresponding dilution factors.6. Peptide stability studiesSerum stability experiment: 1 mL of PBS buffer and 1 mL of PBS buffer containing 200 µL of human serum (20% v / v) were transferred to Eppendorf tubes and put at 37 °C for 15 minutes. Next, the samples were split and to each sample was added 10 µL of either linear AGR5 or purified AGR5 cyclized with scaffold 1 (from 10 mM stock in DMSO-d6). At regular intervals, 50 µL of the reaction mixture was taken and quenched by addition of 200 µL ACN and 100 µL EtOH. The aliquot was shaken vigorously and put on wet ice for 10 min. Next, the suspension was centrifuged (9000 x g, Eppendorf F-45-12-11, 4 min.) and 300 µL of the supernatant was transferred to an Eppendorf containing the acetaminophen internal standard (60 µL of 1.5 mg / mL in DMSO). The samples were concentrated under vacuum using the Concentrator plus (Eppendorf, 40 min., 45 °C HV). Concentrated samples (±80 µL) were mixed well and potential peptide that had collected on the Eppendorf walls was redissolved by re-pipetting the solution over the wall multiple times. Samples were analysed using HPLC (20 µL injection volume) employing a linear gradient of 5 – 95% B (solvent A: 0.1% (v / v) FA in H2O, solvent B: 0.1% (v / v) FA in ACN) over 22 min., at a flow rate of 1 mL / min. Fraction of intact peptide was calculated using the ratio between the peak areas of the intact peptide and the internal standard acetaminophen and comparing them with PBS control samples at t0. *All handling steps involving human serum were performed next to the flame or in a flow cabinet. Fitting of serum stability data: From the peak ratio’s obtained in the serum stability experiment, fraction of intact peptide was calculated as compared to PBS t0. Next, the serum stability data was plotted with GraphPad Prism 10.1.0 and fitted to the equation: Y= Bottom + (Top-Bottom) / (1+((Top-Bottom) / (Fifty-Bottom)- 1)*(Fraction50 / X)^HillSlope) Setting the following constraints: Bottom = 0 and Top = 1. For both the serum stability data of AGR5 linear, as well as AGR5 cyclic, proper fits could be obtained (R squared of 0.995 and 0.987 respectively). Cyclization for HSQC 2D-NMR spectroscopy studies of crude peptides: Crude, lyophilized AG-R4 (1 eq., 3 mg, 3.1 μmol), 1.30 mL acetonitrile for 2 or 1 mL acetonitrile for 3, deprotected scaffold 2 (1 eq., 3.1 μmol) 13.3 μL from 233 mM stock or 3 (1 eq., 3.1 μmol) 1.01 mL of a 3.08 mM stock solution (253 μL acetonitrile and 758 μL water), and ddH2O (up to 6.2 mL) were added to NaPi buffer (3.1 mL, 100 mM, pH 8). The resulting solutions were incubated at 20 °C overnight. UPLC-MS analysis indicated full conversion to the cyclic peptide product and the reaction mixtures were lyophilized. The resulting, crude cyclic peptides were then dissolved in 400 μL DMSO-d6. The resulting suspensions were sonicated for 10 min. and heated to 40 °C to dissolve as much of the peptides as possible. The suspensions were then filtered over cotton in a Pasteur pipette and the filtrate was transferred to NMR tubes for measurement. Example 1: One-pot head-to-side-chain peptide cyclization method This example provides proof-of-concept for the one-pot head-to-side-chain peptide cyclization method of the invention using an exemplary model peptide with a glycine residue at the second position (H2N-AGSSGGCWA-CONH2, AG-M4) and aliphatic-aldehyde-containing bifunctional scaffold 1.The peptide also featured a flexible sequence between the N-terminal alanine and the unique cysteine residue, as well as a tryptophan residue to allow for accurate quantification (Fig.1A). AG-M4 was prepared by solid phase peptide synthesis, while bifunctional scaffold 1 was obtained in three steps from 4-aminophenethyl alcohol adapting previously reported procedures. Crude lyophilized AG-M4 (12.5 μL of a 20 mM stock solution in 0.1% TFA), ddH2O (up to 0.5 mL total volume), acetonitrile (up to 20% final volume), TCEP (37.5 μL of a 4 mM stock in ddH2O), and bifunctional scaffold 1 (50 μL of 10 mM stock solution in acetonitrile) were added sequentially to HEPES buffer (250 μL, 200 mM, pH 8). The resulting solutions were incubated at 20 °C without stirring and the reaction progress was followed by UPLC-MS. We observed quantitative conversion of the starting peptide to a product that corresponds in mass to the imidazolidinone-fused cyclic peptide within 7 hours (Fig.1A). Analyzing the crude reaction on a flatter gradient in the UPLC, revealed the main peak to be an equal mixture of two products with the same mass (data not shown). This observation is consistent with the imidazolidinone formation giving rise to two diastereomers upon cyclization. To confirm the nature and connectivity of the resulting products, we purified the peptides by preparative HPLC and recorded 1D and 2D NMR spectra (Figure 2). Toward this end, crude, lyophilized AG-M4 (1 eq., 12 mg, ~8 μmol), 2.36 mL acetonitrile, bifunctional scaffold 1 (1.05 eq., 8.4 μmol) 0.84 mL of a 10 mM stock solution in acetonitrile, and