Modified natural killer cell line

Abstract

As a natural killer cell line having improved proliferation capability and improved cytotoxic activity, a natural killer cell line in which the expression of CUL5 gene is reduced is provided.

Description

Engineered natural killer cell lines

[0001] The present invention relates to a natural killer cell (NK cell) line in which expression of the CUL5 gene is reduced.

[0002] Cullin-5 protein (encoded by the CUL5 gene) is a protein that provides a reaction site for component molecules when forming a complex essential for the ubiquitination of various proteins (Okumura et al. Cell Div (2016) 11:1). Among the components of this complex, the SOCS (suppressor of cytokine signaling) family is an extremely important binding protein that regulates immune cell proliferation, migration, cytotoxicity, etc.

[0003] It is known that knockdown of the CUL5 gene prevents the ubiquitination of proteins recognized by related substrates, preventing their degradation in the proteasome system. Many of these substrates are known to affect T cell activity.

[0004] Recently, the present inventors discovered that reducing the expression of the CUL5 gene increases the proliferation ability of T cells expressing chimeric antigen receptors (CAR-T cells), and filed patent applications based on this finding (Patent Document 1, Patent Document 2).

[0005] Patent Documents 1 and 2 describe NK cells as cells in which CUL5 gene expression is reduced, but do not describe established NK cell lines. Furthermore, the experiments in Patent Documents 1 and 2 exclusively use T cells, and do not describe what changes occur when CUL5 gene expression in NK cells is reduced.

[0006] International Publication No. 2023 / 22868 Patent Publication No. 2023-174589

[0007] NK cells play an important role in eliminating viruses and tumors. Improving the proliferation and cytotoxic activity of NK cells could lead to the development of new therapeutic methods for viral diseases and tumors. The present invention was made against this background, and aims to provide a means for improving the proliferation and cytotoxic activity of NK cells.

[0008] As a result of extensive research to achieve the above object, the present inventors have found that knockdown of the CUL5 gene in KHYG-1, an NK cell line, activates the JAK-STAT signaling pathway involved in immune responses and improves cytotoxic activity, and have completed the present invention based on these findings. That is, the present invention provides the following (1) to (9).

[0009] (1) A natural killer cell line characterized by reduced expression of the CUL5 gene.

[0010] (2) The natural killer cell line according to (1), characterized in that the natural killer cell line is KHYG-1 cells, NK-92 cells, YT cells, NKL cells, SNT-8 cells, HANK-1 cells, or NK-YS cells.

[0011] (3) The natural killer cell line according to (1), characterized in that the natural killer cell line is a KHYG-1 cell.

[0012] (4) The natural killer cell line according to (1), characterized in that it expresses a chimeric antigen receptor.

[0013] (5) The natural killer cell line according to (4), wherein the chimeric antigen receptor is a chimeric antigen receptor that recognizes CD5.

[0014] (6) The natural killer cell line according to (3), characterized in that it expresses a chimeric antigen receptor.

[0015] (7) The natural killer cell line according to (6), wherein the chimeric antigen receptor is a chimeric antigen receptor that recognizes CD5.

[0016] (8) KHYG-1 cells, characterized by expressing a chimeric antigen receptor.

[0017] (9) The KHYG-1 cell according to (8), wherein the chimeric antigen receptor is a chimeric antigen receptor that recognizes CD5.

[0018] This specification includes part or all of the contents as disclosed in the specification and / or drawings of Japanese Patent Application No. 2024-079458, which is a priority document of the present application.

[0019] The present invention provides a novel NK cell line that has improved cytotoxic activity and is thought to have improved proliferation capacity as well as improved cytotoxic activity due to activation of the JAK-STAT signaling pathway, which is involved in immune responses.

[0020] Schematic diagram showing the structure of a vector containing a CUL5 shRNA expression cassette and a CD19 chimeric antigen receptor (CAR) expression cassette. Photograph showing the expression level of JAK in KHYG-1 cells cultured in the presence of IL-2. Photograph showing the expression level of JAK in KHYG-1 cells cultured in the presence of IL-2 and cycloheximide (CHX). Diagram showing the cytotoxic activity of shCUL5 / shNegative KHYG-1 cells against K562 cells. Diagram showing the cytotoxic activity of shCUL5 / shNegative CD5 CAR KHYG-1 cells against Jurkat cells.

