Monoclonal antibodies against nipah virus

Abstract

The present invention relates to an engineered monoclonal antibody having fragments of heavy chain (HC) and light chain (LC) selected from SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11, 12, 13, 14 and 15 or a combination thereof for interacting and neutralizing Nipah virus as well as Hendra virus isolate. The present invention also discloses the method of production of monoclonal antibodies and its use thereof.

Description

[0001] “MONOCLONAL ANTIBODIES AGAINST NIPAH VIRUS”

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to the field of Biotechnology. In particular, the present invention relates to engineered monoclonal antibodies that bind and neutralize Nipah virus.

[0004] BACKGROUND OF THE INVENTION

[0005] Nipah virus is a zoonotic virus spreads mainly through fruit bats, pigs and other animals like goats, horses, dogs or cats. The rate of mortality in Nipah infected individuals is between 40- 70%. (Nipah virus (who.int)). A recent outbreak of Nipah virus occurred in Kerala, India in 2023. This outbreak of Nipah in Kerala, India was the fourth outbreak in India since 2018 (Nipah virus infection - India (who.int)). ml02.4, a monoclonal antibody (Lancet Infect Dis 2020 Apr;20(4):445-454) that was undergoing clinical trial and has now completed the phase 1 trial, was the only antibody that was available for compassionate use basis and had been sourced by the Indian Government from Australia for the treatment of NiV-infected patients during the outbreak. However, currently there are no licensed vaccines or specific antiviral treatments available for Nipah virus infection.

[0006] There are few prior arts that disclose monoclonal antibodies against Nipah virus, WO2006137931A2 disclose monoclonal antibodies that bind or neutralize Hendra or Nipah virus by targeting the viral envelope glycoprotein G by using a highly purified, oligomeric, soluble HeV G (sG) glycoprotein as the antigen for screening of a large native human phagedisplay library.

[0007] W02011061849A1 disclose a recombinant measles virus produced by inserting a gene encoding a protein involved in the protection against onset of Nipah virus infection into a measles virus genome.

[0008] WO2023109844A1 disclose anti-F protein and anti-G protein antibodies, antigen-binding fragment thereof, and the uses thereof.

[0009] WO2024074571 Al disclose antibodies that are directed against a surface antigen of an antigen presenting cell wherein the heavy chain and / or the light chain is conjugated or fused to the Nipah virus antigenic polypeptides. Nipah virus strains exhibit genetic variations in different geographical locations where outbreaks have occurred, such as Bangladesh, Kerala (India), Malaysia, and Singapore. (BMJ Global Health 2019:4:e001118.) Therefore, the monoclonal antibodies as disclosed in the prior art, are not effective against every strain of Nipah virus. Thus, due to the lack of specific treatments for Nipah virus infection there is a need for the development of engineered monoclonal antibodies that can that bind and neutralize Nipah virus, that significantly improve patient outcomes and control outbreaks.

[0010] OBJECT OF THE INVENTION

[0011] An object of the present invention is to provide an engineered monoclonal antibody, a combination, a composition comprising engineered monoclonal antibody, a method of producing monoclonal antibodies and its utility thereof.

[0012] SUMMARY OF THE INVENTION

[0013] The present invention relates to an engineered monoclonal antibody having fragments of heavy chain (HC) and light chain (LC) selected from SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11 and 12, 13, 14 and 15 or a combination thereof for interacting and neutralizing Nipah virus. The present invention also discloses the method of production of monoclonal antibodies and its use thereof.

[0014] BRIEF DESCRIPTION OF FIGURES

[0015] Figure 1 (a)- (b) depicts Binding and neutralization of plasma obtained from two convalescent donors (2023-NPHR and 2023-NPHS) with history of infection by Nipah virus (NiV) in 2023 in Kerala, India. Figure 1(a) depicts Binding of heat-inactivated plasma to NiV F and G protein antigens as assessed by ELISA. Figure 1(b) depicts Neutralization of pseudoviruses (Pseudovirus - 1 (GenBank ID MK673579) and Pseudovirus - 2 (GenBank ID MK673592) expressing spike protein of NiV representing two Bangladesh variants by heat-inactivated plasma from both the donors.

[0016] Figure 2 (a)-(b) depicts expression and neutralization potential of monoclonal antibodies. Figure 2 (a) depicts expression of antigen-specific single B cell derived monoclonal antibodies (mAbs) (as supernatants) as determined by Fc Capture ELISA and antigen (F and G specific) ELISA. Figure 2 (b) depicts the neutralization potential of antigen-specific functional mAbs examined in a pseudovirus neutralization assay .

[0017] Figure 3 depicts expression of six purified IgGs of the select mAb clones examined by SDS- PAGE.

[0018] Figure 4 (a)- (b) depicts binding of mAbs (as purified IgG) to biotinylated NiV F and G proteins were examined by ELISA.

[0019] Figure 5 depicts pseudovirus neutralization assay.

[0020] Figure 6 depicts kinetics of binding of novel monoclonal antibodies to Nipah virus F and G antigens.

