Targeted nanoparticles

Abstract

Disclosed herein are solid lipid nanoparticles comprising a fatty acid esterified with polyethylene glycol. The polyethylene glycol is functionalised with an aptamer (i.e. targeting ligand). The nanoparticle may be loaded with an antibiotic or an antifungal, and a fluorescent compound. Also provided are their methods of preparation and their use in drug delivery and biosensing.

Description

[0001]1005937956Targeted Nanoparticles This application claims priority to Australian provisional application AU 2024901404 (filed on 14 May 2024), the entire contents of which are incorporated by reference. Field of the invention The present disclosure relates generally to solid lipid nanoparticles comprising targeting ligands, their methods of preparation, and their use in drug delivery and biosensing. Background of the invention There are numerous types of nanoparticle scaffolds under investigation for use in nanoparticle based drug delivery systems. These include polymeric nanoparticles, inorganic nanoparticles, viral nanoparticles, lipid-based nanoparticles, and nanoparticle albumin-bound (nab) technology. Each family has unique characteristics, benefits and drawbacks. A major focus of nanoparticle based drug delivery systems is to improve biodistribution of the drug ie concentrating the drug where it is needed in the body. Biodistribution is generally improved through one of two mechanisms – passive or active targeting. Passive targeting relies on intrinsic characteristics of the nanoparticle to indirectly improve the biodistribution of the system. For instance, factors such as particle size, shape, surface charge and the hydrophilicity of the surface can alter the circulation properties of the system, altering biodistribution. Additionally, biodistribution can be modulated by the addition of surface proteins which alter the particle’s susceptibility to opsonisation, and uptake by the reticuloendothelial system and ultimate organ biodistribution. Passively targeted nanoparticle systems are simpler and more established than actively targeted systems, and more clinical data is available. In addition to the varying factors described above with respect to nanoparticle scaffolds and passively targeted nanoparticle systems, actively targeted nanoparticle systems vary in both the type of targeting molecule used and how the targeting aspect and nanoparticle as a whole are conjugated to one another.1005937956Active targeted nanoparticle systems feature a targeting ligand that binds specifically to receptors on the cell, tissue, or organ of interest, causing the nanoparticles to concentrate and release drug at the area of interest. Actively targeted systems offer improved specificity over passively targeted systems. Flow-on benefits include improving the therapeutic efficiency of the drug payload, limiting cytotoxicity, improving general safety, reducing side effects, and overcoming drug resistance. Despite the benefits outlined above, actively targeted nanoparticle systems also offer challenges, including those related to cost, shelf life, size, specificity, clearance, and stability, depending on the different classes of targeting molecules employed. Similarly, different nanoparticle constructs offer challenges, for factors including biocompatibility and cost and sophistication of production. There is a need to provide new targeted nanoparticles and methods for their production, particularly utilising classes of targeting ligands that have yet to be extensively developed. There is also a specific need for antibiotic and / or antifungal treatments that offer increased efficacy, particularly as resistance to existing antibiotic and / or antifungal drugs and / or delivery platforms increases. Similarly, there is also a need for improved platforms and / or methods to diagnose bacterial infections. Reference to any prior art in the specification is not an acknowledgment or suggestion that this prior art forms part of the common general knowledge in any jurisdiction or that this prior art could reasonably be expected to be understood, regarded as relevant, and / or combined with other pieces of prior art by a skilled person in the art. Summary of the invention In one aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is not loaded with a therapeutic or diagnostic compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol,1005937956wherein the polyethylene glycol is functionalised with an aptamer, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by at least about 300% compared to an equivalent solid lipid nanoparticle that does not comprise the aptamer, and wherein the nanoparticle is loaded with a fluorescent compound. In some embodiments, the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by at least about 300%, about 400%, about 500%, or about 600% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer. In some embodiments, the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by less than about 10,000% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer. In some embodiments, the bacterial species is pathogenic. In some embodiments, the bacterial species is Gram-negative. In some embodiments, the bacterial species is Gram-positive. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by at least about 300% compared to an equivalent solid lipid nanoparticle that does not comprise the aptamer, and wherein the nanoparticle is loaded with a fluorescent compound. In some embodiments, the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by at least about 300%, about 400%, about 500%, or about 600% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer. In some embodiments, the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by less than about 10,000% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer. In some embodiments, the fungal species is pathogenic.1005937956In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer with an affinity for a bacterial species, and wherein the nanoparticle is loaded with a fluorescent compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with an antibiotic compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with an antifungal compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with a fluorescent compound and an antibiotic compound. Aptamers are a less explored class of targeting ligands that have many of the same benefits as antibodies (a more established targeting ligand) relative to other targeting ligands: namely, high specificity and / or high affinity to the desired target. Aptamers also offer benefits over antibodies as targeting ligands; including rapid generation, stability, small size and relatively easy modification. Despite this, aptamers are relatively under- explored, for reasons including the cost and sophistication of production typically required, as well as potential issues with rapid clearance.1005937956In the present invention, issues with sophistication of the targeting ligand are offset by simplicity of the other components of the nanoparticle. Surprisingly, the inventors have developed solid lipid nanoparticles that display high specificity and / or affinity to the desired target through the targeting ligand, whilst maintaining biocompatibility. This has been achieved with a relatively straightforward production of the nanoparticle component. For instance, fatty acids are widely available and widely biocompatible, particularly stearic acid and its derivatives. Similarly, polyethylene glycol is widely available and widely biocompatible, particularly PEG100 and its derivatives. Accordingly, the solid lipid nanoparticles described herein may offer sophisticated targeting coupled with economical / simple production of the nanoparticle component. In some embodiments, the aptamer is conjugated to the polyethylene glycol through an amide functionality. In some embodiments, the aptamer is conjugated to the polyethylene glycol through a thioester functionality. In some embodiments, the polyethylene glycol comprises about 300 to about 20000 kDa of ethylene oxide units. In another aspect, there is provided a pharmaceutical composition comprising the solid lipid nanoparticle of any one of herein disclosed embodiments, and at least one pharmaceutically acceptable excipient, wherein one or more of a fluorescent, antifungal or antibiotic compound is present in the solid lipid nanoparticle. In another aspect, there is provided a pharmaceutical composition comprising the solid lipid nanoparticle of any one of herein disclosed embodiments, and at least one pharmaceutically acceptable excipient, wherein a fluorescent and / or antibiotic compound is present in the solid lipid nanoparticle. In another aspect, there is provided a method for producing a solid lipid nanoparticle according to any one of herein disclosed embodiments, the method comprising: functionalising a molecule comprising polyethylene glycol with an aptamer. In some embodiments of the method, the molecule comprising polyethylene glycol is oxidised prior to functionalisation.1005937956In some embodiments of the method, the method further comprises contacting the molecule comprising polyethylene glycol with another surfactant. In another aspect there is provided a method of delivering an active agent to a cell or tissue, the method comprising contacting the solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of any one of herein disclosed embodiments, with the cell or tissue, wherein one or more of a fluorescent, antifungal or antibiotic compound is present in the solid lipid nanoparticle, thereby introducing the active agent into the cell or tissue. In another aspect there is provided a method of delivering an active agent to a cell or tissue, the method comprising contacting the solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of any one of herein disclosed embodiments, with the cell or tissue, wherein a fluorescent and / or antibiotic compound is present in the solid lipid nanoparticle, thereby introducing the active agent into the cell or tissue. In another aspect there is provided a method of treating or preventing a bacterial and / or fungal disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein an antibiotic and / or antifungal compound is present in the solid lipid nanoparticle. In another aspect there is provided a method of treating or preventing a bacterial disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein an antibiotic compound is present in the solid lipid nanoparticle.1005937956In another aspect there is provided a method of treating or preventing a fungal disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein an antifungal compound is present in the solid lipid nanoparticle. In another aspect there is provided a method of diagnosing a bacterial and / or fungal disease, disorder or condition, the method comprising: administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial and / or fungal species by at least 300% compared to an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle. In another aspect there is provided a method of diagnosing a bacterial disease, disorder or condition, the method comprising: administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by at least 300% compared to an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle. In another aspect there is provided a method of diagnosing a fungal disease, disorder or condition, the method comprising:1005937956administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by at least 300% compared to an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle. Optionally, the method further comprises analysing fluorescence in at least a portion of the subject or a sample from the subject to identify the location and / or quantity of bacteria and / or fungus. Any embodiment herein shall be taken to apply mutatis mutandis to any other embodiment unless specifically stated otherwise. The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally- equivalent products, compositions and methods are clearly within the scope of the invention, as described herein. Further aspects of the present invention and further embodiments of the aspects described in the preceding paragraphs will become apparent from the following description, given by way of example and with reference to the accompanying drawings. Brief description of the drawings Figure 1: FTIR spectra of PEG-100 stearate (top) and PEG-100 stearate carboxylate (bottom), wherein the PEG-100 stearate carboxylate was prepared as described in Example 1. Figure 2: Fluorescence microscope images of the aptamer functionalised fluorescent SLNs of Example 1 when exposed to A – Staphylococcus aureus (fluorescence microscopy), B – Staphylococcus aureus (visual microscopy), C – Staphylococcus epidermidis (fluorescence microscopy), D – Staphylococcus epidermidis (visual microscopy), E – Escherichia coli (fluorescence microscopy), F – Escherichia coli1005937956(visual microscopy), G – Staphylococcus aureus (light microscopy), H – Staphylococcus epidermidis (light microscopy), I – Escherichia coli (light microscopy), as described in Example 2. The scale bars in each image are 100 ^m. Figure 3: FTIR spectra of neutral red (top) and PEG-100 / neutral red conjugate (bottom), wherein the PEG-100 / neutral red conjugate was prepared as described in Example 2. Figure 4: A diagram of a conjugation method of the disclosure, using EDC / NHS. Figure 5: Microscope images of the SA31 functionalised fluorescent SLNs of Example 1 when exposed to Staphylococcus aureus (images on right = fluorescence microscopy; images on left = visual microscopy). The scale bars in each image are 100 ^m. Figure 6: Microscope images of the SA31 functionalised fluorescent SLNs of Example 1 when exposed to Escherichia coli (images on right = fluorescence microscopy; images on left = visual microscopy). The scale bars in each image are 100 ^m. Figure 7: Microscope images of the SA31 functionalised fluorescent SLNs of Example 1 without exposure to bacteria (image on right = fluorescence microscopy; image on left = visual microscopy). The scale bars in each image are 50 ^m. Figure 8: Microscope images of fluorescent SLNs of Example 4 when exposed to Acinetobacter baumannii (images on top = visual microscopy; images on bottom = fluorescence microscopy; images on left = no aptamer, FL0; images on right = Aci49 functionalised, FL-Aci49). The scale bars in each image are 50 µm. Figure 9: Microscope images of fluorescent SLNs of Example 4 when exposed to Candida albicans (images on top = visual microscopy; images on bottom = fluorescence microscopy; images on left = no aptamer, FL0; images on right = AD1 functionalised, FL- AD1). The scale bars in each image are 50 µm. Figure 10: Microscope images of fluorescent SLNs of Example 4 when exposed to Staphylococcus aureus (images on top = visual microscopy, images on bottom =1005937956fluorescence microscopy, images on left = FL-Aci49, images on right = FL-AD1). The scale bars in each image 50 µm. Figure 11: Fluorescence microscope images of Acinetobacter baumannii when exposed to fluorescent SLNs of Example 4 (left= Aci49 functionalised, FL-Aci49; right = no aptamer, FL0). The scale bars in each image are 50 µm. Figure 12: Fluorescence microscope images of Candida albicans when exposed to fluorescent SLNs of Example 4 (left = AD1 functionalised, FL-AD1; right = no