[0021] The present invention is described in detail below. The NK cell line of the present invention is characterized by reduced expression of the CUL5 gene. By reducing expression of the CUL5 gene, the JAK / STAT signaling pathway induced by IL-2 can be activated. In NK cells, JAK / STAT signaling is known to contribute to the control of differentiation, proliferation, invasion, survival, and cytotoxic activity (e.g., Dagmar Gotthardt et al., Front. Immunol. 2019 Nov 12:10:2590). Therefore, activation of the JAK / STAT signaling pathway is expected to improve the proliferation, cytotoxic activity, and persistence of NK cell lines.

[0022] In the present invention, the term "NK cell line" refers to an established NK cell line, i.e., cultured cells that have been immortalized and can proliferate semipermanently while maintaining certain properties. Furthermore, "reduced expression of the CUL5 gene" refers to the expression level of Cullin-5 protein being lower than that of control cells (cells treated under the same conditions except that they have not been treated to reduce CUL5 gene expression), specifically, the expression level of Cullin-5 protein being, for example, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less of the expression level of Cullin-5 protein in the control cells.

[0023] Specific examples of NK cell lines include KHYG-1 cells, NK-92 cells, YT cells, NKL cells, SNT-8 cells, HANK-1 cells, NK-YS cells, etc. Among these, KHYG-1 cells are preferred.

[0024] KHYG-1 cells are a cell line derived from a patient with aggressive NK leukemia with a p53 point mutation and are available from the JCRB Cell Bank (cell number: JCRB0156). NK-92 cells are an IL-2-dependent NK cell line derived from peripheral blood mononuclear cells of a patient with non-Hodgkin's lymphoma and are available from the American Type Culture Collection (ATCC). YT cells are established from a patient with acute lymphoblastic leukemia and are available from the DSMZ-German Collection of Microorganisms and Cell Cultures. NKL cells are established from the peripheral blood of a patient with large granular lymphocyte leukemia. SNT-8 is an Epstein-Barr virus-positive NKT cell line derived from a patient with nasal lymphoma. HANK-1 cells are established from a patient with retroperitoneal CD56+ NK / T cell lymphoma and are available from the RIKEN BRC Cell Bank. NK-YS cells are established from a patient with primary aggressive nasal lymphoma.

[0025] The CUL5 gene expresses Cullin-5 mRNA / protein. Cullin-5 protein is a core component of multiple SCF-like ECS (Elongin-Cullin 2 / 5-SOCS-box protein) E3 ubiquitin-protein ligase complexes and mediates the ubiquitination of target proteins and their subsequent proteasomal degradation. The amino acid sequences of Cullin-5 proteins and the nucleotide sequences of Cullin-5 mRNA from various species are known. Specifically, for example, human Cullin-5 protein includes the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 (NCBI Reference Sequence: NP_003469.2), and human Cullin-5 mRNA includes the mRNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 (NCBI Reference Sequence: NM_003478.6).

[0026] The method for reducing the expression of the CUL5 gene is not particularly limited, and for example, a polynucleotide containing an expression cassette of a CUL5 gene expression-inhibiting polynucleotide may be introduced into an NK cell line, or the CUL5 gene may be modified so that its expression is reduced.

[0027] The CUL5 gene expression-inhibiting polynucleotide is not particularly limited as long as it is a polynucleotide that can inhibit the expression level of Cullin-5 protein, Cullin-5 mRNA, etc. Examples include CUL5-specific small interfering RNA (siRNA), CUL5-specific microRNA (miRNA), CUL5-specific antisense polynucleotide, etc. siRNA may be shRNA (small hairpin RNA).