[0021] Figure 7 depicts novel monoclonal antibodies target non-competing epitopes on Nipah F and G proteins.

[0022] Figure 8 (A and B) depicts cloning of heavy and light chain genes cloned into mammalian expression vector.

[0023] Figure 9 depicts SDS PAGE analysis of THS-NV-MAbO5-Pl and THS-NV-MAbO5-P2.

[0024] Figure 10 depicts the binding affinity of modified THS-NV-MAb05-Pl and THS-NV-MAb05- P2 to Bangladesh F protein and Malaysia F protein.

[0025] Figure 11 depicts neutralization of THS-NV-MAb05-Pl and THS-NV-MAbO5-P2 mAbs against pseudo viruses expressing Nipah spikes of Bangladesh and Indian origin.

[0026] DETAILED DESCRIPTION OF THE PRESENT INVENTION

[0027] The present specification is accompanied by Sequence listing. The Sequence listing is presented as the PATENTIN VERSION 3.5 made on May 08, 2025 and file size 74KB. The present invention provides an engineered monoclonal antibody which targets and neutralize Nipah virus.

[0028] An engineered monoclonal antibody can be selected from fragments of heavy chain (HC) and light chain (LC) selected from SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11, 12,13, 14 and 15 or a combination thereof for interacting and neutralizing Nipah virus.

[0029] The engineered monoclonal antibody consists of heavy chain (HC) selected from SEQ ID No.

[0030] 1. 3, 5, 7, 9, 11, 13 and 15.

[0031] The engineered monoclonal antibody consists of a Light chain (LC) selected from SEQ ID No.

[0032] 2.4, 6, 8, 10, 12 and 14.

[0033] The engineered monoclonal antibody comprising: i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 1, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 2.

[0034] The engineered monoclonal antibody as claimed in claim 2, wherein the association rate constant (Kon) ranges from 1.346 xl05to 3.085xl04,dissociation rate constant (KOff) ranges from 1.443xlO’5to < 1 * 10’7and dissociation constant KD ranges from 0.107 xlO-9to< 1 * 1012.

[0035] The engineered monoclonal antibody comprising: i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 3, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 4.

[0036] The engineered monoclonal antibody as claimed in claim 4, wherein the association rate constant (Kon) ranges from 2.044xl05to 5.548 x IO4,dissociation rate constant (KOff) ranges from 9.892xl0’5to < l >< 10’7and dissociation constant KD ranges from 0.484 xlO’9to < l >< 1012The engineered monoclonal antibody comprising: i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 5, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 6.

[0037] The engineered monoclonal antibody as claimed in claim 6, wherein the association rate constant (Kon) ranges from 1.327xl05to 3.880 x IO4,dissociation rate constant (KOff) ranges from 2.925xl0’5to < 1 x lO-7and dissociation constant KD ranges from 2.203 xl0’9to < l >< 1012

[0038] The engineered monoclonal antibody comprising: i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 7, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 8.

[0039] The engineered monoclonal antibody as claimed in claim 8, wherein the association rate constant (Kon) ranges from 1.640xl05to 3.654 x IO4,dissociation rate constant (KOff) ranges from 1.577xlO’3to 2.116xl0-4and dissociation constant KD ranges from 9.610 xlO-9to 5.790 xlO’9'

[0040] The engineered monoclonal antibody comprising: i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 9, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 10.

[0041] The engineered monoclonal antibody as claimed in claim 10, wherein the association rate constant (Kon) ranges from 1.596xl05to 1.066 x IO5,dissociation rate constant (KOff) ranges from 2.216 xl0’4to 9.044 xl0’5and dissociation constant KD ranges from 1.388 xlO’9to 0.848 xlO’9' The engineered monoclonal antibody comprising: i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 11, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 12.

[0042] The engineered monoclonal antibody as claimed in claim 12, wherein the association rate constant (Kon) ranges from 2.688x105 to 6.441 xl04, dissociation rate constant (Koff) ranges from 3.955 xl0-5 to < 1x 10-7 and dissociation constant KD ranges from 0.147 xlO-9 to < 1 xlO-12.

[0043] The monoclonal antibody consisting of heavy and light chain having SEQ ID No. 1 and 2 were modified with Kozak sequence, signal peptides in the Fab region and introducing L234A / L235A (LALA) and M352Y / S254T / T256E (YTE) mutations in the Fc region.

[0044] Two heavy chain constructs were made based on two different signal peptides introduced upstream of variable heavy chain gene of NiVmAB.R5F denoted by SEQ ID No. 1. The modified heavy chains of NiVmAB.R5F represented by THS-NV-MAb05-SPl-HC and THS- NV-MAbO5-SP2-HC and denoted by SEQ. ID No. 13 and 15.

[0045] Signal peptide was introduced upstream of the variable light chain of NiVmAB.R5F denoted by SEQ ID No. 2. The modified light chain represented by THS-NV-MAb05-SPl- LC and denoted by SEQ ID No. 14.