aptamer, FL0). The scale bars in each image are 50 µm. Detailed description of the embodiments It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention. Definitions For purposes of interpreting this specification, terms used in the singular will also include the plural and vice versa. As used herein, except where the context requires otherwise, the term "comprise" and variations of the term, such as "comprising", "comprises" and "comprised", are not intended to exclude further additives, components, integers or steps. The terms "treatment" or "treating" of a subject includes delaying, slowing, stabilizing, curing, healing, alleviating, relieving, altering, remedying, less worsening, ameliorating, improving, or affecting the disease or condition, the sign or symptom of the disease or condition, or the risk of (or susceptibility to) the disease or condition. The term "treating" refers to any indication of success in the treatment or amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement; remission; lessening of the rate of worsening; lessening severity of the disease; stabilization, diminishing of signs or symptoms or making the injury, pathology or condition more tolerable to the individual; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating.1005937956In particularly preferred embodiments, the methods of the present invention can be to prevent or reduce the severity, or inhibit or minimise progression, of a sign or symptom of a disease or condition as described herein. As such, the methods of the present invention have utility as treatments as well as prophylaxes. As used herein, "preventing" or "prevention" is intended to refer to at least the reduction of likelihood of the risk of (or susceptibility to) acquiring a disease or disorder (i.e., causing at least one of the clinical signs or symptoms of the disease not to develop in an individual that may be exposed to or predisposed to the disease but does not yet experience or display signs or symptoms of the disease). Biological and physiological parameters for identifying such patients are provided herein and are also well known by physicians. Herein, the term “subject” or “patient" can be used interchangeably with each other. The term “individual” or “patient” refers to an animal that is treatable by the compound and / or method, respectively, including but not limited to, for example, dogs, cats, horses, sheep, pigs, cows, and the like, as well as human, non-human primates. Unless otherwise specified, the “subject” or “patient” may include both male and female genders. Further, it also includes a subject or patient, preferably a human, suitable for receiving treatment with a pharmaceutical composition and / or method of the present invention. "About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, in some instances ±5%, in some instances ±1%, and in some instances ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers1005937956within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. As used herein, a solid lipid nanoparticle is a nanoparticle possessing a solid lipid core that is stabilised by at least one surfactant. Suitable lipids include triglycerides, diglycerides, monoglycerides, fatty acids, steroids and waxes. In some embodiments, the lipid is one or more fatty acids. Solid lipid nanoparticles In one aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is not loaded with a therapeutic or diagnostic compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by at least about 300% compared to an equivalent solid lipid nanoparticle that does not comprise the aptamer, and wherein the nanoparticle is loaded with a fluorescent compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by at least about 300% compared to an equivalent solid lipid nanoparticle that does not comprise the aptamer, and wherein the nanoparticle is loaded with a fluorescent compound.1005937956In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer with an affinity for a bacterial species, and wherein the nanoparticle is loaded with a fluorescent compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer with an affinity for a fungal species, and wherein the nanoparticle is loaded with a fluorescent compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with an antibiotic compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with a fluorescent compound and an antibiotic compound. In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with an antifungal compound.1005937956In another aspect, there is provided a solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with a fluorescent compound and an antifungal compound. In some embodiments, the solid lipid nanoparticle consists of a fatty acid esterified with polyethylene glycol, a non-ionic surfactant, a non-esterified fatty acid, an aptamer and an antibiotic compound, wherein the polyethylene glycol is functionalised with an aptamer, wherein the nanoparticle is loaded with an antibiotic compound. In some embodiments, the solid lipid nanoparticle consists of a fatty acid esterified with polyethylene glycol, a non-ionic surfactant, a non-esterified fatty acid, an aptamer and an antifungal compound, wherein the polyethylene glycol is functionalised with an aptamer, wherein the nanoparticle is loaded with an antifungal compound. In some embodiments, the solid lipid nanoparticle consists of a fatty acid esterified with polyethylene glycol, a non-ionic surfactant, a non-esterified fatty acid, an aptamer and a fluorescent compound, wherein the polyethylene glycol is functionalised with an aptamer, wherein the nanoparticle is loaded with a fluorescent compound. In some embodiments, the solid lipid nanoparticle consists of a fatty acid esterified with polyethylene glycol, a non-ionic surfactant, a non-esterified fatty acid, an aptamer, an antibiotic compound and a fluorescent compound, wherein the polyethylene glycol is functionalised with an aptamer, wherein the nanoparticle is loaded with an antibiotic and a fluorescent compound.1005937956In some embodiments, the solid lipid nanoparticle consists of a fatty acid esterified with polyethylene glycol, a non-ionic surfactant, a non-esterified fatty acid, an aptamer, an antifungal compound and a fluorescent compound, wherein the polyethylene glycol is functionalised with an aptamer, wherein the nanoparticle is loaded with an antifungal and a fluorescent compound. In some embodiments, the solid lipid nanoparticle consists of a fatty acid esterified with polyethylene glycol, a non-ionic surfactant, a non-esterified fatty acid, one or more aptamer(s), an antibiotic compound, an antifungal compound and a fluorescent compound, wherein the polyethylene glycol is functionalised with an aptamer, wherein the nanoparticle is loaded with an antibiotic, an antifungal and a fluorescent compound. Conjugation In some embodiments, the aptamer is conjugated to the polyethylene glycol through an amide functionality. In some embodiments, the aptamer is conjugated to the polyethylene glycol only through an amide functionality. In some embodiments, the aptamer is conjugated to the polyethylene glycol through a thioester functionality. In some embodiments, the aptamer is conjugated to the polyethylene glycol only through a thioester functionality. Polyethylene glycol In some embodiments, the polyethylene glycol comprises about 300 to about 20000 kDa of ethylene oxide units. In some embodiments, the polyethylene glycol comprises masses from about 1000 to about 15000 kDa, from about 2000 to about 12000 kDa, from about 3000 to about 10000 kDa, from about 3000 to about 8000 kDa, from about 3500 to about 6000 kDa, or from about 4000 to about 5000 kDa of ethylene oxide units.1005937956In some embodiments, the polyethylene glycol comprises about 99 ethylene oxide units. In embodiments where a fatty acid is esterified with PEG-100 and the other terminus of the PEG-100 is oxidised in order to facilitate functionalisation with an aptamer, this results in 99 ethylene oxide units. In some embodiments, polyethylene glycol is the only glycol present. In some embodiments, the aptamer is conjugated to the solid lipid nanoparticle only through polyethylene glycol. Fatty acid In some embodiments, the fatty acid chain length is C8-C35, C10-C30, C12-C24, C14- C20, C8-C18, C12-C20, or C16-C20. In some embodiments, the fatty acid is saturated. In some embodiments, the fatty acid is unsaturated. In some embodiments, the fatty acid is linear. In some embodiments, the fatty acid is branched. In some embodiments, the fatty acid is one or more of caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, behenic acid, lignoceric acid, cerotic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linoelaidic acid, ^-linolenic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, and docosahexaenoic acid. In some embodiments, the fatty acid is stearic acid. In some embodiments, substantially all of the polyethylene glycol is esterified with a fatty acid. In some embodiments, substantially only one fatty acid is present in the solid lipid nanoparticle. Aptamer In some embodiments, the aptamer comprises a DNA sequence. In some embodiments, the aptamer comprises a RNA sequence. In some embodiments, the1005937956aptamer comprises a XNA sequence. In some embodiments, the aptamer comprises a peptide sequence. In some embodiments, the aptamer is chemically modified. In some embodiments, the 3’ end of the aptamer is capped, preferably with biotin or inverted thymidine. In some embodiments, the aptamer is not chemically modified. In some embodiments, the aptamer is naturally occurring. In some embodiments, the aptamer is not naturally occurring. In some embodiments the binding affinity of the aptamer was discovered using systematic evolution of ligands by exponential enrichment (SELEX). In some embodiments the binding affinity of the aptamer was not discovered using systematic evolution of ligands by exponential enrichment (SELEX). Aptamers are well-known in the art and have been described in numerous publications (for example, Pan et al 2018, Journal of Infection, 77(2): 83-98). Examples of sequences of aptamers are provided as examples in Table A. Table A: Sequences of aptamers SEQ Description Sequence ID NO: 1 AD1 GCGGAATTCGAACAGTCCGAGCCCACACGTGTG AGAAGGGTGTTATCATGTATTTCGTGTTCCTTTCG TCATTCCTTTGTCTGGGGTCAATGCGTCATAGGAT CCCGCAAAAAAAAAA 2 Aci49 TACATGGTCAACCAAATTCTTGCAAATTCTGCATT CCTACTGT 3 MPT64-A1 GGGAGCTCAGAATAAACGCTCAAAAACGCTCAAG AGGCCCGGATCTTCGACATGAGGCCCGGATC 4 G43 TAATACGACTCACTATAGGGAGACAAGACTAGAC GCTCAAAATAGGAACTTAGAACAACCCTCTCCCT CATGTAGCGAACCCGAACCAGGTTCGACATGAGA CTCACAACAGTTCCCTTTAGTGAGGGTTAATT1005937956G78 TAATACGACTCACTATAGGGAGACAAGACTAGAC GCTCAAGCGTTTAAACGTTGCACCGTCGTTGACG GGACCGCTTGAGACATTCGCTCTTCGACATGAGA CTCACAACAGTTCCCTTTAGTGAGGGTTAATT MA1 GGGAGCTCAGAATAAACGCTCAACGGATTAGTCA ATAGACTGGTGGCTTTGTGTGGTGTTCGACATGA GGCCCGGATC Aptamer 1 GGGAGCTCAGAATAAACGCTCAACCCTGCGGGG CTGCCCGATATGTGTCCAAGTGGTGTTCGACATG AGGCCCGGATC Aptamer 33 TATGGCGGCGTCACCCGACGGGGACTTGACATT ATGACAG Aptamer 45 GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACC GAGTAA C4 ACGGGCGTGGGGGCAATGCCTGCTTGTAGGCTT CCCCTGTGCGCG ST2P ATAGGAGTCACGACGACCAGAAAGTAATGCCCG GTAGTTATTCAAAGATGAGTAGGAAAAGATATGTG CGTCTACCTCTTGACTAAT SAL 26 TAGCTCACTCATTAGGCACATTTGTGGCACCAAAT TTGAATTAATCAAGACAGTGTGGTGCATAGTTAAG CCAGCC Apt22 ATGGACGAATATCGTCTCCCAGTGAATTCAGTCG GACAGCG S25 (RNA) GGGUUCACUGCAGACUUGACGAAGCUUGAGAG AUGCCCCCUGAUGTGCAUUCUUGUUGUGUUGC GGCAAUGGAUCCACAUCTACGAAUUC Crn-1 AAGGGCTGGCTGGGATGGACCCTCCCGAAACGA GCTGTCTCTTAACGGAAGCTAATCTGCCTCACTC CACGGACCCCACT Crn-2 AAGGGCTGGCTGGGATGGATGTAAGAAGGGAGG AAAGGACCTAAGACCTGCTATATTGCGATCACTCC ACGGACCCCACT1005937956APTSEB1 GGTATTGAGGGTCGCATCCACTGGTCGTTGTTGT CTGTTGTCTGTTATGTTGTTTCGTGATGGCTCTAA CTCTCCTCT C10 AGCAGCACAGAGGTCAGATGTATACTTCTAAAATT TGTTTGTATCTACGATGTTCTTCGTCCTATGCGTG CTACCGTGAA R12.06 TGTACCGTCTGAGCGATTCGTACGATTACTATAAT TTCCTATCGTCCGACCGCCGTCAGCCAGTCAGTG TTAAGGAGTGC Antibac1 TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGC TGCTCCCCCCGCATCGTCCTCCC Antibac2 TCGCGCGAGTCGTCTGGGGGACTAGAGGACTTG TGCGGCCCCGCATCGTCCTCCC PA#2 / 8 ATACCAGCTTATTCAATTAGCAACATGAGGGGGAT AGAGGGGGTGGGTTCTCTCGGCTACAATCGTAAT CAGTTAG SA20 GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAA GTTCTGCGTTAT SA23 GGGCTGGCCAGATCAGACCCCGGATGATCATCC TTGTGAGAACCA SA31 TCCCACGATCTCATTAGTCTGTGGATAAGCGTGG GACGTCTATGA SA34 CACAGTCACTCAGACGGCCGCTATTGTTGCCAGA TTGCCTTTGGC SA43 TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCC CACAGCTACGT SA17 TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTC CCAGCCTCACACCGCCACCGTGCTACAAC SA61 TCCCTACGGCGCTAACCTCCCAACCGCTCCACC CTGCCTCCGCCTCGCCACCGTGCTACAAC1005937956A8 ATCCATGGGGCGGAGATGAGGGGGAGGAGGGC GGGTACCCGGTTGAT Lbi-17 GCAAGATCTCCGAGATATCGGAGGGAAGAAGGG CCAGCACAGATCAGATCAATCGCTCCGGCTGCA GGTAATACGTATACT LMCA2 ATACCAGCTTATTCAATTCCAAAAGCGCACCCATA TATGTTCTATGTCCCCCACCTCGAGATTGCACTTA CTATCT LMCA26 ATACCAGCTTATTCAATTCGATGGGGATTACTTATC ATGAGAAACCAGCAGCATTTGAGATTGCACTTAC TATCT E-5 ATCCGTCACACCTGCTCTGGTGGAATGGACTAAG CTAGCTAGCGTTTTAAAAGGTGGTGTTGGCTCCC GTAT E-11 ATCCGTCACACCTGCTCTGTAAGGGGGGGGAAT CGCTTTCGTCTTAAGATGACATGGTGTTGGCTCC CGTAT E-12 ATACGGGAGCCAACACCACAGCTGATATTGGATG GTCCGGCAGAGCAGGTGTGACGGAT E-16 ATCCGTCACACCTGCTCTATCCGTCACGCCTGCT CTATCCGTCACACCTGCTCTGGTGTTGGCTCCCG TAT E-17 ATCCGTCACACCTGCTCTATCAAATGTGCAGATAT CAAGACGATTTGTACAAGATGGTGTTGGCTCCCG TAT E-18 ATCCGTCACACCTGCTCTGTAGATGGCAAGGCAT AAGCGTCCGGAACGATAGAATGGTGTTGGCTCC CGTAT E-19 ATCCGTCACACCTGCTCTGTAGATGGCAAGGCAT AAGCGTCCGGAACGATAGAATGGTGTTGGCTCC CGTAT AM-6 CGTGATGATGTTGAGTTGGGGTGATGGGTGCATG TGATGAAAGGGGTTCGTGCTATGCTGTTTTGTCT1005937956AATAATACTAGTCCTTGCCAAGGTTTATTCCAGTAA TGCCAACCAATCT Apt B12 TGGGAGCTCAGAATAAACGCTCAAGGCACACAG GACTATACAGTGTTGCAGTGTTGCTGTTCGACAT GAGGCCCGGATCA E1 ACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCA TCCACTGAGCG E2 CCATGAGTGTTGTGAAATGTTGGGACACTAGGTG GCATAGAGCCG E10 GTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTT GTGAATACCCTGGG E12 GCGAGGGCCAACGGTGGTTACGTCGCTACGGCG CTACTGGTTGAT Ec3(31) (RNA) UUCAAUUGCACGAAUUUGCUGUGUUUUUGGG 8.28A (underlined TCCTCGCGTTTGGATTCATGTTGGTTTGTCGGTG nucleotides are TATTGT phenol-modified dUTP – at positions 1, 4, 9, 10, 11, 15, 16, 19, 21, 22, 25, 26, 27, 29, 33, 35, 37, 38 and 40) ZXL1 GGATCCTATGACGCATTGACCCGGCGCCATAGCG ACGGGGCCATTCCAAGAAGGCTCGGACTGTTCC CTATAGTGAGTCGTATTAG BM2 GCGGAATTCTAATACGACTCACTATAGGGAACAGT CCGAGCCCCCCATGAACTAGGCTCCACAATGAGT TTGGGGGTCAATGCGTCATA Mtb-Apt1 CGAGTGAGGGCGAGGCGCGCTCCTGCCGGT Mtb-Apt6 CGGCCAGGGGACGAGCGCGCCCTGATCGTG S-PS8.4 (RNA) UCACUGUUAUCCGAUAGCAGCGCGGGAUGA100593795654 S3 CCCGCCTCTGAGCATTATTAATGTTATACCTTACG GCTGG Methods of synthesis, purification, and characterisation of aptamers are also known in the art. Without being bound by the examples provided, the skilled person is aware that the present invention may be used with any suitable aptamer. Methods of synthesis and characterisation of some aptamers are provided as examples in Table B. Table B: Examples of aptamers Aptamer Reference AD1 Clack et al, Micromachines (Basel) 2024, 15(2):216 Aci49 Rasoulinejad et al (2016) Journal of Biotechnology, 231: 46-54 T9 Tang et al (2016) J Infect; 72(5):573-86 Ce24 Tang et al (2014) J Infect; 69(6):569-80 CE15 CSIR 2.11 Rotherham et al (2012) PLoS One; 7(10):e46862. MPT64-A1 Qin et al (2009) Clin Chem Lab Med;47(4):405-11 Zhu et al (2012) BMC Infect Dis; 12:96 G43 Ngubane et al (2014) Biochem Biophys Res Commun; 449(1):114-9 G78 MA1 Aimaiti et al (2015) Appl Microbiol Biotechnol; 99(21):9073-83 Aptamer 1 Zhang et al (2017) Biosens Bioelectron; 98:261-266 Aptamer 33 Joshi et al (2009) Mol Cell Probes; 23(1):20–8.1005937956Aptamer 45 Ma et al (2014) J Microbiol Methods; 98: 94–98. I-2 Han and Lee (2013) J Microbiol Biotechnol; 23(6): 878–84. C4 Moon et al (2013) J Microbiol Methods; 95(2): 162–6. ST2P Duan et al (2013) J Agric Food Chem; 61(13): 3229–34. SAL 26 Lavu et al (2016) ACS Comb Sci;18(6): 292–301. Apt22 Yang et al (2013) Sensors;13(5): 6865–81. S25 Hyeon et al (2012) J Microbiol Methods; 89(1): 79–82. Crn-1 Bayrac et al (2017) Biosens Bioelectron; 98 :22–8. Crn-2 APTSEB1 DeGrasse (2012) PLoS One; 7(3): e33410. C10 Huang et al (2015) Food Chem; 166: 623–9. R12.06 Hong et al (2015) Int J Mol Sci; 16(2): 2794–809. Antibac1 Ferreira et al (2014) Appl Biochem Biotechnol; 174(7): 2548–56. Antibac2 PA#2 / 8 Stoltenburg et al (2015) PLoS One; 10(7): e0134403. SA20 Cao et al (2009) Nucleic Acids Research, 37(14): 4621-4628, Supplementary data SA23 Borsa et al (2016) Biosens Bioelectron; 86:27–32. SA31 SA34 SA43 SA17 Chang et al (2013) Sci Rep; 3:1863.1005937956SA61 A8 Ohk et al (2010) J Appl Microbiol 2010; 109(3): 808–17. LLo-3 Bruno et al (2015) J Fluoresc; 25(1): 173–83. Lbi-17 Suh and Jaykus (2013) J Biotechnol; 167(4): 454–61. LMCA2 Wang et al (2017) Nanoscale; 10(1):132–41. LMCA26 E-5 Bruno et al, US 20090186342 E-11 E-12 E-16 E-17 E-18 E-19 AM-6 Amraee et al (2017) Anal Biochem; 536: 36–44. Apt B12 Peng et al (2014) J Fluoresc; 24(4): 1159–68. E1 Kim et al (2013) Anal Biochem; 436(1): 22–8. E2 Guo et al (2016) Biosens Bioelectron; 75:315–19. E10 E12 Ec3(31) Dua et al (2016) Mol Cells; 39(11): 807–13. 