[0028] The expression cassette for the CUL5 gene expression-inhibiting polynucleotide contains a promoter and a CUL5 gene expression-inhibiting polynucleotide coding sequence under the control of the promoter. The coding sequence is typically placed downstream of the promoter so that it is under the control of the promoter. Usable promoters include RNA polymerase II (PoII) promoters such as the CMV promoter, EF1 promoter, SV40 promoter, MSCV promoter, hTERT promoter, β-actin promoter, and CAG promoter; and RNA polymerase III (PoIII) promoters such as mouse and human U6-snRNA promoters, human H1-RNase P RNA promoter, and human valine-tRNA promoter. Among these, PolIII promoters are preferred due to their ability to accurately transcribe short RNAs. A poly(A) addition signal sequence is placed downstream of the coding sequence. Transcription is terminated using the poly(A) addition signal sequence. Examples of poly(A) addition signal sequences that can be used include the SV40 poly(A) addition sequence and the poly(A) addition sequence of the bovine growth hormone gene.

[0029] The method for introducing a polynucleotide containing an expression cassette for a CUL5 gene expression-inhibiting polynucleotide into an NK cell line is not particularly limited, but is preferably a method involving the introduction of a virus containing the polynucleotide, as this method causes less damage to the cells. This allows for introduction without using methods that may cause damage to the cells, such as electroporation or lipofection.

[0030] Modifications that reduce CUL5 gene expression include, for example, gene deletion (gene disruption), mutations in protein coding regions, mutations in splicing regulatory regions, mutations in expression control regions (e.g., promoters, activators, enhancers, etc.), etc. Such modifications can be performed using a gene editing system such as the CRSPR / Cas system.

[0031] The NK cell line of the present invention may express a chimeric antigen receptor. The chimeric antigen receptor is not particularly limited, as long as it can bind to a target antigen and, upon binding to the target antigen, can transmit a signal necessary for immune cell activation into the cell. A chimeric antigen receptor typically comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain.

[0032] The antigen-binding domain is not particularly limited as long as it is a domain that is located extracellularly when the chimeric antigen receptor is located on the cell membrane and is capable of recognizing and binding to an antigen. Specific examples of antigens include CD5, CD7, CD19, GD2, GD3, CD20, CD22, CD30, CD33, CD37, CD70, CD123, CD133, CD147, CD171, CLDN6, CLDN18.2, IL7Ra, IL13Ra2, GPC2, GPC3, Nectin4, ICAM-1, PD1, PD-L1, ROBO1, ROR1, TnMUC1, TROP2, NKG2DL, SLAMF7, B7-H3, EpCAM, FAP, CEA, HER2, EGFR, type III mutant EGFR, CD38, BCMA, MUC-1, PSMA, WT1, cancer testis antigens (e.g., NY-ESO-1, MAGE-A4, etc.), mutation Examples include peptides (for example, k-ras, h-ras, p53, etc.), hTERT, PRAM, TYRP1, mesothelin, PMEL, mucins, etc., as well as complexes of fragments of these with MHC (pMHC).

[0033] The transmembrane domain is a domain that is located within the cell membrane when the chimeric antigen receptor is located on the cell membrane, and is not particularly limited as long as it is capable of constituting a chimeric antigen receptor. Examples of the transmembrane domain that can be used include transmembrane regions of CD28, CD3ε, CD8α, CD3, CD4, and 4-1BB.

[0034] The intracellular signal domain is a domain that is located intracellularly when the chimeric antigen receptor is located on the cell membrane, and is capable of transmitting a signal required for immune cell effector function, i.e., a domain capable of transmitting a signal required for immune cell activation when the antigen-binding domain binds to an antigen. The intracellular signal domain preferably includes an intracellular activation domain. Examples of the intracellular activation domain that can be used include intracellular domains such as CD3ζ and FcεRIγ.

[0035] In an NK cell line expressing a chimeric antigen receptor, a suitable antigen recognized by the chimeric antigen receptor can be CD5, and a suitable NK cell line can be KHYG-1 cells, which express a chimeric antigen receptor that recognizes CD5.

[0036] The method for expressing the chimeric antigen receptor is not particularly limited, and for example, a polynucleotide containing an expression cassette for the chimeric antigen receptor may be introduced into an NK cell line. The expression cassette for the chimeric antigen receptor may be contained in the same polynucleotide as the expression cassette for the CUL5 gene expression-inhibiting polynucleotide described above.