[0046] The modified heavy and light chains represented by THS-NV-MAb05-SPl-HC and THS-NV- MAbO5-SP2-HC and THS-NV-MAb05-SPl- LC denoted by SEQ. ID No.13, 14 and 15 were cloned in expression vector selected from BsiWI, Pmel, BamHI and Sbfl.

[0047] The yield of modified and optimized NiVmAb.R5F constructs cloned in pCGS3UCOE vector expressed in Expi-CHO-S represented by THS-NV-MAb05-Pl and THS-NV-MAbO5-P2 were found to be 245.81 mg / L and 99.88 mg / L respectively. THS-NV-MAbO5-Pl demonstrated efficient and stronger binding than THS-NV-MAbO5-P2 version of NiVmAb.R5F mAb.

[0048] Without being limited to theory, the recombinant monoclonal antibodies with unique nucleotide sequences were made from variable heavy and light chain immunoglobulin G (IgG genes) sourced from single antigen-specific B cells from two individuals recovered from Nipah infection during the recent outbreak (2023) in Kerala, Southern India having specificities to both G (attachment receptor) and F (fusion) proteins, binds very strongly with G and F proteins respectively and neutralize pseudoviruses expressing spike proteins representing Bangladesh and Malaysia variants. The designed recombinant mAbs are of human origin and having distinct antigen (G and F proteins) specificities. They also have demonstrated neutralization of pseudo viruses expressing Nipah spike antigen. These mAbs can potentially be developed as cocktail due to their different target specificities as product for prophylaxis and therapeutic applications in clinical setting.

[0049] In an embodiment the present invention discloses a method of producing the monoclonal antibodies which comprises the following steps: i. obtaining peripheral blood mononuclear cells (PBMCs) from recovered donors infected with Nipah virus; ii. staining PBMCs obtained at step (i) with streptavidin conjugated Nipah F and G proteins for 5 -8 minutes, for obtaining surface markers in 15-25 min in buffer consisting of PBS 1% FBS, 1.0 mM EDTA) on ice, with live / dead fixable viability stain for 5-15 minutes, iii. washing and filtering the cells obtained at step (ii) with buffer consisting of PBS 1% FBS, 1.0 mM EDTA; iv. the antibodies for surface marker at step (iii) was selected from the group consisting of CD3: PE-Cy7, CD8: PE-Cy7, CD 14: PE-Cy7, CD16: PE-Cy7, CD 19: BV421, CD20: BV421, IgD: PerCP-Cy5.5, and IgG: APC-H7. v. the lysis buffer consists of reverse transcriptase (RT) buffer, IGEPAL, Dithiothreitol (DTT) and RNAseOU. vi. sorting of antigen specific single B cell of step (v) vii. amplifying variable Heavy and Light chains from single B cells of step (vi) viii. cloning of variable heavy and light chain genes into mammalian expression vectors containing constant regions of heavy and light chains of step (vii). ix. screening of colonies of step (viii) with desired inserts by colony PCR is used for preparation of plasmid DNA. x. co transfecting variable heavy and light IgG chains of step (ix) into Expi293 cells using polyethyleneimine. xi. purifying IgGs by affinity purification using Protein A resins of step (x) xii. assessing the binding and neutralization ability of all the monoclonal antibodies of step (xi) by ELISA and pseudovirus neutralization assay. xiii. neutralising the live virus isolates by NiVmAb.R5F and NiVmAb.R53F obtained at step (xii). xiv. engineering and codon optimizing NiVmAb.R5F obtained at step (xiii). xv. antigen binding and pseudovirus neutralization of optimized NiVmAb.R5F obtained at step (xiv).

[0050] In an embodiment the present invention discloses the engineered monoclonal antibodies having fragments of heavy chain (HC) and light chain (LC) selected from SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11 and 12, or a combination thereof.

[0051] In an embodiment the present invention discloses a composition comprising the engineered monoclonal antibodies having fragments of heavy chain (HC) and light chain (LC) selected from SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11 and 12, or a combination thereof, and pharmaceutically acceptable carrier.

[0052] The pharmaceutical acceptable carriers can be selected from group comprising diluents, fillers, salts, buffers, stabilizers, solubilizers.

[0053] The engineered monoclonal antibody as claimed in claim 1, wherein the heavy chain (HC) and light chain (LC) denoted by SEQ. ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 and 15 efficiently neutralise pseudoviruses expressing F and G genes of Indian, Bangladesh, Malaysian origin.

[0054] SEQ. ID 1, 2 (NIVmAb.R5F) 3, 4 (NIVmAb.R53F), 11, 12 (NIVmAb.S82F) also found to neutralize pseudovirus expressing Hendra virus spike protein. SEQ. ID 1, 2 (NIVmAb.R5F) 3, 4 (NIVmAb.R53F) also potently neutralized live virus isolates of Indian, Bangladesh, Malaysian origin as well as Hendra virus isolate.