ddH2O (up to 16 mL total volume) were added to HEPES buffer (8 mL, 100 mM, pH 8). The resulting solution were incubated at 20 °C overnight. UPLC-MS analysis indicated full conversion to the presumed imidazolidinone product and the reaction mixtures were lyophilized. The resulting, crude cyclic peptide were then purified by preparative HPLC and lyophilized. Purified cyclic peptides were dissolved in 200 μL DMSO-d6 and transferred to a Shigemi NMR tube for measurement. Sequential walking using NOESY and TOCSY spectra allowed to assign and confirm the order of the amino acids. Notably, the NH proton of the Gly2 amide was absent for both isolated diastereomers. In addition, NOE signals observed between the linker and the rest of the peptide strongly suggested a cyclic topology. Specifically, we observed NOEs between protons belonging to the linker and cysteine, the side chains of amino acids in the center of the peptide, and—importantly—with protons of the N-terminal alanine and glycine in position 2. We further noticed in the1H-NMR the splitting of methylene groups belonging to the benzylic protons of the scaffold, the α- protons of Gly2, and the β-protons of cysteine. These observations are consistent with the formation of a cyclic product, which will increase the rigidity in the overall structure. As an initial analysis by mass spectrometry did not allow to distinguish between a theoretical imine-, enamine-, or imidazolidinone-fused cyclic peptide, we elucidated the nature of the cyclization by DEPT, HSQC and HMBC analyses. Notably, no characteristic signals for an enamine or imine species could be observed in these measurements, while the HMBC was able to pinpoint the imidazolidinone- fused connectivity. Specifically, the isolated carbon shift at ~70 ppm, which is characteristic for imidazolidinones, couples both with one of the benzylic protons of the linker as well as with one of the Gly2 HCα protons (Figure 2). Combined, these experiments exclude the formation of imine or enamine linkages and attest on the formation of MPs following the selective, intramolecular trapping of a transiently-formed iminium ion by the amidic nitrogen of Gly2.Example 2: Structural prerequisites for the formation of stableimidazolidinone-fused cyclic peptides. To demonstrate the relevance of a glycine residue in second position and the role of the aliphatic aldehyde on the scaffold, two additional model peptides were synthesized (H2N-AGNEKHYCWA-CONH2, ‘AGR5’; and H2N- AVNEKHYCWA-CONH2, ‘AVR5’) by solid phase peptide synthesis. While these peptides differ in their second amino acid residue (Gly in AGR5 and Val in AVR5, respectively), both feature a diverse range of functional groups in their amino-acid side chains. We purposefully chose to include a lysine residue to probe for potentially competing reactions of the ε- amine with the N-terminal amine. To investigate the difference in reactivity between an aromatic and aliphatic aldehyde on the bifunctional scaffold, cyclization of AGR5 and AVR5 was performed as described in Example 1 using either scaffold 1 of the invention or the previously disclosed scaffold 4-(bromomethyl)benzaldehyde comprising an aromatic aldehyde. Finally, to evaluate the stability of the formed product(s) after 18 hours, reaction mixtures were either acidified (pH=2 or 5.5) or provided with an external nucleophile (NaBH3CN, 50 mM, pH=5.5) to trap iminium-ion-intermediates. While all four peptides were quantitively modified with the respective linkers, they showed markedly different outcomes with respect to the formation cyclized product. After 18 h (t1) for AGR5 cyclized with 4- (bromomethyl)benzaldehyde the imidazolidinone-fused MPs are the major products (Fig.3, circle symbol: ○). No starting peptide was left (symbol: —) but there is still cysteine-modified linear peptide remaining (∆). For AVR5 cyclized with the aromatic-aldehyde linker, the cysteine-modified linear peptide is the main product at t1 (∆), although some cyclized product can also be observed (○). For AGR5 cyclized with 1, the cyclization does go to completion to the imidazolidinone-fused MP in 18 h (t1) with limited side- product formation. On the other hand, AVR5 cyclized with 1 led to a complex mixture of products. Cyclized peptide is formed (○), but also some cysteine-modified linear peptide remained (∆). When placed in acidic conditions (pH 5.5), we observe partial reversibility to the linear-modified form (∆) for AGR5 cyclized with the aromatic-aldehyde linker and complete reversibility for AVR5 cyclized with the same linker. These results are consistent with the fact that upon addition of an excess of NaBH3CN, AGR5 could be partially reduced to form a MP featuring an amine linkage (symbol: □) while AVR5 completely underwent this reductive amination. The fact that imidazolidinone-fused MPs formed with a valine in second position are readily reversible under these conditions is further attested by our recent report[8]and a study from the Derda group.