[0037] The chimeric antigen receptor expression cassette contains a promoter and a chimeric antigen receptor coding sequence under the control of the promoter. The coding sequence is typically placed downstream of the promoter so that it is under the promoter's control. Usable promoters include RNA polymerase II (poII) promoters such as the CMV promoter, EF1 promoter, SV40 promoter, MSCV promoter, hTERT promoter, β-actin promoter, and CAG promoter. A poly(A) addition signal sequence is placed downstream of the coding sequence. Transcription is terminated using the poly(A) addition signal sequence. Examples of poly(A) addition signal sequences that can be used include the SV40 poly(A) addition sequence and the bovine growth hormone gene poly(A) addition sequence.

[0038] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0039] Example 1 (1) Materials and Methods Cells KHYG-1 cells were used, maintained in the laboratory of the present inventor. The authenticity of the cell line was confirmed by immunophenotyping using flow cytometry. Cells were cultured for up to 2 months before use. KHYG-1 cells were cultured in PRMI-1620 medium supplemented with 10% FBS, 0.8 mM L-glutamine, and 1% penicillin / streptomycin.

[0040] Construction of a two-in-one vector: A CUL5-targeting shRNA was duplexed and inserted between the restriction enzyme sites of the pGreenPuro shRNA vector (catalog no. SI506A-1; SBI). The EF1-copGFP-T2A-puro sequence was then replaced with the EF-1α-CD19CAR-T2A-tEGFR sequence. The DNA sequence inserted into the vector was verified by direct sequencing. The shRNA sequence targeting the CUL5 gene was GCAAGCTGACCCTGAAGTTCAT (SEQ ID NO: 3). A schematic diagram of the constructed vector is shown in Figure 1. In this vector, the shRNA expression cassette was located downstream of the H1 promoter, and the CAR expression cassette was located downstream of the EF-1α promoter.

[0041] Generation of CUL5 KD-CD19 CAR-KHYG-1 cells. shCUL5 RNA, CD19CAR gene, and a plasmid vector expressing a truncated EGFR were packaged into lentivirus and transduced into KHYG-1 cells using the lentiviral vector. Since the transfected cells were EGFR-positive, the EGFR-positive fraction was isolated and purified.

[0042] Immunoblotting. Harvested cells were lysed in 1x lysis solution (catalog no. 895561; R&D Systems) containing 1x protease inhibitor cocktail (catalog no. P8340; Sigma-Aldrich). Cell lysates were purified by centrifugation at 11,700 x g for 15 min on ice. Protein concentrations were determined using the Quick Start Kit. TM Proteins were measured using Bradford 1x Dye Reagent (catalog no. 5000205JA; Bio-Rad). 20 μg of total protein was added to sample buffer containing 5% 2-mercaptoethanol and denatured at 95°C for 5 minutes. Samples were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene difluoride membrane (catalog no. IPVH00010; Millipore). The membrane was blocked with 5% (w / v) nonfat dry milk and Tween in Tris buffer (Tris-HCl [50 mM, pH 7.4], NaCl [150 mM], and 0.05% Tween 20) and incubated with primary antibodies overnight at 4°C. The membrane was then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (CST) at room temperature for 2 hours. Signals were measured using ECL. TMThe cells were observed using the Prime Western Blotting System (Cytiva, RPN2232), visualized with an LAS-4000 mini-image analyzer (FUJIFILM, Tokyo, Japan), and analyzed with MultiGauge software (FUJIFILM). The primary antibodies used were rabbit anti-CUL5 (1:1000; catalog no. ab184177; Abcam), mouse anti-β-actin (1:2000; catalog no. sc-47778; Santa Cruz), anti-JAK1 (1:1000; catalog no. 3344; CST), anti-JAK2 (1:1000; catalog no. 3230; CST), anti-JAK3 (1:1000; catalog no. 8827; CST), anti-TYK2 (1:1000; catalog no. 14193; CST), anti-p-JAK1 (1:1000; catalog no. 74129; CST), anti p-JAK2 (1:1000; catalog no. 8082; CST), anti-p-JAK3 (1:1000; catalog no. 5031; CST), anti-p-TYK2 (1:1000; catalog no. 68790; CST), anti-STAT3 (1:1000; catalog no. 4904; CST), and anti-STAT5 (1:1000; catalog no. 94205; CST).