[0055] In another embodiment the present invention discloses a method of treating Nipah virus comprising engineered monoclonal antibodies consisting of heavy and light chains selected from SEQ. ID Nos 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15.

[0056] Advantages:

[0057] (a) The monoclonal antibodies of the present invention have specificity to either G (SEQ. ID Nos 7, 8, 9, 10) (attachment receptor) or F (SEQ. ID 1, 2, 3, 4, 5, 6, 11, 12) (fusion) proteins,

[0058] (b) Neutralize pseudoviruses expressing spike proteins expressing Bangladesh and Malaysia and India Kerala variants.

[0059] (c) These monoclonal antibodies need no humanization.

[0060] The present invention is illustrated by examples. The examples are mere embodiments of the present invention and cannot be construed as limiting.

[0061] EXAMPLE 1: Preparation of antigen baits.

[0062] The codon optimized avi and his-tagged Nipah F and G genes from both Bangladesh (AAY 43915 and AAY43916 respectively) and Malaysia (AAK29087 and ADN51995 respectively) origin were synthesized and expressed in Expi-293 cells, purified using Ni-NTA column and biotinylated proteins were purified using FPLC. The purified biotinylated F and G proteins were used subsequently for B cell sorting.

[0063] EXAMPLE 2: Screening of donor plasma samples for Nipah- specific antibodies.

[0064] Plasma samples obtained from three individuals who were recovered from Nipah infection in 2023 outbreak in Kerala, India were screened. Plasma samples obtained from all the three donors showed binding to G and F proteins as shown in Figure 1A. Amongst the two donors (2023-NPHR and 2023 -NPHS) plasma of donor 2023 -NPHS demonstrated stronger binding to both F and G proteins in ELISA. The plasma samples from two donors (2023-NPHR and 2023- NPHS) were tested and found neutralizing pseudoviruses expressing Nipah spike proteins of Bangladesh origin as shown in Figure IB. EXAMPLE 3: Isolation of antigen-specific novel monoclonal antibodies.

[0065] Peripheral blood mononuclear cells (PBMCs) prepared from the two of the above donors 2023- NPHR and 2023-NPHS were further used for the isolation of monoclonal antibody by antigenspecific B cell sorting method. The antigen (biotinylated F and G proteins) specific single B cell sorting was done in a cell sorter (BD Inc.). PBMCs were stained with streptavidin conjugated Nipah F and G proteins for 5 minutes and then with antibodies for surface markers (CD3: PE-Cy7; CD8: PE-Cy7; CD 14: PE-Cy7; CD 16: PE-Cy7; CD 19: BV421; CD20: BV421; IgD: PerCP-Cy5.5; IgG: APC-H7 for 20 min in FACS buffer (PBS 1% FBS, 1.0 mM EDTA) on ice. Live / Dead fixable viability stain was used to stain the cells for another 10 minutes on ice as per the manufacturer’s instructions. Cells were washed with FACS buffer and filtered with 70- pm cell mesh. Single antigen- specific (Nipah F and G) B cells (CD3-CD8-CD14- CD16-CD19+CD20+IgD-IgG+) were sorted into individual wells of a 96-well plate prefilled with 20 ul of lysis buffer containing reverse transcriptase (RT) Buffer, IGEPAL, DTT and RNAse OUT using a BD FACS Fusion sorter at 5°C.Plates were sealed, snap-frozen on dry ice and stored at -80°C until used.

[0066] EXAMPLE 4: Amplification and cloning IgG variable heavy and light chains.

[0067] Superscript III Reverse Transcription kit was used to prepare cDNA from sorted cells, cDNA master mix containing dNTPs, random hexamers, IgG gene-specific primers and RT enzyme was added to generate cDNA. Heavy and light-chain variable regions of IgG were amplified in independent nested PCR using gene specific primers. First round PCR amplification was performed using HotStar Taq DNA Polymerases and second round nested PCR was performed using Phusion HF DNA polymerase. Specific restriction enzyme cutting sites (heavy chain 5’- Agel / 3’- Sall; kappa chain 5’Agel / 3’- Bis / Wl and lambda chain 5’- Agel / 3’-Xhol) were introduced in the second round PCR primers in order to clone into the respective expression vectors. Amplified PCR products were verified on the agarose gel and wells with double positives (with amplification of both heavy and light chain variable region from the same well) were identified and selected for subsequent cloning experiments. PCR products were digested with specific restriction enzymes, purified and cloned in-frame into expression vectors encoding the human IgGl, Ig kappa or Ig lambda constant domains using the Quick Ligase cloning system according to the manufacturer instructions. Ligation reactions were transformed into NEB 5-alpha competent E. coli cells, plated on LB agar plates containing ampicillin and incubated overnight at 37°C in incubator. Colonies with desired inserts were screened by colony PCR and used for preparation of plasmid DNA. Plasmid DNA with insert in correct orientation were further confirmed by restriction digestion.

[0068] EXAMPLE 5: Screening of functional and antigen specific monoclonal antibodies.