8.28A Renders et al (2017) Org Biomol Chem; 15(9): 1980–1989.1005937956NK2 Chen et al (2007) Biochem Biophys Res Commun; 357(3): 743– 8. ZXL1 Pan et al (2014) Mol Ther; 22(5): 940–51. BM2 Sun et al (2016) J Am Chem Soc; 138 (36): 11680–9. Mtb-Apt1 Baig et al (2015) Biochim Biophys Acta; 1854(10 Pt A): 1338–50. Mtb-Apt6 S-PS8.4 Pan et al (2005) Antimicrob Agents Chemother; 49(10): 4052–60. Zelada-Guillen et al (2009) Angew Chem Int Ed Engl; 48(40): 7334–7. S3 Wang et al (2016) Toxicon; 119: 21–7. At-33 Vivekananda et al (2014) Biochem Biophys Res Commun; 444(3): 433–8. AT-36 In some embodiments, the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by at least about 300%, about 400%, about 500%, or about 600% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer. In some embodiments, the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by less than about 10,000% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer. In some embodiments, the bacterial species is pathogenic. In some embodiments, the bacterial species is Gram-negative. In some embodiments, the bacterial species is Gram-positive. In some embodiments, the aptamer increases affinity for a species of Gram- negative bacteria. In some embodiments, the aptamer increases affinity for a species of Gram-positive bacteria. In some embodiments, the bacterial species is selected from the group of therapeutically relevant bacterial species consisting of: Enterococcus faecium,1005937956Staphylococcus aureus, Klebsiella pneumoniae, Streptococcus pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp. In some embodiments, the aptamer is selected from the group with affinities for the therapeutically relevant bacterial species consisting of: Mycobacterium tuberculosis (including M. tb Beijing strains, M. tb H37Rv), Salmonella enterica, Listeria monocytogenes, Escherichia coli, Bacillus Calmette–Guérin (BCG) vaccine, Salmonella Typhi, Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Streptococcus pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp. In some embodiments, the aptamer is selected from the group with affinities for the therapeutically relevant bacterial species consisting of: Mycobacterium tuberculosis (including M. tb Beijing strains, M. tb H37Rv), Salmonella Typhimurium, Salmonella Paratyphi A, Salmonella Enteridis, Listeria monocytogenes, Escherichia coli (including E. coli O157, E. coli K88, E. coli KCTC 2571, E. coli DH5^), Bacillus Calmette– Guérin (BCG) vaccine, Salmonella Typhi, Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Streptococcus pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp. In some embodiments, the aptamer is selected from the group with affinities for the therapeutically relevant bacterial species consisting of: Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Streptococcus pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp. In some embodiments, the aptamer has affinity for Staphylococcus aureus. In some embodiments, the aptamer has affinity for Acinetobacter baumannii. In some embodiments, the aptamer increases affinity for a species of fungus. In some embodiments, the aptamer is selected from the group with affinities for the therapeutically relevant fungal species consisting of Candida glabrata, Candida parapsilosis, Candida tropicalis, Candida auris, Candida albicans, Aspergillus fumigatus, Cryptococcus neoformans, Cryptococcus neoformans, Histoplasma spp., Fusarium spp., Scedosporium spp., Cryptococcus gattii, Talaromyces marneffei, Caccidiodes spp., Pneumocystis jirovecci, Paraccidioides spp. and Pneumosystis carinii. In some embodiments, the fungal species is selected from the group consisting of: consisting of Candida glabrata, Candida parapsilosis, Candida tropicalis, Candida auris and Candida albicans; preferably the group consisting of Candida glabrata, Candida parapsilosis,1005937956Candida tropicalis, Candida auris. In some embodiments, the fungal species is Candida albicans. In some embodiments, the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by at least about 300%, about 400%, about 500%, or about 600% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer. In some embodiments, the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by less than about 10,000% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer. In some embodiments, the fungal species is pathogenic. In some embodiments, the aptamer is selected from the group consisting of: AD1, Aci49, T9, Ce24, CE15, CSIR 2.11, MPT64-A1, G43, G78, MA1, Aptamer 1, Aptamer 33, Aptamer 45, I-2, C4, ST2P, SAL 26, Apt22, S25, Crn-1, Crn-2, APTSEB1, C10, R12.06, Antibac1, Antibac2, PA#2 / 8, SA20, SA23, SA31, SA34, SA43, SA17, SA61, A8, LLo-3, Lbi-17, LMCA2, LMCA26, E-5, E-11, E-12, E-16, E-17, E-18, E-19, AM-6, Apt B12, E1, E2, E10, E12, Ec3(31), 8.28A, NK2, ZXL1, BM2, Mtb-Apt1, Mtb-Apt6, S-PS8.4, S3, At- 33 and AT-36. In some embodiments, the aptamer is selected from the group consisting of: Aci49, T9, Ce24, CE15, CSIR 2.11, MPT64-A1, G43, G78, MA1, Aptamer 1, Aptamer 33, Aptamer 45, I-2, C4, ST2P, SAL 26, Apt22, S25, Crn-1, Crn-2, APTSEB1, C10, R12.06, Antibac1, Antibac2, PA#2 / 8, SA20, SA23, SA31, SA34, SA43, SA17, SA61, A8, LLo-3, Lbi-17, LMCA2, LMCA26, E-5, E-11, E-12, E-16, E-17, E-18, E-19, AM-6, Apt B12, E1, E2, E10, E12, Ec3(31), 8.28A, NK2, ZXL1, BM2, Mtb-Apt1, Mtb-Apt6, S-PS8.4, S3, At- 33 and AT-36. In some embodiments, the aptamer is SA31. In some embodiments, the aptamer is SA31 or Aci49. In some embodiments, the aptamer is AD1. In some embodiments, the aptamer is Aci49. In some embodiments, the aptamer is selected from the group consisting of: T9, Ce24, CE15, CSIR 2.11, MPT64-A1, G43, G78, MA1, Aptamer 1, Aptamer 33, Aptamer 45, I-2, C4, ST2P, SAL 26, Apt22, S25, Crn-1, Crn-2, APTSEB1, C10, R12.06, Antibac1, Antibac2, PA#2 / 8, SA20, SA23, SA31, SA34, SA43, SA17, SA61, A8, LLo-3, Lbi-17, LMCA2, LMCA26, E-5, E-11, E-12, E-16, E-17, E-18, E-19, AM-6, Apt B12, E1, E2, E10, E12, Ec3(31), 8.28A, NK2, ZXL1, BM2, Mtb-Apt1, Mtb-Apt6, S-PS8.4, S3, At-33 and AT- 36.1005937956In some embodiments, essentially all of the surfactant in the suspension in the solid lipid nanoparticle is esterified with polyethylene glycol which is in turn functionalised with an aptamer. Surfactant As used herein, “surfactant” refers to a molecule in addition to the fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer. In some embodiments, the nanoparticle comprises a non-ionic surfactant. In some embodiments, the non-ionic surfactant is one of more of a fatty acid ethoxylate, alcohol ethoxylate and ethylene oxide / propylene oxide block copolymer. In some embodiments, the nanoparticle comprises a polysorbate surfactant. In some embodiments, the nanoparticle comprises a surfactant selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, and polysorbate 80. In some embodiments, the nanoparticle comprises polysorbate 20. In some embodiments, the nanoparticle comprises a fatty acid surfactant. In some embodiments the fatty acid surfactant is the same fatty acid as the fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer. In some embodiments, the fatty acid is one or more of caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, behenic acid, lignoceric acid, cerotic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linoelaidic acid, ^-linolenic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, and docosahexaenoic acid. In some embodiments, the fatty acid surfactant is stearic acid. In some embodiments, the nanoparticle comprises a non-ionic surfactant and a polysorbate surfactant. In some embodiments, the nanoparticle does not comprise an anionic surfactant. In some embodiments, the molar ratio of surfactant to aptamer functionalised molecules in the mixture immediately prior to nanoparticle formation is about 99.8% surfactant to about 40% surfactant, 99.8% surfactant to about 50% surfactant, about 99.4% surfactant to about 60% surfactant, about 99.5% surfactant to about 70% surfactant, about 99 % surfactant to about 75% surfactant, about 98% surfactant to about100593795680% surfactant, about 98% surfactant to about 90% surfactant, about 99.5% surfactant to about 80% surfactant, about 80% surfactant to about 40% surfactant, about 70% surfactant to about 50% surfactant, about 60% surfactant to about 50% surfactant, about 95% surfactant to about 65% surfactant, about 90% surfactant to about 70% surfactant, about 85% surfactant to about 75% surfactant, or about 82.6% surfactant. In some of these embodiments concerning molar ratios, the aptamer functionalised molecule is aptamer functionalised PEG-stearate. In some of these embodiments concerning molar ratios, the aptamer functionalised molecule is SA31 functionalised PEG-stearate. In some of these embodiments concerning molar ratios, the nanoparticle comprises a non-ionic surfactant and a polysorbate surfactant. In some embodiments, the molar ratio of surfactant to aptamer functionalised molecules in the nanoparticle is about 99.8% surfactant to about 40% surfactant, 99.8% surfactant to about 50% surfactant, about 99.4% surfactant to about 60% surfactant, about 99.5% surfactant to about 70% surfactant, about 99 % surfactant to about 75% surfactant, about 98% surfactant to about 80% surfactant, about 98% surfactant to about 90% surfactant, about 99.5% surfactant to about 80% surfactant, about 80% surfactant to about 40% surfactant, about 70% surfactant to about 50% surfactant, about 60% surfactant to about 50% surfactant, about 95% surfactant to about 65% surfactant, about 90% surfactant to about 70% surfactant, about 85% surfactant to about 75% surfactant, or about 82.6% surfactant. In some of these embodiments concerning molar ratios, the aptamer functionalised molecule is aptamer functionalised PEG-stearate. In some of these embodiments concerning molar ratios, the aptamer functionalised molecule is SA31 functionalised PEG-stearate. In some of these embodiments concerning molar ratios, the nanoparticle comprises a non-ionic surfactant and a polysorbate surfactant. In some embodiments, the molar ratio of non-ionic surfactant to aptamer functionalised molecules in the nanoparticle is about 99.8% non-ionic surfactant to about 40% non-ionic surfactant, 99.8% non-ionic surfactant to about 50% non-ionic surfactant, about 99.4% non-ionic surfactant to about 60% non-ionic surfactant, about 99.5% non- ionic surfactant to about 70% non-ionic surfactant, about 99 % non-ionic surfactant to about 75% non-ionic surfactant, about 98% non-ionic surfactant to about 80% non-ionic surfactant, about 98% non-ionic surfactant to about 90% non-ionic surfactant, about 99.5% non-ionic surfactant to about 80% non-ionic surfactant, about 80% non-ionic1005937956surfactant to about 40% non-ionic surfactant, about 70% non-ionic surfactant to about 50% non-ionic surfactant, about 60% non-ionic surfactant to about 50% non-ionic surfactant, or about 55% non-ionic surfactant. In some of these embodiments concerning non-ionic surfactant molar ratios, the aptamer functionalised molecule is aptamer functionalised PEG-stearate. In some of these embodiments concerning non-ionic surfactant molar ratios, the non-ionic surfactant is polysorbate 20. In some of these embodiments concerning non-ionic surfactant molar ratios, the aptamer functionalised molecule is SA31 functionalised PEG-stearate. In some of these embodiments concerning non-ionic surfactant molar ratios, the aptamer functionalised molecule is SA31 functionalised PEG-stearate and the non-ionic surfactant is polysorbate 20. In some embodiments, the molar ratio of fatty acid surfactant to aptamer functionalised molecules in the nanoparticle is about 99.8% fatty acid surfactant to about 40% fatty acid surfactant, about 95% fatty acid surfactant to about 50% fatty acid surfactant, about 90% fatty acid surfactant to about 60% fatty acid surfactant, about 85 % fatty acid surfactant to about 70% fatty acid surfactant, about 80% fatty acid surfactant to about 75% fatty acid surfactant, or about 77.8% fatty acid surfactant. In some of these embodiments concerning fatty acid surfactant molar ratios, the aptamer functionalised molecule is aptamer functionalised PEG-stearate. In some of these embodiments concerning fatty acid surfactant molar ratios, the fatty acid surfactant is stearic acid. In some of these embodiments concerning fatty acid molar ratios, the aptamer functionalised molecule is SA31 functionalised PEG-stearate. In some of these embodiments concerning fatty acid molar ratios, the aptamer functionalised molecule is SA31 functionalised PEG-stearate and the fatty acid surfactant is stearic acid. In some embodiments, the molar ratio of non-ionic surfactant to fatty acid surfactant is from about 5% non-ionic surfactant to about 50 % non-ionic surfactant, about 10% non-ionic surfactant to about 40 % non-ionic surfactant, about 15% non-ionic surfactant to about 35 % non-ionic surfactant, about 20% non-ionic surfactant to about 30 % non-ionic surfactant, or about 26% non-ionic surfactant. In some of these embodiments concerning surfactant molar ratios, the non-ionic surfactant is polysorbate 20. In some of these embodiments concerning surfactant molar ratios, the fatty acid surfactant is stearic acid.1005937956Loading In some embodiments loaded with an antibiotic, the nanoparticle comprises an antibiotic that targets one or more of the bacterial cell wall, the cell membrane, interferes with essential bacterial enzymes, and inhibits bacterial protein synthesis. In some embodiments loaded with an antibiotic, the nanoparticle comprises one or more of bacitracin, mupirocin, neomycin, fusidic acid, polymyxin B, clindamycin, trimethoprim / sulfamethoxazole, linezolid, vancomycin, a carbapenem, ciprofloxacin, a penicillin, cephalosporin, polymyxin, rifamycin, lipiarmycin, quinolone, sulphonamide, macrolide, lincosamide, tetracycline, doxycycline, aminoglycoside, cyclic linopeptide, glycylcycline, oxazolidinone, and lipiarmycin. In some embodiments loaded with an antibiotic, the nanoparticle comprises one or more of a penicillin, cephalosporin, polymyxin, rifamycin, lipiarmycin, quinolone, sulphonamide, macrolide, lincosamide, tetracycline, aminoglycoside, cyclic linopeptide, glycylcycline, oxazolidinone, and lipiarmycin. In some embodiments loaded with an antibiotic, the nanoparticle comprises rifampicin. In some embodiments loaded with an antibiotic, the nanoparticle comprises ciprofloxacin. Other potential lipophilic antibiotics include fluoroquinolones, macrolides, tigecycline, tetracyclines, lincosamides and glycylcyclines. In some embodiments loaded with an antibiotic, the molar ratio of antibiotic to aptamer functionalised molecules in the nanoparticle is about 0.5% antibiotic to about 40% antibiotic, about 2% antibiotic to about 30% antibiotic, about 4% antibiotic to about 20% antibiotic, about 6% antibiotic to about 15% antibiotic, about 8% antibiotic to about 12% antibiotic, or about 11% antibiotic. In some embodiments loaded with an antifungal, the nanoparticle comprises an antifungal that targets one or more of the fungal cell wall, the cell membrane, interferes with essential fungal enzymes, and inhibits fungal protein synthesis. In some embodiments loaded with an antifungal, the nanoparticle comprises one or more of clotrimazole, nystatin, flucytosine, econazole, miconazole, econazole, itraconazole.and fluconazole. In some embodiments loaded with an antifungal, the nanoparticle comprises clotrimazole. In some embodiments loaded with an antifungal, the molar ratio of antifungal to aptamer functionalised molecules in the nanoparticle is about 0.5% antifungal to about100593795640% antifungal, about 2% antifungal to about 30% antifungal, about 4% antifungal to about 20% antifungal, about 6% antifungal to about 15% antifungal, about 8% antifungal to about 12% antifungal, or about 11% antifungal. In some embodiments loaded with a fluorescent compound, the nanoparticle comprises one or more xanthene derivatives, cyanine derivatives, squaraine derivatives and ring-substituted squaraines, squaraine rotaxane derivatives, naphthalene derivatives, coumarin derivatives, oxadiazole derivatives, anthracene derivatives, pyrene derivatives, oxazine derivatives, acridine derivatives, arylmethine derivatives, tetrapyrrole derivatives, and dipyrromethene derivatives. In some embodiments loaded with a fluorescent compound, the nanoparticle comprises one or more of fluorescein 5(6)- isothiocyanate, fluorescein, rhodamine, Oregon green, eosin, Texas red, cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, merocyanine, a Seta and / or Square dye, a Tau dye, a dansyl and / or prodan derivative, pyridyloxazole, nitrobenzoxadiazole, benzoxadiazole, anthraquinone (including DRAQ5, DRAQ7 and CyTRAK Orange), cascade blue, Nile red, Nile blue, cresyl violet, oxazine 170, proflavin, acridine orange, acridine yellow, auramine, crystal violet, malachite green, porphin, phthalocyanine, bilirubin, BODIPY, and aza-BODIPY. In some embodiments loaded with a fluorescent compound, the nanoparticle comprises fluorescein 5(6)-isothiocyanate. In some embodiments loaded with a fluorescent compound, the molar ratio of fluorescent compound to aptamer functionalised molecules in the nanoparticle is about 0.5% fluorescent compound to about 40% fluorescent compound, about 2% fluorescent compound to about 30% fluorescent compound, about 4% fluorescent compound to about 20% fluorescent compound, about 6% fluorescent compound to about 15% fluorescent compound, about 8% fluorescent compound to about 12% fluorescent compound, or about 11% fluorescent compound. In some embodiments loaded with a fluorescent compound, the fluorescent compound is the only compound for detection of the solid lipid nanoparticle. Compounds for detection of the solid lipid nanoparticle are compounds suitable for use in analytical studies / imaging such that they allow detection / visualisation of the presence of the solid lipid nanoparticles in a sample, such as tissue. Shape, size and charge1005937956In some embodiments, the nanoparticle is essentially spherical. In some embodiments, the nanoparticle has a mean diameter of about 10 to about 1000 nm, about 50 to about 800 nm, about 100 to about 600 nm, about 150 to about 500 nm, about 200 to about 500 nm, about 200 to about 400 nm, about to 10 to about 500, about to 10 to about 400, about to 10 to about 300, about to 50 to about 300, or about to 50 to about 200, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a polydispersity index of up to about 0.500, of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 10 to about 1000 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. IIn some embodiments, the nanoparticle has a mean diameter of about 50 to about 800 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 100 to about 600 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 150 to about 500 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 200 to about 500 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about10059379560.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 200 to about 400 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 10 to about 500 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 10 to about 400 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 10 to about 300 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 50 to about 300 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a mean diameter of about 50 to about 200 nm and a polydispersity index of about 0.020 to about 0.500, about 0.020 to about 0.200, about 0.040 to about 0.150, about 0.100 to about 0.400, about 0.100 to about 0.300, or about 0.100 to about 0.300, when measured using dynamic light scattering. In some embodiments, the nanoparticle has a zeta potential of about +100 mV to about -150 mV, about +100 mV to about 0 mV, about +50 mV to about -100 mV, about +50 mV to about 0 mV, about 0 mV to about -150 mV, about 0 mV to about -100 mV,1005937956about 0 mV to about -50mV, about +20 mV to about -60mV, about +10 mV to about -50 mV, about 0 mV to about -50mV, -5 mV to about -40 mV, about -5 mV to about -30 mV, about -15 mV to about -25 mV, about -10 mV to about -40 mV, or about -15 mV to about -40 mV, when measured using electrophoretic light scattering. In some embodiments, particle size is measured using dynamic light scattering angle of 173°, 13° and 90°. In some embodiments, particle size is measured using a device equipped with a 10 Watt laser with a 632.8 nm wavelength beam and an Avalanche photodiode detector. In some embodiments, zeta potential is measured using a device equipped with a 10 Watt laser with a 632.8 nm wavelength beam and an Avalanche photodiode detector. In some embodiments, particle size and / or zeta potential is measured using a Malvern Zeta-Sizer Ultra. Pharmaceutical composition In another aspect, there is provided a pharmaceutical composition comprising the solid lipid nanoparticle of any one of herein disclosed embodiments, and at least one pharmaceutically acceptable excipient, wherein a fluorescent and / or antibiotic compound is present in the solid lipid nanoparticle. Pharmaceutical compositions of the disclosure typically include a therapeutically effective amount of one or more active ingredients in admixture with one or more pharmaceutically and physiologically acceptable formulation materials. Suitable formulation materials include, but are not limited to, emulsifying agents, antioxidants, preservatives, coloring, flavoring and diluting agents, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles, diluents, excipients and / or pharmaceutical adjuvants. For example, a suitable vehicle may be water for injection, physiological saline solution, or artificial perilymph, possibly supplemented with other materials common in compositions for parenteral administration. Neutral buffered saline or saline mixed with serum albumin are further exemplary vehicles. A solid lipid nanoparticle may be administered in any form and route which makes the compound bioavailable. Compositions described herein may be administered systemically or directly to the site of condition or disease.1005937956Compositions described herein may be formulated from solid lipid nanoparticles for any appropriate route of administration including, for example, oral, rectal, nasal, vaginal, topical (including transdermal, buccal, ocular and sublingual), parenteral (including subcutaneous, intraperitoneal, intradermal, intravascular (for example, intravenous), intramuscular, spinal, intracranial, intrathecal, intraocular, periocular, intraorbital, intrasynovial and intraperitoneal injection, intracisternal injection as well as any other similar injection or infusion techniques), inhalation, insufflation, infusion or implantation techniques (e.g., as sterile injectable aqueous or non-aqueous solutions or suspensions). In some embodiments, the route of administration is parenteral (including subcutaneous, intraperitoneal, intradermal, intravascular (for example, intravenous), intramuscular, spinal, intracranial, intrathecal, intraocular, periocular, intraorbital, intrasynovial and intraperitoneal injection, intracisternal injection as well as any other similar injection or infusion techniques). In some embodiments, the route of administration is intravenous. In some embodiments, compositions described herein may be administered orally, nasally, intravenously, intramuscularly, topically, subcutaneously, rectally, vaginally or by urethral application. It will be understood, that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, number of doses, and rate of excretion, drug combination (i.e. other drugs being used to treat the patient), and the severity of the particular disorder undergoing therapy. The phrase “therapeutically effective amount” generally refers to an amount of one or more active ingredients of the invention that (i) treats the particular disease, condition, or disorder, (ii) attenuates, ameliorates, or eliminates one or more sign or symptoms of the particular disease, condition, or disorder, or (iii) delays the onset of one or more sign or symptoms of the particular disease, condition, or disorder described herein. Typically, a therapeutically effective dosage is formulated to contain a concentration (by weight) of at least about 0.1% up to about 50% or more, and all combinations and sub-combinations of ranges therein. The compositions can be1005937956formulated to contain one or more actives described herein in a concentration of from about 0.1 to less than about 50%, for example, about 49, 48, 47, 46, 45, 44, 43, 42, 41 or 40%, with concentrations of from greater than about 0.1%, for example, about 0.2, 0.3, 0.4 or 0.5%, to less than about 40%, for example, about 39, 38, 37, 36, 35, 34, 33, 32, 31 or 30%. Exemplary compositions may contain from about 0.5% to less than about 30%, for example, about 29, 28, 27, 26, 25, 25, 24, 23, 22, 21 or 20%, with concentrations of from greater than about 0.5%, for example, about 0.6, 0.7, 0.8, 0.9 or 1%, to less than about 20%, for example, about 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10%. The compositions can contain from greater than about 1% for example, about 2%, to less than about 10%, for example about 9 or 8%, including concentrations of greater than about 2%, for example, about 3 or 4%, to less than about 8%, for example, about 7 or 6%. The active agent can, for example, be present in a concentration of about 5%. In all cases, amounts may be adjusted to compensate for differences in amounts of active ingredients actually delivered to the treated cells or tissue. The frequency of administration may be once daily, 2, 3 or 4 times daily. The treatment period may be for the duration of the detectable disease. Applications The present disclosure provides methods of using the solid lipid nanoparticles and compositions as described in any one of the foregoing paragraphs. The present disclosure also provides methods of delivering to a subject in need thereof a solid lipid nanoparticle or a composition (e.g., an effective amount of the compound or composition) of the present disclosure. In another aspect there is provided a method of delivering an active agent to a cell or tissue, the method comprising contacting the solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of any one of herein disclosed embodiments, with the cell or tissue, wherein one or more of a fluorescent, antifungal or antibiotic compound is present in the solid lipid nanoparticle, thereby introducing the active agent into the cell or tissue.1005937956In another aspect there is provided a method of delivering an active agent to a cell or tissue, the method comprising contacting the solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of any one of herein disclosed embodiments, with the cell or tissue, wherein a fluorescent and / or antibiotic compound is present in the solid lipid nanoparticle, thereby introducing the active agent into the cell or tissue. In some embodiment wherein a fluorescent compound is present, the method further comprises analysing fluorescence in at least a portion of the subject or a sample from the subject. In another aspect there is provided a method of treating or preventing a bacterial and / or fungal disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein an antibiotic and / or fungal compound is present in the solid lipid nanoparticle. In another aspect there is provided a method of treating or preventing a bacterial disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein an antibiotic compound is present in the solid lipid nanoparticle. In another aspect there is provided a method of treating or preventing a fungal disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein an antifungal compound is present in the solid lipid nanoparticle.1005937956In another aspect there is provided a method of diagnosing a bacterial and / or fungal disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial and / or fungal species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle. In another aspect there is provided a method of diagnosing a bacterial disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle. In another aspect there is provided a method of diagnosing a fungal disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle.1005937956In another aspect there is provided use of a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of any one of herein disclosed embodiments, in the manufacture of a medicament for delivering an active agent to a cell or tissue, wherein one or more of a fluorescent, antifungal or antibiotic compound is present in the solid lipid nanoparticle, thereby introducing the active agent into the cell or tissue. In another aspect there is provided use of a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of any one of herein disclosed embodiments, in the manufacture of a medicament for delivering an active agent to a cell or tissue, wherein a fluorescent and / or antibiotic compound is present in the solid lipid