[0021] Strikingly, the imidazolidinone-fused MP between AGR5 + 1 persisted for multiple days at pH 2 and could not be trapped by reduction using NaBH3CN at pH 5.5, indicating that the imidazolidinone formation is essentially irreversible. Again, the results obtained for AGR5 + 1 are a stark contrast with the results for AVR5 + 1, which gave rise to a complex mixture of products at lower pH, with the addition of NaBH3CN yielding some amine-linked MP can (□, Figure 3). Combined, these results confirm the increased reactivity of the aliphatic aldehyde when compared to the aromatic aldehyde. However, despite the increased reactivity of 1 giving a complex mixture of products for AVR5, the cyclization reaction with AGR5 remains highly selective for the desired imidazolidinone-fused MP. The absence of appreciable levels of side product formation for AGR5 furthermore suggests compatibility of the reaction withdiverse amino acid side chains, including the ε-amine of lysines. The glycineresidue in position two of the peptide is essential for steering the reaction toward the imidazolidinone-fused cyclic product, which requires the correct orientation of the amidic nitrogen for attack. We surmise that the required conformation is visited more frequently in the reaction of AGR5 with 1, due to both the aliphatic aldehyde and the glycine residue displaying increased flexibility. Lastly, the formation of the imidazolidinone is thermodynamically favored and (essentially) irreversible as the formed cyclic peptide is stable at low pH and under reducing conditions. Overall, these results highlight that both the aliphatic aldehyde of the scaffold and the polypeptide featuring a glycine in the second position are prerequisites for the efficient and selective formation of stable imidazolidinone-fused MPs.Example 3: Generality of the one-pot cyclization strategy:To demonstrate the generality of the novel peptide cyclization strategy as herein disclosed, six additional model peptides were prepared by solid-phase peptide synthesis, wherein the number of residues between the N-terminal AG and the unique cysteine residue ((Xaa)n)varied between 2-8 (AGR2-AGR8, see also Figure 4).AGR2: H2N-AGWKCA AGR3: H2N-AGRNWCA AGR4: H2N-AGNKDWCA AGR5: H2N-AGNEKHYCWA AGR6: H2N-AGHWRENSCA AGR7: H2N-AGEKQVWSHCA AGR8: H2N-AGVKNWEYSRCA By yielding a range of ring sizes upon cyclization with 1 (22- up to 40- membered rings), we aimed to probe how ring strain influences a peptide’s ability to orient into the appropriate reactive conformation. In addition, the potential for cross-reactivity of side chains in the different steps of the reaction was assessed by incorporating a wide variety of amino acid residues, including lysine residues that feature potentially-competing amines in their side-chains. Cyclization reactions were performed in presence of scaffold 1 under analogous conditions as those employed in Example 1. UPLC-MS analyses after 18 hours confirmed efficient macrocyclization for all model peptides with limited formation of side-products. The difference in polarity between the two diastereomers—as indicated by their separation on UPLC—was dependent on the nature and sequence of the peptides (Figure 4). Next, the stability of the cyclized peptides was investigated by acidifying the samples (pH 5.5) and attempting their reduction with NaBH3CN (50 mM, pH 5.5). While all macrocyclic peptides proved stable under acidic conditions (Figure 4), those featuring smaller ring sizes (AGR2-4) underwent partial reduction upon treatment with NaBH3CN, indicative of an increased ring strain resulting in somewhat reduced stability (data not shown). Lastly, to confirm the formation of imidazolidinone-fused MPs over a wide range of ring sizes, we performed 1D and 2D NMR analyses of cyclic products resulting from treatment of AGR2, AGR5 and AGR8 with 1. The imidazolidinone motif could be assigned for all peptides based on the characteristic13C shift of the imidazolidinone carbon at 70 ppm (data not shown). Due to the large polarity difference between the two diastereomers of AGR2 upon cyclization with 1, we decided to purify them by preparative HPLC to further verify their structure. Both diastereomers could be fully characterized and were confirmed to indeed correspond to imidazolidinone- fused MPs (data not shown). Our main motivation for developing widely-applicable cyclization strategies lies in our desire to access MPs that feature structurally and chemically diverse asymmetric synthetic scaffolds. To demonstrate the diversification potential of our one-pot strategy, we synthesized three additional bi- functional scaffolds (2-4, Figure 5). Thymidine scaffold 2 features a thymidine nucleobase and, thus represents a large and complex cyclization unit that can provide additional binding interactions with future targets. Conversely, bromoacetaldehyde (scaffold 3) is the smallest possible bifunctional lynchpin, which leaves a limited “chemical scar” upon peptide cyclization. Lastly, we also synthesized maleimide-containing scaffold 4 to showcase that the cyclization strategy can also be interfaced with well- established maleimide chemistry. Cyclization reactions between AGR2-AGR8 and bifunctional scaffolds 2-3 efficiently yielded the expected MPs for all possible combinations (Figure 5), with both AGR7 and AGR8 appearing to give slightly more side products. The maleimide-containing scaffold 4 also yielded the expected cyclic products, but gave more diastereomers due to the formation of another chiral center upon thio-Michael addition. Comparing the results obtained for bifunctional scaffolds 2 and 3 provided some notable insights. Consistent with the increased steric demand of 2, cyclization reactions proceeded significantly slower when compared to those performed in presence of the small lynchpin 3. Specifically, the thymidine scaffold required up to 72 hours to obtain full conversion while cyclizations with bromoacetaldehyde were completed within 5 hours. To confirm the formation of the imidazolidinone-fused MPs for cyclization reactions with 2 and 3, crude cyclization reactions with peptide AGR4 were subjected to 1D and13C- HSQC NMR analyses. Gratifyingly, for both scaffold 2 and 3, the characteristic shift for the imidazolidinone carbon at ~70 ppm was readily identified (data not shown). Notably, MPs formed by the addition of 2 or 3 proved also stable, as for the vast majority of combinations the addition of a large excess of NaBH3CN did not change the product distribution (data not shown). For the thymidine scaffold (2), only for AGR8 the formation of a new, unidentified product was observed under reducing conditions. For MPs formed between the bromoacetaldehyde scaffold (3) and AGR7 and AGR8, we either observed partial opening to the free aldehyde (AGR7) or partial reduction of the cyclic species (AGR8). Together, these results showcase the generality of the novel strategy for the cyclization of synthetic peptides of different sizes with a diverse series of bifunctional cyclization units. The one-pot reaction tolerates presence of various amino acid side chains and yields macrocyclic peptide products that are generally stable. Example 4: Stability studies of imidazolidinone-fused macrocyclic peptides. To be able to fulfill their function as therapeutics, imidazolidinone-fused MPs must not only be able to potently and selectively bind a target of interest, but also ought to be stable during uptake and systemic distribution. One parameter that serves as an initial indicator for the latter criteria is serum and / or plasma stability. Due to the slightly higher proteolytic activity of proteases in serum compared to plasma, we chose to investigate the stability of H2N-AGNEKHYCWA-CONH2(AGR5) both in its linear form and following cyclization with 1 in serum and phosphate- buffered saline (PBS, Figure 6). As expected, while unmodified AGR5 remained fully intact in PBS, it rapidly degraded in serum, displaying a half-life time of only ~9 minutes. In stark contrast, cyclic AGR5 had a substantially increased half-life of ~6 hours (348 minutes) in serum and was not degraded in PBS over the course of the experiment. These results, thus, clearly demonstrate the superior proteolytic stability of cyclic peptides over their linear counterparts and attest that the imidazolidinone motif is neither readily recognized by proteases nor undergoes rapid modification through enzymes present in the serum.Example 5: Cyclization of peptides appended to a phage-coatprotein. For the generation of a genetically-encoded MP library, the cyclization strategy must maintain the high selectivity observed with model peptides for larger and more complex systems (e.g. proteins or bacteriophages). To mimic cyclization reactions with 1-3 performed on the surface of bacteriophages, we appended the linear model peptide H2N-AGSSGGC, to the N-terminus of the outermost phage-coat protein D1D2 (Figure 7). In our initial design, we also included the recognition site for the Tobacco Etch Virus (TEV) protease between the appended peptide and the D1D2 domains. Doing so should allow us to selectively cleave off and unambiguously assign the imidazolidine-fused MP by proteolysis (see Materials and Methods section for details). The