[0069] Plasmid DNA containing variable heavy and light IgG chain sequences were co-transfected in 293T cells using PEI transfection reagent in 24 well plates for preparing antibody supernatant for initial screening for their expression and antigen specificity as detailed in the following section. Sanger sequencing were carried out to obtain the nucleotide and amino acid sequences of variable heavy and light IgG chains. Analysis of mAb sequences were carried out using the IMGT (www.imgt.org) V-quest webserver tool as shown in Table 1.

[0070] TABLE 1: Variable Heavy and light Chain characteristics of Nipah mAbs

[0071] Variable Heavy chain characteristics

[0072] Variabte Light chain characteristics The recombinant mAb clones were first assessed for their ability to express by capture ELISA for the detection of IgG expression. For this, MaxiSorp high protein binding 96 well ELISA plate was coated with 2pg / ml goat anti-human Fc antibody and incubated for overnight at 4°C. Next day after washing, plates were blocked with 5% Skimmed Mlik in PBS (pH 7.4) for 1 hour at room temperature. After 3 times of washing with 1 X PBS containing 0.05% tween 20 (PBST), the cell supernatants harvested post transfection of antibody constructs in HEK 293 T were added and incubated for 1 hour at room temperature. This was followed by addition of alkaline phosphatase-conjugated goat anti-human F (ab’) 2 antibody at 1 : 1000 dilution in 1% bovine serum albumin (BSA) incubated for an hour at room temperature. After the final wash, phosphatase substrate was added into the wells and absorption was measured at 405 nm on a 96-well microtiter plate reader (Figure 2A). The functional mAbs were next assessed for their ability to bind to Nipah virus F and G proteins by ELISA. For this, 3pg / ml of Streptavidin was coated onto each wells of Nunc MaxiSorp high protein-binding 96 well ELISA plate and incubated overnight at 4°C. Next day after washing, plates were blocked with 5% skimmed milk in PBS (pH 7.4) for 1 hour at room temperature. 2pg / ml of Biotinylated- F and G protein was subsequently added to separate plates and incubated the plate for 2 hours at room temperature. After washing the plates for 3 times with PBST, cell supernatants at various dilutions were added to the wells and the plate was further incubated for 1 hour at room temperature. Finally, HRP (horse radish peroxidase) conjugated anti-human IgG Fc secondary antibody was added at a dilution of 1 : 1000 containing 1% BSA and the plate was incubated for an hour at room temperature. After the final wash, TMB substrate was added and subsequently IN H2SO4 was added to stop the reaction. The absorption was measured at 450nm(Figure 2A). The mAb supernatants that showed binding to F and G proteins were further assessed for their ability to neutralize pseudo viruses expressing Nipah spike proteins. The pseudoviruses were produced by cotransfection of G and F expressing plasmids and an env defective HIV backbone (pNL4-3 Luc. re-). Neutralization assays were carried out in HEK293T and BHK21 cells. Six recombinant mAbs were found to demonstrate neutralization of the pseudoviruses (Figure 2B).

[0073] EXAMPLE 6: Preparation and Purification of IgGs

[0074] The IgGs were produced in Expi293 (Thermo Scientific) cells. Plasmid DNA expressing variable heavy and light IgG chains were co-transfected into Expi293 cells using polyethyleneimine (PEI). After 4-5 days of incubation, supernatants were harvested by centrifugation and filtered through a 0.2pm membrane filter. Supernatants were then flowed slowly onto the Protein A. beads in the column at 4oC in order to capture the secreted antibodies. Beads in the column were washed with five column volumes of IX PBS at room temperature. Antibodies were eluted in two to three column volumes of 100 mM Glycine (pH 2.5) and immediately neutralized with IM Tris-HCL (pH 8.0). Eluted antibodies were dialyzed using 10K MWCO SnakeSkin dialysis tubings against IX PBS thrice and then concentrated in 30kDa NMWCO Amicon Ultra- 15 Centrifugal Filter Units. Antibody solutions were finally filtered through a 0.2 pm syringe filter before being used for further experiments. Concentration of IgG was measured by NanoDrop spectrophotometer and IgG heavy and light chain bands were visualized with 15% SDS PAGE analysis as shown in Figure 3.

[0075] EXAMPLE 7: Streptavidin ELISA for Purified IgGs

[0076] The binding ELISA for novel Nipah F and G specific antibodies were done using Biotinylated Nipah F protein and G proteins by the method as shown in Figure 4.

[0077] EXAMPLE 8: Pseudo virus neutralization assay

[0078] The neutralization breadth and potency of human monoclonal antibodies (mAbs) targeting Nipah virus were systematically evaluated using a pseudo virus neutralization assay. In this assay, purified IgG molecules representing different mAbs were incubated with pseudo viruses engineered to express the Nipah virus spike proteins — F and G genes — across a range of concentrations. The mixture was allowed to interact at 37°C for one hour, after which it was added to BHK-21 cells and incubated for 48 hours in a CCE-enriched environment as shown in figure 5. The degree of virus neutralization was determined by measuring the reduction in infectivity, quantified through a decline in relative luminescence units (RLU), observed in a dose-dependent manner. The inhibitory concentrations required for 50% (ICso) and 80% (ICso) neutralization across the tested antibodies are shown in Table 2, offering a comparative insight into their neutralizing capacity. Table 2: Neutralization breadth and potencies of novel human monoclonal antibodies against Nipah virus.