nanoparticle, thereby introducing the active agent into the cell or tissue. In another aspect there is provided use of a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, in the manufacture of a medicament for treating or preventing a bacterial and / or fungal disease, disorder or condition, wherein an antibiotic and / or antifungal compound is present in the solid lipid nanoparticle. In another aspect there is provided use of a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, in the manufacture of a medicament for treating or preventing a bacterial disease, disorder or condition, wherein an antibiotic compound is present in the solid lipid nanoparticle. In another aspect there is provided use of a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed1005937956embodiments, in the manufacture of a medicament for treating or preventing a fungal disease, disorder or condition, wherein an antifungal compound is present in the solid lipid nanoparticle. In another aspect there is provided use of a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, in the manufacture of a medicament for diagnosing a bacterial and / or fungal disease, disorder or condition, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial and / or fungal species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle. In another aspect there is provided use of a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, in the manufacture of a medicament for diagnosing a bacterial disease, disorder or condition, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle. In another aspect there is provided use of a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, in the manufacture of a medicament for diagnosing a fungal disease, disorder or condition, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle.1005937956In another aspect there is provided a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of any one of herein disclosed embodiments, for use in delivering an active agent to a cell or tissue, wherein one or more of a fluorescent, antifungal or antibiotic compound is present in the solid lipid nanoparticle. In another aspect there is provided a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of any one of herein disclosed embodiments, for use in delivering an active agent to a cell or tissue, wherein a fluorescent and / or antibiotic compound is present in the solid lipid nanoparticle. In another aspect there is provided a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, for use in treating or preventing a bacterial disease, disorder or condition, wherein an antibiotic compound is present in the solid lipid nanoparticle. In another aspect there is provided a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, for use in treating or preventing a fungal disease, disorder or condition, wherein an antifungal compound is present in the solid lipid nanoparticle. In another aspect there is provided a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, for use in diagnosing a bacterial and / or fungal disease, disorder or condition, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial and / or fungal species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle.1005937956In another aspect there is provided a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, for use in diagnosing a bacterial disease, disorder or condition, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle. In another aspect there is provided a solid lipid nanoparticle of any one of herein disclosed embodiments, or the pharmaceutical composition of herein disclosed embodiments, for use in diagnosing a fungal disease, disorder or condition, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle. In some embodiments, the disease, disorder or condition is selected from the group consisting of sepsis, infection of an implant (such as a stent), food poisoning, a bacterial skin infection (such as impetigo, cellulitis, boils), a bacterial ear infection, a bacterial sinus infection, a bacterial throat infection (such as Strep throat), a bacterial lung disease (such as pneumonia, tuberculosis), a bacterial urinary tract infection, meningitis, a wound infection, sexually transmitted bacterial infection (such as chlamydia, gonorrhoea), Lyme disease, bacterial vaginosis, diarrhoea, superficial mycoses, cutaneous mycoses, subcutaneous mycoses, and systemic mycoses. In some embodiments, the disease, disorder or condition is selected from the group consisting of sepsis, infection of an implant (such as a stent), food poisoning, a bacterial skin infection (such as impetigo, cellulitis, boils), a bacterial ear infection, a bacterial sinus infection, a bacterial throat infection (such as Strep throat), a bacterial lung disease (such as pneumonia, tuberculosis), a bacterial urinary tract infection, meningitis, a wound infection, sexually transmitted bacterial infection (such as chlamydia, gonorrhoea), Lyme disease, bacterial vaginosis and diarrhoea. In some embodiments, the disease, disorder or condition is selected from the group consisting of sepsis, food poisoning, impetigo, and1005937956lung disease (such as pneumonia, tuberculosis). In some embodiments, the disease, disorder or condition is selected from the group consisting of superficial mycoses, cutaneous mycoses, subcutaneous mycoses, and systemic mycoses. In some embodiments, the disease, disorder or condition is not treatable with an equivalent dosage of antibiotic administered neat, ie in the absence of a nanoparticle of the disclosure, wherein equivalence is measured by weight of the antibiotic administered. In some embodiments, the disease, disorder or condition is not treatable with an equivalent dosage of antibiotic administered neat, ie in the absence of a nanoparticle of the disclosure, wherein equivalence is measured by the regularity and / or length of administration. In some embodiments, the disease, disorder or condition is not treatable with an equivalent dosage of antifungal administered neat, ie in the absence of a nanoparticle of the disclosure, wherein equivalence is measured by weight of the antifungal administered. In some embodiments, the disease, disorder or condition is not treatable with an equivalent dosage of antifungal administered neat, ie in the absence of a nanoparticle of the disclosure, wherein equivalence is measured by the regularity and / or length of administration. In some embodiments, the disease, disorder or condition is caused, at least partially, by a bacterial species selected from the group consisting of: Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Streptococcus pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp. In some embodiments, the disease, disorder or condition is caused, at least partially, by a Gram positive pathogenic bacteria. In some embodiments, the disease, disorder or condition is caused, at least partially, by a Gram negative pathogenic bacteria. In some embodiments, the disease, disorder or condition is caused, at least partially, by a fungal species selected from the group consisting of: Candida glabrata, Candida parapsilosis, Candida tropicalis, Candida auris, Candida albicans, Aspergillus fumigatus, Cryptococcus neoformans, Cryptococcus neoformans, Histoplasma spp., Fusarium spp., Scedosporium spp., Cryptococcus gattii, Talaromyces marneffei, Caccidiodes spp., Pneumocystis jirovecci, Paraccidioides spp. and Pneumosystis carinii. In some embodiments, the disease, disorder or condition is caused, at least partially, by1005937956a fungal species selected from the group consisting: Candida glabrata, Candida parapsilosis, Candida tropicalis, Candida auris and Candida albicans; preferably the group consisting of Candida glabrata, Candida parapsilosis, Candida tropicalis, Candida auris. In some embodiments, the disease, disorder or condition is caused, at least partially, by Candida albicans. In some embodiments, the disease, disorder or condition is not treatable with an equivalent dosage of antifungal administered neat, ie in the absence of a nanoparticle of the disclosure, wherein equivalence is measured by weight of the antifungal administered. In some embodiments, the disease, disorder or condition is not treatable with an equivalent dosage of antifungal administered neat, ie in the absence of a nanoparticle of the disclosure, wherein equivalence is measured by the regularity and / or length of administration. In some embodiments, diagnosis comprises ex-vivo analysis of a sample following contact with the solid lipid nanoparticle. In some embodiments, the sample is a biopsy. In some embodiments, the method further comprises performing a biopsy to obtain a sample of the subject. In some embodiments, the method further comprises contacting a biopsied sample with the solid lipid nanoparticle. In some embodiments concerning diagnosis, the aptamer is not naturally occurring. In some embodiments concerning diagnosis, the method further comprises administering an antibiotic in light of the analysis of fluorescence. In some embodiments concerning diagnosis, the method further comprises administering a solid lipid nanoparticle comprising an antibiotic in light of the analysis of fluorescence. In some embodiments concerning diagnosis, the method further comprises administering a solid lipid nanoparticle comprising an antibiotic as described herein in light of the analysis of fluorescence. In some embodiments concerning diagnosis, the method further comprises removing a bacterial infestation in light of the analysis of fluorescence. Removal may include surgical removal and / or mechanical cleaning (for instance, cleaning of a stent or other implant such as an artificial joint). Production In another aspect, there is provided a method for producing a solid lipid nanoparticle according to any one of herein disclosed embodiments, the method comprising:1005937956functionalising a molecule comprising polyethylene glycol with an aptamer. In some embodiments, the molecule comprising polyethylene glycol is oxidised prior to functionalisation. In some embodiments, the method further comprises oxidising the polyethylene glycol prior to functionalisation. In some embodiments, the oxidant is potassium permanganate. In some embodiments, functionalising a molecule comprising polyethylene glycol with an aptamer involves forming an amide bond. In some embodiments, the method further comprises activation of oxidised polyethylene glycol. In some embodiments, the activated oxidised polyethylene glycol is an acid halide. In some embodiments, the activated oxidised polyethylene glycol is an activated ester. In some embodiments, the activated oxidised polyethylene glycol is an acid anhydride. In some embodiments, activation involves use of a carbodiimide (such as dicyclohexylcarbodiimide or diisopropylcarbodiimide), an aminium / uranium (such as HATU, HBTU / TBTU or HCTU), a phospohonium (such as PyBOP or PyAOP), and / or propanephosphonic acid anhydride (T3P). In some embodiments, the activated ester is formed using EDC and NHS. In some embodiments, functionalising a molecule comprising polyethylene glycol with an aptamer involves forming a thioester bond. In some embodiments, the method further comprises contacting the molecule comprising polyethylene glycol with a surfactant. In some embodiments, the method further comprises contacting the molecule comprising oxidised polyethylene glycol with a surfactant. In some embodiments, the method further comprises microwave exposure of a molecule comprising polyethylene glycol and a surfactant, as well as optionally one or more of an antibiotic, antifungal or fluorescent compound, thereby forming a microemulsion. In some embodiments, the method further comprises microwave exposure of a molecule comprising polyethylene glycol and a surfactant, as well as optionally an antibiotic and / or fluorescent compound, thereby forming a microemulsion. In some embodiments, the molecule comprising polyethylene glycol is oxidised prior to microemulsion formation. In some embodiments, the method further comprises microwave exposure of a molecule comprising polyethylene glycol functionalised with an aptamer and a surfactant, as well as optionally one or more of an antibiotic, antifungal or1005937956fluorescent compound, thereby forming a microemulsion. In some embodiments, the method further comprises microwave exposure of a molecule comprising polyethylene glycol functionalised with an aptamer and a surfactant, as well as optionally an antibiotic and / or fluorescent compound, thereby forming a microemulsion. In some embodiments, the method further comprises heating the microemulsion. In some embodiments, the method further comprises heating the microemulsion to at least about 50 °C, to at least about 60 °C, to at least about 70 °C, or at least about 80 °C. In some embodiments, the microemulsion is heated for at least about 2 minutes, at least about 4 minutes, at least about 6 minutes, at least about 8 minutes, or at least about 10 minutes. In some embodiments, the microemulsion is stirred. In some embodiments, the microemulsion is stirred while being heated. In some embodiments, the microemulsion is heated via microwave irradiation. In some embodiments, at least an aliquot of the microemulsion is chilled. In some embodiments, at least an aliquot of the microemulsion is chilled in aqueous solution. In some embodiments, at least an aliquot of the microemulsion is chilled in water. In some embodiments, at least an aliquot of the microemulsion is chilled at about 15 °C or lower, at about 10 °C or lower, or at about 5 °C or lower. In some embodiments, the nanoparticle produced by the method has a loading capacity of greater than about 1%, greater than about 2%, greater than about 3%, greater than about 4%, greater than about 5%, or greater than about 6%. In some embodiments, the nanoparticle produced by the method has an encapsulation efficiency greater than about 30%, greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, or greater than about 75%. In some embodiments, the polyethylene glycol functionalised with an aptamer is added to the matrix prior to nanoparticle formulation, for instance, prior to formation using microwave assisted microemulsion. In some embodiments, the polyethylene glycol functionalised with an aptamer is added to the matrix subsequent to nanoparticle formulation. In some embodiments, addition subsequent to nanoparticle formation is achieved by diluting the nanoparticles in a mixture comprising the polyethylene glycol functionalised with an aptamer. In some embodiments, the diluted mixture of vortexed1005937956and / or incubated. In some embodiments, incubation is for at least about 10 minutes, about 20 minutes, at least about 30 minutes, at least about 45 minutes, at least about 1 hour, at least about 2 hours or at least about 3 hours. In some embodiments, incubation is for less than about 12 hours. SA31 conjugated oxidised PEG100 stearate (CJ) may be added to the matrix prior to nanoparticle formulation, for instance, prior to formation using microwave assisted microemulsion. SA31 conjugated oxidised PEG100 stearate (CJ) may be added to the matrix subsequent to nanoparticle formulation, for instance, prior to formation using microwave assisted microemulsion. AD1 conjugated oxidised PEG100 stearate may be added to the matrix prior to nanoparticle formulation, for