resulting AGpep-TEV-D1D2 was produced in Escherichia Coli, purified by Ni2+-affinity chromatography (yield ~35 mg / L) and its identity confirmed by UPLC-MS (Figure 7). Upon addition of the bi-functional scaffold 1 (0.5 mM) to purified AGpep- TEV-D1D2 (80 μM) at pH 8, the protein was singly modified over the course of 1 h at 20 °C (Figure 7). Excess 1 was removed by size exclusion and the reaction was incubated at 8 °C for 18 h, yielding a protein species that corresponds in mass to the desired imidazolidinone-fused MP formed between AGpep and 1. Notably, the parent D1D2 protein lacking the appended peptide did not show any appreciable levels of modification underotherwise identical conditions (data not shown). To further verify that thecyclization occurred selectively via the N-terminal amine of the peptide, we performed proteolysis of the formed product by addition of TEV protease to the crude reaction mixture and analyzed the cleavage products by UPLC- MS (Figure 7). In the UV-chromatogram we noticed the appearance of two small peaks which corresponded in mass to the two expected diastereomers of the imidazolidinone-fused MP. The only other species that eluted from the column was the cleaved-off protein. Notably, comparable results were obtained when using bifunctional cyclization units 2 and 3, which all yielded cleaved MPs upon TEV protease treatment from the crude cyclization reactions (Figure 7). Combined, these findings demonstrate that our one-pot cyclization strategy is applicable to complex biomolecules and efficiently and selectively yields an imidazolidinone-fused MP on a peptide displayed on the protein domain used in bacteriophage display.Example 6: Phage compatibility of head-to-side-chain cyclizationstrategy. For the head-to-side-chain cyclization strategy to be applicable in the discovery of new lead compounds by bacteriophage display, bi-functional scaffolds must be compatible with the life cycle of bacterio-phages. To assess phage-compatibility of exemplary scaffolds 1-3, we inserted AGpep-D1D2 into the fd bacteriophage genome and produced virions following established protocols. With the appropriate bacteriophages in hand, we measured the infectivity of phage particles (=phage titers in colony forming units (CFUs)) throughout all steps necessary for peptide cyclization. Gratifyingly, at 30 °C neither the addition of 1 (100 μM) at pH 8 for 1 hour nor the use of up to 20% of acetonitrile as co-solvent had a significant impact on infectivity levels (Figure 8). Furthermore, the addition of bifunctional scaffolds 2-3, also was well tolerated for concentrations up to 100 μM (Figure 8). For thymidine scaffold 2, the concentration could even be increased to 500 μM before a slight (2-fold) drop in infectivity became apparent. Combined, these results attest to the phage compatibility of the cyclization chemistry here described and augur well for application of this cyclization reaction in bacteriophage display. References [1] Vinogradov, A. A.; Yin, Y.; Suga, H. Macrocyclic Peptides as Drug Candidates: Recent Progress and Remaining Challenges. J. Am. Chem. Soc. 2019, 141, 4167–4181. [2] Zorzi, A.; Deyle, K.; Heinis, C. Cyclic Peptide Therapeutics: Past, Present and Future. Curr. Opin. Chem. Biol. 2017, 38, 24–29.[3] Sohrabi C., Foster A. & Tavassoli A.. Methods for generating and screening libraries of genetically encoded cyclic peptides in drug discovery, Nat. Rev. Chem.2020, 4, 90-101. [4] Hampton, J. T.; Liu, W. R. Diversification of Phage-Displayed Peptide Libraries with Noncanonical Amino Acid Mutagenesis and Chemical Modification. Chem. Rev. 2024 https: / / doi.org / 10.1021 / acs.chemrev.4c00004[5] O'Neil, K. T.; Hoess, R. H.; Jackson, S. A.; Ramachandran, N. S.; Mousa, S. A.; DeGrado, W. F., Identification of novel peptide antagonists for GPIIb / IIIa from a conformationally constrained phage peptide library. Proteins 1992, 14,509-15. [6] Wang, X. S.; Chen, P. C.; Hampton, J. T.; Tharp, J. M.; Reed, C. A.; Das, S. K.; Wang, D. S.; Hayatshahi, H. S.; Shen, Y.; Liu, J.; Liu, W. R., A Genetically Encoded, Phage-Displayed Cyclic-Peptide Library. Angew. Chem. Int. Ed. 2019, 58, 15904-15909.[7] Heinis, C.; Winter, G., Encoded libraries of chemically modified peptides. Curr. Opin. Chem. Biol. 2015, 26, 89-98[8] Oppewal, T.R.; Jansen, I.D.; Hekelaar; J.; Mayer C., A Strategy to Select Macrocyclic Peptides Featuring Asymmetric Molecular Scaffolds as Cyclization Units by Phage Display. J. Am. Chem. Soc. 2022, 144, 3644–3652.[9] Iskandar, S. E.; Bowers, A. A. MRNA Display Reaches for the Clinic with New PCSK9 Inhibitor. ACS Med. Chem. Lett. 2022, 13, 1379–1383.