[0079] To complement the neutralization data, the binding kinetics of these novel mAbs to the Nipah virus F and G glycoproteins were investigated using biolayer interferometry (BLI) via the Octet system. As shown in Figure 6, two experimental configurations were employed. In the first setup (left panel), mAbs (R5F, R53F, S82F, R92F targeting F protein and S65G, R94G targeting G protein) were immobilized on anti-human Fc capture biosensors and then exposed to purified antigens starting at 900 nM with 3 -fold serial dilutions. In the second configuration (right panel), biotinylated F and G antigens were immobilized on Streptavidin biosensors and tested against serially diluted mAbs starting at 300 nM. Each association and dissociation phase lasted 500 seconds, and the resulting data were reference- subtracted and analyzed using Octet Data Analysis Software version 11.1. Binding curves were modeled using a 1: 1 interaction framework to extract kinetic parameters including the association rate constant (Kon), dissociation rate constant (Koff), and equilibrium dissociation constant (KD). The specific Kon, Koff, and KD values for each mAb as shown in Table 3 and 4, offering a quantitative view of the antibodies’ binding affinities to their respective antigens.

[0080] Table 3: The Kon, Kotf and KD values of lOpg / ml monoclonal antibodies immobilized on anti-human Fc capture biosensors and purified antigens (F and G), diluted 3-fold starting with 900nM.

[0081] Table 4: The Kon, Kotf and KD values of l()pg / ml monoclonal antibodies immobilized on Streptavidin (SA) biosensors tested using three-fold serial dilutions mAbs starting with 300nM.

[0082] Monoclonal antibodies were evaluated for epitope competition using Biolayer interferometry (BLI). Biotinylated F and G proteins were captured using streptavidin biosensor followed by first incubation with one antigen-specific mAb at a saturating concentration of lOOpg / ml for 400 sec followed by incubation with 25pg / ml of competing antibodies as shown in figure 7.

[0083] EXAMPLE 8: Neutralization of live virus isolates.

[0084] The top two mAbs NiVmAb.R5F and NiVmAb.R53F which demonstrated potent neutralization of pseudo viruses were further assessed for their ability to neutralize live virus isolates. Both NiVmAb.R5F and NiVmAb.R53F were found to efficiently neutralize Nipah virus (NiV) live virus isolates of Indian, Bangladesh and Malaysian origin as well as Hendra virus isolate as shown in Table 5.

[0085] Table 5: Neutralization of live Nipah virus (NiV) isolates different geographical origin by

[0086] NiVmAb.R5F and NiVmAb.R53F.

[0087] IgG Positive Negative

[0088] Virus isolates (ng / mL) NiVmAb.R5F NiVmAb.R53F control control

[0089] EXAMPLE 9: Engineering and codon optimization of NiVmAb.R5F.

[0090] As NiVmAb.R5F demonstrated best neutralization breadth and maximum potency, it was further codon optimized after introducing Kozak sequence (GCCGCCACC), signal peptides in the Fab region and introducing L234A / L235A (LALA) and M352Y / S254T / T256E (YTE) mutations in the Fc region to abolish the effector function and enhance serum half-life respectively. Two heavy chain constructs were made based on two different signal peptides (ATGAAGTGGGTCACCTTCATCTCCCTGCTGTTTCTGTTCTCCAGCGCCTACTCT and

[0091] ATGGGATGGTCCCTGATTCTGCTGTTTCTGGTGGCCGTGGCTACCAGAGTTCTGT CC) introduced upstream of variable heavy chain gene of NiVmAB.R5F. For light chain, the following signal peptide was introduced upstream of variant variable light chain gene: ATGAAGTGGGTCACCTTCATCTCCCTGCTGTTTCTGTTCTCCAGCGCCTACAGC.

[0092] The modified heavy chains are referred to as THS-NV-MAbO5-SPl-HC and THS-NV- MAbO5-SP2-HC and the modified light chain as THS-NV-MAbO5-SPl-LC. The nucleotide sequences of THS-NV-MAbO5-SPl-HC, THS-NV-MAbO5-SP2-HC and THS-NV-MAbO5- SP1-LC are depicted in SEQ. ID Nos. 13, 14 and 15.

[0093] EXAMPLE 10: Cloning into expression vector.

[0094] Both the modified and codon optimized heavy and light chain genes were cloned into a mammalian expression vector (pCGS3UCOE) as shown in Figure 8. The heavy chains (THS- NV-MAb05-SPl-HC and THS-NV-MAbO5-SP2-HC) were cloned using BsiWI and Pmel while the light chain (THS-NV-MAb05-SPl-LC) was cloned using the BamHI and Sbfl as indicated in Figure 8(A & B).