instance, prior to formation using microwave assisted microemulsion. AD1 conjugated oxidised PEG100 stearate may be added to the matrix subsequent to nanoparticle formulation, for instance, prior to formation using microwave assisted microemulsion. Aci49 conjugated oxidised PEG100 stearate may be added to the matrix prior to nanoparticle formulation, for instance, prior to formation using microwave assisted microemulsion. Aci49 conjugated oxidised PEG100 stearate may be added to the matrix subsequent to nanoparticle formulation, for instance, prior to formation using microwave assisted microemulsion. Kit In another embodiment there is provided a kit or article of manufacture including one or more solid lipid nanoparticles, and / or pharmaceutical compositions as described above. In other embodiments there is provided a kit for use in a therapeutic application mentioned above, the kit including: a container holding one or more solid lipid nanoparticles and / or pharmaceutical compositions as described herein; a label or package insert with instructions for use.1005937956It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention. Examples A fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, can be synthesised following the outlined sequence of steps in Scheme 1 or similar as one skilled in the art may consider. The skilled person would be aware of numerous suitable oxidising agents, including potassium permanganate. The skilled person would be aware of numerous suitable amide bond forming conditions, including activation of the carboxylic acid through conversion to an activated ester, including using EDC and NHS. Activation of the carboxylic acid through other means is also suitable, for instance, through conversion to the corresponding acid chloride. One skilled in the art will recognise that utilising differential polyethylene glycol fatty acid esters and different aptamers would allow access to various fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, as disclosed herein. Scheme 1: Preparation of a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer. Example 1: Synthesis Materials and methods Materials used1005937956Synthesis grade stearic acid, and Tween® 20 (polysorbate 20); commercial grade N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) and N- Hydroxysuccinimide (NHS); and HPLC grade rifampicin and Fluorescein 5(6)- isothiocyanate were purchased from Sigma-Aldrich. MYRJ-S100 (PEG-100 stearate) were kindly donated by CRODA. Nutrient broth and nutrient agar powder were purchased from oxoid (ThermoFisher). The amino SA31 aptamer with an amino C7 tag was purchased from Merck’s custom oligo division. Unless otherwise indicated, all water used was filtered via Millipores MilliQ Plus® water purification system fitted with a Millipak® 40 filter unit (0.22 µm pore size). Preparation of the Aptamerized PEG stearate 0.5 mmol of PEG-100 stearate was dissolved in 50 mL of water, alongside 1 mmol potassium permanganate, and 1 mmol potassium hydroxide, under constant magnetic stirring. Upon the solution losing its purple colour the solution was centrifuged at 4000 rpm to remove the solidified magnesium oxide, and new 1 mmol potassium permanganate was added to the solution. This was repeated four times, with the pH being tested periodically, and potassium hydroxide added in 1 mmol increments if the pH dropped below 7. The pH was then adjusted to 2-3, and sodium chloride added to saturation. The now carboxylated PEG stearate was then removed from the aqueous phase via liquid-liquid extraction 5 times using dichloromethane as the organic phase. The dichloromethane was then airdried, and the PEG-100 stearate carboxylate was weighed and analysed via the Thermo Fisher Nicolet IS5 FTIR spectrometer, taking 24 rounds at 0.4 resolution. 35 µM of PEG-100 stearate carboxylate was dissolved in a solution containing 300 µM EDC and NHS, and incubated for 30 minutes. The SA31 aptamer with an amino C7 tag was then added at 100% excess the PEG-100 stearate carboxylate and the solution left under constant magnetic stirring for 2 hours for the conjugation to take place to afford SA31 conjugated oxidised PEG-100 stearate. Preparation of drug-free, antibiotic-loaded, and fluorescent solid lipid nanoparticles The stearic acid nanoparticles were prepared using the microwave assisted microemulsion technique pioneered by Shah et al., 2014, Journal of Colloid and Interface Science, 428, 286-294. Stearic acid (SA), polysorbate 20 (P20) and ultrapure water were all added to a 10 mL microwave synthesis tube; in the case of the antibiotic loaded SLNs,1005937956rifampicin (RF) was also added while fluorescein 5(6)-isothiocyanate (FL) was added in the case of the fluorescent probes (Table 1). The vial was capped then sealed in the sample chamber of CEM Labmate Microwave Synthesis System and the machines power (max 18 W) was auto adjusted until the temperature reached 80°C, upon which the temperature kept for 10 minutes while the solution underwent constant magnetic stirring, forming a microemulsion. The vial was then removed and a Terumo syringe fitted with a blunt tip was then used to remove the microemulsion and inject it into 50 mL of chilled (>5°C) water causing the droplets to solidify and form nanoparticles. Table 1: Solid lipid nanoparticle formulation in microwave tube (w / w) Formulation SA P20 Water RF FL Total SLN 6.25% 9.35% 84.4% - - 1.60 g SLN-RF 6.20% 9.30% 83.9% 0.6% - 1.70 g SLN-FL 6.25% 9.35% 84.1% - 0.3% 1.65 g SA31 conjugated oxidised PEG100 stearate (CJ) was inserted into the surfactant surface layer of the nanoparticles by diluting the nanoparticles in a solution containing 2 X 10-5M CJ, which was then vortexed and incubated for an hour. This afforded nanoparticles with a theoretical molar ratio of SA to CJ to P20 of 7:2:2.5. The skilled person will appreciate that SA31 conjugated oxidised PEG100 stearate (CJ) may be added to the matrix prior to nanoparticle formulation, for instance, prior to formation using microwave assisted microemulsion. Example 2: Characterisation Particle size and charge The particle size and zeta potential the samples were analysed via the Malvern Zetasizer Pro. The suspension was transferred to a folded capillary zeta cell and placed in the analysis chamber. The sample was calibrated at 25°C for 2 minutes then the particle size and polydispersity analysed via dynamic light scattering, using general purpose mode, while electrophoretic light scattering, auto mode, was used to analyse the1005937956zeta potential. In the case of all measurements the attenuation and process parameters were auto-selected by the Zetasizer Ultra-Pro ZS Xplorer software. Encapsulation Efficiency and Loading Capacity To determine the encapsulation efficiency and loading capacity of the incorporated compounds in the SLNs, the rifampicin-loaded SLNs and fluorescent SLNs were vacuum filtered through Whatman 41 filter paper to remove any encapsulated / insoluble drug. The SLN suspension was then centrifuged at 13,000 RPM for 30 minutes and the supernatant taken up via a Terumo syringe and filtered through a plastic 0.22 µm filter, before being refiltered through 10 kDa Amicon® Centrifugal Filter Units. The supernatant was then analysed via the Malvern Zetasizer to confirm the lack of nanoparticles. The vacuum filtered solution was then diluted by a factor of 10 in methanol, dissolving the nanoparticles and incorporated drug, while the ultrafiltered solution was diluted in methanol by the same factor. The soluble and insoluble fractions of the antibiotic nanoparticle suspension were analysed using a Thermo Scientific - Genesys 30 Visible Spectrophotometer at 330 nm to determine the concentration of rifampicin, while the soluble and insoluble fractions of the fluorescent probe suspension were analysed at 460 nm to determine the concentration of fluorescein 5(6)-isothiocyanate. Fluorescence microscopy of SLN biosensors A drop of water was placed on a sterile microscopic slide and a sterile loop was used to transfer an isolated colony of either Staphylococcus aureus, Escherichia coli or Staphylococcus epidermidis was transfer the slide. The water and colony were mixed to create a homogenous thin layer. The aptamer-functionalised PEG stearate was then post-inserted into the surfactant surface layer by diluting the fluorescent SLNs in a solution containing 2 X 10-5M aptamer, which was then vortexed and incubated for an hour. The smear was allowed to airdry then 50 µL of the aptamer functionalised SLNs were transferred to the smear, which was airdried again, then the smear was heat fixed to the slide. The slides were then analysed using a Nikon Eclipse Ti fluorescence microscope with a green filter to analyse the samples for fluorescent targeting. Minimum inhibitory concentration1005937956The minimum inhibitory concentration (MIC) was determined using the broth dilution method. Broth containing Staphylococcus aureus or Staphylococcus epidermidis was mixed with decreasing concentrations of either SLNs or rifampicin SLNs diluted in water, SLNs (unloaded and loaded with rifampicin) diluted and incubated for an hour in 2 X 10-5M aptamer solution (to post-insert aptamer into the SLNs surfactant layer) or an aqueous rifampicin solution. The solutions were homogenised and then subcultured onto nutrient agar plates and incubated for 48 hours at 37°C. The samples were observed for the presence of bacteria growth to determine the MIC. Results and Discussion Development of Aptamer Functionalised PEG stearate The aptamer functionalised PEG-100 stearate was prepared via a two-step process. The PEG stearate was oxidised using potassium permanganate in basic conditions replacing the hydroxyl group with a carboxylic acid group. Its presence was confirmed by FTIR. Comparing the IR spectrums, shown in Figure 1, it was observed that the unoxidized PEG stearate displayed a minor peak at around the ~1730 cm-1due to the carbonyl group connecting the PEG and stearate tail, while the oxidised PEG stearate showed a much larger peak at the same point due to the presence of a free carboxylic acid group. The carboxylated PEG stearates percentage yield (by weight) was determined to be 69% ± 10%. The second step involved conjugating the aptamer to the carboxylated PEG stearate through carbodiimide coupling. The PEG stearate added to a solution containing EDC, and NHS and incubated for 30 minutes before the aptamer was added and the solution left to sit under magnetic stirring for 120 minutes while the amine-aptamer was conjugated to the carboxyl group. To confirm the carbodiimide coupling method worked, the carboxylate PEG stearate was conjugated to an analogous molecule with an amine group, neutral red (which could be more easily analysed than the aptamer – which are large molecules and used at minute quantities). After the carbodiimide coupling was undertaken between the PEG stearate and neutral red, the sample was analysed via FTIR, as outlined in Figure 3. The PEG stearate conjugate had overlapping peak(s) at ~1625 cm-1and ~1600 cm-11005937956which are likely alkene and imine groups, respectively (Jafari, 2017, Application of Vibrational Spectroscopy in Organic Electronics), present in the neutral red, and correspond to the peak cluster at ~1600 cm-1on the neutral reds FTIR spectrum. The conjugated molecules fingerprint region in in the 800> cm-1range is also more like neutral reds spectrum than either of the PEG stearates as shown in Figure 3. The peaks present at the 3325~3180 cm-1range in the neutral red spectrum are significantly larger than those in conjugated molecule, where they are almost inexistent. This is likely due to both the fact that they are a comparatively smaller part of the molecule and that the conjugated molecules no longer contain a primary amine which was replaced with a secondary amine during the coupling process. Secondary amines tend to give far weaker signals in the 3000+ cm-1range. The above appears to confirm that the EDC / NHS coupling method is successful. A diagram of the conjugation method is outlined below (Figure 4). Characterization of SLNs Three stearic acid SLN formulations were produced using the microwave assisted microemulsion technique. In each case, stearic acid was used as the lipid, and polysorbate 20 was used as the emulsifying agent. The formulations developed were an unloaded stearic acid SLN, a rifampicin loaded SLN with the rifampicin added totalling 10% of the stearic acid, and a fluorescein loaded SLN with fluorescein added totalling 5% the mass of the stearic acid. Prior to incorporation of aptamer, the SLN formulations were as described in Table 1. Aptamer-PEG conjugate was added post SLN synthesis and the quantity of aptamer-PEG conjugate was equivalent to 10-20% (w / w) of total polysorbate 20 in the sample by mass. As seen in Table 2, little change in particle size was observed when fluorescein was incorporated while the size and polydispersity of rifampicin loaded particles rose markedly compared to unloaded SLNs. Particle size often (though not universally depending) increased as higher drug loading percentage is increased which could explain the increase in particle size when rifampicin is added, or alternatively other structures such as micelles or nanosuspensions. The SLN suspension and supernatants were then analysed via photo spectroscopy to determine the amount of incorporated drug. The encapsulation efficiency of the rifampicin into the SLNs was 60.8% ± 4.5%, resulting in a total loading capacity of 6.1% ± 0.5%, while when fluorescein1005937956was added to the SLN formulation, an encapsulation efficiency of 78.1 ± 3.2, and a total loading capacity of 3.9% ± 2% was achieved, unsurprisingly as fluorescein isothyanate is a more hydrophobic than rifampicin (Sigma, 1997, Sigma, 2008). Table 2: Characterisation of prepared SLN formulations Diameter Polydispersity Zeta potential Encapsulation Loading Formulation (nm) index (mV) Efficiency (%) capacity (%) SLN 267.3 ± 2.7 0.127 ± 0.034 -12.6 ± 2.4 - - SA31+SLN 274.5 ± 1.1 0.235 ± 0.047 -31.2 ±1.5 - - SLN-FL 280 ± 1.3 0.061 ± 0.01 -12.3 ±1.8 78.1% ± 3.9% ± 0.4% SA31+SLN- 3.2% 281.8 ± 20.3 0.211 ± 0.068 -21.8 ±1.8 FL SLN-RF 382.4 ± 4.4 0.129 ± 0.027 -15.8 ±1.1 60.8 ± 4.5% 6.1 ± 0.5% SA31+SLN- 420.4 ± 19.5 0.351 ± 0.007 -20.3 ±0.1 RF The aptamer functionalised particles all saw minor increases in particle size and had more negative zeta potentials than the unfunctionalized particles. This suggests that the negatively charged PEG stearate DNA conjugate was successfully post-inserting into the surfactant layer surrounding the nanoparticle, similar to how PEG conjugates insert into lipid bilayer of liposomes. Fluorescence Microscopy To determine if the SLNs could be specifically targeted to bacteria, the fluorescein loaded SLNs of Table 2 were adapted as fluorescent biosensors used to target Staphylococcus aureus specifically. A method mimicking Gram staining was developed to visualise the relationship between the SLNs and the bacterial cells, under fluorescence microscopy. A bacterial colony was transferred via a sterile loop to a drop of water on a bacterial slide and emulsified to create a smear, which was then airdried in a fume hood.1005937956SLNs with and without aptamers were diluted by a factor of 100 and 50 µL transferred to the smear which was then airdried and the smear then heat fixed via