[0010] Zheng, X.; Li, Z.; Gao, W.; Xiaoting Meng; Meng, X.; Li, X.; Luk, L. Y. P.; Zhao, Y.; Tsai, Y.-H.; Wu, C. Condensation of 2- ((Alkylthio)(Aryl)Methylene)Malononitrile with 1,2-Aminothiol as a Novel Bioorthogonal Reaction for Site-Specific Protein Modification and Peptide Cyclization. J. Am. Chem. Soc. 2020, 142, 5097–5103

[0011] Nitsche, C.; Onagi, H.; Quek, J.-P.; Otting, G.; Luo, D.; Huber, T. Biocompatible Macrocyclization between Cysteine and 2-Cyanopyridine Generates Stable Peptide Inhibi-tors. Org. Lett. 2019, 21, 4709–4712.

[0012] Zheng, M.; Haeffner, F.; Gao, J. N-Terminal Cysteine Mediated Backbone-Side Chain Cyclization for Chemically Enhanced Phage Display. Chem. Sci. 2022,13, 8349–8354.

[0013] Hampton, J. T.; Lalonde, T. J.; Tharp, J. M.; Kurra, Y.; Alugubelli, Y. R.; Roundy, C. M.; Hamer, G. L.; Xu, S.; Liu, W. R. Novel Regioselective Approach to Cyclize Phage-Displayed Peptides in Combination with Epitope- Directed Selection to Identify a Potent Neutralizing Macrocyclic Peptide for SARS-CoV-2. ACS Chem. Biol.2022, 17, 2911–2922.

[0014] Ren, H.; Xiao, F.; Zhan, K.; Kim, Y.-P.; Xie, H.; Xia, Z.; Rao, J. A Biocompatible Condensation Reaction for the Labeling of Terminal Cysteine Residues on Proteins. Angew. Chem. Int. Ed. 2009, 48, 9658–9662.

[0015] Liu, M.; Morewood, R.; Yoshisada, R.; Pascha, M. N.; Hopstaken, A. J. P.; Tarcoveanu, E.; Poole, D. A.; Haan, C. A. M. de; Nitsche, C.; Jongkees, S. A. K. Selective Thiazoline Peptide Cyclisation Compatible with mRNA Display and Efficient Synthesis. Chem. Sci.2023, 14, 10561–10569.

[0016] Liu, M.; Yoshisada, R.; Amedi, A.; Hopstaken, A. J. P.; Pascha, M. N.; de Haan, C. A. M.; Geerke, D. P.; Poole III, D. A.; Jongkees, S. A. K. An Efficient, Site-Selective and Spontaneous Peptide Macrocyclisation During in vitro Translation. Chem. – Eur. J. 2023, 29, e202203923.

[0017] Wu, Y.; Li, C.; Fan, S.; Zhao, Y.; Wu, C. Fast and Selective Reaction of 2- Benzylacrylaldehyde with 1,2-Aminothiol for Stable N-Terminal Cysteine Modification and Peptide Cyclization. Bioconjug. Chem.2021, 32, 2065–2072.

[0018] Lang, K.; Chin, J.W. Cellular Incorporation of Unnatural Amino Acids and Bioorthogonal Labeling of Proteins. Chem. Rev. 2014, 114, 4764-4806

[0019] Young, D.D.; Schultz, P.G. Playing with the molecules of life. ACS Chem. Biol. 2018, 13, 854-870.