[0095] EXAMPLE 11: Expression, target antigen binding and pseudo virus neutralization of optimized NiVmAb.R5F.

[0096] Expression:

[0097] The modified and optimized NiVmAb.R5F constructs cloned in pCGS3UCOE vector were expressed in Expi-CHO-S (Thermo Inc.) by transient transfection and harvested on day 8. The harvested supernatants were clarified and were purified using protein A resin. The yield of THS-NV-MAb05-Pl and THS-NV-MAbO5-P2 were found to be 245.81 mg / L and 99.88 mg / L respectively. The purified IgG were then assessed in reducing and non-reducing (SDS-PAGE) conditions as shown in Figure 9 (A and B). Overall, the above data indicated efficient expression of both versions of the optimized NiVmAb.R5F mAb.

[0098] Target antigen binding:

[0099] The modified and optimized mAbs were next assessed for their ability to bind to the target antigens. As shown in Figure 10, both the optimized were found to strongly bind to the target (F protein) protein antigens of Nipah virus of Bangladesh and Malaysia origin. THS-NV- MAb05P-l demonstrated stronger binding than THS-NV-MAbO5-P2 version of the NiVmAb.R5F mAb.

[0100] Pseudo virus neutralization:

[0101] The optimized mAb were subsequently assessed for their ability to neutralize Nipah virus by pseudo virus neutralization assay. As shown in Figure 11, both THS-NV-MAb05-Pl and THS- NV-MAbO5-P2 showed efficient neutralization of pseudo viruses expressing Nipah virus spikes of Bangladesh and Indian origin.

Claims

Claims:

1. An engineered monoclonal antibody for interacting and neutralizing Nipah virus consisting of: i. a heavy chain (HC) comprising Kozak sequence, HC variable domain, human IgGl constant region by SEQ. ID Nos 1, 3, 5, 7, 9, 11, 13 and 15, and ii. a light chain (LC) comprising Kozak sequence, LC variable region, human lambda-2 constant region denoted by SEQ ID Nos 2, 4, 6, 8, 10, 12 and 14.

2. The engineered monoclonal antibody as claimed in claim 1. Comprising i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 1, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 2.

3. The engineered monoclonal antibody as claimed in claim 2, wherein the association rate constant (Kon) ranges from 1.346 xl05to 3.085x 104,dissociation rate constant (Koff) ranges from 1.443x105to < 1x107and dissociation constant KD ranges from 0.107 xlO9to < 1x10124. The engineered monoclonal antibody as claimed in claim 1 comprising i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 3, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 4.

5. The engineered monoclonal antibody as claimed in claim 4, wherein the association rate constant (Kon) ranges from 2.044xl05to 5.548 x 104,dissociation rate constant (Koff) ranges from 9.892xl05to < lxl07and dissociation constant KD ranges from 0.484 xl09to < 1x10126. The engineered monoclonal antibody as claimed in claim 1 comprising i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 5, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 6.

7. The engineered monoclonal antibody as claimed in claim 6, wherein the association rate constant (Kon) ranges from 1.327xl05to 3.880 x 104,dissociation rate constant (Koff) ranges from 2.925xl05to < lxl07and dissociation constant KD ranges from 2.203 xl09to < 1x1012.

8. The engineered monoclonal antibody as claimed in claim 1 comprising:i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 7, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 8.

9. The engineered monoclonal antibody as claimed in claim 8, wherein the association rate constant (Kon) ranges from 1.640xl05to 3.654 x IO4,dissociation rate constant (Koff) ranges from 1.577x103to 2.116x104and dissociation constant KD ranges from 9.610 xl09to 5.790 xlO9.

10. The engineered monoclonal antibody as claimed in claim 1 comprising: i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 9, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 10.

11. The engineered monoclonal antibody as claimed in claim 10, wherein the association rate constant (Kon) ranges from 1.596xl05to 1.066 x IO5,dissociation rate constant (Koff) ranges from 2.216 xl04to 9.044 xl05and dissociation constant KD ranges from 1.388 xl09to 0.848 xlO9.

12. The engineered monoclonal antibody as claimed in claim 1 comprising i. a heavy chain (HC) comprising HC variable domain, human IgGl constant region denoted by SEQ. ID No 11, and ii. a light chain (LC) comprising LC variable region, human lambda-2 constant region denoted by SEQ ID No 12.

13. The engineered monoclonal antibody as claimed in claim 12, wherein the association rate constant (Kon) ranges from 2.688xl05to 6.441 x 104,dissociation rate constant (Koff) ranges from 3.955 xlO5to < 1x107and dissociation constant KD ranges from 0.147 xlO9to < 1 xlO 1214. The engineered monoclonal antibody as claimed in claim 1 , wherein the heavy and light chains having SEQ ID No. 1 and 2 are modified with Kozak sequence, signal peptides in the Fab region and introducing L234A / L235A (LALA) and M352Y / S254T / T256E (YTE) mutations in the Fc region.