Bunsen burner. The smears were then analysed via the Nikon Eclipse Ti-S / L100, using a green filter. As observed in Figure 2 and Figure 5, the SA31 aptamer-functionalised fluorescent loaded SLNs, when exposed to the Staphylococcus aureus cells, resulted in a very clear fluorescent visualisation of the cell cultures, corresponding to the non-fluorescence microscope image. This suggests the fluorescein loaded NPs are concentrating around the bacterial cells. This was in contrast to SA31 aptamer-functionalised nanoparticles exposed to Escherichia coli colonies – which were clearly visible under light microscopy but not under fluorescent microscopy as observed in Figure 6. As shown in Figure 2, when the SA31 aptamer-functionalised nanoparticles were exposed to the Staphylococcus epidermidis (a close, gram-positive relative of S. aureus) and Escherichia coli colonies (without rinsing of the slides to ensure that no particles were lost), the images were far less fluorescent overall, largely consisting a mixture of bright clusters, likely SLN colloidal aggregates forming under solvent removal and dull fluorescent backdrop of residual SLNs / released fluorescein. The Staphylococcus epidermidis and Escherichia coli colonies that were visible under normal lighting were far less defined or invisible under fluorescent lighting. This indicates that the fluorescent nanoparticles are not interacting with cells not matched to the aptamer, which was expected as the SLNs are negatively charged, as are bacteria, and electrostatic forces alone are expected to repel them from the particle’s surface. This suggests only when the SA31 aptamer-functionalised nanoparticles are exposed to S. aureus can the electrostatic forces be overcome and the particles bind to the bacterial cells through high affinity interactions with the SA31 aptamer. The data is consistent with the SA31 aptamer-functionalised nanoparticles having an affinity for Staphylococcus aureus, compared with other bacteria. This is consistent with work previously undertaken by Cao et al., 2009, Nucleic Acids Research, 37, 4621- 4628, which found them to have a high affinity for Staphylococcus aureus specifically. SA31 aptamer-functionalised nanoparticles were also analysed under visual and fluorescent light without the presence of bacterial cells (Figure 7). In this case, coagulated1005937956particles were visible (like Figure 2), and there was a dark / green background where the particles had concentrated upon the removal of water. Example 3: Antibacterial tests The MIC of the SLNs was determined by the broth dilution method. The MIC of the SLNs loaded was 0.125 mg / L against S. aureus. This was half the MIC of rifampicin alone, 0.250 mg / L. Staphylococcus aureus’ MIC varies significantly depending on the strain with values below 0.01 to above 0.2 reported. However, as shown in Table 3, upon the addition of the SA31 aptamer, the MIC dropped to 0.04 mg / L a value on the lower end of the rifampicin effectiveness range. Nanoencapsulation of antimicrobials in lipid-based particles has been demonstrated to be capable of improving the effects of the loaded drugs over pure compounds due to the delayed release of drug from the particle matrix, which improves efficacy due to the time-dependent effect of many antibiotics, and polysorbates have been shown to improve the antimicrobial effect of many lipophilic compounds against numerous bacterial species. Neither the unloaded SLNs or aptamer alone prevented cellular growth at the concentrations tested. While incorporation of drugs can often improve antibacterial effect, in other cases nanocarriers have lower MICs than the pure compound. It appears aptamer functionalisation can drastically improve the effectiveness of pure SLNs, and overcome problems associated with incorporation of the drug. Table 3: Minimum inhibitory concentrations and assayed target in brackets Analyte MIC (mg / L) SLN-RF (S. aureus) 0.125 SA31+SLN-RF (S. aureus) 0.04 Rifampicin (S. aureus) 0.250 SLN (S. aureus) >100 SA31 aptamer (S. aureus) >1001005937956SLN-RF (S. epidermidis) 0.125 SA31+SLN-RF (S. epidermidis) 0.063 SLN-RF (E. coli) 25 SA31+SLN-RF (E. coli) 25 When an appropriate aptamer is added to the SLN formulation, the MIC is drastically reduced, dropping by a factor of three compared to the rifampicin-loaded nanoparticles. Negatively charged nanoparticles tend to be excluded from bacteria due to electrostatic forces but it appears the aptamer can overcome that repulsion and concentrate around the bacteria, increasing exposure to the drug and improving its efficacy. The combined effect of the SLNs release kinetics / polysorbate layer and aptamer- driven bacterial targeting improved the antibacterial effect of rifampicin by several orders of magnitude compared with the unencapsulated drug. The aptamer was also determined to improve the MIC against S. epidermidis but to a lesser extent. This could be due to interactions between the aptamer and cell suggesting less specificity for the S. aureus than previous studies suggested by Cao et al., 2009, Nucleic Acids Research, 37, 4621- 4628. However, the fluorescent aptamer-SLN probes did not interact more strongly with S. epidermidis. Additionally, the MIC of E. coli demonstrated no difference between aptamer functionalised and non-functionalised particles. This may indicate the possibility that the decrease in MIC could be due to effects between the polyethylene glycol and bacterial cells rather than non-specific aptamer targeting Conclusion New aptamer functionalised PEG stearate molecules were developed and incorporated into SLNs which had an affinity and specificity for Staphylococcus aureus and S. epidermidis. By combining the aptamerised PEG stearate with stearic acid NPs, it was demonstrated that the SLNs could be functionalised as biosensors for Staphylococcus aureus and S. epidermidis, by loading the NPs with a fluorescent compound such as fluorescein. It was further demonstrated that when incorporated with1005937956an antibiotic such as rifampicin, the aptamer PEG stearate conjugate could substantially improve the antimicrobial effect against the target bacteria Staphylococcus aureus or S. epidermidis. Example 4: Prepared Formulations The following particle formulations have been designed and analysed (see Table 4). Each SLN formulation was produced using the microwave assisted method developed by Shah et al.2014, Journal of Colloid and Interface Science, 428, 286-294. Stearic acid, tween 20, and water, along with incorporated compound were added to a microwave synthesis tube using the quantities outlined in Table 4. The microwave tube was then placed in the reactor and heated to 80°C, then held at that temperature for 10 minutes. The microemulsion was then removed from the tube and dispersed in water, chilled to < 5.0°C, and kept under magnetic stirring for 60 minutes. Table 4: Solid lipid nanoparticle formulations Formulation SA T20 H2O Rif Flu Chl Cip Aptamer RF5 100 mg 150 µL 1.35 mL 5 mg x x x No RF10 100 mg 150 µL 1.35 mL 10 mg x x x No RF10-AP 100 mg 150 µL 1.35 mL 10 mg x x x Yes (SA31) CIP2.5 100 mg 150 µL 1.35 mL 100 mg x x 2.5 mg No CIP5.0 100 mg 150 µL 1.35 mL 100 mg x x 5 mg No CIP10 100 mg 150 µL 1.35 mL 100 mg x x 10 mg No CIP10-AP 100 mg 150 µL 1.35 mL 100 mg x x 10 mg Yes (Aci49) ChL5-AP 100 mg 150 µL 1.35 mL 100 mg x 5 mg x Yes (AD1) FL0 100 mg 150 µL 1.35 mL x 5 mg x x No FL-SA31 100 mg 150 µL 1.35 mL x 5 mg x x Yes (SA31)1005937956FL-AD1 100 mg 150 µL 1.35 mL x 5 mg x x Yes (AD1) FL-Aci49 100 mg 150 µL 1.35 mL x 5 mg x x Yes (Aci49) Rif - rifampicin, Flu - fluorescein isothiocyanate, Cip – ciprofloxacin, Chl – clotrimazole, SA -stearic acid, T20 – Tween 20 To functionalise the particles with the targeting aptamers, they were dispersed in solution containing aptamer moles equivalent to 20% the tween 20 used in the particles. The aptamers tested were SA31 (specific to Staphylococcus aureus (Cao et al., 2009, Nucleic Acids Research, 37, 4621-4628), AD1 (specific to Candida albicans (Hou et al., 2021, NanoImpact, 21, 100275), and Aci49 (specific to Acinetobacter baumannii (Rasoulinejad and Gargari, 2016, J Biotechnol, 231, 46-54). Example 5: Drug loaded nanoparticles – summary of physical characteristics Table 5 lists the particle size, zeta potential & polydispersity of antibiotic / dye loaded nanoparticle formulations of Table 4 used in this experiment along with their encapsulation efficiency (percent of drug loaded into the particle) and loading capacity (percent of drug of total lipid mass). Rifampicin is a widely used antibiotic. Ciprofloxacin was selected as it is a common antibiotic, often used for urinary tract infections, but with utility as an antimicrobial agent against most gram-negative strains of bacteria. Unlike rifampicin, ciprofloxacin tends not to be a last resort antibiotic. It is highly insoluble in water, having a positive octanol-water partition coefficient of ~1.5-2.5, and an increasing number of bacterial strains are developing resistance. Table 5: Characteristics of loaded SLNs Formulation Zeta (mV) Diameter (nm) Polydispersity EE% LC% RF10 -15.8 ± 1.1 382 ± 4 0.129 ± 0.027 61 ± 5% 6.1 ± 0.5% FL0 -12.3 ± 1.8 280 ± 1 0.061 ± 0.01 78% ± 3% 3.9% ± 0.4% CIP10 -22.9 ± 1.4 394 ± 16 0.106 ± 0.029 49 ± 7% 5.0 ± 0.77% CIP2.5 -18.5 ± 0.3 312 ± 7 0.098 ± 0.030 Neg Neg1005937956CP5.0 -22.4 ± 0.1 384 ± 8 0.104 ± 0.008 34 % ± 1% 1.72% ± 0.5% RIF5 - 266.3 ± 43 0.285 ± 0.07 33% ± 5% 1.6% ± 0.09 EE% encapsulation efficiency, LC% loading capacity, neg, negligible loading, green background represents selected formulations. STD DEV (±). The particles become more effective at encapsulating ciprofloxacin as the concentration is increased (see Table 5). Formulations that contained 2.5% ciprofloxacin (as a percentage of lipid weight) saw negligible drug loading, while those loaded with 5% ciprofloxacin saw an encapsulation efficiency of ~35%, and those loaded with 10% ciprofloxacin had an encapsulation efficiency of ~50%. Without being bound by theory, this is likely due to higher percentages of drug partitioning into the water phase during the microemulsion process at lower concentrations, where ciprofloxacin is more soluble. Particle size increases with the percentage of drug encapsulated – like rifampicin loaded SLNs, but the particles remain largely monodisperse. Example 6: Aptamer functionalised nanoparticles – summary of physical characteristics It was important to determine how addition of the aptamer effected the nanoparticles physical characteristics. Table 6 lists the particle size, zeta potential & polydispersity of antibiotic loaded nanoparticles. The formulations follow the formulation outlined above – 100 mg of stearic acid, 150 µL of Tween 20 and 1.35 mL of water but are diluted in a solution of PEG stearate – aptamer conjugate (which accounts for 20% of the surfactant overall). Table 6: Characteristics of aptamer functionalised SLNs Formulation Zeta (mV) Diameter (nm) Polydispersity RF10-AP -10.8 ± 2.8 546 ± 117 0.68 ± 0.14 FL-SA13 -21.8 ± 1.8 281 ± 20 0.21 ± 0.07 FL-Aci49 -6.0 ± 1.9 588 ± 107 0.63 ± 0.051005937956CIP10-AP -20.0 ± 1.9 512 ± 15 0.46 ± 0.02 CHL5-AP -12.0 ± 0.7 458 ± 98 0.85 ± 0.08 STD DEV (±). Aptamer functionalisation appeared to increase the particle sizes of the nanoparticles by a range of approximately 100 to 200 except for FL-SA31. Without being bound by theory, this could be since aptamers are large particles, and increase the particle diameter. It could also be that the aptamers cause a degree of flocculation in solution (which could explain the higher polydispersity). Alternatively, it is possible that micellular structures are forming alongside the nanoparticles, consisting of the PEG 100 stearate – aptamer conjugate. Example 7: Creation and characterisation of the aptamer functionalised PEG 100 stearate The aptamer-functionalised PEG-100 stearate was prepared via a new two-step process – the oxidation of PEG 100 stearate to add a carboxyl group to the polymer end and then the attachment of the aptamer through carbodiimide coupling – where an aptamer with an amino tag is attached to the carboxyl group. First the PEG 100 stearate was oxidised using potassium permanganate in basic conditions, replacing the hydroxyl group with a carboxylic acid group. The chemical change was then confirmed using FTIR. By comparing the IR spectra of unmodified PEG 100 stearate and carbonylated PEG 100 stearate it could be observed that the unoxidized PEG stearate displayed a minor peak at ~1730 cm-1due to the carbonyl group connecting the PEG and stearate tail (Ching et al., 2019). The oxidised PEG stearate exhibited a larger peak at the same point due to the presence of a free carboxylic acid group. The bump present at ~3400 cm-1in the carboxylated spectra was likely due to the difficulty in removing excess water. Example 8: Fluorescence microscopy of FL-Aci49 and FL-AD1 functionalised SLNs1005937956The fluorescence microscopy tests of Example 2 were repeated with other fluorescent nanoparticles functionalised with the aptamers specific to A. baumanni, formulation FL-Aci49, and C. albicans, FL-AD1 (see Table 4). These samples were tested on a Invitrogen EVOS M5000 imaging system, a microscope with higher resolution. When the FL-Aci49 functionalised nanoparticles (FL-Aci49) were exposed to A. baumannii (Figure 8, top row = visual microscopy, bottom row = fluorescence microscopy), the cells / clusters became clear, and with the higher resolution, rings where the particles were concentrating around the particles were clearly visualised (Figure 8- images on right). By contrast when the particles with no aptamer were added (FL0) – no rings were visible around the cell colonies, though bright clusters (coagulated particles / cells) and a dull fluorescing background where the particles / free fluorescein has precipitated upon evaporation of liquid, was clearly visible in the case of particles with no aptamer added (Figure 8- images on left). This phenomenon could also be observed in the case of C. albicans (see Figure 9, top row = visual microscopy, bottom row = fluorescence microscopy). Where the fluorescent SLNs had the fungi specific aptamer AD1 (FL-AD1), fluorescent rings could once again be observed around the cell clusters (Figure 9, bottom right). When the control particles, FL0, were added to C. albicans cells – no rings were observed, only fluorescing clusters were visible (Figure 9, bottom left). Like exposure to A. baumannii, when the cells were exposed to particles, containing the cell specific aptamers, the outside of the cells glowed (indicative of the particles adhering to the cells surface). When particles were added alone, fluorescent clumps and a dull background were be observed, with no cells / cluster with defined outlines. To test the specificity of the aptamers to the cells, SLNs functionalised with the A. baumannii aptamer Aci49, and C. albicans aptamer AD1, respectively were exposed to S. aureus cells. Figure 10 show the results (top row = visual microscopy, bottom row = fluorescence microscopy, left side = FL-Aci49, right side = FL-AD1). As can be observed, no cells / clusters with defined fluorescent outlines were observed (although the different aptamers did result in different profiles, suggesting that non-specific effects driven by the physicochemical nature of the aptamers could also be taking place).