[0020] Kather, I.; Bippes, C.A.; Schmid, F.X. A stable disulfide-free gene-3-protein of phage fd generated by in vitro evolution. J. Mol. Biol. 2005, 354, 666-78.

[0021] Yan, K.; Miskolzie, M.; Bañales Mejia, F.; Peng, C.; Ekanayake, A. I.; Maly, D. J.; Derda, R. Late-stage reshaping of phage-displayed libraries to macrocyclic and bicyclic landscapes using multipurpose linchpin. ChemRxiv. 2024; doi:10.26434 / chemrxiv-2024-08847-v2 This content is a preprint and has not been peer-reviewed.

Claims

Claims1. A method for providing a cyclic peptide, or a peptide compoundhaving a cyclic portion, comprising reacting a linear peptide comprising an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys, wherein NH2indicates the N-terminus of the peptide; Xaa is any natural or non-natural amino acid residue and n is 2 to 15; with a bifunctional synthetic scaffold comprising a first functionality HC(O)–(CH2)x – and a second functionality – (CH2)y-LG, wherein x is 1 to 5, y is 1 to 5, preferably 1 to 3; LG is an electrophilic leaving group or a cysteine-reactive electrophile,under conditions allowing for the formation of an imidazolidinone-fusedmacrocyclic peptide (MP).

2. The method according to claim 1, wherein Xaa1 is Ala or Pro,preferably Ala.

3. The method according to claim 1 or 2, wherein n is 2 to 10, preferably 2to 8.

4. The method according to any one of the preceding claims, wherein(Xaa)n comprises or consists of amino acids selected from D and L stereoisomers of natural or non-natural amino acids, preferably wherein Xaa is any natural or non-natural amino acid residue other than Cys.

5. The method according to any one of the preceding claims, wherein LGis an electrophilic leaving group, preferably a halogen atom, more preferably Br.

6. The method according to any one of claims 1-4, wherein LG is a cysteine-reactive electrophile, preferably wherein LG comprises a vinyl moiety, more preferably a maleimide moiety.

7. The method according to any one of the preceding claims, wherein the scaffold comprises first functionality HC(O)-(CH2)x – wherein x is 1 to 3.

8. The method according to any one of the preceding claims, wherein the second functionality of the scaffold comprises – NH-C(O)-(CH2)x-LG, preferably – NH-C(O)-CH2-Br.

9. The method according to any one of the preceding claims, wherein the scaffold is of the general formulawhereinis a linear alkane or a mono- or a polycyclic (hetero)aromatic core.

10. The method according to claim 9, wherein the mono- or polycyclic (hetero)aromatic core consists or comprises one or more 5- or 6-membered (hetero)aromatic ring structure(s), preferably selected from an optionally substituted benzene, pyrimidine, triazoles, pyridine, indole, furan, thiophene, imidazole, or oxazole.

11. The method according to any one of claims 1-9, wherein the scaffold is a linear alkane, preferably of the formula HC(O)-(CH2)z-LG wherein z is 1 to 6, preferably 1 to 5, more preferably 1 to 3.

12. The method according to any one of the preceding claims, wherein the synthetic bifunctional scaffold is selected from the group consisting of scaffolds 1-4, preferably scaffolds 1-3, depicted by the following structures13. The method according to any one of the preceding claims, wherein the peptide is a recombinantly produced or a synthetic peptide, preferably wherein the peptide is obtained by solid phase peptide synthesis.

14. The method according to any one of the preceding claims, wherein the peptide is displayed on the surface of an entity that can be replicated, preferably on a replicative genetic particle, more preferably on a bacteriophage.

15. A cyclic peptide or a peptide compound having a cyclic portion comprising an imidazolidinone-fused macrocycle (MP) structure obtainable by a method according to any one of claims 1-14.

16. A cyclic peptide or a peptide compound having a cyclic portioncomprising an imidazolidinone-fused macrocycle (MP) structure comprising or consisting of the formulaWherein is a linear alkane, a mono- or a polycyclic (hetero)aromatic core; G means Glycine and C means Cysteine;indicates a peptide consisting of 2 to 15 amino acid residues Xaa, wherein Xaa is any natural or non-natural amino acid residue; and R is the side-chain of any natural amino acid, preferably wherein R is CH3.