15. The engineered monoclonal antibody as claimed in claim 8, wherein the modified heavy chains of NiVmAB.R5F (SEQ. ID No 1) represented by THS-NV-MAb05-SPl-HC and THS-NV- MAbO5-SP2-HC and denoted by SEQ. ID No. 13 and 15.

16. The engineered monoclonal antibody as claimed in claim 8, wherein the modified light chain of NiVmAB.R5F (SEQ. ID No 2) is represented by THS-NV-MAb05-SPl- LC and denoted by SEQ ID No. 14.

17. The engineered monoclonal antibody as claimed in claim 8, wherein the modified heavy and light chain represented by THS-NV-MAb05-SPl-HC and THS-NV-MAbO5-SP2-HC and THS-NV-MAb05-SPl- LC denoted by SEQ. ID No.13, 14 and 15 were cloned in expression vector selected from BsiWI, Pmel, BamHI and Sbfl.

18. The engineered monoclonal antibody as claimed in claim 5, wherein the yield of THS-NV- MAb05-Pl and THS-NV-MAbO5-P2 ranges from 240-250 mg / L and 98-102 mg / L respectively.

19. A method of producing the monoclonal antibodies which comprises the following steps: i. obtaining peripheral blood mononuclear cells (PBMCs) from recovered donors infected with Nipah virus; ii. staining PBMCs obtained at step (i) with streptavidin conjugated Nipah F and G proteins for 5 -8 minutes, for obtaining surface markers in 15-25 min in buffer consisting of PBS 1 % FBS, 1.0 mM EDTA) on ice, with live / dead fixable viability stain for 5-15 minutes, iii. washing and filtering the cells obtained at step (ii) with buffer consisting of PBS 1% FBS, 1.0 mM EDTA; iv. the antibodies for surface marker at step (iii) was selected from the group consisting of CD3: PE-Cy7, CD8: PE-Cy7, CD14: PE-Cy7, CD16: PE-Cy7, CD19: BV421, CD20: BV421, IgD: PerCP-Cy5.5, and IgG: APC-H7. v. the lysis buffer consists of reverse transcriptase (RT) buffer, IGEPAL, Dithiothreitol (DTT) and RNAseOU. vi. sorting of antigen specific single B cell of step (v) vii. amplifying variable Heavy and Light chains from single B cells of step (vi) viii. cloning of variable heavy and light chain genes into mammalian expression vectors containing constant regions of heavy and light chains of step (vii). ix. screening of colonies of step (viii) with desired inserts by colony PCR is used for preparation of plasmid DNA. x. co transfecting variable heavy and light IgG chains of step (ix) into Expi293 cells using polyethyleneimine .xi. purifying IgGs by affinity purification using Protein A resins of step (x) xii. assessing the binding and neutralization ability of all the monoclonal antibodies of step(xi) by ELISA and pseudovirus neutralization assay. xiii. neutralising the live virus isolates by NiVmAb.R5F and NiVmAb.R53F obtained at step(xii). xiv. engineering and codon optimizing NiVmAb.R5F obtained at step (xiii). xv. antigen binding and pseudovirus neutralization of optimized NiVmAb.R5F obtained at step (xiv).

20. The method as claimed in claim 10, wherein the antibodies for surface marker can be selected from the group consisting of CD3: PE-Cy7, CD8: PE-Cy7, CD14: PE-Cy7, CD16: PE-Cy7, CD19: BV421, CD20: BV421, IgD: PerCP-Cy5.5, and IgG: APC-H7.

21. The method as claimed in claim 10, wherein the lysis buffer consists of reverse transcriptase (RT) buffer, IGEPAL, Dithiothreitol (DTT) and RNAseOU.

22. An engineered monoclonal having fragments of heavy chain (HC) and light chain (LC) selected from SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11, 12, 13, 14 and 15 or a combination thereof.

23. A composition comprising the engineered monoclonal antibodies having fragments of heavy chain (HC) and light chain (LC) selected from SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11, 12, 13, 14 and 15 or a combination thereof, and pharmaceutically acceptable carrier.

24. The composition comprising the engineered monoclonal antibodies as claimed in claim 14, wherein the pharmaceutical acceptable carriers can be selected from group comprising diluents, fillers, salts, buffers, stabilizers, solubilizers.

25. The engineered monoclonal antibodies as claimed in claim 1, wherein (NiVmAb.R5F and NiVmAb.R53F) with SEQ. ID Nos. 1, 2, 3, 4 neutralizes Hendra virus.

26. The engineered monoclonal antibody as claimed in claim 1, wherein the heavy chain (HC) and light chain (LC)denoted by SEQ. ID No. 1,2, 3, 4 efficiently neutralise live virus isolates of Indian, Bangladesh and Malaysian origin as well as Hendra virus isolate.

27. A method for treating Nipah virus as claimed in claim 1, comprising engineered monoclonal antibodies consisting of heavy and light chains selected from SEQ. ID Nos 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15.

Images