[0043] (2) Results and Discussion: Wild-type KHYG-1 cells and CUL5 KD KHYG-1 cells were cultured overnight under IL-2 deprivation and then stimulated with 200 IU / mL of IL-2. The expression of JAK1, phosphorylated JAK1 (p-JAK1), JAK3, and phosphorylated JAK3 (p-JAK3) in both cell lines was analyzed by immunoblotting (Fig. 2). Furthermore, 40 μg / mL of cycloheximide (CHX) was added in addition to IL-2 for the indicated times, and immunoblotting analysis was performed in the same manner (Fig. 3).

[0044] Knockdown of CUL5 increased the expression of JAK1, p-JAK1, and p-JAK3. Furthermore, JAK3 expression was increased only by IL-2 stimulation. Notably, simultaneous administration of IL-2 and cycloheximide, which inhibits the translocation step in protein synthesis, delayed the disappearance of JAKs (Fig. 3). These results suggest that CUL5 functions in the degradation of JAKs and that it degrades JAK3 in an IL-2 signal-dependent manner.

[0045] These results suggest that suppression of CUL5 expression inhibits JAK3 degradation and enhances the JAK / STAT pathway, and further suggest that suppression of CUL5 expression improves the proliferation and persistence of KHYG-1 cells via the JAK / STAT pathway.

[0046] Example 2: Cytotoxicity of shCUL5 KHYG-1 / shNegative KHYG-1 Cells Against K562 Cells. shCUL5 KHYG-1 / shNegative KHYG-1 cells were used as effector cells and DsRed-expressing K562 cells as target cells at an E / T ratio of 10:1. The mixture was incubated at 37°C under 5% CO2 for 2 hours and then stained with Annexin V at room temperature for 15 minutes. Apoptotic target cells were identified as DsRed- and Annexin V-positive cells using flow cytometry. The Annexin V-positive rate of K562 cells was measured as the cytotoxic activity of KHYG-1 cells and compared between the presence and absence of shCUL5 (Figure 4). As shown in Figure 4, knockdown of CUL5 enhanced the cytotoxic activity of KHYG-1 cells.

[0047] Cytotoxicity of shCUL5 / shNegative CD5 CAR KHYG-1 cells against Jurkat cells. shCUL5 / shNegative CD5 CAR KHYG-1 cells and Jurkat cells stained with Calcein AM were mixed at an E / T ratio of 10:1 and incubated at 37°C under 5% CO2 for 2 hours, followed by Annexin V staining at room temperature for 15 minutes. Apoptotic target cells were identified as Calcein AM- and Annexin V-positive cells using flow cytometry. The Annexin V-positive rate of Jurkat cells was measured as the cytotoxic activity of CD5 CAR KHYG-1 cells in the presence or absence of shCUL5 (Figure 5). As shown in Figure 5, knockdown of CUL5 enhanced the cytotoxic activity of KHYG-1 cells, even in the presence of CAR.

[0048] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

[0049] The present invention can be used in industrial fields related to pharmaceuticals and the like.

Claims

1. A natural killer cell line characterized by reduced expression of the CUL5 gene.

2. The natural killer cell line described in claim 1, characterized in that the natural killer cell line is KHYG-1 cells, NK-92 cells, YT cells, NKL cells, SNT-8 cells, HANK-1 cells, or NK-YS cells.

3. The natural killer cell line according to claim 1, characterized in that the natural killer cell line is KHYG-1 cells.

4. The natural killer cell line according to claim 1, characterized in that it expresses a chimeric antigen receptor.

5. The natural killer cell line described in claim 4, characterized in that the chimeric antigen receptor is a chimeric antigen receptor that recognizes CD5.

6. The natural killer cell line according to claim 3, characterized in that it expresses a chimeric antigen receptor.

7. The natural killer cell line described in claim 6, characterized in that the chimeric antigen receptor is a chimeric antigen receptor that recognizes CD5.

8. KHYG-1 cells characterized by expressing a chimeric antigen receptor.

9. KHYG-1 cells according to claim 8, characterized in that the chimeric antigen receptor is a chimeric antigen receptor that recognizes CD5.

Images