17. A complex comprising a replicative entity, preferably a replicative genetic particle, more preferably a bacteriophage particle, a yeast cell or a bacterial particle, said replicative entity comprising (i) a polypeptide comprising an amino acid sequence of the formulaNH2-Xaa1-Gly-(Xaa)n-Cys, wherein NH2indicates the N-terminus of the polypeptide; Xaa is any natural or non-natural amino acid residue and n is 2 to 15; preferably wherein Xaa1is Ala; (ii) a nucleic acid encoding the polypeptide of (i); (iii) a synthetic scaffold attached to said polypeptide via the peptide’s Cys residue and via an imidazolidinone-moiety formed from the N-terminal amine and the amidic nitrogen of a Gly residue.

18. A polypeptide library comprising at least two complexes according to claim 17, preferably wherein each complex in the library comprises the same scaffold and wherein the complexes differ in the (Xaa)n amino acid sequence.

19. A method for providing a complex according to claim 17, said method comprising contacting a replicative entity comprising a polypeptide chain comprising an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys wherein Xaa is any natural or non-natural amino acid residue and n is 2 to 15; with a bifunctional synthetic scaffold defined in any one of claims 1 and 7-12, thereby attaching said scaffold to said polypeptide.

20. A method for identifying a complex according to claim 19 which is capable of binding to a target of interest, preferably a protein target of interest, the method comprising (i) providing a complex according to claim 13 or 14; (ii) contacting said complex with the (protein) target of interest, and (iii) selecting those complexes which bind said (protein) target.

21. The method according to claim 20, wherein the complex is part of a polypeptide library according to claim 18.

22. A bifunctional scaffold for use in a method for providing a cyclic peptide, or a peptide compound having a cyclic portion, the scaffold comprising a first functionality HC(O)–(CH2)x – and a second functionality – (CH2)y-LG, wherein x is 1 to 5, y is 1 to 5, preferably 1 to 3; LG is an electrophilic leaving group or a cysteine-reactive electrophile.

23. The bifunctional scaffold according to claim 22, wherein the second functionality of the scaffold comprises – NH-C(O)-(CH2)x-LG, preferably – NH-C(O)-CH2-Br.

24. The bifunctional scaffold according to claim 22 or 23, wherein the scaffold is of the general formulawhereinis a linear alkane, a mono- or a polycyclic (hetero)aromatic core, preferably a mono- or polycyclic (hetero)aromatic core consisting of or comprising one or more 5- or 6-membered (hetero)aromatic ring structure(s), preferably selected from an optionally substituted benzene, pyrimidine, triazoles, pyridine, indole, furan, thiophene, imidazole, or oxazole.

25. The bifunctional scaffold according to any one of claims 22 to 24, wherein the scaffold is a linear alkane, preferably of the formula HC(O)- (CH2)z-LG wherein z is 1 to 6, more preferably 1 to 3.

26. The bifunctional scaffold according to any one of claims 22-25, selected from the group consisting of scaffolds 1-4, preferably scaffolds 1-3, depicted by the following structures27. The use of a bifunctional scaffold according to any one of claims 22-26 in the manufacture of an imidazolidinone-fused macrocyclic peptide (MP),preferably in the manufacture of an imidazolidinone-fused MP displayed ona replicative entity, more preferably on a bacteriophage, or a library of replicative entities displaying imidazolidinone-fused macrocyclic peptides.

28. A kit-of-parts comprising a bifunctional scaffold according to any one of claims 22-26 and one or more components conventionally used in genetically-encoded libraries, preferably selected from a peptide phage display library, a construct comprising a vector that includes a restriction endonuclease site for custom insertion of candidate peptide sequences, means for ligand / target immobilization.

29. The kit-of-parts according to claim 28, further comprising a phage display library displaying linear peptides comprising an amino acid sequence of the formula NH2-Xaa1-Gly-(Xaa)n-Cys, wherein NH2 indicates the N-terminus of the peptide; Xaa is any natural or non-natural amino acid residue and n is 2 to 15; preferably wherein Xaa1is Ala.

30. The kit-of-parts according to claim 28 or 29, wherein the phage display library encodes one or more linear peptides fused to an engineered gene 9, gene 8, gene 7, gene 6 or gene 3 of a bacteriophage, preferably to the N-terminus of the soluble D1D2-domains of a cysteine-free phage-coat protein III (pIII).

Citation Information

Patent Citations

  • Synthetic cyclic peptides and methods of preparation and use thereof

    US20220119445A1