Claims

1005937956CLAIMS 1. A solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is not loaded with a therapeutic or diagnostic compound.

2. A solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer, and wherein the nanoparticle is loaded with a fluorescent compound.

3. A solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with an antibiotic compound.

4. A solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with a fluorescent compound and an antibiotic compound.

5. The solid lipid nanoparticle of any one of the preceding claims, wherein the aptamer is selected from the group consisting of Aci49, T9, Ce24, CE15, CSIR 2.11, MPT64-A1, G43, G78, MA1, Aptamer 1, Aptamer 33, Aptamer 45, I-2, C4, ST2P, SAL 26, Apt22, S25, Crn-1, Crn-2, APTSEB1, C10, R12.06, Antibac1, Antibac2, PA#2 / 8,1005937956SA20, SA23, SA31, SA34, SA43, SA17, SA61, A8, LLo-3, Lbi-17, LMCA2, LMCA26, E- 5, E-11, E-12, E-16, E-17, E-18, E-19, AM-6, Apt B12, E1, E2, E10, E12, Ec3(31), 8.28A, NK2, ZXL1, BM2, Mtb-Apt1, Mtb-Apt6, S-PS8.4, S3, At-33 and AT-36.

6. The solid lipid nanoparticle of any one of the preceding claims, wherein the aptamer is SA31 or Aci49.

7. A solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a fungal species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer, and wherein the nanoparticle is loaded with a fluorescent compound.

8. A solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with an antifungal compound.

9. A solid lipid nanoparticle comprising a fatty acid esterified with polyethylene glycol, wherein the polyethylene glycol is functionalised with an aptamer, and wherein the nanoparticle is loaded with a fluorescent compound and an antifungal compound.

10. The solid lipid nanoparticle of any one of claims 1 to 4 or 7 to 9, wherein the aptamer comprises a DNA sequence.

11. The solid lipid nanoparticle of any one of claims 7 to 9, wherein the aptamer is AD1.100593795612. The solid lipid nanoparticle of any one of the preceding claims, wherein the aptamer is conjugated to the polyethylene glycol through an amide functionality.

13. The solid lipid nanoparticle of any one of the preceding claims, wherein the polyethylene glycol comprises about 300 to about 20000 kDa of ethylene oxide units.

14. The solid lipid nanoparticle of any one of the preceding claims, wherein the polyethylene glycol comprises about 99 ethylene oxide units.

15. The solid lipid nanoparticle of any one of the preceding claims, wherein the fatty acid is C8-C35.

16. The solid lipid nanoparticle of any one of the preceding claims, wherein the fatty acid is saturated.

17. The solid lipid nanoparticle of any one of the preceding claims, wherein the fatty acid is stearic acid.

18. The solid lipid nanoparticle of any one of the preceding claims, wherein the nanoparticle comprises a non-ionic surfactant.

19. The solid lipid nanoparticle of any one of the preceding claims, wherein the nanoparticle comprises a non-esterified fatty acid.

20. A pharmaceutical composition comprising the solid lipid nanoparticle of any one of claims 2 to 19 and at least one pharmaceutically acceptable excipient, wherein one or more of a fluorescent, antifungal or antibiotic compound is present in the solid lipid nanoparticle.

21. A method for producing a solid lipid nanoparticle according to any one of claims 1 to 19, the method comprising: functionalising a molecule comprising polyethylene glycol with an aptamer.

22. The method of claim 21, wherein the molecule comprising polyethylene glycol is oxidised prior to functionalisation.100593795623. The method of claim 21 or 22, wherein the method further comprises contacting the molecule comprising polyethylene glycol with another surfactant.

24. A method of delivering an active agent to a cell or tissue, the method comprising contacting the solid lipid nanoparticle of any one of claims 2-19, or the pharmaceutical composition of claim 20, with the cell or tissue, wherein one or more of a fluorescent, antifungal or antibiotic compound is present in the solid lipid nanoparticle, thereby introducing the active agent into the cell or tissue.

25. A method of treating or preventing a bacterial and / or fungal disease, disorder or condition, the method comprising administering to a subject in need thereof a solid lipid nanoparticle of any one of claims 2 to 19, or the pharmaceutical composition of claim 20, wherein an antibiotic and / or antifungal compound is present in the solid lipid nanoparticle.

26. A method of diagnosing a bacterial and / or fungal disease, disorder or condition, the method comprising: administering to a subject in need thereof a solid lipid nanoparticle of any one of claims 2 to 19, or the pharmaceutical composition of claim 20, wherein the solid lipid nanoparticle comprising the aptamer displays increased affinity for a bacterial and / or fungal species by at least about 300% relative an equivalent solid lipid nanoparticle that does not comprise the aptamer; and wherein a fluorescent compound is present in the solid lipid nanoparticle.

27. The method of claim 25 or 26, wherein the disease, disorder or condition is selected from the group consisting of: sepsis, infection of an implant (such as a stent), food poisoning, a bacterial skin infection (such as impetigo, cellulitis, boils), a bacterial ear infection, a bacterial sinus infection, a bacterial throat infection (such as Strep throat), a bacterial lung disease (such as pneumonia, tuberculosis), a bacterial urinary1005937956tract infection, meningitis, a wound infection, a sexually transmitted bacterial infection (such as chlamydia, gonorrhoea), Lyme disease, bacterial vaginosis and diarrhoea, superficial mycoses, cutaneous mycoses, subcutaneous mycoses, and systemic mycoses.

Images